REGULATION OF RAN PROTEIN TRANSLATION BY PKR AND eIF2A-P PATHWAYS

Abstract

To provide methods and compositions for modulating repeat non-ATG protein (RAN protein) translation.SOLUTION: In some aspects, the disclosure provides methods of inhibiting RAN protein translation by contacting a cell with an effective amount of an inhibitor of eIF2 phosphorylation or an inhibitor of protein kinase R (PKR). In some embodiments, methods described by the disclosure are useful for treating diseases associated with RAN protein translation, such as certain neurodegenerative diseases.SELECTED DRAWING: None

Description

[Technical field]

[0001] Related Applications This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Patent Application No. 62 / 486,424, filed April 17, 2017, and U.S. Provisional Patent Application No. 62 / 563,588, filed September 26, 2017, the entire contents of each of which are incorporated herein by reference. Federally funded research This invention was made with Government support under Grant Nos. NS098819, NS040389, and NS058901 awarded by the National Institutes of Health. The Government has certain rights in the invention. [Background technology]

[0002] background Since the initial discovery of repeat-associated non-ATG repeat-associated non-ATG (RAN) translation, an increasing number of disease-associated repeats have been found to undergo RAN translation. Although RAN proteotoxicity has been demonstrated in transfected cells and model systems, implicating the relevance of RAN translation to disease pathogenesis, our understanding of the mechanism of RAN translation has not progressed since the initial discovery of RAN translation. Summary of the Invention

[0003] overview Aspects of the present disclosure relate to methods and compositions for reducing or inhibiting repeat-associated non-ATG (RAN) protein translation in a cell (e.g., a cell of a subject). In some aspects, the present disclosure relates to the recognition that inhibiting eukaryotic initiation factor 2-alpha (eIF2α) phosphorylation (e.g., activity of eIF2α-P) and / or alternative eukaryotic initiation factor 2A (eIF2A) expression or activity inhibits RAN protein translation. In some aspects, the present disclosure relates to the recognition that inhibiting protein kinase R (PKR) expression or activity inhibits RAN protein translation.

[0004] Thus, in some aspects, the disclosure provides a method of inhibiting repeat non-ATG protein (RAN protein) translation, the method comprising contacting a cell expressing the repeat non-ATG protein (RAN protein) with an effective amount of a eukaryotic initiation factor 2 (eIF2) modulating agent. In some aspects, the disclosure provides a method of inhibiting repeat non-ATG protein (RAN protein) translation, the method comprising contacting a cell expressing the repeat non-ATG protein (RAN protein) with an effective amount of a protein kinase R (PKR) modulating agent.

[0005] In some aspects, the present disclosure relates to the recognition that inhibiting eIF2α and / or inhibiting the expression or activity of eIF2α, or inhibiting PKR (e.g., inhibiting the PKR pathway) reduces RAN protein translation and accumulation in a tissue (e.g., brain tissue) of a subject.Thus, in some aspects, the present disclosure provides a method for treating a disease associated with repeat non-ATG protein (RAN protein) translation, comprising administering an effective amount of a eukaryotic initiation factor 2 (eIF2) modulating agent or a PKR modulating agent (e.g., a PKR inhibitor) to a subject expressing repeat non-ATG protein (RAN protein).In some embodiments, the subject is a mammal, such as a human.

[0006] In some embodiments, the RAN protein is poly-alanine, poly-leucine, poly-serine, poly-cysteine, poly-glutamine, poly-Leu-Pro-Ala-Cys, poly-Gln-Ala-Gly-Arg, poly-Gly-Pro, poly-Gly-Arg, poly-Gly-Ala, or poly-Pro-Ala, poly-Pro-Arg, poly-Gly-Pro. In some embodiments, the RAN protein comprises at least 35 poly-amino acid repeats. In some embodiments, the RAN protein is associated with Huntington's disease (HD, HDL2), Fragile X syndrome (FRAXA), Spinal-bulbar muscular atrophy (SBMA), Dentatorubral-Pallidoluysian atrophy (DRPLA), Spinocerebellar ataxia 1 (SCA1), Spinocerebellar ataxia 2 (SCA2), Spinocerebellar ataxia 3 (SCA3), Spinocerebellar ataxia 6 (SCA6), Spinocerebellar ataxia 7 (SCA7), Spinocerebellar ataxia 8 (SCA8), Spinocerebellar ataxia The gene is encoded by a gene associated with spinocerebellar ataxia type 12 (SCA12) or spinocerebellar ataxia type 17 (SCA17), amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia type 36 (SCA36), spinocerebellar ataxia type 29 (SCA29), spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuchs endothelial corneal dystrophy (e.g., CTG181).

[0007] In some embodiments, the eIF2 modulating agent inhibits phosphorylation of eIF2α, inhibits expression or activity of eIF2A, or inhibits phosphorylation of eIF2α and expression or activity of eIF2A. In some embodiments, the eIF2 modulating agent inhibits protein kinase R (PKR) expression or activity. In some embodiments, the eIF2 modulating agent is a protein, nucleic acid, or a small molecule.

[0008] In some embodiments, the eIF2 modulating agent is an inhibitory nucleic acid.In some embodiments, the inhibitory nucleic acid is an interfering RNA selected from the group consisting of dsRNA, siRNA, shRNA, mi-RNA and artificial miRNA (ami-RNA).In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or a nucleic acid aptamer, optionally an RNA aptamer. In some embodiments, the eIF2 modulating agent is a protein. In some embodiments, the protein is a dominant negative variant of protein kinase R (PKR). In some embodiments, the dominant negative variant comprises a mutation at amino acid position 296, such as a K296R mutation.

[0009] In some embodiments, the eIF2 modulator or PKR inhibitor is a small molecule. In some embodiments, the small molecule is represented by formula (I): [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof, wherein: R 1 is hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; and R 2 is hydrogen, an optionally substituted alkyl, or a nitrogen protecting group.

[0010] In some embodiments, R 1 is hydrogen. In some embodiments, R 1 is unsubstituted C1-6 alkyl. In some embodiments, R 2 is unsubstituted C alkyl. In some embodiments, R 2 is unsubstituted n-butyl. In some embodiments, R 2 is unsubstituted methyl. In some embodiments, R 2 is a substituted C alkyl. In some embodiments, R 2 is the expression: [ka] It is expressed as:

[0011] In some embodiments, R 1 and R 2are both unsubstituted methyl. In some embodiments, the compound of formula (I) has the formula: [ka] (Metformin), [ka] (Buformin), [ka] (phenformin), or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof.

[0012] In some embodiments, the eiF2 modulating agent or the PKR modulating agent (e.g., a PKR inhibitor) is delivered to the cell by a vector. In some embodiments, the vector is a viral vector, optionally a recombinant adeno-associated virus (rAAV). In some embodiments, the rAAV comprises an AAV9 capsid protein or a variant thereof. In some embodiments, the cells are located in a subject. In some embodiments, the cells are located in the subject's brain, optionally in the white matter of the brain.

[0013] In some embodiments, the methods described by the present disclosure further comprise administering an additional therapeutic agent for a disease associated with repeat non-ATG protein (RAN protein) translation. In some embodiments, the additional therapeutic agent is an antibody, optionally an antibody that specifically binds to the RAN repeat expansion, or an antibody that specifically binds to a unique region of the RAN protein that is C-terminal to the repeat expansion, or an additional inhibitory nucleic acid.

[0014] In some embodiments, in the methods described by the present disclosure, an eIF2 modulating agent or a PKR modulating agent (e.g., a PKR inhibitor) is administered to a subject systemically, optionally by injection, such as an intravenous injection. In some embodiments, an eIF2 modulating agent or a PKR modulating agent (e.g., a PKR inhibitor) is administered to the CNS of a subject, optionally by injection, such as an intracerebroventricular (ICV) injection.

[0015] In some aspects, the disclosure provides a recombinant adeno-associated virus (rAAV) comprising: (i) a capsid protein; and (ii) a nucleic acid comprising a transgene encoding an eIF2 modulating agent operably linked to a promoter. In some embodiments, the capsid protein is AAV9 capsid protein or a variant thereof. In some embodiments, the nucleic acid comprises at least one inverted terminal repeat (ITR), optionally an AAV2 ITR. In some embodiments, the rAAV is formulated for delivery by injection. In some aspects, the present disclosure provides a pharmaceutical composition comprising the rAAV as described by the present disclosure and a pharmaceutically acceptable excipient.

[0016] In some aspects, the disclosure provides a method for treating and / or preventing a neurological disease associated with a repeat expansion in a subject, the method comprising administering a therapeutically effective amount of a peptide of formula (I): [ka] where: 1 is hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; and R 2 includes administering to a subject a compound, or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof, wherein R is hydrogen, an optionally substituted alkyl, or a nitrogen protecting group.

[0017] In some embodiments, R 1is hydrogen. In some embodiments, R 1 is unsubstituted C1-6 alkyl. In some embodiments, R 2 is unsubstituted C alkyl. In some embodiments, R 2 is unsubstituted n-butyl. In some embodiments, R 2 is unsubstituted methyl. In some embodiments, R 2 is a substituted C alkyl. In some embodiments, R 2 is the expression: [ka]

[0018] In some embodiments, R 1 and R 2 are both unsubstituted methyl. In some embodiments, the compound of formula (I) has the formula: [ka] (Metformin), [ka] (Buformin), [ka] (phenformin), or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof.

[0019] In some aspects, the present disclosure relates to a method of reducing accumulation of repeat-associated non-ATG proteins (RANs) in a subject, tissue, or cell, comprising administering to a subject or contacting with a biological sample (e.g., tissue or cell) an effective amount of metformin or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof, or a pharmaceutical composition thereof. In some embodiments, the derivative of metformin is represented by formula (I): [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof, wherein: R1 is hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; and R2 is hydrogen, an optionally substituted alkyl, or a nitrogen protecting group. In some embodiments, the derivative of metformin is buformin or phenformin.

[0020] Another aspect of the present disclosure relates to a kit comprising a container having metformin, a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative or prodrug or a pharmaceutical composition thereof as described herein. The kit described herein may include a single dose or multiple doses of the compound or pharmaceutical composition. The kit may be useful in the method of the present disclosure. In some embodiments, the kit further includes instructions for using the compound or composition. The kit described herein may also include information (e.g., prescription information) as required by regulatory agencies such as the U.S. Food and Drug Administration (FDA). These and other aspects of the present application are described in more detail herein and illustrated by the following non-limiting drawings. [Brief description of the drawings]

[0021] [Figure 1A-1B]Figures 1A-1E show that protein kinase R (PKR) regulates RAN translation of CAG, CCTG, and G4C2 expansions through the eIF2a-P pathway. Figure 1A shows a diagram of the CAG, CCTG, and GGGCC repeat expansion constructs used to test the effect of PKR on repeat-associated non-ATG (RAN) translation. The constructs have a 6x stop codon cassette, two stops in each reading frame, upstream of the repeat expansion and a C-terminal epitope tag. Figure 1B shows a diagram of the PKR vectors expressing wild type (PKR-WT), a dominant-negative K296R mutant form of PKR (PKR-K296R) or the C-terminal only domain (PKR-CT). [Figure 1C] Figure 1C shows representative immunoblots of transfected HEK293T cells suggesting that PKR-WT increases polyAla RAN protein from the CAG-expanded construct; PKR-CT lacking the RRM motif has no effect on polyAla RAN levels; and the dominant-negative mutant K296R PKR decreases polyAla RAN levels. The eIF2α-P panel shows that PKR increases the levels of eIF2α-P, PKR-CT has no effect, and PKR-K296R decreases steady-state levels of eIF2α-P.

[0022] [Fig. 1D-1E]Figure 1D shows a representative immunoblot of transfected HEK293T cells, suggesting that PKR-WT increases poly-LPAC-RAN protein from CCTG-extended constructs; PKR-CT has no effect on LPAC-RAN levels; and dominant negative mutant K296R PKR decreases poly-LPAC-RAN levels. The eIF2α-P panel suggests that PKR increases steady-state levels of eIF2α-P; PKR-CT has no effect on steady-state levels of eIF2α-P; and PKR K296R decreases steady-state levels of eIF2α-P. Figure 1E shows a representative immunoblot of transfected HEK293T cells, showing that PKR-WT increases, PKR-CT has no effect, and mutant K296R PKR decreases poly-GP-RAN protein levels. The eIF2α-P panel shows that PKR increases, PKR-CT has no effect, and PKR-K296R decreases steady-state levels of eIF2α-P.

[0023] [Figure 2A] Figures 2A-2C show that eIF2α-P increases RAN protein levels in HEK293T cells. Figure 2A shows representative protein blots of HEK293T cells co-transfected with plasmids expressing WT or mutant eIF2α and CAG-expanded protein (CAGexp), which show increased polyAla RAN protein levels in cells overexpressing the phosphomimetic eIF2α-S51D mutation compared to eIF2α-WT or nonphosphorylatable eIF2α-S51A. [Figure 2B] FIG. 2B shows a representative protein blot showing that polyAla, polyAla and LPAC RAN proteins expressed from CAG, CTG and CCTG repeat expansions, respectively, are decreased in the presence of a PKR inhibitor that reduces the levels of eIF2α-P. [Figure 2C]FIG. 2C shows a representative protein blot demonstrating reduced polyAla RAN protein levels in the presence of ISIRB, which inhibits the downstream effects of eIF2α-P.

[0024] [Figure 3A] Figures 3A-3C show that inhibition of the PKR pathway reduces RAN protein assembly and improves behavioral phenotypes in C9-500 BAC transgenic mice. Figure 3A shows a schematic diagram of the AAV2 / 9 construct used for AAV injection into a BAC transgenic mouse model of C9orf72 ALS / FTD containing 500 G4C2 repeats (C9-500 BAC). [Figure 3B-3C] Figure 3B shows representative immunohistochemical (IHC) staining of GA RAN protein in sections of the retrosplenial cortex from C9-500 BAC mice, and quantification of GA RAN protein aggregates. Figure 3C shows open field analysis suggesting that C9-500 BAC animals treated with dominant negative PKR (K296R) show reduced center time, a phenotype that represents anxiety-like behavior, compared to EGFP control animals.

[0025] [Figure 4] Figure 4 shows that alternative eIF2A initiation factors increase RAN translation. eIF2A is an alternative eukaryotic translation initiation factor that can be used as an alternative to eIF2α under certain conditions. The constructs used to express RAN protein are shown with 6x stop codons (two upstream stop codons in each reading frame), repeat expansion mutations (CCTG, CAGG or GGGCC), and 3' triple tags with epitope tags in each reading frame. Co-transfection with these repeat expansion constructs increases RAN protein levels in combination with overexpression of eIF2A, demonstrating that eIF2A serves as an alternative eukaryotic initiation factor for RAN across a variety of disease causing expansion mutations. [Diagram 5]FIG. 5 shows a schematic illustrating eIF2α phosphorylation, which downregulates global translation and leads to increased RAN protein levels.

[0026] [Figure 6A-6B] Figures 6A-6G show data suggesting that protein kinase R (PKR) regulates RAN translation of CAG, CCTG, CAGG, G4C2 expansions by activating the PKR pathway. Figure 6A shows the repeat expansion constructs used for HEK293T transfection. The constructs have a 6x stop codon cassette, two stops in each reading frame, upstream of the repeat expansion and a C-terminal epitope tag. Figure 6B shows activation of PKR by hairpin-forming extended repeat RNA. Protein blots show that expression of CAG, CCUG, CAGG, and GGGGCC repeat expansions induces phosphorylation of PKR at sites (T446 and T451) known to be critical for PKR activation. [Figure 6C-6D] Figure 6C shows a diagram of PKR vectors expressing wild type (PKR-WT), a dominant-negative K296R mutant form of PKR (PKR-K296R) or the inactive C-terminal domain (PKT-CT). Figure 6D shows immunoblots of transfected HEK293T cells showing that PKR-WT increases polyAla RAN protein from CAG-expanded constructs, PKR-CT lacking the RRM motif has no effect on polyAla RAN levels, and the dominant-negative mutant K296R PKR decreases polyAla RAN levels.

[0027] [Figure 6E] FIG. 6E shows immunoblots of transfected HEK293T cells showing that PKR-WT increases poly-LPAC-RAN protein from CCTG-extended constructs, PKR-CT lacking the RRM motif has no effect on poly-LPAC-RAN levels, and the dominant-negative mutant K296R PKR decreases poly-LPAC-RAN levels. [Figure 6F] Figure 6F shows immunoblots of transfected HEK293T cells showing that PKR-WT increases polyQAGR RAN protein from the CAGG expansion construct, PKR-CT, which lacks the RRM motif, has no effect on polyQAGR RAN levels, and the dominant-negative mutant K296R PKR reduces polyQAGR RAN levels. [Figure 6G] FIG. 6G shows immunoblots of transfected HEK293T cells showing that PKR-WT increases polyGP RAN protein from the GGGGCC-expanded construct, PKR-CT, which lacks the RRM motif, has no effect on polyGP RAN levels, and the dominant-negative mutant K296R PKR reduces polyGP RAN levels.

[0028] [Figure 7A] Figures 7A-7B show that PKR activation reduces LAPAC RAN protein in three reading frames but does not affect the levels of ATG-initiated polyglutamine proteins. Figure 7A shows an immunoblot of transfected HEK293T cells. The levels of ATG-initiated polyGln proteins are not affected by overexpression of PKR-WT, PKR-CT or PKR K296R. [Figure 7B] FIG. 7B shows immunoblots of transfected HEK293T cells indicating that overexpression of PKR-WT increases poly-LPAC-RAN protein from the CCTG expansion construct, PKR-CT has no effect, and the dominant-negative mutant PKR K296R reduces poly-LPAC-RAN levels in all three reading frames.

[0029] [Figure 8A]Figures 8A-8C show RAN protein levels regulated by the PKR / eIF2a pathway. Figure 8A shows protein blots of HEK293T cells co-transfected with plasmids expressing WT or mutant eIF2α and CAGexp, which show increased polyAla RAN protein levels in cells overexpressing the phosphomimetic eIF2α-S51D mutation compared to eIF2α-WT or non-phosphorylatable eIF2α-S51A. [Fig. 8B-8C] Figure 8B shows a protein blot showing that the PKR inhibitor transactivation response element RNA binding protein (TARBP2) reduces the levels of RAN polyAla expressed from CAG and CUG expansion RNA and polyLPAC ​​expressed from CCUG repeats. In addition, TARBP2 reduces the levels of p-eIF2α. Figure 8C shows a protein blot showing that polyAla RAN protein levels are elevated with PKR-WT overexpression and also reduced when treated with integrated stress response inhibitor (ISRIB), which inhibits the downstream effects of p-eIF2α. [Figure 9-1] Figure 9 shows CRISPR / Cas9 knockout of PKR in HEK293T cells. Transient transfection of CAG, CCTG, and CAGG expansion constructs shows reduction of polyAla, polyLPAC, and polyQAGR protein. [Figure 9-2] Figure 9 shows CRISPR / Cas9 knockout of PKR in HEK293T cells. Transient transfection of CAG, CCTG, and CAGG expansion constructs shows reduction of polyAla, polyLPAC, and polyQAGR protein.

[0030] [Figure 10A-10C]Figures 10A-10D show that inhibition of the PKR pathway reduces RAN protein assembly and improves behavioral phenotypes in C9-500 BAC transgenic mice. Figure 10A shows a schematic diagram of EGFP control and PKR-K296R AAV2 / 9 constructs used for intracerebroventricular (ICV) injection into BAC transgenic C9orf72 ALS / FTD mice (C9-500 BAC) containing 500 G4C2 repeats. ICV injections were performed at P0 with AAV2 / 9 viruses expressing either EGFP or a dominant negative form of PKR (K296R), and animals were sacrificed for analysis at 3 months of age. Figure 10B shows mesoscale detection (MSD) assays of brain lysates, which show that mice treated with PKR-K296R have lower levels of soluble GP RAN protein. Figure 10C shows representative immunohistochemical (IHC) staining (brown) of GA RAN protein aggregates in sections of the retrosplenial cortex from C9-500 BAC mice, with quantification showing that GA RAN protein aggregates are reduced in mice treated with PKR-K296R compared to controls. Analysis was performed in a blinded fashion. [Figure 10D] FIG. 10D shows an open field analysis demonstrating that C9-500 BAC mice treated with PKR-K296R exhibited reduced center time, a phenotype indicative of anxiety-like behavior, compared to EGFP control animals.

[0031] [Figure 11A-11B]Figures 11A-11J show that metformin inhibits PKR and reduces RAN protein and ameliorates disease in C9-BAC mice. Figure 11A shows protein blots suggesting that metformin reduces RAN protein expression in HEK293T cells transiently transfected with CAG, CCTG, CAGG and G4C2 expansion constructs. Figure 11B shows data suggesting that metformin reduces p-PKR levels (T446 and T451) in cells transfected with repeat expansion constructs. [Fig. 11C-11E] Figure 11C is a schematic diagram showing the study design for two metformin treatment groups, with treatment with 5 mM metformin at 2-5 months of age or 6-9 months of age. Figure 11D shows data quantifying GA aggregates and suggests reduced GA aggregates in mice treated with 5 mM metformin in drinking water from 2-5 months of age compared to untreated C9-500 mice. Figure 11E shows quantification of GFAP staining, suggesting reduced levels of reactive gliosis in C9-500 metformin-treated mice compared to C9-500 control animals.

[0032] [Fig. 11F-11G] Figure 11F shows a DigiGait analysis of eight parameters that were different between untreated C9-500 and NT controls, suggesting that six of these parameters were improved in metformin-treated C9-500 animals. Example data from four of these eight parameters are shown. Figure 11G shows an open field analysis that showed that the decreased center time in C9-500 animals was normalized in metformin-treated C9-500 animals. [Fig. 11H-11I]Figure 11H shows data from MSD assays suggesting that soluble GP levels are reduced in C9-500 animals treated with metformin compared to C9-500 controls. Figure 11I shows that GA assembly is reduced in C9-500 animals treated with metformin compared to C9-500 controls. [Figure 11J] FIG. 11 is a schematic showing that chronic activation of the PKA pathway by J-repeat-expanded RNA prioritizes RAN translation through an integrated stress response and eIF2α phosphorylation.

[0033] [Figure 12] Figure 12 shows that metformin and the related drugs phenformin and buformin inhibit PKR and reduce GP RAN protein levels in a dose-dependent manner. Top panel: Protein blot showing that metformin, phenformin and buformin reduce RAN GP protein levels in HEK293T cells transiently transfected with G4C2 expansion constructs in a dose-dependent manner. Bottom panel: Metformin, phenformin and buformin reduce p-PKR levels (T446 and T451) in cells transfected with G4C2 repeat expansion constructs.

[0034] [Figure 13A] Figures 13A-13B show that metformin inhibits RNA translation at multiple reading frames in cells transfected with constructs containing the CAG, CCTG, or GGGGCC repeat expansion motifs. Protein blots were performed on protein lysates from HEK293T cells transfected with the various repeat expansion constructs shown in Figure 13A. [Figure 13B]In FIG. 13B, the lane labeled KMQ has a methionine-encoding ATG located immediately 5' to the CAG repeat expansion and in the polyGln reading frame. The KKQ vector contains a CAG expansion without an AUG start codon and indicates: Ser-Flag, Ala-HA, Gln-Myc. These constructs contain epitope tags incorporated into the C-terminal regions of ATG-initiated polyGln and non-ATG-initiated RAN proteins (poly-Gln, poly-Leu-Pro-Ala-Cys and poly-Gly-Pro) that are expressed across these repeat expansions. The lane labeled CCTG expresses the following RAN proteins: LPAC-Flag, LPAC-HA, LPAC-Myc. The lane labeled G4C2 is designed to detect the following RAN proteins: GP-Flag, GR-HA, GA-Myc. Treatment of transfected HEK293T cells with metformin shows reduced RAN protein levels following poly-LPAC (poly-leucine-proline-alanine-cysteine), poly-Ala, and poly-GP (polyglycine-proline) in all three reading frames.

[0035] [Figure 14] FIG. 14 shows that metformin reduces the levels of RAN protein produced by expression of C9ORF72 in vivo. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0036] Detailed Description In eukaryotes, the machinery of protein translation, encompassing ribosomes, initiation factors (eIFs), and the specific steps of translation initiation and elongation, is well conserved. Eukaryotic initiation factor 2 (eIF2) is a multiprotein complex involved in the initiation phase of eukaryotic protein translation. Generally, in humans, eIF2 contains three non-identical subunits (e.g., eIF2α, eIF2β, and eIF2γ). Typically, eIF2α forms a ternary complex with guanosine triphosphate (GTP) and initiator methionyl-initiator transfer RNA to participate in the initiation of translation.

[0037] RAN protein translation Aspects of the present application relate to methods and compositions for reducing the expression of repeat-associated non-ATG (RAN) proteins. A "RAN protein (repeat-associated non-ATG translated protein)" is a polypeptide translated from a bidirectionally transcribed sense or antisense RNA sequence carrying a nucleotide stretch in the absence of an AUG start codon. Generally, RAN proteins contain extended repeats of single, di-, tri-, or tetraamino acids (e.g., tetraamino acids), referred to as polyamino acid repeats. For example, "AAAAAAAAAAAAAAAAAAAAA" (poly-alanine) (SEQ ID NO: 3), "LLLLLLLLLLLLLLLLLL" (poly-leucine) (SEQ ID NO: 4), "SSSSSSSSSSSSSSSSSSSS" (poly-serine) (SEQ ID NO: 5), or "CCCCCCCCCCCCCCCCCC" (poly-cysteine) (SEQ ID NO: 6) are each polyamino acid repeats of 20 amino acid residues in length.

[0038] Examples of diamino acid RAN proteins include GPGPGPGPGPGPGPGPGPGP (poly-GP) (SEQ ID NO: 7), GAGAGAGAGAGAGAGAGA (poly-GA) (SEQ ID NO: 8), GRGRGRGRGRGRGRGRGRGR (poly-GR) (SEQ ID NO: 9), PAPAPAPAPAPAPAPAPAPA (poly-PA) (SEQ ID NO: 10), and PRPRPRPRPRPRPRPRPRPR (poly-PR) (SEQ ID NO: 11). Examples of tetraamino acid repeats include LPACLPACLPAC (e.g., poly-LPAC) (SEQ ID NO: 12) and QAGRQAGRQAGR (e.g., poly-QAGR) (SEQ ID NO: 13). RAN proteins can have polyamino acid repeats at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, or at least 200 amino acid residues in length. In some embodiments, the RAN protein has a polyamino acid repeat that is greater than 200 amino acid residues in length.

[0039] Generally, RAN protein is translated from abnormal repeat expansions (e.g., CAG repeats) of DNA. Without wishing to be bound by any particular theory, RAN protein accumulation (e.g., in the nucleus or cytoplasm of a cell) disrupts cell function and induces cytotoxicity. In some embodiments, RAN protein translation and accumulation are associated with a disease or disorder, such as a neurodegenerative disease or disorder. Examples of disorders and diseases associated with RAN protein translation and accumulation include, but are not limited to, spinocerebellar ataxia type 8 (SCA8), myotonic dystrophy type 1 (DM1), fragile X tremor ataxia syndrome (FXTAS), and C9ORF72 amyotrophic lateral sclerosis / frontotemporal dementia (ALS / FTD). Thus, the methods and compositions described herein are useful in some embodiments for treating one or more RAN protein-related diseases or conditions in a subject in need thereof. In some embodiments, the subject is a mammalian subject. In some embodiments, the subject is a human subject.

[0040] Inhibition of eIF2α-P, eIF2A, and PKR Aspects of the present disclosure relate to the recognition that inhibition of eIF2α phosphorylation (e.g., eIF2α-P) reduces RAN protein translation and accumulation in cells.In some aspects, the present disclosure is based on the recognition that alternative mammalian eIF (e.g., eIF2A) can act as an alternative eukaryotic initiation factor for RAN across a variety of diseases that cause expansion mutations.In some aspects, the present disclosure is based on the recognition that inhibition of protein kinase R (PKR) reduces RAN protein translation and accumulation in cells.

[0041] Thus, in some aspects, the disclosure provides a method for inhibiting repeat non-ATG protein (RAN protein) translation, the method comprising contacting a cell expressing the repeat non-ATG protein (RAN protein) with an effective amount of a eukaryotic initiation factor 2 (eIF2) modulating agent or a PKR modulating agent. As used herein, "eIF2 modulator" refers to an agent that directly or indirectly affects the expression level or activity of eIF2 protein complex or eIF2 complex subunit (e.g., eIF2α, eIF2β, eIF2γ, etc.). The modulator can be an eIF2 or eIF2 subunit activator (e.g., increases the expression or activity of eIF2 or eIF2 subunit) or an eIF2 or eIF2 subunit inhibitor (e.g., decreases the expression or activity of eIF2 or eIF2 subunit). In some embodiments, the eIF2 modulator increases or decreases the expression and / or activity of eIF2 or eIF2 subunit in a cell or subject, relative to a cell or subject that is not administered the eIF2 modulator. In some embodiments, the eIF2 modulator is a protein, a nucleic acid, or a small molecule.

[0042] Generally, a direct modulator functions by interacting with (e.g., interacting with or binding to) a gene encoding eIF2 (or an eIF2 subunit), or an eIF2 protein complex, or an eIF2 subunit. Generally, an indirect modulator functions by interacting with a gene or protein that regulates the expression or activity of eIF2 or an eIF2 subunit (e.g., without directly interacting with a gene or protein encoding eIF2 or an eIF2 subunit).

[0043] In some aspects, the present disclosure relates to the recognition that inhibiting phosphorylation of eIF2α (e.g., phosphorylation of eIF2α at Ser 51) reduces RAN protein translation (e.g., RAN protein translation in a cell). Without wishing to be bound by any particular theory, inhibitors of certain serine kinases (e.g., protein kinase R (PKR), etc.) that phosphorylate eIF2α are useful in some embodiments to inhibit RAN protein translation and / or RAN protein accumulation in a cell (e.g., a cell of a subject). Thus, in some embodiments, the modulator of eIF2 is an inhibitor of a serine / threonine kinase. Examples of serine / threonine kinases include, but are not limited to, protein kinase A (PKA), protein kinase C (PKC), Mos / Raf kinase, mitogen-activated protein kinases (MAPKs), protein kinase B (AKT kinase), etc. In some embodiments, the eIF2 modulating agent is a protein kinase R (PKR) inhibitor.

[0044] As used herein, a "PKR modulator" refers to an agent that directly or indirectly affects the expression level or activity of protein kinase R (PKR). The modulator can be an activator of PKR (e.g., increases the expression or activity of PKR) or an inhibitor of PKR (e.g., decreases the expression or activity of PKR). In some embodiments, the PKR modulator increases or decreases the expression and / or activity of PKR in a cell or control, relative to a cell or subject that is not administered the PKR modulator. In some embodiments, the PKR inhibitor is a protein, a nucleic acid, or a small molecule. Generally, a direct modulator functions by interacting with (e.g., interacting with or binding to) PKR. Generally, an indirect modulator functions by interacting with a gene or protein that regulates the expression or activity of PKR (e.g., without directly interacting with the gene or protein encoding PKR).

[0045] The present disclosure relates, in part, to a variant of a protein kinase R (PKR) that functions in a dominant-negative manner to inhibit phosphorylation of eIFα, and is therefore useful for reducing RNA protein translation in cells. As used herein, a "protein kinase R (PKR) variant" refers to a protein that comprises an amino acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to wild-type protein kinase R (PKR) (e.g., GenBank Accession No. NP_002750.1), where the variant protein comprises at least one amino acid change (sometimes also referred to as a "mutation") relative to the amino acid sequence of wild-type PKR.

[0046] In some embodiments, the amino acid sequence of the PKR variant is at least 75%, at least 85%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the amino acid sequence of wild-type PKR. In some embodiments, the amino acid sequence is about 95-99.9% identical to the amino acid sequence of wild-type PKR. In some embodiments, the protein comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, or at least fifteen different amino acid sequence mutations compared to the sequence of amino acids defined in the amino acid sequence of wild-type PKR. In some embodiments, the PKR variant comprises a mutation at position 296 (e.g., position 296 of human wild-type PKR). In some embodiments, the mutation at position 296 is K296R.

[0047] The present disclosure is directed, in part, to the recognition that under certain conditions, eIF2A functions as an alternative translation initiation factor for RAN translation. Thus, in some embodiments, the modulator of eIF2 is an inhibitor of eIF2A. In some embodiments, the modulator of eIF2 or PKR is a selective modulator. "Selective modulator" refers to a modulator of eIF2 or PKR that preferentially modulates the activity or expression of one type of eIF2 subunit compared to other types of eIF2 subunits, or preferentially modulates the activity or expression of PKR compared to other kinases. In some embodiments, the modulator of eIF2 is a selective modulator of eIF2α. In some embodiments, the modulator of eIF2 is a selective modulator of eIF2A. In some embodiments, the modulator of eIF2 is a selective modulator of protein kinase R (PKR), such as a selective PKR inhibitor.

[0048] Examples of proteins that inhibit eiF2 (e.g., the eIF2 subunit) include, but are not limited to, polyclonal anti-eIF2 antibodies, monoclonal anti-eIF2 antibodies, and the like. Examples of nucleic acid molecules that inhibit eiF2 (e.g., the eIF2 subunit) include, but are not limited to, dsRNA, siRNA, miRNA, and the like that target the gene encoding the eIF2 subunit (e.g., the gene encoding the mRNA set forth in GenBank Accession No. NM_004094.4). Examples of small molecule inhibitors of eIF2 include, but are not limited to, LY 364947, eIF-2α inhibitor II Sal003, and the like.

[0049] Examples of proteins that inhibit PKR include, but are not limited to, certain dominant negative PKR variants (e.g., K296R PKR mutation), TARBP2, and the like. Examples of nucleic acid molecules that inhibit PKR include, but are not limited to, dsRNA, siRNA, miRNA, and the like that target the gene encoding PKR. Examples of small molecule inhibitors of PKR include, but are not limited to, 6-amino-3-methyl-2-oxo-N-phenyl-2,3-dihydro-1H-benzo[d]imidazole-1-carboxamide, N-[2-(1H-indol-3-yl)ethyl]-4-(2-methyl-1H-indol-3-yl)pyrimidin-2-amine, metformin, buformin, phenformin, and the like.

[0050] Examples of nucleic acid molecules that inhibit eIF2A include, but are not limited to, dsRNA, siRNA, miRNA, etc. that target the gene encoding eIF2A (e.g., the gene encoding the mRNA set forth in GenBank Accession No. NM_032025.4). Examples of small molecule inhibitors of eIF2A include, but are not limited to, salubrinal, Sal003, ISRIB, etc. In some embodiments, the eIF2 modulating agent or PKR modulating agent is an inhibitory nucleic acid. In some embodiments, the inhibitory nucleic acid is an interfering RNA selected from the group consisting of dsRNA, siRNA, shRNA, mi-RNA, and ami-RNA. In some embodiments, the inhibitory nucleic acid is an antisense nucleic acid (e.g., antisense oligonucleotide (ASO)) or a nucleic acid aptamer (e.g., RNA aptamer). In general, the inhibitory RNA molecule can be unmodified or modified. In some embodiments, the inhibitory RNA molecule comprises one or more modified oligonucleotides, e.g., oligonucleotides modified by phosphothioate-, 2'-O-methyl-, etc., because such modifications are recognized in the art as improving the stability of oligonucleotides in vivo.

[0051] In some embodiments, the interfering RNA comprises a sequence that is complementary to between 5 and 50 contiguous nucleotides (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, about 30, about 35, about 40, or about 50 contiguous nucleotides) of a nucleic acid sequence (e.g., an RNA sequence) encoding an eIF2 subunit or a nucleic acid sequence (e.g., an RNA sequence) encoding PKR.

[0052] In some embodiments, the eIF2 modulating agent or PKR modulating agent is a small molecule (e.g., a compound) represented by formula (I): [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof, where: R1 is hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; and R2 is hydrogen, an optionally substituted alkyl, or a nitrogen protecting group.

[0053] The term "pharmaceutical acceptable salt" refers to a salt that is suitable for use in contact with the tissues of humans and lower animals, within the scope of sound medical judgment, without undue toxicity, irritation, allergic reaction, etc., and commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe pharmaceutical acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, which is incorporated herein by reference.

[0054] Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. Examples of pharma-ceutically acceptable, non-toxic acid addition salts are the salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or formed using other methods known in the art, such as ion exchange.

[0055] Other pharma- ceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, Salts derived from appropriate bases include alkali metal salts, alkaline earth metal salts, ammonium salts and N-type salts. + (C 1~4 Alkyl)4 - Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Further pharma- ceutically acceptable salts include non-toxic ammonium cations, quaternary ammonium cations, and amine cations formed, where appropriate, using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkylsulfonates and arylsulfonates.

[0056] The term "solvate" refers to a form of a compound that is associated with a solvent, usually by solvolysis. This physical association may involve hydrogen bonding. Conventional solvents include water, methanol, ethanol, acetic acid, DMSO, THF, diethyl ether, and the like. Metformin, for example, may be prepared in crystalline form and may be solvated. Suitable solvates include pharmaceutically acceptable solvates, and further include both stoichiometric and non-stoichiometric solvates. In some cases, the solvate may be capable of being isolated, for example, when one or more solvent molecules are incorporated into the crystal lattice of a crystalline solid. "Solvate" encompasses both solution-phase and isolatable solvates. Representative solvates include hydrates, ethanolates, and methanolates.

[0057] The term "hydrate" refers to a compound associated with water. Typically, the number of water molecules contained in a hydrate of a compound is a fixed ratio to the number of compound molecules in the hydrate. Thus, a hydrate of a compound may be represented, for example, by the general formula R·xH2O, where R is a compound and x is a number greater than 0. A given compound may form more than one type of hydrate, including, for example, monohydrates (x is 1), lower hydrates (x is greater than 0 and less than 1, for example, hemihydrates (R·0.5H2O)), and polyhydrates (x is a number greater than 1, for example, dihydrates (R·2H2O) and hexahydrates (R·6H2O)).

[0058] The term "tautomer" or "tautomeric" refers to two or more interconvertible compounds resulting from at least one formal shift of a hydrogen atom and at least one change in valence (e.g., from a single bond to a double bond, a triple bond to a single bond, or vice versa). The exact ratio of tautomers depends on several factors, including temperature, solvent, and pH. Tautomerization (i.e., the reaction that provides a tautomeric pair) may be catalyzed by acid or base. Exemplary tautomerizations include keto to enol, amide to imide, lactam to lactim, enamine to imine, and enamine to a different enamine.

[0059] It should also be understood that compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are termed "isomers." Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereomers" and those that are non-superimposable mirror images of each other are called "enantiomers". When a compound has an asymmetric center, e.g., it is bonded to four different groups, a pair of enantiomers can exist. Enantiomers can be characterized by the absolute configuration of their asymmetric center and described by the R- and S-sequencing rules of Cahn and Prelog, or by the mode of rotation of the molecule relative to the plane of polarized light, designated as dextrorotatory or levorotatory (i.e., as (+) or (-) isomers, respectively). Chiral compounds can exist as either individual enantiomers or mixtures thereof. A mixture containing equal proportions of enantiomers is called a "racemic mixture".

[0060] The term "prodrug" refers to a compound that has a cleavable group and that, by solvolysis or under physiological conditions, becomes a compound described herein, which is pharmacologic in vivo active. Such examples include, but are not limited to, choline ester derivatives, N-alkylmorpholine esters, and the like. Other derivatives of the compounds described herein are active in both their acid and acid derivative forms, but the acid-sensitive forms often offer advantages of solubility, tissue compatibility, or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs, pp. 7-9, 21-24, Elsevier, Amsterdam 1985).

[0061] Prodrugs include acid derivatives well known to those skilled in the art, such as esters prepared by reaction of the parent acid with a suitable alcohol, or amides prepared by reaction of the parent acid compound with a substituted or unsubstituted amine, or acid anhydrides, or mixed anhydrides. Simple aliphatic or aromatic esters, amides, and anhydrides derived from acid groups pendant on the compounds described herein are particular prodrugs. In some cases, it is desirable to prepare double ester type prodrugs, such as (acyloxy)alkyl esters or ((alkoxycarbonyl)oxy)alkyl esters. The C1-C8 alkyl, C2-C8 alkenyl, C2-C8 alkynyl, aryl, C7-C8 alkyl, C8-C8 alkyl, C9-C10 alkyl, C10-C12 alkyl, C10-C14 alkyl, C10-C16 alkyl, C10-C18 alkyl, C10-C16 alkyl, C10-C18 alkyl, C10-C12 ... 12 Substituted aryl, and C7-C 12 Aryl alkyl esters may be preferred.

[0062] In certain embodiments, R1 is hydrogen. The term "optionally substituted" refers to a group that is substituted or unsubstituted. Exemplary carbon atom substituents include, but are not limited to, halogen, -CN, -NO2, -N3, -SO2H, -SO3H, -OH, -NH2, C3-10 carbocyclyl, 3-14 membered heterocyclyl, C6-14 aryl, and 5-14 membered heteroaryl. "Carbocyclyl" refers to a radical of a non-aromatic cyclic hydrocarbon group having 3 to 10 ring carbon atoms ("C3-10 carbocyclyl") and zero heteroatoms in the non-aromatic ring system. The term "heterocyclyl" or "heterocycle" refers to a radical of a 3-14 membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur (3-14 membered heterocyclyl).

[0063] The term "aryl" refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic), 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic array) having 6-14 ring carbon atoms and 0 heteroatoms provided in the aromatic ring system ("C6-14 aryl"). The term "heteroaryl" refers to a radical of a 5-14 membered monocyclic or polycyclic (e.g., bicyclic, tricyclic), 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic array) having ring carbon atoms and 1-4 ring heteroatoms provided in the aromatic ring system, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-14 membered heteroaryl").

[0064] In some embodiments, R1 is an optionally substituted alkyl. In some embodiments, R1 is an unsubstituted C1-6 alkyl. In some embodiments, R1 is an unsubstituted methyl, unsubstituted ethyl, unsubstituted propyl, or unsubstituted butyl. In some embodiments, R1 is an unsubstituted methyl. In some embodiments, R1 is an unsubstituted n-butyl. In some embodiments, R1 is a nitrogen protecting group (e.g., an amide group, a carbamate group, or a sulfonamide group (e.g., t-butyl carbamate (BOC), benzyl, benzyl carbamate (Cbz), or benzyloxymethyl)).

[0065] In some embodiments, R2 is hydrogen. In some embodiments, R2 is optionally substituted alkyl. In some embodiments, R2 is optionally substituted C1-6 alkyl. In some embodiments, R1 is unsubstituted methyl, unsubstituted ethyl, unsubstituted propyl, or unsubstituted butyl. In some embodiments, R1 is unsubstituted methyl. In some embodiments, R2 is substituted C1-6 alkyl. In some embodiments, R2 is optionally substituted methyl. In some embodiments, R2 is optionally substituted ethyl. In some embodiments, R2 is substituted ethyl. In some embodiments, R2 is a group of the formula: [ka] In some embodiments, R2 is a substituted propyl. In some embodiments, R2 is a substituted butyl. In some embodiments, R1 and R2 are both unsubstituted methyl. In some embodiments, R2 is a nitrogen protecting group (e.g., an amide group, a carbamate group, or a sulfonamide group (e.g., t-butyl carbamate (BOC), benzyl, benzyl carbamate (Cbz), or benzyloxymethyl)).

[0066] In some embodiments, the compound of formula (I) has the formula: [ka] (Metformin), [ka] (Buformin), [ka] (phenformin), or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof.

[0067] In some embodiments, one or more modulators (e.g., one or more activators, or one or more inhibitors) of one or more subunits of eIF2 and / or one or more modulators of PKR are administered to a subject to treat a disease associated with the expansion of nucleic acid repeats (e.g., associated with repeat-associated non-ATG translation). For example, in some embodiments, a subject is administered two, three, four, five, six, seven, eight, nine, or ten modulators (e.g., proteins, nucleic acids, small molecules, etc.) of one or more subunits of eIF2 and / or two, three, four, five, six, seven, eight, nine, or ten modulators (e.g., proteins, nucleic acids, small molecules, etc.) of PKR. In some embodiments, a subject is administered an inhibitor of eIF2α and an inhibitor of eIF2A.

[0068] Pharmaceutical Compositions The present disclosure also provides a pharmaceutical composition comprising a compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.) and, optionally, a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition comprises a compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.) or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient.

[0069] In some embodiments, a compound of formula (I) (e.g., metformin, buformin, phenformin, etc.) is provided in an effective amount in a pharmaceutical composition. In some embodiments, the effective amount is a therapeutically effective amount. In some embodiments, the effective amount is a prophylactically effective amount. In some embodiments, the therapeutically effective amount is an amount effective in reducing repeat expansion. In some embodiments, the therapeutically effective amount is an amount effective in reducing transcription of an RNA that produces a RAN protein. In some embodiments, the therapeutically effective amount is an amount effective in reducing translation of a RAN protein.

[0070] In some embodiments, the therapeutically effective amount is an amount effective in reducing the level of one or more RAN proteins in a subject.In some embodiments, the therapeutically effective amount is an amount effective for treating a neurological disease associated with repeat expansion.In some embodiments, the therapeutically effective amount is an amount effective in reducing the level of one or more RAN proteins to treat a neurological disease associated with repeat expansion.In some embodiments, the therapeutically effective amount is an amount effective in reducing the accumulation of RAN protein.

[0071] In some embodiments, an effective amount is an amount effective in reducing the level of RAN protein by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% (e.g., the level of RAN protein relative to the level of RAN protein in a cell or subject not administered an eIF2 modulator or a PKR modulator). In some embodiments, an effective amount is an amount effective in reducing the translation of RAN protein by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% (e.g., the level of RAN protein relative to the level of RAN protein in a cell or subject not administered an eIF2 modulator or a PKR modulator).

[0072] The pharmaceutical compositions described herein can be prepared by any method known in the art of pharmacology.In general, such preparation methods include bringing into association the compound described herein (i.e., "active ingredient") with a carrier or excipient, and / or one or more other accessory ingredients, and then, if necessary and / or desired, shaping and / or packaging the product into the desired single or multiple dose unit. Pharmaceutical compositions can be prepared, packaged, and / or sold in bulk as a single unit dose and / or as a plurality of single unit doses. A "unit dose" is a discrete amount of pharmaceutical composition that contains a predetermined amount of active ingredient. The amount of active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject and / or a convenient fraction of such a dosage, such as one-half or one-third of such a dosage.

[0073] The relative amounts of the active ingredient, pharma- ceutically acceptable excipient, and / or any additional ingredients in the pharmaceutical compositions described herein will vary depending on the identity, size, and / or condition of the subject being treated, and also depending on the route by which the composition is to be administered. The compositions may contain between 0.1% and 100% (w / w) of the active ingredient. Pharmaceutically acceptable excipients used in the manufacture of the provided pharmaceutical compositions include inert diluents, dispersing and / or granulating agents, surfactants and / or emulsifying agents, disintegrating agents, binders, preservatives, buffers, lubricants, and / or oils. Excipients such as cocoa butter and suppository waxes, colorants, coating agents, sweeteners, flavorings, and perfuming agents may also be present in the composition.

[0074] Exemplary diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, powdered sugar, and mixtures thereof. Exemplary granulating and / or dispersing agents include potato starch, corn starch, tapioca starch, sodium starch glycolate, clay, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose, and wood products, natural sponge, cation exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water insoluble starch, calcium carboxymethylcellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds, and mixtures thereof.

[0075] Exemplary surfactants and / or emulsifiers include natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g., bentonite (aluminum silicate) and Veegum (magnesium aluminum silicate)), long chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g., carboxypolymethylene, polyacrylic acid, acrylic acid polymers, and carboxyvinyl polymers), carrageenan, cellulose derivatives (e.g., sodium carboxymethylcellulose, powdered cellulose, hydroxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, methylcellulose), Sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate (Tween® 20), polyoxyethylene sorbitan (Tween® 60), polyoxyethylene sorbitan monooleate (Tween® 80), sorbitan monopalmitate (Span® 40), sorbitan monostearate (Span® 60), sorbitan tristearate (Span® 65), glyceryl monooleate, sorbitan monooleate (Span® 80)), Polyoxyethylene esters (e.g., polyoxyethylene monostearate (Myrj® 45), polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and Solutol®), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., Cremophor®), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether (Brij® 30)), poly(vinylpyrrolidone), diethylene glycol monolaurate,Triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, Pluronic® F-68, Poloxamer P-188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, sodium docusate, and / or mixtures thereof.

[0076] Exemplary binders include starches (e.g., corn starch and starch paste), gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol, and the like), natural and synthetic gums (e.g., acacia, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, mucilage of isapol husk, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinylpyrrolidone), magnesium aluminum silicate (Veegum®), and larch arabogalactan), alginates, polyethylene oxide, polyethylene glycol, inorganic calcium salts, silicic acid, polymethacrylates, waxes, water, alcohol, and / or mixtures thereof.

[0077] Exemplary preservatives include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, antiprotozoal preservatives, alcohol preservatives, acidic preservatives, and other preservatives. In some embodiments, the preservative is an antioxidant. In other embodiments, the preservative is a chelating agent. Exemplary antioxidants include alpha tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite.

[0078] Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA) and its salts and hydrates (e.g., sodium edetate, disodium edetate, trisodium edetate, calcium disodium edetate, dipotassium edetate, etc.), citric acid and its salts and hydrates (e.g., citric acid monohydrate), fumaric acid and its salts and hydrates, malate and its salts and hydrates, phosphoric acid and its salts and hydrates, and tartaric acid and its salts and hydrates. Exemplary antimicrobial preservatives include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal.

[0079] Exemplary antifungal preservatives include butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid. Exemplary alcohol preservatives include ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and phenylethyl alcohol. Exemplary acidic preservatives include vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid.

[0080] Other preservatives include tocopherol, tocopherol acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant® Plus, Phenonip®, methylparaben, Germall® 115, Germaben® II, Neolone®, Kathon®, and Euxyl®.

[0081] Exemplary buffers include citrate buffer, acetate buffer, phosphate buffer, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, and mixtures thereof.

[0082] Exemplary lubricants include magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behenate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and mixtures thereof.

[0083] Exemplary natural oils include almond, apricot kernel, avocado, babassu, bergamot, black current seed, borage, cade, chamomile, canola, caraway, carnauba, castor oil, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cottonseed, emu, eucalyptus, evening primrose, fish, linseed, geraniol, loofah, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemongrass, and thyme. Examples of synthetic oils include, but are not limited to, butyl stearate, caprylic triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristate, mineral oil, octyldodecyl ester, oleyl alcohol, silicone oil, and mixtures thereof.

[0084] The liquid dosage form for oral and parenteral administration includes pharmaceutically acceptable emulsion, microemulsion, solution, suspension, syrup and elixir.In addition to active ingredient, liquid dosage form may contain inert diluent commonly used in the art, such as water or other solvent, solubilizer and emulsifier (ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, etc.), oil (for example, cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and fatty acid ester of sorbitan, and mixtures thereof.

[0085] Apart from inert diluents, oral compositions can include adjuvants, such as wetting agents, emulsifying and suspending agents, sweeteners, flavorings, and perfumes. In certain embodiments for parenteral administration, the conjugates described herein are mixed with solubilizing agents, such as Cremophor®, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and mixtures thereof. Exemplary liquid dosage forms in certain embodiments are formulated for ease of swallowing or for administration via a feeding tube.

[0086] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active ingredient is mixed with at least one inert, pharma- ceutically acceptable excipient or carrier (such as sodium citrate or dicalcium phosphate) and / or with (a) a filler or extender (such as starch, lactose, sucrose, glucose, mannitol, and silicic acid), (b) a binder (such as carboxymethylcellulose, alginate, gelatin, polyvinylpyrrolidinone, sucrose, and acacia), (c) a humectant (such as glycerol), (d) a disintegrant (such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate), (e) a dissolution retarder (such as paraffin), (f) an absorption enhancer (such as a quaternary ammonium compound), (g) a wetting agent (such as a humectant, glycerol, or glycerol), (h) a humectant (such as a humectant, glycerol, or glycerol), (i) a humectant (such as a humectant, glycerol, or glycerol), (j) a humectant (such as a humectant, glycerol, or glycerol), (j) a humectant (such as a humectant, glycerol, or glycerol), (j) a humectant (such as a humectant, glycerol, or glycerol), (k ... (h) absorbents (such as kaolin and bentonite clay), and (i) lubricants (such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof). In the case of capsules, tablets, and pills, the dosage form may also include buffering agents.

[0087] Solid compositions of a similar type can be employed as fillers in soft and hard filled gelatin capsules using such excipients as lactose or milk sugar and high molecular weight polyethylene glycols. Solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and other coatings well known in the art of pharmacology. They can optionally contain opacifying agents and can be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally in a delayed manner. Examples of encapsulating compositions that can be used include polymeric substances and waxes. Solid compositions of a similar type can be employed as fillers in soft and hard filled gelatin capsules using such excipients as lactose or milk sugar and high molecular weight polyethylene glycols.

[0088] The active ingredient can be in microencapsulated form with one or more excipients as mentioned above. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings, release-controlling coatings, and other coatings well known in the pharmaceutical formulation art. In such solid dosage forms, the active ingredient can be mixed with at least one inert diluent, such as sucrose, lactose, or starch. Such solid dosage forms may contain additional substances other than the inert diluent, such as, for example, tableting lubricants and other tableting aids, such as magnesium stearate and microcrystalline cellulose, according to conventional methods. In the case of capsules, tablets, and pills, the dosage forms may also contain buffering agents. They may optionally contain opacifying agents, and may be of a composition such that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally in a delayed manner. Examples of encapsulating agents that can be used include polymeric substances and waxes.

[0089] Although the description of pharmaceutical compositions provided herein is directed primarily to pharmaceutical compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to animals of all kinds. Modifications of pharmaceutical compositions suitable for administration to humans to make the compositions suitable for administration to a variety of animals are well understood, and a veterinary pharmacologist of ordinary skill can design and / or perform such modifications using routine experimentation.

[0090] The compound of formula (I) provided herein (e.g. metformin, buformin, phenformin, etc.) is formulated in dosage unit form for easy administration and uniformity of dosage.However, it is understood that the total daily use of the compositions described herein will be determined by a physician within the scope of sound medical judgment.The specific therapeutically effective dose level for any specific subject or organism depends on various factors, including the severity of the disease and disorder being treated; the activity of the specific active ingredient being employed; the specific composition being employed; the age, weight, general health, sex, and diet of the subject; the time of administration, route of administration, and the excretion rate of the specific active ingredient being employed; the duration of treatment; the drugs used in combination or simultaneously with the specific active ingredient being employed; and similar factors well known in the medical arts.

[0091] The compounds of formula (I) (e.g., metformin, buformin, phenformin, etc.) and compositions provided herein can be administered by any route, including enteral (e.g., orally), parenteral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, subcutaneous, intracerebroventricular, transdermal, intradermal, rectal, intravaginal, intraperitoneal, topical (such as by powders, ointments, creams, and / or drops), mucosal, nasal, buccal, sublingual; by intratracheal instillation, bronchial instillation, and / or by inhalation; and / or as an oral spray, nasal spray, and / or aerosol.

[0092] Specifically contemplated routes are oral administration, intravenous administration (e.g., systemic intravenous injection), local administration via blood and / or lymphatic supply, and / or direct administration to affected area.Generally, the most suitable administration route depends on various factors, including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract) and / or the condition of the subject (e.g., whether the subject can tolerate oral administration).In some embodiments, the compound or pharmaceutical composition described herein is suitable for topical administration to the eye of a subject.

[0093] The exact amount of the compound of formula (I) (e.g., metformin, buformin, phenformin, etc.) required to achieve an effective amount varies from subject to subject, depending on, for example, the species, age, and general condition of the subject, the severity of side effects or disorders, the identity of the particular compound, the mode of administration, etc. The effective amount may be included in a single dose (e.g., a single oral dose) or multiple doses (e.g., multiple oral doses). In some embodiments, when multiple doses are administered to a subject or applied to a biological sample, tissue, or cell, any two doses of the multiple doses include different or substantially the same amount of the compound described herein.

[0094] In some embodiments, when multiple doses are administered to a subject or applied to a biological sample, tissue or cell, the frequency of administering multiple doses to a subject or applying multiple doses to a biological sample, tissue or cell is 3 doses per day, 2 doses per day, 1 dose per day, 1 dose every other day, 1 dose every 3 days, 1 dose per week, 1 dose per 2 weeks, 1 dose per 3 weeks, or 1 dose per 4 weeks.In some embodiments, the frequency of administering multiple doses to a subject or applying multiple doses to a biological sample, tissue or cell is 1 dose per day.In some embodiments, the frequency of administering multiple doses to a subject or applying multiple doses to a biological sample, tissue or cell is 2 doses per day.In some embodiments, the frequency of administering multiple doses to a subject or applying multiple doses to a biological sample, tissue or cell is 3 doses per day.

[0095] In some embodiments, when multiple doses are administered to a subject or applied to a biological sample, tissue, or cell, the period between the first and last doses of the multiple doses is 1 day, 2 days, 4 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 6 months, 8 months, 9 months, 1 year, 2 years, 3 years, 4 years, 5 years, 7 years, 10 years, 15 years, 20 years, or the lifetime of the subject, tissue, or cell. In some embodiments, the period between the first and last doses of the multiple doses is 3 months, 6 months, or 1 year. In some embodiments, the period between the first and last doses of the multiple doses is the lifetime of the subject, tissue, or cell.

[0096] In some embodiments, the doses described herein (e.g., either in a single dose or multiple doses) independently include between 0.1 μg and 1 μg, between 0.001 mg and 0.01 mg, between 0.01 mg and 0.1 mg, between 0.1 mg and 1 mg, between 1 mg and 3 mg, between 3 mg and 10 mg, between 10 mg and 30 mg, between 30 mg and 100 mg, between 100 mg and 300 mg, between 300 mg and 1,000 mg, or between 1 g and 10 g of the compounds described herein, inclusive. In some embodiments, the doses described herein independently include between 1 mg and 3 mg of the compounds described herein, inclusive. In some embodiments, the doses described herein independently include between 3 mg and 10 mg of the compounds described herein, inclusive. In some embodiments, the doses described herein independently encompass between 10 mg and 30 mg (inclusive) of a compound described herein. In some embodiments, the doses described herein independently encompass between 30 mg and 100 mg (inclusive) of a compound described herein.

[0097] In one aspect, the method comprises administering a therapeutically effective amount of metformin: [ka] or its pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug to a subject. In some embodiments, metformin is formulated as metformin hydrochloride tablets. In some embodiments, metformin is formulated as metformin hydrochloride extended release tablets. In some embodiments, metformin is formulated as metformin succinate or metformin fumarate. Metformin and compositions thereof are administered via enteral (e.g., oral) route in some embodiments.

[0098] In some embodiments, the compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.) is administered at a dose of 500 mg metformin twice a day, or at a dose of 850 mg metformin once a day. In some embodiments, the compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.) is administered at a dose of at least 825 mg metformin three times a day. In some embodiments, the compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.) is administered at a dose of 825 mg metformin three times a day. In some embodiments, the compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.) is administered at a dose of 500 mg metformin once a day. In some embodiments, a compound of Formula (I) (eg, metformin, buformin, phenformin, etc.) is administered at a dose of 1000 mg of metformin once a day.

[0099] In some embodiments, the dose of the compound of formula (I) (e.g., metformin, buformin, phenformin, etc.) is given with a meal. In some embodiments, the method includes administering the compound of formula (I) (e.g., metformin, buformin, phenformin, etc.) to the subject for a period between 10 and 30 days. In some embodiments, the period between the first and last dose of the multiple doses of the compound of formula (I) (e.g., metformin, buformin, phenformin, etc.) is 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, or 30 days. In some embodiments, the period between the first and last dose of multiple doses of a compound of Formula (I) (e.g., metformin, buformin, phenformin, etc.) is at least 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, or 30 days.

[0100] In some embodiments, the time period between the first and last dose of the multiple doses of the compound of formula (I) (e.g., metformin, buformin, phenformin, etc.) is 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, multiple months, at least 1 year, multiple years, at least 10 years, or decades. In some embodiments, the dose of the compound of formula (I) (e.g., metformin, buformin, phenformin, etc.) is administered indefinitely. In some embodiments, the dose of the compound of formula (I) (e.g., metformin, buformin, phenformin, etc.) is administered for the lifetime of the subject. In certain embodiments, the doses described herein are at least 500 mg, 600 mg, 650 mg, 750 mg, 700 mg, 800 mg, 825 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1500 mg, 2000 mg, 2500 mg, 3000 mg, 3500 mg, 4000 mg, 5000 mg, 8000 mg, 9000 mg, or 10,000 mg of a compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.).

[0101] In some embodiments, the time period between the first and last doses of multiple doses of a compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.) is based on the time period required to prevent accumulation of RAN protein in a subject. In some embodiments, the time period between the first and last doses of multiple doses of a compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.) is based on the time period required to reduce the level of RAN protein in a subject. In some embodiments, multiple doses of a compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.) are administered as a preventive treatment to reduce the level of RAN protein in a subject. The preventive treatment is, in some embodiments, long-term. In some embodiments, multiple doses of a compound represented by formula (I) (e.g., metformin, buformin, phenformin, etc.) are administered as a long-term therapeutic treatment to reduce the level of RAN protein in a subject.

[0102] In some embodiments, the subject has a microsatellite expansion mutation, including, but not limited to, mutations that cause the following: C9orf72 ALS or C9orf72 FTD, myotonic dystrophy type 1 (DM1) and myotonic dystrophy type 2 (DM2); spinocerebellar ataxia types 1, 2, 3, 6, 7, 8, 10, 12, 17, 31 and 36; spinal-bulbar muscular atrophy; dentatorubral-pallidoluysian atrophy (DRPLA); Huntington's disease (HD); fragile X tremor ataxia syndrome (FXTAS); Huntington's disease-related disorder type 2 (HDL2); fragile X syndrome (FXS); disorders associated with the 7p11.2 folate-sensitive fragile site FRA7A; disorders associated with the folate-sensitive fragile site 2q11 FRA2A; and fragile XE syndrome (FRAXE).

[0103] The dosage ranges as described herein provide guidance for administration of the provided pharmaceutical compositions to adults. For example, the amount administered to a child or adolescent can be determined by a physician or person skilled in the art and can be lower or the same as that administered to an adult. As described herein, a compound of formula (I) (e.g., metformin, buformin, phenformin, etc.) or a composition thereof can be administered in combination with one or more additional pharmaceutical agents (e.g., therapeutically and / or prophylactically active agents).

[0104] The compounds or compositions can be administered in combination with additional pharmaceutical agents that improve their activity (e.g., activity (e.g., potency and / or efficacy) in treating a disease in a subject in need thereof, preventing a disease in a subject in need thereof, inhibiting the activity of a protein kinase (e.g., a CDK) in a subject, biological sample, tissue, or cell), improve bioavailability, improve safety, reduce drug resistance, reduce and / or alter metabolism, inhibit excretion, and / or alter distribution within the subject biological sample, tissue, or cell.

[0105] It will also be understood that the treatments employed may achieve the desired effect on the same disorder and / or they may achieve different effects. In some embodiments, the pharmaceutical compositions described herein that include a compound described herein and an additional pharmaceutical agent exhibit a synergistic effect that is not present in a pharmaceutical composition that includes one of the compound and the additional pharmaceutical agent, but not both.

[0106] The compound of formula (I) (e.g., metformin, buformin, phenformin, etc.) or a composition thereof can be administered, for example, simultaneously with, prior to, or subsequent to one or more additional pharmaceutical agents useful as combination therapy. Pharmaceutical agents include therapeutically active agents. Pharmaceutical agents also include prophylactically active agents. Pharmaceutical agents include small organic molecules such as drug compounds (e.g., compounds approved for human or veterinary use by the U.S. Food and Drug Administration, as defined in the Code of Federal Regulations (CFR)), peptides, proteins, carbohydrates, monosaccharides, oligosaccharides, polysaccharides, nucleoproteins, mucoproteins, lipoproteins, synthetic polypeptides or proteins, small molecules linked to proteins, glycoproteins, steroids, nucleic acids, DNA, RNA, nucleotides, nucleosides, oligonucleotides, antisense oligonucleotides, lipids, hormones, vitamins, and cells.

[0107] In some embodiments, the additional pharmaceutical agent is a pharmaceutical agent useful for treating and / or preventing a disease (e.g., a neurological disease). Each additional pharmaceutical agent may be administered at a dose and / or time schedule determined for that pharmaceutical agent. The additional pharmaceutical agents may also be administered together in a single dose or separately in different doses, with each other and / or with the compounds or compositions described herein. The particular combination to be employed in the regimen will take into account the compatibility of the compounds described herein with the additional pharmaceutical agent(s) and / or the desired therapeutic and / or prophylactic effect to be achieved. In general, it is expected that the additional pharmaceutical agent(s) in the combination will be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels utilized in combination will be lower than the levels utilized individually.

[0108] Additional pharmaceutical agents include, but are not limited to, anti-proliferative agents, anti-cancer agents, anti-angiogenic agents, anti-inflammatory agents, immunosuppressants, antibacterial agents, anti-viral agents, cardiovascular agents, cholesterol-lowering agents, anti-diabetic agents, anti-allergy agents, contraceptives, analgesics, and combinations thereof. In some embodiments, additional pharmaceutical agents include, but are not limited to, cardiovascular agents, anti-diabetic agents, agents for treating and / or preventing neurological diseases. Additional pharmaceutical agents include, but are not limited to, anti-inflammatory agents or compounds (e.g., turmeric). In some embodiments, additional pharmaceutical agents are anti-RAN antibodies, such as anti-polyGA, anti-polyGP, anti-polyPA, anti-polyPR, anti-polyGR, anti-polyAla, anti-polySer, anti-polyLeu, anti-polyLPAC, anti-polyQAGR, and the like.

[0109] Kits (e.g., pharmaceutical packs) are also covered by the present disclosure. The kits provided may include a pharmaceutical composition or compound described herein and a container (e.g., a vial, an ampoule, a bottle, a syringe, and / or a dispenser package, or other suitable container). In some embodiments, the kits provided may further include a second container that optionally includes a pharmaceutical excipient for diluting or suspending the pharmaceutical composition or compound described herein. In some embodiments, the pharmaceutical composition or compound provided in the first container and the second container are mixed to form one unit dosage form.

[0110] Thus, in one aspect, a kit is provided that includes a first container containing a compound represented by formula (I) as described herein (e.g., metformin, buformin, phenformin, etc.) or a composition thereof. In some embodiments, the kit is useful for treating a neurological disease in a subject in need thereof. In some embodiments, the kit is useful for preventing a neurological disease in a subject in need thereof. In some embodiments, the kit is useful for reducing the level of one or more RAN proteins (e.g., reducing the expression of RAN proteins) in a subject, biological sample, tissue, or cell. In some embodiments, the kit is useful for reducing the accumulation of RAN proteins in a subject, biological sample, tissue, or cell. In some embodiments, the kit is useful for modulating (e.g., reducing or inhibiting) RAN protein translation in a subject, biological sample, tissue, or cell.

[0111] In some embodiments, the kit described herein further includes instructions for using the metformin or pharmaceutical composition thereof included in the kit. The kit described herein may also include information as required by regulatory agencies such as the U.S. Food and Drug Administration (FDA). In some embodiments, the information included in the kit is prescription information. In some embodiments, the kit and instructions provide for treating a disease (e.g., a neurological disease) in a subject in need thereof. In some embodiments, the kit and instructions provide for preventing a disease (e.g., a neurological disease) in a subject in need thereof.

[0112] In some embodiments, the kit and instructions provide for reducing the level of one or more RAN proteins in a subject, biological sample, tissue, or cell. In some embodiments, the kit and instructions provide for reducing the accumulation of RAN protein in a subject, biological sample, tissue, or cell. In some embodiments, the kit and instructions provide for modulating (e.g., reducing or inhibiting) RAN protein translation in a subject, biological sample, tissue, or cell. The kits described herein may include one or more additional pharmaceutical agents described herein as separate compositions.

[0113] In some embodiments, other modulators of eIF2, eIF2A, and / or PKR (eg, proteins, small molecules, nucleic acids, etc.) are formulated as pharmaceutical compositions as described above.

[0114] Methods of Treating Diseases and Disorders Associated with Ran Protein Translation or Accumulation - Patent application In some embodiments, the compositions and methods as described by the present disclosure are useful for reducing or inhibiting RAN protein translation or accumulation in a cell or a subject (e.g., a subject having a disorder or disease associated with RAN translation). In some embodiments, the cell is in vitro. In some embodiments, the subject is a mammalian subject. In some embodiments, the subject is a human subject. In some aspects, the disclosure provides methods of treating a disease associated with repeat non-ATG protein (RAN protein) translation by administering an effective amount of a eukaryotic initiation factor 2 (eIF2) modulating agent or an effective amount of a PKR modulating agent (e.g., a PKR inhibitor) to a subject expressing a repeat non-ATG protein (RAN protein).

[0115] In some embodiments, the eIF2 modulating agent is an inhibitor of PKR. In some embodiments, the inhibitor of PKR is represented by formula (I): [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof, wherein: R 1 is hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; and R 2 is hydrogen, an optionally substituted alkyl, or a nitrogen protecting group. In some embodiments, the compound represented by formula (I) is metformin, buformin, or phenformin.

[0116] In some embodiments, the disease associated with repeat non-ATG protein (RAN protein) translation is Huntington's disease (HD, HDL2), Fragile X syndrome (FRAXA), Spinal-bulbar muscular atrophy (SBMA), Dentatorubral-Pallidoluysian atrophy (DRPLA), Spinocerebellar ataxia 1 (SCA1), Spinocerebellar ataxia 2 (SCA2), Spinocerebellar ataxia 3 (SCA3), Spinocerebellar ataxia 6 (SCA6), Spinocerebellar ataxia 7 (SCA7), Spinocerebellar ataxia 8 (SCA9), Spinocerebellar ataxia 9 (SCA10), Spinocerebellar ataxia 10 (SCA11), Spinocerebellar ataxia 11 (SCA12), Spinocerebellar ataxia 12 (SCA13), Spinocerebellar ataxia 13 (SCA14), Spinocerebellar ataxia 14 (SCA15), Spinocerebellar ataxia 15 (SCA16), Spinocerebellar ataxia 16 (SCA17), Spinocerebellar ataxia 17 (SCA18), Spinocerebellar ataxia 18 (SCA19), Spinocerebellar ataxia 19 ... cerebellar ataxia 8 (SCA8), spinocerebellar ataxia 12 (SCA12) or spinocerebellar ataxia 17 (SCA17), amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia type 36 (SCA36), spinocerebellar ataxia type 29 (SCA29), spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuchs endothelial corneal dystrophy (e.g., CTG181).

[0117] As used herein, "effective amount" refers to the dosage of a therapeutic agent that is sufficient to provide medically desirable results, such as treatment or improvement of one or more signs or symptoms caused by a disease or disorder associated with RAN protein translation or accumulation (e.g., neurodegenerative disease).Effective amount varies with the age and health condition of the subject being treated, the severity of the disease or disorder in the subject (e.g., the amount of RAN protein accumulation, or the cytotoxicity caused by such accumulation), the duration of treatment, the nature of any concomitant therapy, the specific route of administration, and similar factors within the knowledge and expertise of medical practitioners.In some embodiments, effective amount is the amount of eIF2α inhibitor, eIF2A inhibitor, or PKR inhibitor that is sufficient to reduce the phosphorylation of eIF2α, the expression or activity of eIF2A, or any combination thereof.

[0118] In some embodiments, the method for treating a disease associated with repeat non-ATG protein (RAN protein) translation as described by the present disclosure further comprises administering one or more additional therapeutic agents to the subject.The identification and selection of suitable additional therapeutic agents are within the capabilities of those skilled in the art and depend on the disease that the subject suffers from.For example, in some embodiments, one or more therapeutic agents for Huntington's disease (e.g., tetrabenazine, amantadine, chlorpromazine, etc.), fragile X syndrome (e.g., selective serotonin reuptake inhibitors, carbamazepine, methylphenidate, trazodone, etc.), spinocerebellar ataxia (e.g., baclofen, riluzole, amantadine, varenicline, etc.), or amyotrophic lateral sclerosis (ALS) (e.g., riluzole, etc.), myotonic dystrophy type 1 (tideglobus, mexiletine, etc.) are administered to the subject.

[0119] In some embodiments, the additional therapeutic agent is an antibody that specifically binds to the RAN repeat expansion or specifically binds to a unique region of the RAN protein that is C-terminal to the repeat expansion. For example, in some embodiments, the antibody specifically binds to a poly-Ser RAN repeat expansion. In some embodiments, the antibody binds to the C-terminal region of a protein that contains a poly-Ser RAN repeat expansion. In some embodiments, the anti-RAN antibody binds to an intracellular RAN protein. In some embodiments, the anti-RAN antibody binds to an extracellular RAN protein.

[0120] Anti-RAN antibodies can be polyclonal or monoclonal. Typically, polyclonal antibodies are produced by inoculation into a suitable mammal, such as a mouse, rabbit or goat, and larger mammals are preferred because larger amounts of serum can often be collected. Typically, an antigen (e.g., an antigen containing a poly-Ser repeat region) is injected into the mammal. This induces B lymphocytes to produce IgG immunoglobulins specific to the antigen. The polyclonal IgG is purified from the serum of the mammal. Monoclonal antibodies are generally produced from a single cell line (e.g., a hybridoma cell line). In some embodiments, the anti-RAN antibody is purified (e.g., isolated from serum).

[0121] Numerous methods can be used to obtain anti-RAN antibodies. For example, antibodies can be produced using recombinant DNA methods. Monoclonal antibodies may also be produced by hybridoma production (see, for example, Kohler and Milstein (1975) Nature, 256: 495-499) in accordance with known methods. Hybridomas formed in this manner are then screened using standard methods, such as enzyme-linked immunosorbent assay (ELISA) and surface plasmon resonance (e.g., OCTET or BIACORE) analysis, to identify one or more hybridomas that produce an antibody that specifically binds to the designated antigen.

[0122] Any form of a specified antigen (e.g., a RAN protein) may be used as an immunogen, including recombinant antigens, naturally occurring forms, any variants or fragments thereof. One exemplary method of making an antigen involves screening a protein expression library, such as a phage or ribosome display library, that expresses the antigen or a fragment thereof (e.g., an scFV). Phage display has been described, for example, in Ladner et al., U.S. Patent No. 5,223,409; Smith (1985) Science 228:1315-1317; Clackson et al. (1991) Nature, 352: 624-628; Marks et al. (1991) J. Mol. Biol., 222: 581-597, WO92 / 18619; WO91 / 17271; WO92 / 20791; WO92 / 15679; WO93 / 01288; WO92 / 01047; WO92 / 09690; and WO90 / 02809.

[0123] Administration of the treatment can be accomplished by any method known in the art (see, e.g., Harrison's Principle of Internal Medicine, McGraw Hill Inc.). Administration can be local or systemic. Administration can be parenteral (e.g., intravenous, subcutaneous, or intradermal) or oral. Compositions for different routes of administration are well known in the art (see, e.g., Remington's Pharmaceutical Sciences by EW Martin). Dosage depends on the subject and the route of administration. Dosage can be determined by one skilled in the art.

[0124] Routes of administration include, but are not limited to, oral, parenteral, intravenous, intramuscular, intraperitoneal, intranasal, sublingual, intratracheal, inhalation, subcutaneous, ocular, vaginal, and rectal. Systemic routes include oral and parenteral. Several types of devices are commonly used for administration by inhalation. These types of devices include metered dose inhalers (MDIs), breath actuated MDIs, dry powder inhalers (DPIs), spacer / holding chambers combined with MDIs, and nebulizers.

[0125] In some embodiments, the treatment for the disease associated with RAN protein expression is administered to the central nervous system (CNS) of the subject in need thereof. As used herein, "central nervous system (CNS)" refers to all cells and tissues of the brain and spinal cord of a subject, including but not limited to neurons, glial cells, astrocytes, cerebrospinal fluid, etc. The mode of administering the therapeutic agent to the CNS of a subject includes direct injection into the brain (e.g., intracerebral injection, intraventricular injection, intraparenchymal injection, etc.), direct injection into the spinal cord of a subject (e.g., intrathecal injection, lumbar injection, etc.), or any combination thereof.

[0126] In some embodiments, the treatment as described by the present disclosure is administered to the subject systemically, for example, by intravenous injection. The therapeutic molecule that is administered systemically (e.g., eIF2 modulating agent, PKR inhibitor, etc.) can be modified in some embodiments to improve the delivery of the molecule to the CNS of the subject. Examples of modifications that improve the CNS delivery of therapeutic molecules include, but are not limited to, co-administration or conjugation with blood-brain barrier targeting agents (e.g., transferrin, melanotransferrin, low-density lipoprotein (LDL), angiopeps, RVG peptide, etc., as disclosed by Georgieva et al. Pharmaceuticals 6(4): 557-583 (2014)), co-administration with BBB disrupting agents (e.g., bradykinin), and physical disruption of the BBB prior to administration (e.g., by MRI-guided focused ultrasound), etc.

[0127] The eIF2 modulating agent can be delivered by any suitable manner known in the art. In some embodiments, the eIF2 modulating agent is delivered to a subject by a vector, such as a viral vector (e.g., an adenoviral vector, a recombinant adeno-associated viral vector (rAAV vector), a lentiviral vector, etc.) or a plasmid-based vector. In some aspects, the present disclosure is based on the discovery that, in some embodiments, administration of a recombinant adeno-associated virus (rAAV) comprising a transgene encoding an eIF2α modulating agent to a subject (e.g., a subject having a disease characterized by RAN protein translation and accumulation) reduces RAN protein translation and RAN protein accumulation in the subject.

[0128] In some embodiments, the recombinant rAAV particle comprises a nucleic acid vector, such as a single-stranded (ss) or self-complementary (sc) AAV nucleic acid vector. In some embodiments, the nucleic acid vector comprises a transgene encoding an eIF2 modulating agent as described herein, and one or more regions comprising an inverted terminal repeat (ITR) sequence (e.g., a wild-type ITR sequence or a modified ITR sequence) flanking the expression construct. In some embodiments, the nucleic acid is encapsidated by a viral capsid. In some embodiments, the transgene is operably linked to a promoter, e.g., a constitutive promoter or an inducible promoter. In some embodiments, the promoter is a tissue-specific (e.g., a CNS-specific) promoter.

[0129] Thus, in some embodiments, the rAAV particle comprises a viral capsid and a nucleic acid vector as described herein encapsidated by the viral capsid. In some embodiments, the viral capsid comprises 60 capsid protein subunits, including VP1, VP2 and VP3. In some embodiments, the VP1, VP2 and VP3 subunits are present in the capsid at a ratio of approximately 1:1:10, respectively.

[0130] The ITR sequences of the nucleic acids or nucleic acid vectors described herein can be derived from any AAV serotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) or can be derived from more than one serotype. In some embodiments of the nucleic acids or nucleic acid vectors provided herein, the ITR sequences are derived from AAV2. ITR sequences, and plasmids containing ITR sequences, are known in the art and commercially available (e.g., products and services available from Vector Biolabs, Philadelphia, PA; Cellbiolabs, San Diego, CA; Agilent Technologies, Santa Clara, Ca; and Addgene, Cambridge, MA; and "Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein." Kessler PD, Podsakoff GM, Chen X, McQuiston SA, Colosi PC, Matelis LA, Kurtzman GJ, Byrne BJ. Proc Natl Acad Sci US A. 1996 Nov 26;93(24):14082-7; and Curtis A. Machida. "Methods in Molecular Medicine TM." "Viral Vectors for Gene Therapy Methods and Protocols." 10.1385 / 1-59259-304-6:201 (C) Humana Press Inc. 2003. Chapter 10, "Targeted Integration by Adeno-Associated Virus." Matthew D. Weitzman, Samuel M. Young Jr., Toni Cathomen and Richard Jude Samulski; see U.S. Patent Nos. 5,139,941 and 5,962,313, all of which are incorporated herein by reference.).

[0131] Exemplary AAV2 ITR sequences are shown below: TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 14) In some embodiments, the expression construct is 7 kilobases or less, 6 kilobases or less, 5 kilobases or less, 4 kilobases or less, or 3 kilobases or less in size, hi some embodiments, the expression construct is between 4 and 7 kilobases in size.

[0132] The rAAV particles can be of any AAV serotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10), including any derivative (including non-naturally occurring variants of a serotype) or pseudotype. In some embodiments, the rAAV particles are rAAV9 particles. Additional AAV serotypes and derivatives / pseudotypes, and methods for producing such derivatives / pseudotypes, are known in the art (see, e.g., Mol Ther. 2012 Apr;20(4):699-708. doi: 10.1038 / mt.2011.287. Epub 2012 Jan 24. "The AAV vector toolkit: poised at the clinical crossroads." Asokan A1, Schaffer DV, Samulski RJ.). These and other aspects of the present application are illustrated by the following non-limiting examples. EXAMPLES

[0133] example Example 1. Protein kinase R (PKR) regulates RAN translation of CAG, CCTG, and G4C2 expansions through the eIF2a-P pathway. Diagrams of the CAG, CCTG and GGGCC repeat expansion constructs used to test the effect of PKR on repeat-associated non-ATG (RAN) translation are shown in Figure 1A. Briefly, the constructs have 6x stop codon cassettes (e.g., two stops in each reading frame, upstream of the repeat expansion and a C-terminal epitope tag). Diagrams of PKR vectors expressing wild type (PKR-WT), a dominant-negative K296R mutant form of PKR (PKR-K296R), or the C-terminal-only domain (PKR-CT) are shown in Figure 1B.

[0134] HEK293T cells were transfected with RAN protein expression and PKR expression constructs. Immunoblot analysis suggested that PKR-WT increased polyAla RAN protein from the CAG-expanded construct, PKR-CT lacking the RRM motif had no effect on polyAla RAN levels, and dominant-negative mutant K296R PKR decreased polyAla RAN levels (Figure 1C). Immunoblot also suggested that PKR increased the level of eIF2α-P, PKR-CT had no effect, and PKR-K296R decreased the steady-state level of eIF2α-P.

[0135] Immunoblot analysis suggested that PKR-WT increased poly-Leu-Pro-Ala-Cys (poly-LPAC) RAN protein from CCTG-extended constructs, PKR-CT had no effect on LPAC RAN levels, and dominant-negative mutant K296R PKR decreased poly-LPAC RAN levels (Figure 1D). It was also observed that PKR-CT had no effect on, and PKR-K296R decreased, the steady-state levels of eIF2α-P. Immunoblot analysis suggested that PKR-WT, PKR-CT, had no effect on, and mutant K296R PKR decreased poly-GPRAN protein levels, and that PKR increased, PKR-CT had no effect on, and PKR-K296R decreased the steady-state levels of eIF2α-P (Figure 1E).

[0136] eIF2α-P increases RAN protein levels in HEK293T cells. The effect of eIF2α phosphorylation on RAN protein translation was investigated. Protein blots of HEK293T cells co-transfected with plasmids expressing WT or mutant eIF2α and CAG expansion (CAGexp) show increased polyAla RAN protein levels in cells overexpressing the phosphorylation-mimetic eIF2α-S51D mutation compared to eIF2α-WT or nonphosphorylatable eIF2α-S51A (Figure 2A). It was observed that polyAla, polyAla and LPAC RAN proteins expressed from the CAG, CTG and CCTG repeat expansions, respectively, were decreased in the presence of a PKR inhibitor (TARBP2), which reduces the levels of eIF2α-P (Figure 2B). It was also observed that polyAla RAN protein levels were decreased in the presence of ISIRB, which inhibits the downstream effects of eIF2α-P (Figure 2C).

[0137] Inhibition of the PKR pathway reduces RAN protein assembly and ameliorates behavioral phenotypes in C9-500 BAC transgenic mice. A schematic of the AAV2 / 9 construct used for AAV injection into the BAC transgenic mouse model of C9orf72 ALS / FTD containing 500 G4C2 repeats (C9-500 BAC) is shown in Figure 3 A. Briefly, following intracerebroventricular (ICV) injection on postnatal day 1 (P1) with AAV2 / 9 viruses expressing either EGFP or a dominant negative form of PKR(K296R), animals were sacrificed for analysis at 3 months of age.

[0138] Representative immunohistochemical (IHC) staining of GA RAN protein in sections of retrosplenial cortex from C9-500 BAC mice (Figure 3B, left). Quantification of GA RAN protein aggregates was also performed (Figure 3B, right). Analysis was performed in a blinded fashion. The data suggested that animals treated with dominant-negative mutant PKR(K296R) had fewer GA RAN protein aggregates compared to age-matched EGFP control animals. Open field analysis was also performed (Figure 3C), suggesting that C9-500 BAC animals treated with dominant-negative PKR(K296R) showed reduced center time, a phenotype indicative of anxiety-like behavior, compared to EGFP control animals.

[0139] The alternative eIF2A initiation factor increases RAN translation. eIF2A is an alternative eukaryotic translation initiation factor, and in some embodiments, can be used as an alternative to eIF2α under certain conditions. Typically, phosphorylation of eIF2α prevents its use in transcription initiation, and RAN translation increases under conditions that favor eIF2α-P. Therefore, we investigated whether eIF2A can act as an alternative initiation factor for RAN translation. The constructs used to express RAN protein are shown (Figure 4). Co-transfection with repeat expansion constructs increases RAN protein levels in combination with overexpression of eIF2A, suggesting that eIF2A can act as an alternative eukaryotic initiation factor for RAN across a variety of diseases that cause expansion mutations. These data also identify eIF2A as a novel drug target for modulating RAN protein levels.

[0140] eIF2α phosphorylation, which downregulates global translation, leads to increased RAN protein levels. In general, four major stress pathways (PKR, heme-regulated inhibitor (HRI), general control nonderepressible (GCN), and protein kinase RNA-like endoplasmic reticulum kinase (PERK)) lead to eIF2α phosphorylation (eIF2α-P) and the repression of global protein synthesis. Surprisingly, it was observed that conditions that favor eIF2α-P lead to the upregulation of RAN translation across multiple types of repeats.

[0141] In some embodiments, when the disease that causes repeat expansion mutation occurs, double-stranded RNA (dsRNA) that forms hairpins and / or dsRNA from the expression of sense and antisense transcripts are produced.In some embodiments, these mutant dsRNAs cause PKR pathway to chronically hyperactivate.In some embodiments, the chronic activation of PKR pathway causes eIF2α phosphorylation, the use of alternative initiation factor eIF2A, and increased RAN translation.

[0142] As described in the above examples, it has been observed that RAN translation is upregulated by PKR overexpression and substantially reduced by overexpression of a dominant negative form of PKR that blocks eIF2α-P from the PKR pathway. It has also been observed that RAN protein levels increase with increasing levels of eIF2α phosphorylation and decrease with inhibitors of eIF2α phosphorylation, including TARDBP2. It has also been observed that alternative initiation factor eIF2A increases RAN protein levels. In some embodiments, this alternative eukaryotic initiation factor (e.g., eIF2A) can be used under stress conditions where eIF2α phosphorylation prevents canonical translation initiation at eIF2α. In some embodiments, eIF2A does not require an AUG initiation codon, allowing translation initiation at multiple types of non-AUG initiation codons that are characteristic of RAN translation.

[0143] In summary, stress pathways have been identified as important drivers of RAN translation and as druggable targets that can be used to modulate RAN translation in diseases including, but not limited to, C9orf72 ALS / FTD (G4C2 and G2C4 repeats), myotonic dystrophy type 1, Huntington's disease and multiple forms of spinocerebellar ataxia (CAG and CTG repeats), and myotonic dystrophy type 2 (CCTG and CAGG repeats). Data suggest that inhibition of the PKR or eIF2α pathway reduces RAN protein accumulation. eIF2A has also been identified as an alternative eukaryotic initiation factor. Figure 5 shows a schematic showing eIF2α phosphorylation, which downregulates global translation, leading to increased RAN protein levels.

[0144] Example 2: Metformin inhibits RNA translation through the PKR pathway and improves phenotypes in the C9orf72 mouse model This example describes the activation of PKR pathway by structured RAN positive repeat-expanded RNA.In some embodiments, activation leads to increased phospho-eIF2α (p-eIF2α) and increased RAN protein level.It has been observed that inhibition of PKR reduces RAN protein level in cell culture and C9orf72 ALS / FTD BAC transgenic mouse model (C9-BAC).It has also been observed that metformin (and some metformin derivatives, such as buformin and phenformin) inhibits phospho-PKR activation, reduces RAN protein level, and improves phenotype in C9-BAC mice.

[0145] material and method Cell culture and transfection HEK293T cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and incubated at 37° C. in a humidified environment containing 5% CO DNA transfection was performed using Lipofectamine 2000 Reagent (Invitrogen) according to the manufacturer's instructions.

[0146] AAV construction and preparation An AAV vector expressing PKR under the control of the cytomegalovirus enhance / chicken beta actin (CAG) promoter, woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), and bovine growth hormone polyA was produced by transfection into HEK293T cells in 5% CO. Cells were cotransfected with the AAV helper plasmid pDP8.ape to produce the recombinant adeno-associated virus (rAAV) vector rAAV2 / 8.

[0147] Intracerebroventricular (ICV) injection Neonates were injected within 0–12 h of life. Naive neonates were covered in aluminum foil and completely surrounded by ice for 3–4 min, which resulted in a drop in body temperature to <0°C. Pups were considered fully cryo-anesthetized when all movement ceased and skin color changed from pink to purple. Using a 10 μl syringe (beveled at 30°), 2 μl of virus (10 viral genomes / ml) was slowly injected into the ventricle. After injection, pups were allowed to fully recover on a warming blanket and returned to their home cage.

[0148] Immunofluorescence staining The intracellular distribution of macromolecular proteins was evaluated in transfected HEK293T cells by immunofluorescence staining. Cells were plated on 8-well cell culture chambers and transfected with plasmids the next day. 48 hours after transfection, cells were fixed with 4% paraformaldehyde (PFA) in PBS for 30 minutes and permeabilized with 0.5% triton X-100 in PBS for 15 minutes on ice. Cells were blocked with 1% normal goat serum (NGS) in PBS for 30 minutes. After blocking, cells were incubated for 1 hour at room temperature in blocking solution containing primary antibodies for rabbit anti-Myc (Abcam), mouse anti-HA (Covance), mouse anti-Flag (Sigma), rabbit α-GR and rabbit α-GR-CT at a dilution of 1:400. Slides were washed three times in PBS and incubated in blocking solution containing goat anti-rabbit conjugated to Cy3 (Jackson ImmunoResearch, PA) and goat anti-mouse conjugated to Alexa Fluor 488 (Invitrogen) secondary antibodies at a dilution of 1:200 for 1 hour at room temperature.

[0149] Slides were washed three times in PBS and mounted with mounting medium containing DAPI (Invitrogen). Immunofluorescence staining of patient hippocampal tissue was performed on 6 μm fresh frozen sections. A similar protocol was used as for transfected cells, except that NGS was used as blocking buffer and higher dilutions of antibodies (mouse α-GP 1:1000 and rabbit α-GP-CT 1:5000) were used.

[0150] Western blotting Transfected cells in each well of a 6-well tissue culture plate were rinsed with PBS and lysed in 300 μL of RIPA buffer with protease inhibitor cocktail for 45 min on ice. DNA was sheared through passage through a 21-gauge needle. Cell lysates were centrifuged at 16,000×g for 15 min at 4° C., and the supernatant was collected. Protein concentrations of cell lysates were determined using protein assay reagent (Bio-Rad). 20 μg of protein was separated in a 4-12% NuPAGE Bis-Tris gel (Invitrogen) and transferred to a nitrocellulose membrane (Amersham). Membranes were blocked in 5% milk powder in PBS containing 0.05% Tween-20 (PBS-T) and probed with anti-Flag (1:2000), anti-Myc (1:1000), anti-HA (1:1000), or rabbit polyclonal antibodies (1:1000) in blocking solution. After incubation of the membranes with anti-rabbit or anti-mouse HRP-conjugated secondary antibodies (Amersham), bands were visualized by ECL plus Western Blotting Detection System (Amersham).

[0151] Sequential extraction of the patient's frontal cortex dissection tissue was performed as follows: the tissue was homogenized in PBS containing 1% Triton-X100, 15 mM MgCl2, 0.2 mg / ml DNase I and protease inhibitor cocktail and centrifuged at 16,000 x g for 15 min at 4 ° C. The supernatant was collected. The pellet was resuspended in 2% SDS, incubated at room temperature for 1 h, then centrifuged at 16,000 x g for 15 min at 4 ° C. The supernatant was collected and the 2% SDS-insoluble pellet was resuspended in 8% SDS, 62.5 mM Tris-HCl pH 6.8, 10% glycerol and 20% 2-mercaptoethanol for protein blotting.

[0152] Activation of PKR by elongating RNA induces RNA translation Repeat expansions have been observed to undergo RAN translation. CUG repeats have been observed to activate PKR. Therefore, we tested the ability of other RAN positive repeat expansions to activate PKR and the role of PKR on RAN translation. We observed that HEK293T cells expressing CAG, CCUG, CAGG and GGGGCC expanded RNAs (Figure 6A) had increased levels of phospho-PKR at sites (T446 and T451) that are important for PKR activation (Figure 6B).

[0153] We next tested the effect of PKR overexpression and inhibition on RAN protein accumulation across several types of repeat expansions. Plasmids expressing CAG, CCUG, CAGG or GGGGCC repeat expansions were co-transfected with constructs expressing either full-length PKR, a dominant-negative form of the enzyme (PKR-K296R), or an inactive PKR lacking the binding domain (PKR-Cter) (Figure 6C). For cells expressing CAGEXP, PKR-WT overexpression led to increased p-PKR and p-eIF2α, and increased RAN polyAla protein levels. In contrast, expression of the dominant-negative PKR-K296R mutant reduced polyAla RAN protein levels. Expression of the inactive form of the enzyme had no effect (Figure 6D). PolyGln reading frames containing AUG start codons are not affected by PKR (Figure 7A).

[0154] RAN poly-LPAC, poly-QAGR and poly-GP proteins expressed across CCUG, CAGG and GGGGCC repeats were increased by PKR-WT overexpression and decreased by PKR-K296R (Figures 6E-6G and 7B). These data suggested that several types of microsatellite expansion mutations activate the PKR pathway and that PKR regulates RAN protein accumulation.

[0155] Upregulation of RAN translation through PKR-mediated phosphorylation of eIF2α. PKR was inhibited by overexpressing TAR RNA binding protein (also called TRBP or TARBP2). Cotransfection experiments suggest that TARBP2 overexpression reduces the levels of RAN polyAla expressed from CAG and CUG-expanded RNAs and polyLPAC ​​expressed from CCUG transcripts (Figures 8A-8B). In some embodiments, the ternary complex [eIF2α-GTP / Met-tRNA i Met Formation of the .alpha.-p-eIF2α is required for AUG-initiated translation. In some embodiments, phosphorylation of eIF2α is an important regulatory mechanism that reduces global translation under conditions of stress. Consistent with the role of PKR in the integrated stress response pathway, we observed that PKR inhibition by TARBP2 reduces p-eIF2α (FIG. 8B). These data suggest that regulation of RAN translation is upregulated through the eIF2α pathway by elongation-induced PKR activation.

[0156] To directly test whether the eIF2α pathway affects RAN translation, HEK293T cells were cotransfected with CAG-expanded constructs expressing the WT, phosphomimetic (S51D), or nonphosphorylatable S51A mutant forms of eIF2α. Expression of the phosphomimetic form of eIF2α (eIF2α-S51D) was observed to increase steady-state levels of polyAla RAN protein, whereas the nonphosphorylatable eIF2α-S51A mutant had no effect compared to cells expressing WT eIF2α (Figure 8A). ISRIB has been identified as a potent inhibitor of the ISR pathway that reduces the effect of eIF2α phosphorylation and blocks the downstream effects of all eIF2α kinases, including PKR. Here, we observed that ISRIB reduced polyAla RAN protein levels in HEK293T transfected with expanded CAG and PKR-WT constructs (Figure 8C).

[0157] To independently test the role of PKR in RAN translation, we used CRISPR / Cas9 to generate HEK293T PKR knockout cell line.In some embodiments, PKR KO cells show reduced levels of polyAla expressed from CAG expansion (e.g., associated with DM1, SCA1, 2, 3, 6, 7, 8, 17, DRPLA, HD, HDL2, SBMA, etc.), and CCUG and CAGG repeat expansion RNA (e.g., associated with myotonic dystrophy type 2).Transient transfection with CAG, CCTG, CAGG expansion constructs shows dramatic reduction of polyAla, polyLPAC ​​and polyQAGR protein (Figure 9). Taken together, these results suggest that, in some embodiments, PKR activation, including activation by repeat-expanded RNA, increases PKR protein levels through the eIF2α phosphorylation pathway.

[0158] Effect of PKR on RAN translation in the C9-500 mouse model. rAAV-mediated delivery of dominant-negative PKR-K296R, or EGFP as a control, was performed using intracerebroventricular (ICV) injection at P0 in C9orf72 ALS / FTD BAC transgenic mice (C9-BAC) and non-transgenic (NT) littermate controls. A schematic depiction of each construct is shown in FIG. 10A. The four groups of animals (EGFP / C9, EGFP / NT, PKR-K296R / C9 and PKR-K296R / NT) were up to 3 months of age. Genotyping was performed by both PCR and Southern blot analysis, which suggested that the C9-treated and control groups had comparable repeat expansion sizes. Immunohistochemistry (IHC) using a monoclonal GA antibody suggested that C9 mice treated with PKR-K296R had reduced numbers of GA aggregates in the retrosplenial cortex compared to C9 EGFP controls (Figures 10B-10C).

[0159] Similarly, soluble GP levels detected by mesoscale detection (MSD) assay were reduced in brain lysates from C9 PKR-K296R treated animals compared to C9 EGFP controls. PKR-K296R treated animals showed improvement in the open field test with increased center time compared to C9 EGFP control animals (Figure 10D). In addition, DigiGait analysis suggested that of the 15 parameters that differed between untreated C9-500 and NT EGFP injected controls at 12 weeks, 9 of these parameters were improved in C9 PKR-K296R treated animals. In addition, animals from the C9 PKR-K296R treated group showed similar DigiGait performance with only 2 of the 15 parameters significantly different between the C9 PKR-K296R and NT treated groups.

[0160] Metformin reduces RAN translation and attenuates repeat-induced PKR activation In some embodiments, metformin was observed to reduce RAN protein levels in cells expressing CAG, CCUG or G4C2-expanded RNA (Figure 11A). Metformin inhibits RAN protein similarly to that of PKR-K296R, suggesting that metformin alleviates the PKR activation induced by repeat-expanded RNA. Transient transfection of the expanded constructs was performed with or without metformin. Protein blots suggest that metformin reduces PKR phosphorylation at T446 and T451, which are sites that have been observed to be required for PKR activation (Figure 11B).

[0161] In addition, metformin and the related drugs phenformin and buformin mediate similar dose-dependent inhibition of G4C2 repeat expansion-induced p-PKR and RAN polyGP levels (FIG. 12). In summary, metformin reduces the levels of several types of RAN proteins in mammalian cells, and PKR was identified as a metformin target that inhibits PKR activation and eIF2α phosphorylation.

[0162] Metformin improves neuropathological and behavioral phenotypes in the C9-500 mouse model C9orf72, C9-500 BAC and NT mice were treated with or without metformin (5 mg / ml) in the drinking water for 3 months. In group A animals, treatment began at 2 months of age, prior to the onset of overt behavioral or pathological phenotypes. In group B, a smaller cohort of animals (n=8 / group) was treated beginning at 6 months of age, an age when behavioral phenotypes become evident.

[0163] A schematic depicting the treatment regimen is shown in Figure 11C. DigiGait analysis of group A mice at 5 months identified eight DigiGait parameters that differed between untreated C9 and NT cohorts. Six of these parameters improved in C9 metformin-treated mice compared to the C9 water-treated group (Figure 11E-11G). Similarly, metformin-treated C9 mice in group A showed increased center time from the open field test compared to untreated C9 mice. These data suggest that this anxiety-like behavior was ameliorated by metformin treatment (Figure 11G).

[0164] IHC staining of group A animals for glial fibrillary acidic protein (GFAP), a marker of neuroinflammation previously reported in our C9-BAC mice, was significantly reduced in C9 metformin-treated compared to untreated C9 animals (Figure 11E). In addition, C9 metformin-treated animals showed reduced numbers of GA aggregates in the retrosplenial cortex compared to C9 controls in cohorts where treatment began at presymptomatic (8 weeks, group A) or symptomatic age (6 months, group B) (Figure 11D). In C9 metformin-treated animals, reduced soluble GP levels were observed compared to C9 controls in the older group B but not in the younger group A treatment cohorts (Figures 11H-11I).

[0165] Taken together, the data suggest that metformin reduces RAN protein levels in vitro and in vivo, and metformin treatment improves behavior and reduces neuroinflammation in C9 BAC transgenic mice.In some embodiments, the data described in this example are consistent with the model that repeat-expanded RNA leads to chronic activation of the PKR pathway, a condition that leads to increased levels of p-eIF2a, reduced global protein synthesis and upregulation of RAN translation (Figure 11J).

[0166] Example 3: Metformin was evaluated for its effect on RAN protein translation in HEK293T cells transfected with constructs containing CAG, CCTG or GGGGCC repeat expansion motifs. Transfected HEK293T cells were treated with metformin. Protein blots were performed on protein lysates from HEK293T cells transfected with various repeat expansion constructs shown in Figure 13A. In Figure 13B, the lane labeled KMQ shows the following: RAN poly-Ser-Flag, RAN poly-Ala-HA, ATG-initiated polyGln-Myc. In Figure 13B, the lane labeled KMQ has an ATG encoding a methionine located immediately 5' to the CAG repeat expansion and within the polyGln reading frame.

[0167] The lanes labeled KKQ indicate the KKQ vector containing a CAG stretch without an AUG start codon, and the following: RAN polySer-Flag, RAN polyAla-HA, RAN polyGln-Myc. These constructs contain epitope tags incorporated into the C-terminal regions of the ATG-initiated polyGln and non-ATG-initiated RAN proteins (poly-Gln, poly-Leu-Pro-Ala-Cys, and poly-Gly-Pro) that are expressed across these repeat stretches. The lanes labeled CCTG express the following RAN proteins: RAN polyLPAC-Flag, RAN polyLPAC-HA, RAN polyLPAC-Myc.

[0168] The lanes labeled G4C2 are designed to detect the following RAN proteins: RAN polyGP-Flag, RAN polyGR-HA, RAN polyGA-Myc. The protein blot in Figure 13B shows reduced RAN protein levels in all three reading frames following RAN proteins: poly-LPAC (poly-leucine-proline-alanine-cysteine), poly-Ala, and poly-GP (polyglycine-proline). Figure 13B shows that metformin inhibits RAN protein accumulation in cells transfected with the exemplary repeat expansion constructs.

[0169] Metformin was evaluated for its effect on steady-state levels of glycine-proline (GP)RAN protein detected in vivo in proteins extracted from peripheral blood of C9ORF72 expansion positive study subjects before and after treatment with C9ORF72. These levels were measured in human study subjects before and after administration of metformin (500 mg or 1000 mg metformin hydrochloride extended release tablets per day) at different doses as prescribed by the subjects' physician.

[0170] A dose-dependent reduction in glycine-proline (GP) RAN protein levels compared to pre-treatment levels was observed in blood samples taken from a single human subject with a C9ORF72 repeat expansion. GP levels were measured in protein lysates from leukocytes isolated from peripheral blood at multiple time points between 10 and 30 days after metformin treatment at 500 or 1000 mg / day. * p<0.05, *** p<0.001 after correction for multiple comparisons. Figure 14 shows that metformin reduces the levels of RAN protein produced by expression of C9ORF72 in vivo.

[0171] Other Aspects All features disclosed herein may be combined in any combination. Each feature disclosed herein may be replaced by alternative features serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features. From the above description, those skilled in the art can easily ascertain the essential features of the present disclosure, and can make various changes and modifications to the disclosure to adapt it to various uses and conditions without departing from the spirit and scope thereof. Accordingly, other embodiments are within the scope of the claims.

[0172] Equivalent While several inventive aspects have been described and illustrated herein, those of ordinary skill in the art will readily conceive of various other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein. Each such variation and / or modification is deemed to be within the scope of the inventive aspects described herein. More generally, those of ordinary skill in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the particular application(s) for which the teachings of the invention are being used. Those of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive aspects described herein. Thus, the foregoing embodiments are presented by way of example only, and it will be understood that within the scope of the appended claims and their equivalents, the inventive aspects may be practiced otherwise than as specifically described and claimed. Inventive aspects of the present disclosure relate to each individual feature, system, article, material, kit, and / or method described herein. Furthermore, any combination of two or more of such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is also included within the inventive scope of the present disclosure.

[0173] All definitions and those used herein should be understood to govern any dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms. All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, and may in some cases include the entire document. The indefinite articles "a" and "an," as used in the specification and claims, unless clearly indicated otherwise, should be understood to mean "at least one."

[0174] The phrase "and / or" as used in the specification and claims should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and / or" should be construed in the same manner, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the "and / or" clause, whether or not related to the specifically identified elements. Thus, as a non-limiting example, a reference to "A and / or B" when used with open-ended language such as "comprising" may refer in one embodiment to only A (optionally including elements other than B), in another embodiment to only B (optionally including elements other than A), in yet another embodiment to both A and B (optionally including other elements), etc.

[0175] As used herein and in the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as inclusive, i.e., including at least one, but also including a plurality of the elements of the number or list, and optionally including additional items not included in the list. Only terms expressly indicated to the contrary, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one number or list of elements. In general, the term "or" as used herein will only be interpreted to indicate exclusive alternatives (i.e., "one or the other, but not both") when preceded by a term of exclusivity, such as "either," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0176] As used in the specification and claims, the phrase "at least one" in reference to a list of one or more elements should be understood to mean at least one element selected from any one or more elements in the list of elements, but not necessarily including at least one and every element specifically listed in the list of elements, and not excluding any combination of elements in the list of elements. This definition also allows for elements other than the elements specifically identified in the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified, may optionally be present. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently, "at least one of A and / or B") can refer, in one embodiment, to at least one (optionally including more than one) A (wherein B is absent (and optionally including elements other than B)), in another embodiment, to at least one (optionally including more than one) B (wherein A is absent (and optionally including elements other than A)), in yet another embodiment, to at least one (optionally including more than one) A and at least one (optionally including more than one) B (and optionally including other elements), etc.

[0177] It is also to be understood that, unless expressly stated to the contrary, in any method of the claims that includes more than one step or act, the order of the method steps or acts is not necessarily limited to the order in which the method steps or acts are recited. In the claims and the above specification, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like, are to be understood to be open-ended, i.e., to mean inclusive but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" are intended to be closed or semi-closed transitional phrases, respectively, as set forth in the U.S. Patent Office Patent Examining Procedures, Section 2111.03. Embodiments described in this document using open-ended transitional phrases (e.g., "comprising") are also contemplated in alternative embodiments as "consisting of" and "consisting essentially of" the features described by the open-ended transitional phrase. For example, if the disclosure describes "a composition comprising A and B," the disclosure also contemplates the alternative embodiments "a composition consisting of A and B" and "a composition consisting essentially of A and B."

Claims

1. 1. A pharmaceutical composition comprising a eukaryotic initiation factor 2-alpha (eIF2α) inhibitor for use in a method of inhibiting repeat non-ATG protein (RAN protein) translation, the method comprising contacting a cell expressing a repeat non-ATG protein (RAN protein) with an effective amount of the eIF2α inhibitor, wherein the RAN protein is poly-alanine, poly-leucine, poly-serine, poly-cysteine, poly-glutamine, poly-Leu-Pro-Ala-Cys, poly-Gln-Ala-Gly-Arg, poly-Gly-Pro, poly-Gly-Arg, poly-Gly-Ala, or poly-Pro-Ala, poly-Pro-Arg, poly-Gly-Pro RAN protein.

2. The pharmaceutical composition for use according to claim 1 , wherein the cells are located in a subject.

3. A pharmaceutical composition comprising a eukaryotic initiation factor 2-alpha (eIF2α) inhibitor for use in a method for treating a disease associated with repeat non-ATG protein (RAN protein) translation, the method comprising administering an effective amount of an eIF2α inhibitor to a subject expressing a RAN protein.

4. The disease is fragile X syndrome (FRAXA), spinobulbar muscular atrophy (SBMA), dentatorubral-pallidoluysian atrophy (DRPLA), spinocerebellar ataxia type 1 (SCA1), spinocerebellar ataxia type 2 (SCA2), spinocerebellar ataxia type 3 (SCA3), spinocerebellar ataxia type 6 (SCA6), spinocerebellar ataxia type 7 (SCA7), spinocerebellar ataxia type 8 (SCA8), spinocerebellar ataxia type 12 (SCA12) or spinocerebellar ataxia type 17 (SCA17), amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia type 36 (SCA36), spinocerebellar ataxia type 29 (SCA29), spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), 4. The pharmaceutical composition of claim 3, wherein the corneal dystrophy is DM2, or Fuchs' corneal dystrophy (e.g., CTG181).

5. The pharmaceutical composition for use according to any one of claims 2 to 4, wherein the subject is a mammalian subject.

6. The pharmaceutical composition for use according to claim 5, wherein the mammalian subject is a human subject.

7. RAN protein is associated with fragile X syndrome (FRAXA), spinal-bulbar muscular atrophy (SBMA), dentatorubral-pallidoluysian atrophy (DRPLA), spinocerebellar ataxia 1 (SCA1), spinocerebellar ataxia 2 (SCA2), spinocerebellar ataxia 3 (SCA3), spinocerebellar ataxia 6 (SCA6), spinocerebellar ataxia 7 (SCA7), spinocerebellar ataxia 8 (SCA8), spinocerebellar ataxia 12 (SCA12) or spinocerebellar ataxia 17 (SCA17), 7. A pharmaceutical composition for use according to any one of claims 1 to 6, wherein the pharmaceutical composition is encoded by a gene associated with amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia type 36 (SCA36), spinocerebellar ataxia type 29 (SCA29), spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuchs endothelial corneal dystrophy (e.g., CTG181).

8. The pharmaceutical composition for use according to any one of claims 1 to 7, wherein the eIF2α inhibitor inhibits phosphorylation of eIF2α.

9. The pharmaceutical composition for use according to any one of claims 1 to 8, wherein the eIF2α inhibitor is a protein or a nucleic acid.

10. The pharmaceutical composition for use according to any one of claims 1 to 9, wherein the eIF2α inhibitor is an inhibitory nucleic acid.

11. The pharmaceutical composition for use according to claim 10, wherein the inhibitory nucleic acid is a dsRNA, siRNA, shRNA, mi-RNA, artificial miRNA (ami-RNA), antisense oligonucleotide (ASO), or RNA aptamer.

12. The pharmaceutical composition for use according to any one of claims 1 to 11, wherein the eIF2α inhibitor is delivered by a viral vector.

13. The pharmaceutical composition for use according to claim 12, wherein the viral vector is a recombinant adeno-associated virus (rAAV).

14. 14. The pharmaceutical composition for use according to claim 13, wherein the rAAV comprises an AAV9 capsid protein or a variant thereof.

15. The pharmaceutical composition for use according to any one of claims 1 to 8, wherein the eIF2α inhibitor is a small molecule.

16. The eIF2α inhibitor is represented by the formula (I): 【Chemistry 1】 or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof, wherein: R1 is hydrogen, optionally substituted alkyl, or a nitrogen protecting group; and R2 is hydrogen, optionally substituted alkyl, or a nitrogen protecting group.

17. 4. The compound of formula: 【Chemistry 2】 (metformin), 【Chemistry 3】 (Buformin), 【Chemistry 4】 (phenformin), or a pharma- ceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, derivative, or prodrug thereof.

Images