Method for testing for sensitivity of chemotherapy against colorectal cancer

Abstract

To provide a new method for testing for sensitivity of chemotherapy against colorectal cancer using, as an indicator, a methylation site that has not been conventionally known to be an indicator of responsiveness to chemotherapy of colorectal cancer.SOLUTION: The present invention provides a method for testing for sensitivity of chemotherapy against colorectal cancer, the method using, as an indicator, methylation in at least one site selected from a group consisting of CpG sites comprised in regions (i) to (xvi) in DNA collected from a colorectal cancer patient (the regions (i) to (xvi) are as described herein).SELECTED DRAWING: None

Description

[Technical field]

[0001] [CROSS REFERENCE TO RELATED APPLICATIONS] This application claims priority based on Japanese Patent Application No. 2019-103299, filed on May 31, 2019, the entire disclosure of which is incorporated herein by reference. The present invention relates to a method for testing sensitivity to drug therapy for colorectal cancer. [Background technology]

[0002] Colorectal cancer is a general term for carcinomas that occur in the large intestine (colon, rectum, and anus). Colorectal cancer is one of the cancers with the highest incidence and mortality rates, and research into its treatment is ongoing. As part of efforts to research cancer treatment, "personalized medicine" is being considered to maximize the effectiveness of treatment and minimize side effects.

[0003] For example, Patent Document 1 discloses 24 genes represented by the following Target IDs: cg01791410, cg01802453, cg02484469, cg02916312, cg03839709, cg05218346, cg07005523, cg01068327, cg07258916, cg01360792, cg09767602, cg11092616, cg12646649, cg13261931, cg16041660, cg16958716, cg1 A method has been described in which 1188046, cg18412834, cg20012008, cg20265733, cg20339230, cg21787291, cg24792289, and cg27628784 are used as marker genes, and whether or not bases at specific positions in these marker genes are methylated is used as an indicator to predict the responsiveness of colorectal cancer patients to cancer chemotherapy using an anti-EGFR antibody (Reference 1, Example 8, etc.). [Prior art documents] [Patent documents]

[0004] [Patent Document 1] WO2016 / 060278A1 Summary of the Invention [Problem to be solved by the invention]

[0005] An objective of the present invention is to provide a new method for testing the sensitivity of colorectal cancer to drug therapy, which uses as an indicator a methylation site that was not previously known to be an indicator of responsiveness to drug therapy for colorectal cancer. [Means for solving the problem]

[0006] Under such circumstances, the present inventors have conducted intensive research and found that sensitivity to drug therapy for colorectal cancer can be efficiently tested by using methylation at at least one site selected from the group consisting of CpG sites contained in the regions (i) to (xvi) described below as an index. The present invention is based on such a novel finding.

[0007] Thus, the present invention provides the following: Item 1. A method for testing sensitivity to drug therapy for colorectal cancer, using as an indicator methylation at at least one site selected from the group consisting of CpG sites contained in the following regions (i) to (xvi) in DNA collected from a colorectal cancer patient: Region (i) chromosome 2, 207307150-207309004 Region (ii) chromosome 2, 241758282-241760510 Region (iii) chromosome 3, 150802997-150805168 Region (iv) chromosome 4, 141347993-141348489 Region (v) chromosome 4, 186048714-186050048 Region (vi) chromosome 5, 17216679-17219240 Region (vii) chromosome 6, 37663982-37664539 Region (viii) chromosome 6, 39281183-39282332 Region (ix) chromosome 7, 42273390-42277951 Region (x) chromosome 10, 13039715-13043422 Region (xi) chromosome 10, 81664401-81665076 Region (xii) chromosome 10, 88126287-88127189 Region (xiii) chromosome 11, 61595807-61596627 Region (xiv) chromosome 14, 23820337-23822266 Region (xv) chromosome 17, 44895317-44896749 Region (xvi) chromosome 19, region 39520228 to 39523159.

[0008] Item 2. Chromosome 2, positions 207307150, 207307490, 207307544, 207307622, ​​207307732, 207308004, 207308087, 207308244, 207308375, 207308829, 207309003, 241758282, 241758399, 241758805, 241758901, 241759279, 241759414, 241760025, 241760164, 241760190, 241760509, Chromosome 3 positions 150802997, 150803295, 150803307, 150803666, 150803669, 150804058, 150804063, 150804313, 150804490, 150804696, 150804719, 150805167, Chromosome 4, positions 141347993, 141348043, 141348167, 141348307, 141348488, 186048714, 186048907, 186049687, 186049926, 186050047, Chromosome 5 at positions 17216679, 17216922, 17217093, 17217877, 17218089, 17218278, 17218308, 17218547, 17218778, 17219020, 17219128, 17219226, and 17219239; Chromosome 6: 37663982, 37664451, 37664538, 39281183, 39281421, 39281450, 39281541, 39281694, 39281885, 39282164, 39282316, 39282331, Chromosome 7: 42273390, 42275601, 42275813, 42275870, 42275872, 42276004, 42276814, 42276816, 42276819, 42276848, 42276881, 42276890, 42276941, 42276981, 42277044, 42277066, 42277071, 42277347, 42277375, 42277394, 42277410, 42277807, 42277950, Chromosome 10 positions 13039715, 13041989, 13043313, 13043421, 81664401, 81664567, 81664583, 81664698, 81664955, 81665075, 88126287, 88126291, 88126299, 88126306, 88126853, 88127188, Chromosome 11, positions 61595807, 61595956, 61596068, 61596307, 61596333, 61596405, and 61596626; Chromosome 14, positions 23820337, 23821149, 23821229, 23821435, 23821445, 23821570, 23821596, 23821902, 23822017, and 23822265; Chromosome 17, positions 44895317, 44896017, 44896080, 44896147, 44896162, 44896166, 44896168, 44896212, 44896223, 44896424, 44896748, Item 2. The method according to Item 1, comprising detecting methylation at at least one site selected from the group consisting of bases at positions 39520228, 39521931, 39522418, 39522548, 39522747, 39522944, 39523083, and 39523158 of chromosome 19, and using the detection result as an index of sensitivity to drug therapy for colorectal cancer.

[0009] Item 3. The method according to Item 1 or 2, wherein methylation at at least one site selected from the group consisting of CpG sites contained in the following regions (i') to (iv'), regions (viii') to (x'), and regions (xii') to (xvi') is used as an indicator: Region (i') chromosome 2, 207307490-207308376 Region (ii') chromosome 2, 241758805-241760510 Region (iii') chromosome 3, 150802997-150804720 Region (iv') chromosome 4, 141348167-141348308 Region (viii') chromosome 6, 39281541-39282165 Region (ix') chromosome 7, 42275870-42276817 Region (x') chromosome 10, 13041989-13043422 Region (xii') chromosome 10, region 88126287-88126307 Region (xiii') chromosome 11, 61595807-61596334 Region (xiv') chromosome 14, 23821596-23822266 Region (xv') chromosome 17, 44895317-44896425 Region (xvi') Region from 39520228 to 39523084 of chromosome 19.

[0010] Item 4. Chromosome 2, positions 207308141, 207308149, 207308153, 207308172, 207308177, 207308181, 207308185, 207308244, 207308247, 207308267, 2417588 85th, 241758889th, 241758896th, 241758901st, 241758919th, 241758922nd, 241758931st, 241758936th, 241758940th, 241759003rd, 241759005th, 241759009th, Chromosome 3 at positions 150804417, 150804420, 150804474, 150804479, 150804486, 150804490, 150804496, 150804504, and 150804507; Chromosome 4: 141348224, 141348232, 141348272, 141348282, 141348289, 141348307, 141348318, 141348324, 186049623, 186049636, 186049659, 186049670, 186049685, 186049687, 186049689, 186049705, Chromosome 5, positions 17216904, 17216916, 17216922, 17216940, 17216949, 17216952, 17217003, 17217011, and 17217017; Chromosome 6: 37664352, 37664366, 37664419, 37664424, 37664451, 37664460, 39281692, 39281694, 39281723, 39281729, 39281735, 39281738, 39281797, 39281806, 39281808, 39281813, Chromosome 7: 42276764, 42276767, 42276769, 42276783, 42276810, 42276814, 42276816, 42276819, 42276825, 42276852, 42276862, 42276874, Chromosome 10: 13043231, 13043247, 13043285, 13043288, 13043313, 13043321, 13043333, 81664567, 81664573, 81664583, 81664598, 81664600, 8 1664606th, 81664614th, 81664636th, 81664656th, 88126243rd, 88126250th, 88126259th, 88126285th, 88126287th, 88126291st, 88126299th, 88126306th, 88126310th, Chromosome 11, positions 61595796, 61595807, 61595815, 61595818, 61595820, 61595829, 61595843, and 61595852; Chromosome 14, positions 23822015, 23822017, 23822043, 23822054, 23822073, 23822075, and 23822079; Chromosome 17, positions 44896314, 44896316, 44896324, 44896386, 44896390, 44896401, 44896424, 44896443, and 44896450; Item 2. The method according to Item 1, comprising detecting methylation at at least one site selected from the group consisting of bases at positions 39522493, 39522510, 39522533, 39522537, 39522548, 39522550, 39522552, 39522582, 39522587, 39522591, and 39522608 of chromosome 19, and using the detection result as an index of sensitivity to drug therapy for colorectal cancer.

[0011] Item 5. The method according to any one of items 1 to 4, Chromosome 2, region 207308134-207308268 Chromosome 2, region 241758885-241759011 Chromosome 3, region 150804402-150804508 Chromosome 4, region 141348215-141348329 Chromosome 4, region 186049616-186049706 Chromosome 5, region 17216901-17217025 Chromosome 6, region 37664344-37664472 Chromosome 6, region 39281671-39281814 Chromosome 7, region 42276764-42276875 Chromosome 10, region 13043227-13043334 Chromosome 10, region 81664566-81664662 Chromosome 10, region 88126243-88126334 Chromosome 11, region 61595787-61595864 Chromosome 14, region 23821996-23822092 Chromosome 17, region 44896309-44896451 Chromosome 19, region 39522493-39522609 The method uses, as an indicator, methylation at at least one site selected from the group consisting of CpG sites included in

[0012] Item 6. The method according to any one of Items 1 to 5, wherein the CpG site is located within a region to which at least one oligonucleotide having a sequence selected from the group consisting of SEQ ID NOs: 1 to 48 hybridizes in DNA obtained by bisulfite treatment of DNA containing the methylated CpG site.

[0013] Item 7. The method according to any one of items 1 to 6, (1) detecting a plurality of CpG sites contained in at least two of the regions (i) to (xvi) and measuring the frequency of methylation of the detected CpG sites; (2) determining that each region measured in the above step (1) is a highly methylated region when the frequency of methylation is equal to or higher than a predetermined value; (3) determining that the colorectal cancer is insensitive to drug therapy when a predetermined proportion or more of the regions measured in the above step (1) are determined to be hypermethylated regions in step (2); A method comprising:

[0014] Item 8. The method according to any one of items 1 to 6, (1) detecting a plurality of CpG sites contained in at least two of the regions (i) to (xvi) and measuring the frequency of methylation of the detected CpG sites; (2) determining that each region measured in the above step (1) is a highly methylated region when the frequency of methylation is equal to or higher than a predetermined value; (3) determining that a region having a methylation level less than a predetermined ratio among the regions measured in the above step (1) is a hypermethylated region in the step (2), the region being determined to be sensitive to a drug therapy for colorectal cancer. A method comprising:

[0015] Item 9. The method according to Item 7 or 8, wherein the measurement of the frequency of methylation in each region in step (1) is carried out by real-time PCR, and the region is determined to be a highly methylated region when a ΔCt value, which is the difference between the Ct value measured by real-time PCR and the Ct value of a control reaction, is less than a predetermined value.

[0016] Item 10. The method according to any one of Items 7 to 9, wherein in step (1), methylation frequencies are measured for at least eight of the regions (i) to (xvi).

[0017] Item 11. The method according to any one of Items 1 to 10, wherein the DNA collected from the colon cancer patient is prepared from colon tissue, blood, serum, plasma, feces, intestinal lavage fluid, or enema lavage fluid collected from the colon cancer patient.

[0018] Item 12. The method according to any one of Items 1 to 11, wherein the drug therapy for colorectal cancer uses an anti-EGFR antibody.

[0019] Item 13. The method according to item 12, wherein the anti-EGFR antibody is at least one selected from the group consisting of cetuximab and panitumumab.

[0020] Item 14. A kit for obtaining information that can be an indicator of the presence or absence of sensitivity to drug therapy for colorectal cancer, comprising a primer set for analyzing methylation at at least one site selected from the group consisting of CpG sites contained in the following regions (i) to (xvi) in DNA collected from a colorectal cancer patient: Region (i) chromosome 2, 207307150-207309004 Region (ii) chromosome 2, 241758282-241760510 Region (iii) chromosome 3, 150802997-150805168 Region (iv) chromosome 4, 141347993-141348489 Region (v) chromosome 4, 186048714-186050048 Region (vi) chromosome 5, 17216679-17219240 Region (vii) chromosome 6, 37663982-37664539 Region (viii) chromosome 6, 39281183-39282332 Region (ix) chromosome 7, 42273390-42277951 Region (x) chromosome 10, 13039715-13043422 Region (xi) chromosome 10, 81664401-81665076 Region (xii) chromosome 10, 88126287-88127189 Region (xiii) chromosome 11, 61595807-61596627 Region (xiv) chromosome 14, 23820337-23822266 Region (xv) chromosome 17, 44895317-44896749 Region (xvi) chromosome 19, region 39520228 to 39523159.

[0021] Item 15. The kit according to Item 14, wherein the primer set is a primer set for analyzing methylation of CpG sites by at least one method selected from the group consisting of methylation-specific PCR, sequencing, and mass spectrometry.

[0022] Item 16. The kit according to Item 14 or 15, comprising a primer set capable of amplifying at least one of the following regions after bisulfite treatment when a CpG site contained in the region is methylated: Region including chromosome 2, 207308134 to 207308267 Region including chromosome 2, 241758885 to 241759011 Region including 150804402-150804508 of chromosome 3 Region including 141348215-141348329 of chromosome 4 Region including 186049616-186049705 of chromosome 4 Region including 17216901-17217025 of chromosome 5 Region including 37664344-37664472 of chromosome 6 Region including 39281671-39281814 of chromosome 6 Region including 42276765-42276874 of chromosome 7 Region including 13043227-13043334 of chromosome 10 Region including 81664566-81664662 of chromosome 10 Region including 88126244-88126334 of chromosome 10 Region including 61595787-61595864 of chromosome 11 Region including 23821996-23822092 of chromosome 14 Region including 44896309-44896450 of chromosome 17 A region including chromosome 19 positions 39522494 to 39522608.

[0023] Item 17. Use of a primer set for analyzing methylation at at least one site selected from the group consisting of CpG sites contained in the following regions (i) to (xvi) in DNA collected from a patient with colorectal cancer, for producing a kit for obtaining information that can be an indicator of the presence or absence of sensitivity to drug therapy for colorectal cancer: Region (i) chromosome 2, 207307150-207309004 Region (ii) chromosome 2, 241758282-241760510 Region (iii) chromosome 3, 150802997-150805168 Region (iv) chromosome 4, 141347993-141348489 Region (v) chromosome 4, 186048714-186050048 Region (vi) chromosome 5, 17216679-17219240 Region (vii) chromosome 6, 37663982-37664539 Region (viii) chromosome 6, 39281183-39282332 Region (ix) chromosome 7, 42273390-42277951 Region (x) chromosome 10, 13039715-13043422 Region (xi) chromosome 10, 81664401-81665076 Region (xii) chromosome 10, 88126287-88127189 Region (xiii) chromosome 11, 61595807-61596627 Region (xiv) chromosome 14, 23820337-23822266 Region (xv) chromosome 17, 44895317-44896749 Region (xvi) chromosome 19, region 39520228 to 39523159.

[0024] Item 18. The use according to Item 17, wherein the primer set is a primer set for analyzing methylation of CpG sites by at least one method selected from the group consisting of methylation-specific PCR, sequencing, and mass spectrometry.

[0025] Item 19. The use according to Item 17 or 18, wherein the primer set comprises a primer set capable of amplifying at least one of the following regions after bisulfite treatment when a CpG site contained in the region is methylated: Region including chromosome 2, 207308134 to 207308267 Region including chromosome 2, 241758885 to 241759011 Region including 150804402-150804508 of chromosome 3 Region including 141348215-141348329 of chromosome 4 Region including 186049616-186049705 of chromosome 4 Region including 17216901-17217025 of chromosome 5 Region including 37664344-37664472 of chromosome 6 Region including 39281671-39281814 of chromosome 6 Region including 42276765-42276874 of chromosome 7 Region including 13043227-13043334 of chromosome 10 Region including 81664566-81664662 of chromosome 10 Region including 88126244-88126334 of chromosome 10 Region including 61595787-61595864 of chromosome 11 Region including 23821996-23822092 of chromosome 14 Region including 44896309-44896450 of chromosome 17 A region including chromosome 19 positions 39522494 to 39522608. Effect of the Invention

[0026] According to the present invention, a new method for testing sensitivity to drug therapy for colorectal cancer can be provided, which uses as an indicator a methylation site that was not previously known to be an indicator of responsiveness to drug therapy for colorectal cancer. [Brief description of the drawings]

[0027] [Figure 1] 1 shows a graph summarizing progression-free survival (PFS) in each group in Example 2. [Diagram 2] 1 shows a graph summarizing progression-free survival (PFS) in each group in Example 3. [Diagram 3] 1 shows a graph summarizing the progression-free survival (PFS) of each group in 83 cases of progressive and recurrent colorectal cancer with wild-type KRAS gene in Example 4. [Figure 4] 1 shows a graph summarizing progression-free survival (PFS) in each group in 65 cases in which the RAS gene is wild-type in Example 4. [Diagram 5] 1 shows the results of DNA methylation analysis around Target ID cg07319626 in an example. [Figure 6] 1 shows the results of DNA methylation analysis around Target ID cg02610058 in an example. [Figure 7] 1 shows the results of DNA methylation analysis around Target ID cg13803214 in an example. [Figure 8] 1 shows the results of DNA methylation analysis around Target ID cg14235416 in an example. [Figure 9] 1 shows the results of DNA methylation analysis around Target ID cg24642320 in an example. [Figure 10] 1 shows the results of DNA methylation analysis around Target ID cg25203704 in an example. [Figure 11] 1 shows the results of DNA methylation analysis around Target ID cg26129310 in an example. [Figure 12] 1 shows the results of DNA methylation analysis around Target ID cg18960642 in an example. [Figure 13] 1 shows the results of DNA methylation analysis around Target ID cg07413609 in an example. [Figure 14] 1 shows the results of DNA methylation analysis around Target ID cg22738219 in an example. [Figure 15] 1 shows the results of DNA methylation analysis around Target ID cg20629468 in an example. [Figure 16] 1 shows the results of DNA methylation analysis around Target ID cg20649951 in an example. [Figure 17] 1 shows the results of DNA methylation analysis around Target ID cg25303599 in an example. [Figure 18] 1 shows the results of DNA methylation analysis around Target ID cg01557297 in an example. [Figure 19] 1 shows the results of DNA methylation analysis around Target ID cg12379948 in an example. [Figure 20] 1 shows the results of DNA methylation analysis around Target ID cg14730085 in an example. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] (1. Methods for testing sensitivity to chemotherapy for colon cancer) The present invention provides a method for testing sensitivity to drug therapy for colorectal cancer, using as an indicator methylation at at least one site selected from the group consisting of CpG sites contained in the following regions (i) to (xvi) in DNA collected from a colorectal cancer patient: Region (i) chromosome 2, 207307150 to 207309004 (preferably, 207307490 to 207308376) Region (ii) chromosome 2, 241758282 to 241760510 (preferably, 241758805 to 241760510) Region (iii) chromosome 3, 150802997-150805168 (preferably, 150802997-150804720) Region (iv) chromosome 4, 141347993 to 141348489 (preferably, 141348167 to 141348308) Region (v) chromosome 4, 186048714-186050048 Region (vi) chromosome 5, 17216679-17219240 Region (vii) chromosome 6, 37663982-37664539 Region (viii) chromosome 6, 39281183 to 39282332 (preferably, 39281541 to 39282165) Region (ix) chromosome 7, 42273390 to 42277951 (preferably, 42275870 to 42276817) Region (x) chromosome 10, 13039715-13043422 (preferably, 13041989-13043422) Region (xi) chromosome 10, 81664401-81665076 Region (xii) chromosome 10, 88126287 to 88127189 (preferably, 88126287 to 88126307) Region (xiii) chromosome 11, 61595807 to 61596627 (preferably, 61595807 to 61596334) Region (xiv) chromosome 14, 23820337 to 23822266 (preferably, 23821596 to 23822266) Region (xv) chromosome 17, 44895317 to 44896749 (preferably, 44895317 to 44896425) Region (xvi) A region of chromosome 19, from 39520228 to 39523159 (preferably, from 39520228 to 39523084).

[0029] The testing method of the present invention is carried out in vitro.

[0030] (1.1. Explanation of terms) In the present invention, the subject of measurement is DNA collected from a colon cancer patient. In the present invention, colon cancer refers to carcinoma occurring in the large intestine (colon (including cecum) and rectum), including carcinoma occurring in the anal canal. The subject of the present invention is humans. In the present invention, colon cancer patients include not only people who are suffering from colon cancer, but also people who are suspected of having the disease and need to be examined for their response to cancer chemotherapy. In addition, in the present invention, colon cancer patients also include people who have already had colon cancer removed by surgery.

[0031] In the present invention, DNA is extracted from a sample collected from the colon cancer patient. The sample from which DNA is extracted is not particularly limited, but may be, for example, colon tissue, blood, serum, plasma, feces, intestinal lavage fluid, enema lavage fluid, etc., collected from the colon cancer patient. The method of extracting DNA from these samples is also not particularly limited, and may be performed using or based on a known method. For example, it may be performed using a commercially available kit such as EZ DNA Methylation-GOLD QIAamp Kit (ZYMO RESEARCH), QIAamp DNA Micro Kit (QIAGEN), NucleoSpinR Tissue (TAKARA), etc.

[0032] In the present invention, the drug therapy for colorectal cancer is not particularly limited, and examples thereof include chemotherapy, therapy using molecular targeted drugs, and combinations thereof. The drugs used in chemotherapy are not particularly limited, and examples thereof include oxaliplatin, irinotecan, fluorouracil, trifluridine-tipiracil hydrochloride, etc. The molecular targeted drugs are also not particularly limited, and examples thereof include anti-EGFR antibodies, anti-VEGF antibodies, oral multikinase inhibitors, etc.

[0033] In the present invention, the term "anti-EGFR antibody" refers to an antibody specific to EGFR (epidermal growth factor receptor) or an immunologically active fragment thereof. Examples of anti-EGFR antibodies include, but are not limited to, cetuximab, panitumumab, etc.

[0034] In the present invention, sensitivity to chemotherapy for colorectal cancer means the sensitivity of a patient to cancer chemotherapy as described above, and is expressed as sensitivity when cancer chemotherapy is effective and resistance when it is not effective.

[0035] DNA methylation can usually occur at the 5th carbon atom of the pyrimidine ring of cytosine or the 6th nitrogen atom of the purine ring of adenine that constitutes DNA. In somatic tissues of adult mammals, DNA methylation typically occurs easily at CpG sites (dinucleotide sites where cytosine and guanine are adjacent to each other). In the present invention, when each region on DNA is indicated as "regions Y to Z of chromosome X", the reference sequence is "hg19". When the base sequence of DNA in a sample of a cancer patient to be examined involves addition, substitution and / or deletion of a base sequence compared to the base sequence recorded in the reference sequence, the Target ID and the position of the base refer to the position corresponding to the position in the human genome sequence recorded in the above "hg19", taking into account the addition, substitution and / or deletion. In the present invention, "detection of methylation of the Yth base of chromosome X" includes not only the case where the Yth base of chromosome X is cytosine and methylation of the cytosine is detected, but also the case where the Yth base of chromosome X is guanine and methylation of the corresponding cytosine in the complementary strand is detected. In the present invention, "detection of methylation" means confirmation of the presence or absence of methylation of cytosine at a certain position, unless otherwise specified.

[0036] (1.2. Methods for detecting methylation and measuring methylation frequency) The method for detecting methylation of a CpG site is not limited, and examples thereof include a method for calculating a β value using a bead array described later, and a method for determining a ΔCt value using real-time PCR. In the present invention, the frequency of methylation can be used as an index of methylation. In the present invention, the method for measuring the frequency of methylation of a CpG site contained in a predetermined region is not limited, and examples thereof include a method for detecting methylation at a predetermined position in the region by calculating a β value using a bead array described later, and calculating the frequency of methylation from the detection result, and a method for measuring the frequency by real-time PCR using a ΔCt value as an index of the frequency of methylation, and the method using real-time PCR is preferred.

[0037] When detecting methylation of CpG sites by calculating β values ​​using a bead array, for example, methylation can be detected using a method using a bead array (Infinium (registered trademark) HumanMethylation450 BeadChip or Infinium methylationEPIC BeadChip) manufactured by Illumina. In this method, methylated cytosine is distinguished from unmethylated cytosine by converting unmethylated cytosine in DNA to uracil by bisulfite treatment. Then, after hybridization of two probes immobilized on beads, a methylation probe (M type) and a unmethylation probe (U type) specific to each site, a single base extension reaction is performed using labeled ddNTP, and the ratio of methylation and unmethylation is calculated from the fluorescence intensity signal. This makes it possible to easily perform comprehensive DNA methylation analysis. When using such a method, the frequency of methylation can be measured using, for example, the β value. Specifically, the β value is an index of the ratio of methylation (methylation / methylation+unmethylation) and is calculated by the following formula. β value=(maximum fluorescence value of methyl detection probe) / (maximum fluorescence value of non-methyl detection probe+maximum fluorescence value of methyl detection probe+100). In the present invention, the reference value for the β value can be set appropriately, but for example, a value greater than 0.4 is preferably regarded as being highly methylated, and a value greater than 0.3 is more preferably regarded as being highly methylated.

[0038] In another preferred embodiment of the present invention, real-time PCR can be used. Specifically, real-time PCR (methylation-specific PCR) is performed using a forward primer, a reverse primer, and / or a probe specific to a methylated DNA sequence. By bisulfite treatment, cytosine in unmethylated DNA is converted to uracil, and the sequence differs from that of the forward primer and reverse primer specific to the methylated DNA sequence. Therefore, PCR amplification does not occur, and only methylated DNA is amplified by PCR.

[0039] A probe is used to detect PCR amplification products. In a typical embodiment, a probe labeled with a fluorescent substance and a quencher at both ends can be used. Before the reaction, the generation of fluorescence is suppressed by the quencher, but when the probe is decomposed by the activity of DNA polymerase during the PCR reaction, the fluorescent substance is released and emits fluorescence. A fluorescent signal generated by the decomposition of the probe is detected, and a cycle threshold (Ct) value, which is the number of cycles when the fluorescence intensity reaches a certain amount, is calculated. In methylation-specific PCR, the probe hybridizes to the methylated DNA sequence, and then is decomposed and emits light. The Ct value can be obtained by detecting this fluorescent signal. On the other hand, since the probe does not hybridize to the non-methylated DNA sequence, the fluorescent signal due to the decomposition of the probe is not detected, and the Ct value becomes very large or cannot be obtained. Usually, the Ct value is also affected by the quantity and quality of the sample DNA, so that real-time PCR of a control region is performed simultaneously in the same reaction to correct for the influence. In that case, preferably, the control primers and probes are designed to amplify and detect a region different from the region to be detected for DNA methylation. More preferably, the control primer is designed so that it does not contain a CpG site in the region to be amplified. Therefore, the control region can be amplified regardless of the presence or absence of methylation. The difference between the Ct value of the control reaction and the Ct value of the methylation detection reaction is calculated as the ΔCt value, and the results can be judged according to the ΔCt value. The ΔCt value is large for unmethylated DNA and small for methylated DNA.

[0040] In this embodiment, the measurement of the frequency of methylation in each of the regions (i) to (xvi) can be performed, for example, by the following method. First, when all the CpG sites to be detected are methylated, a primer and probe set are designed so that the range including the CpG site can be amplified and detected by PCR after bisulfite treatment. A control region is also set, real-time PCR is performed, and a ΔCt value is calculated. When ΔCt is small, the frequency of methylation is high, and when ΔCt is large, the frequency of methylation is low. Therefore, when ΔCt is less than a predetermined value Tb, the region can be determined as a high methylation region. In addition, the ΔCt value can be calculated by the above method, and when ΔCt is equal to or greater than a predetermined value Tb, the region can be determined as a low methylation region. In the present invention, the reference value Tb of the ΔCt value can be appropriately set, for example, in the range of 3≦Tb≦7, preferably 3.5≦Tb≦5, more preferably 3.5≦Tb≦4.5, and particularly preferably Tb=4. More specifically, for example, a ΔCt value of 6 or less is preferably considered to be hypermethylated, and a value less than 4 is more preferably considered to be hypermethylated. When using real-time PCR, the base length of the region amplified by the primer set can be appropriately set, for example, in the range of 75 to 200 bases, preferably 90 to 160 bases, and more preferably 100 to 150 bases. The number of CpG sites contained in the region to be amplified can be one or more (for example, 1 or more, preferably 3 or more, more preferably 5 or more, more preferably 8 or more, more preferably 10 or more, more preferably 13 or more, and even more preferably 15 or more).The method of setting the region to be amplified is not particularly limited, and examples of the method include the following: (i-1) to (i-11), (ii-1) to (ii-10), (iii-1) to (iii-12), (iv-1) to (iv-5), (v-1) to (v-5), (vi-1) to (vi-13), (vii-1) to (vii-3), (viii-1) to (viii-9), (ix-1) to (ix-23), (x-1) to (x-4), (xi-1) to (xi-6), (xii-1) to (xii-23), (xii-2) to (xii-3), (xii-2) to (xii-4), (xii-2) to (xii-5), (xii-3) to (xii-6), (xii-3) to (xii-7), (xii-4) to (xii-8), (xii-5) to (xii-9), (xii-6) to (xii-9), (xii-1) to (xii-10), (xii-1) to (xii-23), (xii-1) to (xii-3), (xii-1) to (xii-4), (xii-1) to (xii-5), (xii-1) to (xii-6), (xii-1) to (xii-7), (xii-1) to (xii-8), (xii-1) to (xii-9), (xii-1) to (xii-10), (xii-1) to (xii-11), (xii-1) to (xii-12), (xii-1) to (xii-13), (xii-1) to (xii-14), (xii-1) to (xii-15), (xii-1) to (xii-16), (xii-1) to (xii-17), (xii-1) to ( The structure may be set to include one or more locations (for example, one or more locations, preferably three or more locations, more preferably five or more locations, more preferably eight or more locations, more preferably ten or more locations, more preferably thirteen or more locations, and even more preferably fifteen or more locations) selected from the group consisting of (xii-6), (xiii-1) to (xiii-7), (xiv-1) to (xiv-10), (xv-1) to (xv-11), and (xvi-1) to (xvi-8).

[0041] In another typical embodiment, the method of the present invention includes a method using the frequency of methylation at at least one site selected from the group consisting of CPG sites contained in the regions (i) to (xvi) as an index. In this embodiment, the method of the present invention includes a step of measuring the frequency of methylation at at least one site selected from the group consisting of CPG sites contained in the regions (i) to (xvi). The method of measuring the frequency of methylation in each of the regions (i) to (xvi) is not particularly limited, and for example, a method of detecting methylation of a CPG site at a predetermined position in each region as a representative CPG site of the region can be mentioned. Here, the "methylation frequency" is an index showing the proportion of methylated (or unmethylated) cytosines. For example, it can be expressed as a percentage. In the present invention, the methylation frequency in a CPG site can be rephrased as the methylation frequency of the bases constituting the CPG site. In one embodiment, the frequency of methylation is calculated by dividing the number of cytosines (including cytosines in the complementary strand corresponding to glycines in the CPG sites of the reference sequence) contained in the CPG sites to be detected in the region by the number of methylated cytosines (or the number of unmethylated cytosines). Even if the number of CPG sites to be detected in the region is 1, the frequency of methylation can be calculated. In this case, the frequency of methylation is represented as 0%, 50%, or 100%.

[0042] In this embodiment, when the ratio of the number of regions determined to be hypermethylated regions to the number of regions to be measured among the regions (i) to (xvi) is equal to or greater than the reference value Tc, it can be determined that the patient is not susceptible to drug therapy for colorectal cancer. For example, the reference value Tc can be appropriately set within the range of 0.2≦Tc, preferably 0.2≦Tc≦0.8, more preferably 0.3≦Tc≦0.7, and even more preferably 0.4≦Tc≦0.6. More specifically, it can be set to, for example, Tc=0.5.

[0043] In another embodiment of the present invention, for example, when measuring the frequency of methylation in the region (i), the frequency of methylation in the region (i) can be measured by detecting the methylation of a representative CpG site rather than detecting the methylation of all CpG sites contained in the region. For example, the frequency of methylation in the region (i) can be measured by detecting the methylation of at least one base (preferably 2 or more, more preferably 6 or more, more preferably 8 or more, and even more preferably 11 bases) selected from the group consisting of the following (i-1) to (i-11): (i-1) chromosome 2, base 207307150 (i-2) chromosome 2, base 207307490 (i-3) chromosome 2, base 207307544 (i-4) chromosome 2, base 207307622 (i-5) chromosome 2, base 207307732 (i-6) chromosome 2, 207308004th base (i-7) chromosome 2, base 207308087 (i-8) chromosome 2, base 207308244 (i-9) chromosome 2, base 207308375 (i-10) chromosome 2, base 207308829 (i-11) Base number 207309003 on chromosome 2. In particular, it is preferable to detect methylation at least at (i-8) among the above base positions. The method for detecting methylation is not limited, but examples include a method for calculating a β value using a bead array described later, and a method for calculating a ΔCt value using real-time PCR, and the like. The method for calculating a β value using a bead array is preferable. In this embodiment, when detecting methylation at one of (i-1) to (i-11), the position where the detection is performed is considered to be a representative position in the region (i), and when the base at the position is methylated (for example, when the β value is a predetermined value or more, when the ΔCt value is a predetermined value or less, etc.), the region (i) can be determined as a high methylation region, and when not, the region (i) can be determined as a low methylation region. Furthermore, in this embodiment, when detecting methylation at two or more of (i-1) to (i-11), the positions are considered to be representative positions in region (i), and when a predetermined percentage or more (e.g., more than half, more than 60%, more than 70%, etc.) of the bases at those positions are methylated (e.g., when the β value is a predetermined value or more, when the ΔCt value is a predetermined value or less, etc.), region (i) can be determined to be a highly methylated region, and when this is not the case, region (i) can be determined to be a hypomethylated region.

[0044] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (ii), the frequency of methylation in the region (ii) can be measured by detecting the methylation of at least one base at a position (preferably two or more positions, more preferably six or more positions, more preferably seven or more positions, and even more preferably ten positions) selected from the group consisting of the following (ii-1) to (ii-10): (ii-1) chromosome 2, base 241758282 (ii-2) chromosome 2, base 241758399 (ii-3) chromosome 2, base 241758805 (ii-4) chromosome 2, base 241758901 (ii-5) chromosome 2, base 241759279 (ii-6) chromosome 2, base 241759414 (ii-7) chromosome 2, base 241760025 (ii-8) chromosome 2, base 241760164 (ii-9) chromosome 2, base 241760190 (ii-10) Base 241760509 on chromosome 2. In particular, it is preferable to detect methylation at least in (ii-4) of the above base positions. In such an embodiment, the method of detecting methylation and the circumstances in which region (ii) is considered to be a highly methylated region and the circumstances in which region (ii) is considered to be a low methylated region are the same as those described above for region (i).

[0045] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (iii), the frequency of methylation in the region (iii) can be measured by detecting the methylation of at least one base at a position (preferably two or more positions, more preferably six or more positions, more preferably eight or more positions, and even more preferably twelve positions) selected from the group consisting of the following (iii-1) to (iii-12): (iii-1) chromosome 3, base 150802997 (iii-2) chromosome 3, base 150803295 (iii-3) chromosome 3, nucleotide 150803307 (iii-4) chromosome 3, base 150803666 (iii-5) chromosome 3, base 150803669 (iii-6) chromosome 3, base 150804058 (iii-7) chromosome 3, base 150804063 (iii-8) chromosome 3, base 150804313 (iii-9) chromosome 3, base 150804490 (iii-10) chromosome 3, base 150804696 (iii-11) chromosome 3, base 150804719 (iii-12) Base number 150805167 on chromosome 3. In particular, it is preferred to detect methylation at least at (iii-9) of the above base positions. In such an embodiment, the method of detecting methylation and the circumstances in which region (iii) is a highly methylated region and the circumstances in which region (iii) is a low methylated region are the same as those described above for region (i).

[0046] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (iv), the frequency of methylation in the region (iv) can be measured by detecting the methylation of at least one base (preferably two or more bases, more preferably three or more bases, more preferably four or more bases, and even more preferably five bases) selected from the group consisting of the following (iv-1) to (iv-5): (iv-1) chromosome 4, base 141347993 (iv-2) chromosome 4, base 141348043 (iv-3) chromosome 4, base 141348167 (iv-4) chromosome 4, nucleotide 141348307 (iv-5) Base 141348488 on chromosome 4. In particular, it is preferable to detect methylation at least at (iv-4) among the above base positions. In such an embodiment, the method of detecting methylation and the circumstances in which region (iv) is a highly methylated region and the circumstances in which region (iv) is a low methylated region are the same as those described above for region (i).

[0047] In one embodiment of the present invention, for example, the measurement of the frequency of methylation in the region (v) can be carried out by detecting the methylation of at least one base (preferably two or more bases, more preferably three or more bases, more preferably four or more bases, and even more preferably five bases) selected from the group consisting of the following (v-1) to (v-5): (v-1) chromosome 4, nucleotide 186048714 (v-2) chromosome 4, base 186048907 (v-3) chromosome 4, base 186049687 (v-4) chromosome 4, base 186049926 (v-5) Base number 186050047 on chromosome 4. In particular, it is preferable to detect the methylation of at least (v-3) among the above base positions. In such an embodiment, the method of detecting the methylation and the circumstances in which region (v) is considered to be a highly methylated region and the circumstances in which region (v) is considered to be a low methylated region are the same as those described above for region (i).

[0048] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (vi), the frequency of methylation in the region (vi) can be measured by detecting the methylation of at least one base at a position (preferably two or more positions, more preferably seven or more positions, more preferably ten or more positions, and even more preferably thirteen positions) selected from the group consisting of the following (vi-1) to (vi-13): (vi-1) chromosome 5, base 17216679 (vi-2) chromosome 5, base 17216922 (vi-3) chromosome 5, base 17217093 (vi-4) chromosome 5, base 17217877 (vi-5) chromosome 5, base 17218089 (vi-6) chromosome 5, base 17218278 (vi-7) chromosome 5, base 17218308 (vi-8) chromosome 5, base 17218547 (vi-9) chromosome 5, base 17218778 (vi-10) chromosome 5, base 17219020 (vi-11) chromosome 5, base 17219128 (vi-12) chromosome 5, base 17219226 (vi-13) Base 17219239 of chromosome 5. In particular, it is preferable to detect methylation at least at (vi-2) among the above base positions. In such an embodiment, the method of detecting methylation and the circumstances in which region (vi) is considered to be a highly methylated region and the circumstances in which region (vi) is considered to be a low methylated region are the same as those described above for region (i).

[0049] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (vii), the frequency of methylation in the region (vii) can be measured by detecting the methylation of at least one base (preferably two or more bases, more preferably three bases) selected from the group consisting of the following (vii-1) to (vii-3): (vii-1) base 37663982 of chromosome 6 (vii-2) nucleotide 37664451 of chromosome 6 (vii-3) Base 37664538 of chromosome 6. In particular, it is preferable to detect methylation at least at (vii-2) among the above base positions. In such an embodiment, the method of detecting methylation and the circumstances in which region (vii) is considered to be a hypermethylated region and the circumstances in which region (vii) is considered to be a hypomethylated region are the same as those described above for region (i).

[0050] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (viii), the frequency of methylation in the region (viii) can be measured by detecting the methylation of at least one base (preferably two or more bases, more preferably five or more bases, more preferably seven or more bases, and even more preferably nine bases) selected from the group consisting of the following (viii-1) to (viii-9): (viii-1) chromosome 6, base 39281183 (viii-2) chromosome 6, base 39281421 (viii-3) chromosome 6, base 39281450 (viii-4) chromosome 6, base 39281541 (viii-5) chromosome 6, base 39281694 (viii-6) chromosome 6, base 39281885 (viii-7) chromosome 6, base 39282164 (viii-8) chromosome 6, base 39282316 (viii-9) Nucleotide 39282331 of chromosome 6. In particular, it is preferred to detect methylation at least at (viii-5) of the above base positions. In such an embodiment, the method of detecting methylation and the circumstances under which region (viii) is considered to be a highly methylated region and the circumstances under which region (viii) is considered to be a hypomethylated region are the same as those described above for region (i).

[0051] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (ix), the frequency of methylation in the region (ix) can be measured by detecting the methylation of at least one base at a position (preferably two or more positions, more preferably 12 or more positions, more preferably 18 or more positions, and even more preferably 23 positions) selected from the group consisting of the following (ix-1) to (ix-23): (ix-1) chromosome 7, base 42273390 (ix-2) chromosome 7, base 42275601 (ix-3) chromosome 7, base 42275813 (ix-4) chromosome 7, base 42275870 (ix-5) chromosome 7, base 42275872 (ix-6) chromosome 7, 42276004th base (ix-7) chromosome 7, base 42276814 (ix-8) chromosome 7, base 42276816 (ix-9) chromosome 7, base 42276819 (ix-10) chromosome 7, base 42276848 (ix-11) chromosome 7, position 42276881 (ix-12) chromosome 7, base 42276890 (ix-13) chromosome 7, base 42276941 (ix-14) chromosome 7, base 42276981 (ix-15) chromosome 7, base 42277044 (ix-16) chromosome 7, base 42277066 (ix-17) chromosome 7, base 42277071 (ix-18) chromosome 7, position 42277347 (ix-19) chromosome 7, base 42277375 (ix-20) chromosome 7, base 42277394 (ix-21) chromosome 7, base 42277410 (ix-22) chromosome 7, base 42277807 (ix-23) Base 42277950 on chromosome 7. In particular, it is preferable to detect the methylation of at least (ix-8) among the above base positions. In such an embodiment, the method of detecting the methylation and the circumstances in which the region (ix) is a highly methylated region and the circumstances in which the region (ix) is a low methylated region are the same as those described above for the region (i).

[0052] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (x), the frequency of methylation in the region (x) can be measured by detecting the methylation of at least one base (preferably two or more bases, more preferably three or more bases, and even more preferably four bases) selected from the group consisting of the following (x-1) to (x-4): (x-1) chromosome 10, base 13039715 (x-2) chromosome 10, base 13041989 (x-3) 13043313th base of chromosome 10 (x-4) Base 13043421 of chromosome 10. In particular, it is preferable to detect methylation at least at (x-3) of the above base positions. In such an embodiment, the method of detecting methylation and the circumstances under which region (x) is considered to be a highly methylated region and the circumstances under which region (x) is considered to be a hypomethylated region are the same as those described above for region (i).

[0053] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xi), the frequency of methylation in the region (xi) can be measured by detecting the methylation of at least one base at a position (preferably two or more positions, more preferably four or more positions, more preferably five or more positions, and even more preferably six positions) selected from the group consisting of the following (xi-1) to (xi-6): (xi-1) chromosome 10, base 81664401 (xi-2) chromosome 10, base 81664567 (xi-3) chromosome 10, base 81664583 (xi-4) chromosome 10, base 81664698 (xi-5) chromosome 10, base 81664955 (xi-6) Base number 81665075 on chromosome 10. In particular, it is preferable to detect methylation at least at (xi-3) among the above base positions. In such an embodiment, the method of detecting methylation and the circumstances in which region (xi) is a hypermethylated region and the circumstances in which region (xi) is a hypomethylated region are the same as those described above for region (i).

[0054] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xii), the frequency of methylation in the region (xii) can be measured by detecting the methylation of at least one base (preferably two or more bases, more preferably three or more bases, more preferably four or more bases, and even more preferably six bases) selected from the group consisting of the following (xii-1) to (xii-6): (xii-1) nucleotide 88126287 of chromosome 10 (xii-2) chromosome 10, base 88126291 (xii-3) chromosome 10, base 88126299 (xii-4) chromosome 10, base 88126306 (xii-5) chromosome 10, base 88126853 (xii-6) Base number 88127188 on chromosome 10. In particular, it is preferable to detect the methylation of at least (xii-4) among the above base positions. In such an embodiment, the method of detecting the methylation and the circumstances in which region (xii) is considered to be a highly methylated region and the circumstances in which region (xii) is considered to be a low methylated region are the same as those described above for region (i).

[0055] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xiii), the frequency of methylation in the region (xiii) can be measured by detecting the methylation of at least one base (preferably two or more bases, more preferably five or more bases, more preferably seven bases) selected from the group consisting of the following (xiii-1) to (xiii-7): (xiii-1) 61595807th base of chromosome 11 (xiii-2) 61595956th base of chromosome 11 (xiii-3) 61596068th base of chromosome 11 (xiii-4) 61596307th base of chromosome 11 (xiii-5) 61596333 base of chromosome 11 (xiii-6) 61596405th base of chromosome 11 (xiii-7) Base 61596626 on chromosome 11. In particular, it is preferred to detect the methylation of at least (xiii-1) of the above base positions. In such an embodiment, the method of detecting the methylation and the circumstances in which region (xiii) is considered to be a highly methylated region and the circumstances in which region (xiii) is considered to be a low methylated region are the same as those described above for region (i).

[0056] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xiv), the frequency of methylation in the region (xiv) can be measured by detecting the methylation of at least one base (preferably two or more bases, more preferably five or more bases, more preferably eight or more bases, and even more preferably ten bases) selected from the group consisting of the following (xiv-1) to (xiv-10): (xiv-1) chromosome 14, base 23820337 (xiv-2) chromosome 14, base 23821149 (xiv-3) chromosome 14, base 23821229 (xiv-4) chromosome 14, base 23821435 (xiv-5) chromosome 14, base 23821445 (xiv-6) chromosome 14, base 23821570 (xiv-7) chromosome 14, base 23821596 (xiv-8) chromosome 14, base 23821902 (xiv-9) chromosome 14, base 23822017 (xiv-10) Base number 23822265 on chromosome 14. In particular, it is preferable to detect the methylation of at least (xiv-9) among the above base positions. In such an embodiment, the method of detecting the methylation and the circumstances in which region (xiv) is considered to be a highly methylated region and the circumstances in which region (xiv) is considered to be a low methylated region are the same as those described above for region (i).

[0057] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xv), the frequency of methylation in the region (xv) can be measured by detecting the methylation of at least one base (preferably two or more bases, more preferably six or more bases, more preferably eight or more bases, and even more preferably 11 bases) selected from the group consisting of the following (xv-1) to (xv-11): (xv-1) chromosome 17, base 44895317 (xv-2) chromosome 17, base 44896017 (xv-3) chromosome 17, base 44896080 (xv-4) chromosome 17, position 44896147 (xv-5) chromosome 17, base 44896162 (xv-6) chromosome 17, base 44896166 (xv-7) chromosome 17, base 44896168 (xv-8) chromosome 17, position 44896212 (xv-9) chromosome 17, base 44896223 (xv-10) chromosome 17, base 44896424 (xv-11) Base 44896748 on chromosome 17. In particular, it is preferable to detect the methylation of at least (xv-10) among the above base positions. In such an embodiment, the method of detecting the methylation and the circumstances in which the region (xv) is a hypermethylated region and the circumstances in which the region (xv) is a hypomethylated region are the same as those described above for the region (i).

[0058] In one embodiment of the present invention, for example, when measuring the frequency of methylation in the region (xvi), the frequency of methylation in the region (xvi) can be measured by detecting the methylation of at least one base (preferably two or more bases, more preferably four or more bases, more preferably six or more bases, and even more preferably eight bases) selected from the group consisting of the following (xvi-1) to (xvi-8): (xvi-1) chromosome 19, base 39520228 (xvi-2) chromosome 19, base 39521931 (xvi-3) chromosome 19, base 39522418 (xvi-4) 39522548th base of chromosome 19 (xvi-5) chromosome 19, base 39522747 (xvi-6) chromosome 19, base 39522944 (xvi-7) chromosome 19, base 39523083 (xvi-8) Base number 39523158 of chromosome 19. In particular, it is preferable to detect the methylation of at least (xvi-4) among the above base positions. In such an embodiment, the method of detecting the methylation and the circumstances in which region (xvi) is considered to be a highly methylated region and the circumstances in which region (xvi) is considered to be a low methylated region are the same as those described above for region (i).

[0059] By detecting the methylation of multiple CpG sites among the CpG sites contained in each region by the above method, it is possible to accurately test the sensitivity of colorectal cancer to drug therapy even by measuring the methylation frequency of only one of the regions (i) to (xvi). In this case, if the measured region is a hypermethylated region according to the above criteria, the patient can be determined to be a hypermethylated patient who is not sensitive to drug therapy for colorectal cancer. Also, if the measured region is a hypomethylated region, the patient can be determined to be a hypomethylated patient who is sensitive to drug therapy for colorectal cancer. In addition, in such an embodiment, even when the frequency is measured by detecting methylation of bases at relatively few positions among the CpG sites contained in each region (e.g., 1 to 3 bases, 1 to 2 bases, 1 base, etc. per region), the frequency of methylation of two or more regions among regions (i) to (xvi) is measured, and if a predetermined percentage or more (e.g., more than half, more than 60%, more than 70%, etc.) of the regions are highly methylated, the patient is determined to be a highly methylated patient and not susceptible to drug therapy for colorectal cancer, thereby enabling accurate determination of sensitivity. In addition, in such an embodiment, the frequency of methylation of two or more regions among regions (i) to (xvi) is measured, and if a predetermined percentage or less (e.g., less than half, less than 40%, less than 30%, etc.) of the regions are highly methylated, the patient is determined to be a low methylated patient and susceptible to drug therapy for colorectal cancer, thereby enabling accurate determination of sensitivity.

[0060] In another preferred embodiment of the present invention, it is preferable to use the methylation of the following CpG sites as an indicator: In this embodiment, methylation of at least one site (preferably 3 sites or more, more preferably 5 sites or more, even more preferably 7 sites or more, most preferably 10 sites) selected from the group consisting of bases at 207308141, 207308149, 207308153, 207308172, 207308177, 207308181, 207308185, 207308244, 207308247, and 207308267 of chromosome 2 can be detected. In this embodiment, it is preferable to detect methylation of at least 207308244 of chromosome 2. When a predetermined proportion Ta1 or more of the above bases are methylated, the region can be determined to be a highly methylated region. The reference value Ta1 can be appropriately set within the range of, for example, 0.80≦Ta1, more preferably 0.90≦Ta1, and further preferably 0.95≦Ta1.

[0061] In this embodiment, methylation of at least one site (preferably 3 sites or more, more preferably 6 sites or more, even more preferably 9 sites or more, most preferably 12 sites) selected from the group consisting of bases at 241758885, 241758889, 241758896, 241758901, 241758919, 241758922, 241758931, 241758936, 241758940, 241759003, 241759005 and 241759009 of chromosome 2 can be detected. In this embodiment, it is preferable to detect methylation of at least 241758901 of chromosome 2. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region. The reference value Ta1 can be set in the same manner as in the above-described embodiment (the same applies below).

[0062] In this embodiment, methylation of at least one site (preferably 3 sites or more, more preferably 5 sites or more, even more preferably 7 sites or more, most preferably 9 sites) selected from the group consisting of bases at 150804417, 150804420, 150804474, 150804479, 150804486, 150804490, 150804496, 150804504 and 150804507 of chromosome 3 can be detected. In this embodiment, it is preferable to detect methylation of at least 150804490 of chromosome 3. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0063] In this embodiment, methylation of at least one site (preferably two or more sites, more preferably four or more sites, even more preferably six or more sites, and most preferably eight sites) selected from the group consisting of bases at 141348224, 141348232, 141348272, 141348282, 141348289, 141348307, 141348318, and 141348324 of chromosome 4 can be detected. In this embodiment, it is preferable to detect methylation of at least 141348307 of chromosome 4. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0064] In this embodiment, methylation of at least one site (preferably two or more sites, more preferably four or more sites, even more preferably six or more sites, and most preferably eight sites) selected from the group consisting of bases at 186049623, 186049636, 186049659, 186049670, 186049685, 186049687, 186049689, and 186049705 of chromosome 4 can be detected. In this embodiment, it is preferable to detect methylation of at least 186049687 of chromosome 4. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0065] In this embodiment, methylation of at least one site (preferably 3 sites or more, more preferably 6 sites or more, even more preferably 9 sites or more, most preferably 10 sites) selected from the group consisting of bases at 17216904, 17216916, 17216922, 17216940, 17216949, 17216952, 17217003, 17217011, 17217017 and 17217023 of chromosome 5 can be detected. In this embodiment, it is preferable to detect methylation of at least 17216922 of chromosome 5. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0066] In this embodiment, methylation can be detected at least one site (preferably two or more sites, more preferably four or more sites, even more preferably five or more sites, and most preferably six sites) selected from the group consisting of bases at 37664352, 37664366, 37664419, 37664424, 37664451, and 37664460 of chromosome 6. In this embodiment, it is preferable to detect methylation at least at 37664451 of chromosome 6. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0067] In this embodiment, methylation of at least one site (preferably 3 sites or more, more preferably 6 sites or more, even more preferably 9 sites or more, most preferably 10 sites) selected from the group consisting of bases at 39281692, 39281694, 39281723, 39281729, 39281735, 39281738, 39281797, 39281806, 39281808, and 39281813 of chromosome 6 can be detected. In this embodiment, it is preferable to detect methylation of at least 39281694 of chromosome 6. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0068] In this embodiment, methylation of at least one site (preferably 3 sites or more, more preferably 6 sites or more, even more preferably 9 sites or more, most preferably 12 sites) selected from the group consisting of bases at 42276764, 42276767, 42276769, 42276783, 42276810, 42276814, 42276816, 42276819, 42276825, 42276852, 42276862 and 42276874 of chromosome 7 can be detected. In this embodiment, it is preferable to detect methylation of at least 42276816 of chromosome 7. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0069] In this embodiment, methylation of at least one site (preferably two or more sites, more preferably four or more sites, even more preferably six or more sites, and most preferably seven sites) selected from the group consisting of bases at 13043231, 13043247, 13043285, 13043288, 13043313, 13043321, and 13043333 of chromosome 10 can be detected. In this embodiment, it is preferable to detect methylation of at least 13043313 of chromosome 10. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0070] In this embodiment, methylation of at least one site (preferably 3 sites or more, more preferably 5 sites or more, even more preferably 7 sites or more, most preferably 9 sites) selected from the group consisting of bases at 81664567, 81664573, 81664583, 81664598, 81664600, 81664606, 81664614, 81664636, and 81664656 of chromosome 10 can be detected. In this embodiment, it is preferable to detect methylation of at least 81664583 of chromosome 10. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0071] In this embodiment, methylation of at least one site (preferably 3 sites or more, more preferably 5 sites or more, even more preferably 7 sites or more, most preferably 9 sites) selected from the group consisting of bases at 88126243, 88126250, 88126259, 88126285, 88126287, 88126291, 88126299, 88126306, and 88126310 of chromosome 10 can be detected. In this embodiment, it is preferable to detect methylation of at least 88126306 of chromosome 10. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0072] In this embodiment, methylation of at least one site (preferably two or more sites, more preferably four or more sites, even more preferably six or more sites, and most preferably eight sites) selected from the group consisting of bases at 61595796, 61595807, 61595815, 61595818, 61595820, 61595829, 61595843, and 61595852 of chromosome 11 can be detected. In this embodiment, it is preferable to detect methylation of at least 61595807 of chromosome 11. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0073] In this embodiment, methylation of at least one site (preferably two or more sites, more preferably four or more sites, even more preferably six or more sites, and most preferably seven sites) selected from the group consisting of bases at 23822015, 23822017, 23822043, 23822054, 23822073, 23822075, and 23822079 of chromosome 14 can be detected. In this embodiment, it is preferable to detect methylation of at least 23822017 of chromosome 14. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0074] In this embodiment, methylation of at least one site (preferably two or more sites, more preferably four or more sites, even more preferably six or more sites, and most preferably eight or more sites) selected from the group consisting of bases at 44896314, 44896316, 44896324, 44896386, 44896390, 44896401, 44896424, 44896443, and 44896450 of chromosome 17 can be detected. In this embodiment, it is preferable to detect methylation of at least 44896424 of chromosome 17. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0075] In this embodiment, methylation of at least one site (preferably 3 sites or more, more preferably 5 sites or more, even more preferably 8 sites or more, most preferably 11 sites) selected from the group consisting of bases at 39522493, 39522510, 39522533, 39522537, 39522548, 39522550, 39522552, 39522582, 39522587, 39522591, and 39522608 of chromosome 19 can be detected. In this embodiment, it is preferable to detect methylation of at least 39522548 of chromosome 19. When a predetermined proportion Ta1 or more of the bases to be detected are methylated, the region can be determined to be a highly methylated region.

[0076] In this embodiment, the frequency of methylation in the region to be measured can be determined by a method of calculating the ΔCt value using real-time PCR. Specifically, for example, a primer and probe set is designed to amplify the region to be measured, real-time PCR is performed, and the ΔCt value is calculated. If the ΔCt value is less than a predetermined value Tb, the region can be determined as a highly methylated region. Alternatively, the ΔCt value can be calculated by the above method, and if the ΔCt value is equal to or greater than a predetermined value Tb, the region can be determined as a low methylated region. The reference value Tb can be set in the same manner as in the above embodiment.

[0077] In another preferred embodiment of the present invention, it is preferable to use the methylation of the following CpG sites as an indicator: In this embodiment, the region of chromosome 2 from base 207308134 to base 207308268 Chromosome 2, region 241758885-241759011 Chromosome 3, region 150804402-150804508 Chromosome 4, region 141348215-141348329 Chromosome 4, region 186049616-186049706 Chromosome 5, region 17216901-17217025 Chromosome 6, region 37664344-37664472 Chromosome 6, region 39281671-39281814 Chromosome 7, region 42276764-42276875 Chromosome 10, region 13043227-13043334 Chromosome 10, region 81664566-81664662 Chromosome 10, region 88126243-88126334 Chromosome 11, region 61595787-61595864 Chromosome 14, region 23821996-23822092 Chromosome 17, region 44896309-44896451 Chromosome 19, region 39522493-39522609 The methylation at at least one site selected from the group consisting of CpG sites included in the above can be used as an indicator.

[0078] In this embodiment, the length of the region to be measured is not particularly limited, but can be appropriately set within the range of, for example, 75 to 200 bases, preferably 90 to 160 bases, and more preferably 100 to 150 bases.

[0079] In this embodiment, the frequency of methylation in the region to be measured can be determined by a method of calculating the ΔCt value using real-time PCR. Specifically, for example, a primer and probe set is designed to amplify the region to be measured, real-time PCR is performed, the ΔCt value is calculated, and the region can be determined as a high methylation region if the ΔCt is less than a predetermined value Tb. In addition, the ΔCt value can be calculated by the above method, and the region can be determined as a low methylation region if the ΔCt is equal to or greater than a predetermined value Tb. The reference value Tb can be set in the same manner as in the above embodiment. The frequency of methylation can also be determined based on a method of calculating the β value using a bead array.

[0080] In a preferred embodiment of the present invention, the probe and primer set for measuring the methylation frequency of each region includes the following: Area (i) F-Primer TAGTATTCGAAGTTTCGTTCG (SEQ ID NO: 1) R-Primer GAACCTAAAAATACTAAAACGACG (SEQ ID NO: 2) Probe AAACGAACGTACGCCCCGC (SEQ ID NO: 3) Area (ii) F-Primer CGGTCGTGTAACGAAGC (SEQ ID NO: 4) R-Primer CCGAACGCGAACAACTA (SEQ ID NO: 5) Probe CAAACGAACGAAACGAAAACTACGACG (SEQ ID NO: 6) Area (iii) F-primer AGTAGAGGAGGTAGGCGTC (SEQ ID NO: 7) R-Primer CGACGAATACTCGACTACG (SEQ ID NO: 8) Probe CTCGAACCCCGAAACGCAC (SEQ ID NO: 9) area (iv) F-Primer GAGTCGAGGTCGTTATTTTAGC (SEQ ID NO: 10) R-Primer AATAAACAACGCCCAAACG (SEQ ID NO: 11) Probe CCCCGAACTCAAACGTAAAACG (SEQ ID NO: 12) area (v) F-Primer GGGGAAAGTTTTTATCGC (SEQ ID NO: 13) R-Primer CTAATAACGTTACCCACAACCG (SEQ ID NO: 14) Probe CCCGAAAAAACTACGAAATAAAACTAACCG (SEQ ID NO: 15) area (vi) F-Primer TCGATTACGATTTCGTTATTTC (SEQ ID NO: 16) R-Primer ATACGAATACAAATACGAAACCG (SEQ ID NO: 17) Probe CAACTCGTTTACAACGACGCAACC (SEQ ID NO: 18) area (vii) F-Primer TTTGTAAGAGGCGTAAAGTGC (SEQ ID NO: 19) R-Primer CTATATTCCGAAACAACTAACTCG (SEQ ID NO: 20) Probe CATCCACTCCAAAATCCGAATCG (SEQ ID NO: 21) area (viii) F-Primer GTTTTTTAATTTTTTGGTTTTCGC (SEQ ID NO: 22) R-Primer CGAACCGCGAAATATACGA (SEQ ID NO: 23) probe AACGTCGAAAACGCAAACGC (SEQ ID NO:24) area(ix) F-Primer GAAATTGATGTCGGAGTTGTAC (SEQ ID NO: 25) R-Primer GACGCGAATAAATAAAAACG (SEQ ID NO: 26) Probe TACGAACGCGCCGATAACGC (SEQ ID NO: 27) area(x) F-Primer ATTACGGTGTGGGAGTGGTAC (SEQ ID NO: 28) R-Primer CGAAATACTATACGACCAAACG (SEQ ID NO: 29) Probe CAACATACTAAAATACCCGCCGACTC (SEQ ID NO: 30) area(xi) F-Primer AGATTCGTTAATAGTTGAGTGTAGGC (SEQ ID NO: 31) R-Primer CCGAAAACGAAATAAAACG (SEQ ID NO: 32) probe CACGCGAACCCGATAAAACG (SEQ ID NO:33) Area (xii) F-Primer GTTTTTCGGGAGAGTCGAG (SEQ ID NO: 34) R-Primer AACTAAACTAAACTAAACTAAAACGAACG (SEQ ID NO: 35) Probe CAAAACGCAAAAACGAACGCG (SEQ ID NO:36) area (xiii) F-Primer ATGTTGTTTGTCGATTGTGAC (SEQ ID NO: 37) R-Primer AAAAACAACCGTCTATACAACG (SEQ ID NO: 38) Probe AACCGACGCGAAAAAACCG (SEQ ID NO: 39) Area (xiv) F-Primer AGATTAAGGAGGCGTTCGC (SEQ ID NO: 40) R-Primer CTATCCTCTAACTCAATTACGCG (SEQ ID NO: 41) Probe CAACTCGAAAAAATCCCGCTCTACAAC (SEQ ID NO: 42) Area (xv) F-Primer GGTTTTCGTTAGTAAAGGAGTTATTC (SEQ ID NO: 43) R-Primer AAAAACGCGATAAACCGAAC (SEQ ID NO: 44) probe CTTTAACCCGAACGTTCACATAACGAA (SEQ ID NO: 45) Area (xvi) F-Primer GTAGTTGTTAGTTTTTCGTTCGTAAC (SEQ ID NO: 46) R-Primer GAAATCCCACCTTAACCGC (SEQ ID NO: 47) Probe TTACGTCCGATAAATCTACGCGCG (SEQ ID NO: 48) In this specification, the primer set of the forward primer and the reverse primer for the above region (i) is referred to as primer set 1. Similarly, the primer sets of the forward primer and the reverse primer for the above regions (ii) to (xvi) are referred to as primer sets 2 to 16, respectively. The probe for the above region (i) is referred to as probe 1. Similarly, the probes for the above regions (ii) to (xvi) are referred to as probes 2 to 16, respectively.

[0081] Therefore, in a preferred embodiment of the present invention, the region to be measured may be set to be detected using at least one of the above probes 1 to 16 and / or at least one of the above primer sets 1 to 16. Alternatively, in a preferred embodiment of the present invention, the region to be measured may be set to be detected using at least one of the above probes 1 to 16 and / or at least one of the above primer sets 1 to 16 (or at least one of the primers constituting each primer of the primer sets 1 to 16). Alternatively, in a preferred embodiment of the present invention, it is preferable that at least a part of the CpG site to be used as an indicator is included in a region to which any of the primers constituting each primer of the above primer sets 1 to 16 hybridizes after bisulfite treatment. Alternatively, in a preferred embodiment of the present invention, it is preferable that the CpG site to be used as an indicator is located in a region to which any of the above primer sets 1 to 16 and probes 1 to 16 hybridize in DNA obtained by bisulfite treatment of DNA containing the methylated CpG site. In the present invention, "hybridize" means to hybridize under stringent conditions usually set in the technical field of the present invention. For example, it means that hybridization occurs under the conditions of Example 2 of the present application. The stringency during hybridization is known to be a function of temperature, salt concentration, primer chain length, GC content of the nucleotide sequence of the primer, and the concentration of the chaotropic agent in the hybridization buffer, and a person skilled in the art can appropriately adjust the stringency by referring to known information such as Sambrook, J. et al. (1998) Molecular Cloning: A Laboratory Manual (2nd ed.), Cold Spring Harbor Laboratory Press, New York, taking into consideration the above-mentioned conditions.In the present invention, the region to which an oligonucleotide hybridizes in DNA obtained by bisulfite treatment of DNA containing a methylated CpG site refers to a region to which an oligonucleotide hybridizes in the resultant region corresponding to the region after bisulfite treatment of DNA containing the region. By bisulfite treatment, unmethylated cytosine contained in the region is converted to uracil, and methylated cytosine is not converted. The above-mentioned primer sets 1 to 16 and probes 1 to 16 are designed to hybridize after bisulfite treatment of the region, assuming that all cytosines in the CpG sites contained in the region to be hybridized are methylated (and therefore not converted by bisulfite treatment), and that cytosines not in the CpG sites are not methylated (and therefore converted to uracil by bisulfite treatment). As described above, in a typical embodiment, when a certain oligonucleotide hybridizes to a base sequence in a certain region of a reference sequence, in which the cytosines in CpG sites in the reference base sequence are left intact and all cytosines not in CpG sites are converted to uracil, the region can be defined as a region "to which the oligonucleotide hybridizes in DNA obtained by subjecting DNA containing methylated CpG sites to bisulfite treatment."

[0082] In the present invention, the "method of testing sensitivity to drug therapy for colorectal cancer using methylation in regions (a) to (c) as an index" may include not only a method using methylation in only regions (a) to (c) as an index, but also a method including a step of detecting methylation in regions (a) to (c) and other regions to the extent that the test results are not different. For example, the "method of testing sensitivity to drug therapy for colorectal cancer using methylation in regions (i) to (v) as an index" may include not only a method using methylation in only regions (i) to (v) as an index, but also a method including a step of detecting methylation in regions (i) to (v) and other regions ("other regions" may be regions other than regions (vi) to (xvi)) to the extent that the test results are not different. Thus, the method of the present invention may also include a method including a step of detecting methylation in at least one site selected from the group consisting of CpG sites included in regions (i) to (xvi) and detecting methylation in a region that does not substantially affect the test results.

[0083] (2. Treatment methods for colon cancer patients) The present invention provides a method for treating a patient with colorectal cancer, comprising the steps of: determining the sensitivity of colorectal cancer to drug therapy using as an index methylation at at least one site selected from the group consisting of CpG sites contained in the regions (i) to (xvi) in DNA collected from the patient with colorectal cancer; and administering drug therapy to the colorectal cancer patient determined to be susceptible in the above step.

[0084] The drug therapy administered to a colon cancer patient who has been determined to be susceptible to drug therapy for colon cancer by the above-mentioned sensitivity assessment is not particularly limited, but can be performed, for example, by administering to the colon cancer patient an effective amount of a drug used in drug therapy for colon cancer.

[0085] The route of administration of the drug is not particularly limited, and may be oral or parenteral. Parenteral administration includes, for example, oral administration, airway administration, rectal administration, subcutaneous administration, intramuscular administration, and intravenous administration.

[0086] The formulation form of the drug is not particularly limited, and examples of the formulation form include oral administration agents such as tablets, pills, capsules, powders, granules, and syrups; and parenteral administration agents such as injections (intravenous injections, intramuscular injections, local injections, etc.), mouthwashes, infusions, external preparations (ointments, creams, patches, inhalants), and suppositories.

[0087] In the present invention, the dosage of the drug used in the pharmacotherapy varies depending on the administration route, the age, weight, symptoms, etc. of the patient and cannot be generally specified, but the dosage of the active ingredient is usually about 5000 mg or less, preferably about 1000 mg or less, more preferably 500 mg or less for an adult. The lower limit of the dosage is not particularly limited, and for example, the dosage of the active ingredient can be appropriately set within the range of usually 1 mg or more, preferably 10 mg or more, more preferably 100 mg or more for an adult. When administered once a day, this amount should be contained in one preparation, and when administered three times a day, one third of this amount should be contained in one preparation.

[0088] (3. Other embodiments) Although the present application has been described above using specific embodiments, the present invention is not limited to such embodiments. As described above, the present invention is based on the novel finding that the above regions (i) to (xvi) are useful as indicators of sensitivity to drug therapy for colorectal cancer. Therefore, the present invention also includes, for example, the following embodiments: a method for assisting in the determination of sensitivity to drug therapy for colorectal cancer using as an indicator methylation at at least one site selected from the group consisting of CpG sites contained in the following regions (i) to (xvi) in DNA collected from a colorectal cancer patient; a method for using methylation at at least one site selected from the group consisting of CpG sites contained in the above regions (i) to (xvi) in DNA collected from a colorectal cancer patient as an indicator for determining sensitivity to drug therapy for colorectal cancer; a program for causing a computer to realize a first function of obtaining a score indicating the methylation frequency of at least one site selected from the group consisting of the regions (i) to (xvi) in DNA collected from a patient with colorectal cancer, a second function of determining that a region is a highly methylated region when the score indicating the methylation frequency obtained by the first function is equal to or lower than a predetermined value for each region, and a third function of determining that the patient is not susceptible to drug therapy for colorectal cancer when more than half of the regions (i) to (xvi) for which scores are obtained by the first function are determined to be highly methylated regions by the second function.

[0089] In these embodiments, the DNA collected from colorectal cancer patients, the drug therapy, each region, etc., and the details of the method for detecting methylation in each region are as described above. In the above kit embodiment, the means for detecting methylation are exemplified by the probe, primer set, etc. used in the above method. In addition, the kit of the present invention can contain other components as necessary. Examples of other components include, but are not limited to, tools for collecting samples (e.g., syringes), etc. It can also contain a written document that describes the procedure for performing the above test method.

[0090] In addition, specific embodiments of the present invention will be described in more detail below using examples, but it is clear that the present invention is not limited to such examples. EXAMPLES

[0091] Reference Example 1: Comprehensive DNA methylation analysis using 97 cases of colorectal cancer We performed comprehensive DNA methylation analysis using Infinium 450K (Illumina) on formalin-fixed paraffin-embedded tissues (FFPE specimens) of colon cancer tumor tissues surgically resected from 97 cases of colon cancer with a history of anti-EGFR antibody drug use. The subjects were cases without KRAS exon 2 mutations by Sanger analysis.

[0092] The β value (methylated probe / methylated probe + unmethylated probe) was calculated for each of the 486,428 targeted CpG sites, and unsupervised hierarchical cluster analysis was performed using 3,163 probes whose β value distribution had a standard deviation exceeding 0.25, according to the method described in Patent Document 1.

[0093] As a result of the above, the analyzed cases were classified into two groups: the Highly-Methylated Colorectal Cancer (HMCC) group (34 cases) with high methylation levels, and the Low-Methylated Colorectal Cancer (LMCC) group (63 cases) with low methylation levels.

[0094] Example 1 Statistical analysis was performed on the beta values ​​of each CpG site in 63 LMCC cases and 34 HMCC cases classified in the above reference example. In addition, the beta values ​​of CpG sites were also measured and calculated for normal colon mucosa samples (n=10) separately from the above 97 cases, and the results were also taken into consideration. Furthermore, further narrowing down of CpG sites was performed focusing on the consistency between the methylation judgment and the actual treatment outcome, and the following 16 base CpG sites were selected from the 486,428 CpG sites targeted by the above comprehensive DNA methylation analysis. As a result of this selection, it is considered that it is possible to determine whether a subject is in the LMCC group or the HMCC group, that is, whether the subject has sensitivity to drug therapy for colorectal cancer, by using the methylation of some or all of the bases in the 16 sites listed in Table 1 as an index.

[0095] [Table 1]

[0096] Example 2 Of 83 retrospectively collected cases of advanced / recurrent colorectal cancer with a history of treatment with anti-EGFR antibody drugs (RAS gene mutant cases, n=18, RAS gene wild-type cases, n=65), 65 cases with RAS gene wild-type were subjected to measurement of DNA methylation status by real-time PCR using the following procedure, and classified into either HMCC group or LMCC group.

[0097] Determination of methylation using real-time PCR The DNA samples from each case were subjected to bisulfite treatment under the following conditions, and then ΔCt values ​​were calculated by real-time PCR: Bisulfite treatment - Bisulfite kit: EZ DNA Methylation Gold Kit - DNA content: 500-600ng / rxn Reagent composition of methylation detection system - Amount of DNA used for qPCR: 10-50ng / well - Enzyme used: GoTaqG2 Hot Start Master Mix (MgCl2 final concentration 2.0mM) - Target: Primer final concentration l000nM / Probe (FAM) final concentration 500nM - Control: Primer final concentration 500nM / Probe (HEX) final concentration 250nM - ACTB Promoter region(GenBank Y00474.1) Reaction temperature conditions 95℃: 2min→(95℃ 15sec→55℃ 30sec→72℃ 1min) x 50cycles ·Measuring equipment: Bio-Rad CFX96 The target primer probe set and control primer probe set used for real-time PCR are as follows:

[0098] [Table 2]

[0099] As a result of real-time PCR using the primer-probe sets for the 16 analyzed regions and one control primer-probe set, if the ΔCt value was less than 4, the methylation of the analyzed region was determined to be positive. Cases with 8 or more methylation-positive regions out of the 16 analyzed regions were classified as the HMCC group, and cases with less than 8 methylation-positive regions were classified as the LMCC group. Then, the treatment outcomes (progression-free survival: PFS and response rate) of anti-EGFR antibody drugs (cetuximab or panitumumab) were compared for each group.

[0100] First, the proportions of the RAS gene mutation group, HMCC group, and LMCC group among the 83 cases are shown in Table 3 below.

[0101] [Table 3]

[0102] The response rate for each group is shown in Table 4 below.

[0103] [Table 4]

[0104] Furthermore, a graph summarizing the progression-free survival (PFS) of each group is shown in Figure 1. As can be seen from these results, by measuring DNA methylation status, it was possible to extract a group resistant to anti-EGFR antibody drugs in RAS wild-type advanced / recurrent colorectal cancer.

[0105] Example 3 It is known that the prognosis of advanced colorectal cancer varies depending on the location of the primary lesion. Therefore, the 65 cases of advanced recurrent colorectal cancer in Example 2 were further classified according to the location of the primary lesion (right colon or left colon) to determine which classification method has better accuracy in predicting therapeutic effects. First, the response rates in the HMCC and LMCC groups and the response rates according to the location of the primary lesion are shown in Table 5 below.

[0106] [Table 5]

[0107] Furthermore, a graph summarizing the progression-free survival (PFS) of the HMCC group whose primary tumor is in the left colon (L-HMCC group), the HMCC group whose primary tumor is in the right colon (R-HMCC group), the LMCC group whose primary tumor is in the left colon (L-LMCC group), and the LMCC group whose primary tumor is in the right colon (R-LMCC group) is shown in Figure 2. As shown in Figure 2, among the cases whose primary tumor is in the left colon, there were cases of the HMCC group and the LMCC group, and the median PFS was statistically significantly different between the two groups. In addition, among the cases whose primary tumor is in the right colon, there were cases of the HMCC group and the LMCC group, and the median PFS was statistically significantly different between the two groups. Therefore, it can be seen that the judgment based on methylation is useful as an index separate from the location of the primary tumor. In addition, the results of analyzing the difference in PFS for each of the location of the primary tumor, RAS gene mutation, and methylation status are shown in Table 6.

[0108] [Table 6]

[0109] As shown in Table 6, the hazard ratio for methylation status was the smallest, suggesting that, among these indices, the method using methylation as an index has superior accuracy in predicting treatment effect.

[0110] Example 4 The subjects of measurement were 83 cases of progressive and recurrent colorectal cancer in which the KRAS gene was wild type, and the ΔCt value was determined by real-time PCR in the same manner as in Example 2, except that only probe ID1 targeting the region containing cg07319626 was used (thus, primer set 1 and probe 1 were used). As a result of the above real-time PCR, cases with a ΔCt value of less than 4 were classified as the HMCC group, and cases with a ΔCt value of 4 or more were classified as the LMCC group. Then, the treatment outcomes (progression-free survival: PFS and response rate) of anti-EGFR antibody drugs (cetuximab or panitumumab) were compared for each group. A graph summarizing the progression-free survival (PFS) of each group is shown in Figure 3. In addition, a graph summarizing the PFS of the HMCC group and the LMCC group for 65 cases of wild-type RAS genes out of 83 cases of advanced recurrent colorectal cancer with wild-type KRAS genes is shown in Figure 4. As can be seen from these results, by using the methylation of only one region as an indicator, it was possible to extract a group of advanced recurrent colorectal cancer resistant to anti-EGFR antibody drugs.

[0111] Example 5 Graphs showing β values ​​calculated by comprehensive DNA methylation analysis of the surrounding CpG sites by Infinium 450K (Illumina) for each of the 16 CpG sites used as indicators in the above examples are shown in Figures 5 to 20. In each figure, each column shows each case. In addition, in the figures, "Target ID" is the ID of the CpG site, "CHR" is the chromosome number, and "MAPINFO" indicates which base on the chromosome is intended to be methylated. In addition, in each figure, β values ​​less than 0.4 are shown in dark gray, β values ​​greater than 0.3 and less than 0.4 are shown in light gray, and β values ​​less than 0.3 are shown in white.

[0112] As shown in FIGS. 5 to 20, the β values ​​of HMCC cases tend to be larger than those of LMCC cases even in the CpG sites before and after the 16 CpG sites used as indexes in Example 1 above. Therefore, for example, by using the methylation of one of the 16 regions shown in Figs. 5 to 20 (for example, the region of chromosome 2 at positions 207307150 to 207309004 (region (i)) shown in Fig. 5) as an index, it is considered possible to determine whether a subject belongs to the LMCC group or the HMCC group, and therefore whether or not the subject has sensitivity to drug therapy for colorectal cancer. For example, in Fig. 5, TargetID cg24399540, TargetID cg27380819, TargetID cg04307977, TargetID cg06123396, TargetID cg09454676, TargetID cg08804846, TargetID cg26258845, TargetID cg07319626, TargetID cg16778809, TargetID Using cg09553380 and TargetID cg21823149 as indicators, CpG sites were determined to be hypermethylated when the beta value was 0.4 or higher, and HMCC was determined when there were 8 or more hypermethylated regions. The median PFS was 82 days and 224 days, respectively (p = < 0.001), and the HMCC and LMCC groups could be classified with a significant difference.

Claims

1. A method for testing sensitivity to drug therapy for colorectal cancer, using as an indicator methylation at at least one site selected from the group consisting of CpG sites contained in the following regions (i) to (xvi) in DNA collected from a colorectal cancer patient: Region (i) chromosome 2, 207307150-207309004 Region (ii) chromosome 2, 241758282-241760510 Region (iii) chromosome 3, 150802997-150805168 Region (iv) chromosome 4, 141347993-141348489 Region (v) chromosome 4, 186048714-186050048 Region (vi) chromosome 5, 17216679-17219240 Region (vii) chromosome 6, 37663982-37664539 Region (viii) chromosome 6, 39281183-39282332 Region (ix) chromosome 7, 42273390-42277951 Region (x) chromosome 10, 13039715-13043422 Region (xi) chromosome 10, 81664401-81665076 Region (xii) chromosome 10, 88126287-88127189 Region (xiii) chromosome 11, 61595807-61596627 Region (xiv) chromosome 14, 23820337-23822266 Region (xv) chromosome 17, 44895317-44896749 Region (xvi) chromosome 19, region from 39520228 to 39523159.

2. Chromosome 2: 207307150, 207307490, 207307544, 207307622, ​​207307732, 207308004, 207308087, 207308244, 207308375, 207308829, 207309003, 241758282, 241758399, 241758805, 241758901, 241759279, 241759414, 241760025, 241760164, 241760190, 241760509, Chromosome 3 positions 150802997, 150803295, 150803307, 150803666, 150803669, 150804058, 150804063, 150804313, 150804490, 150804696, 150804719, 150805167, Chromosome 4, positions 141347993, 141348043, 141348167, 141348307, 141348488, 186048714, 186048907, 186049687, 186049926, 186050047, Chromosome 5, positions 17216679, 17216922, 17217093, 17217877, 17218089, 17218278, 17218308, 17218547, 17218778, 17219020, 17219128, 17219226, 17219239, Chromosome 6, positions 37663982, 37664451, 37664538, 39281183, 39281421, 39281450, 39281541, 39281694, 39281885, 39282164, 39282316, 39282331, Chromosome 7: 42273390, 42275601, 42275813, 42275870, 42275872, 42276004, 42276814, 42276816, 42276819, 42276848, 42276881, 42276890, 42276941, 42276981, 42277044, 42277066, 42277071, 42277347, 42277375, 42277394, 42277410, 42277807, 42277950, Chromosome 10 positions 13039715, 13041989, 13043313, 13043421, 81664401, 81664567, 81664583, 81664698, 81664955, 81665075, 88126287, 88126291, 88126299, 88126306, 88126853, 88127188, Chromosome 11, positions 61595807, 61595956, 61596068, 61596307, 61596333, 61596405, and 61596626; Chromosome 14, positions 23820337, 23821149, 23821229, 23821435, 23821445, 23821570, 23821596, 23821902, 23822017, and 23822265, Chromosome 17, positions 44895317, 44896017, 44896080, 44896147, 44896162, 44896166, 44896168, 44896212, 44896223, 44896424, 44896748, The method according to claim 1, wherein methylation of at least one site selected from the group consisting of bases at 39520228, 39521931, 39522418, 39522548, 39522747, 39522944, 39523083, and 39523158 of chromosome 19 is detected, and the detection result is used as an indicator of sensitivity to drug therapy for colorectal cancer.

3. The method according to claim 1 or 2, wherein methylation at at least one site selected from the group consisting of CpG sites contained in the following regions (i') to (iv'), regions (viii') to (x'), and regions (xii') to (xvi') is used as an indicator: Region (i') chromosome 2, 207307490-207308376 Region (ii') chromosome 2, 241758805-241760510 Region (iii') chromosome 3, 150802997-150804720 Region (iv') chromosome 4, 141348167-141348308 Region (viii') chromosome 6, region 39281541-39282165 Region (ix') chromosome 7, 42275870-42276817 Region (x') chromosome 10, 13041989-13043422 Region (xii') chromosome 10, region 88126287-88126307 Region (xiii') chromosome 11, 61595807-61596334 Region (xiv') chromosome 14, 23821596-23822266 Region (xv') chromosome 17, 44895317-44896425 Region (xvi'): Region from 39520228 to 39523084 of chromosome 19.

4. Chromosome 2: 207308141, 207308149, 207308153, 207308172, 207308177, 207308181, 207308185, 207308244, 207308247, 207308267, 24175888 5th, 241758889th, 241758896th, 241758901st, 241758919th, 241758922nd, 241758931st, 241758936th, 241758940th, 241759003rd, 241759005th, 241759009th, Chromosome 3, positions 150804417, 150804420, 150804474, 150804479, 150804486, 150804490, 150804496, 150804504, and 150804507, Chromosome 4: 141348224, 141348232, 141348272, 141348282, 141348289, 141348307, 141348318, 141348324, 186049623, 186049636, 186049659, 186049670, 186049685, 186049687, 186049689, 186049705, Chromosome 5, positions 17216904, 17216916, 17216922, 17216940, 17216949, 17216952, 17217003, 17217011, 17217017, and 17217023; Chromosome 6: 37664352, 37664366, 37664419, 37664424, 37664451, 37664460, 39281692, 39281694, 39281723, 39281729, 39281735, 39281738, 39281797, 39281806, 39281808, 39281813, Chromosome 7, positions 42276764, 42276767, 42276769, 42276783, 42276810, 42276814, 42276816, 42276819, 42276825, 42276852, 42276862, 42276874, Chromosome 10: 13043231, 13043247, 13043285, 13043288, 13043313, 13043321, 13043333, 81664567, 81664573, 81664583, 81664598, 81664600, 8 1664606th, 81664614th, 81664636th, 81664656th, 88126243rd, 88126250th, 88126259th, 88126285th, 88126287th, 88126291st, 88126299th, 88126306th, 88126310th, Chromosome 11, positions 61595796, 61595807, 61595815, 61595818, 61595820, 61595829, 61595843, and 61595852, Chromosome 14, positions 23822015, 23822017, 23822043, 23822054, 23822073, 23822075, and 23822079, Chromosome 17, positions 44896314, 44896316, 44896324, 44896386, 44896390, 44896401, 44896424, 44896443, and 44896450, The method according to claim 1, wherein methylation of at least one site selected from the group consisting of bases at 39522493, 39522510, 39522533, 39522537, 39522548, 39522550, 39522552, 39522582, 39522587, 39522591, and 39522608 of chromosome 19 is detected, and the detection result is used as an indicator of sensitivity to drug therapy for colorectal cancer.

5. The method according to any one of claims 1 to 4, Chromosome 2, region 207308134-207308268 Chromosome 2, region 241758885-241759011 Chromosome 3, region 150804402-150804508 Chromosome 4, region 141348215-141348329 Chromosome 4, region 186049616-186049706 Chromosome 5, region 17216901-17217025 Chromosome 6, region 37664344-37664472 Chromosome 6, region 39281671-39281814 Chromosome 7, region 42276764-42276875 Chromosome 10, region 13043227-13043334 Chromosome 10, region 81664566-81664662 Chromosome 10, region 88126243-88126334 Chromosome 11, region 61595787-61595864 Chromosome 14, region 23821996-23822092 Chromosome 17, region 44896309-44896451 Chromosome 19, region 39522493-39522609 The method uses, as an indicator, methylation at at least one site selected from the group consisting of CpG sites included in

6. The method according to any one of claims 1 to 5, wherein the CpG site is located within a region to which at least one oligonucleotide having a sequence selected from the group consisting of SEQ ID NOs: 1 to 48 hybridizes in DNA obtained by bisulfite treatment of DNA containing the methylated CpG site.

7. The method according to any one of claims 1 to 6, (1) detecting a plurality of CpG sites contained in at least two of the regions (i) to (xvi) and measuring the frequency of methylation of the detected CpG sites; (2) determining that each region measured in the above step (1) is a highly methylated region when the frequency of methylation is equal to or higher than a preset value; (3) determining that the colorectal cancer is insensitive to drug therapy when a predetermined proportion or more of the regions measured in the above step (1) are determined to be hypermethylated regions in the step (2); A method comprising:

8. The method according to any one of claims 1 to 6, (1) detecting a plurality of CpG sites contained in at least two of the regions (i) to (xvi) and measuring the frequency of methylation of the detected CpG sites; (2) determining that each region measured in the above step (1) is a highly methylated region when the frequency of methylation is equal to or higher than a preset value; (3) determining that a region having a methylation level less than a predetermined ratio among the regions measured in the above step (1) is a hypermethylated region in the step (2), the region being determined to be sensitive to a drug therapy for colorectal cancer. A method comprising:

9. 9. The method according to claim 7 or 8, wherein the measurement of the frequency of methylation in each region in step (1) is carried out by real-time PCR, and the region is determined to be a highly methylated region when a ΔCt value, which is the difference between the Ct value measured by real-time PCR and the Ct value of a control reaction, is less than a predetermined value.

10. The method according to any one of claims 7 to 9, wherein in step (1), the methylation frequency is measured for at least eight of the regions (i) to (xvi).

11. The method according to any one of claims 1 to 10, wherein the DNA collected from the colorectal cancer patient is prepared from colon tissue, blood, serum, plasma, feces, intestinal lavage fluid, or enema lavage fluid collected from the colorectal cancer patient.

12. The method according to any one of claims 1 to 11, wherein the drug therapy for colorectal cancer uses an anti-EGFR antibody.

13. The method according to claim 12, wherein the anti-EGFR antibody is at least one selected from the group consisting of cetuximab and panitumumab.

14. A kit for obtaining information that can be an indicator of the presence or absence of sensitivity to drug therapy for colorectal cancer, comprising a primer set for analyzing methylation at at least one site selected from the group consisting of CpG sites contained in the following regions (i) to (xvi) in DNA collected from a patient with colorectal cancer: Region (i) chromosome 2, 207307150-207309004 Region (ii) chromosome 2, 241758282-241760510 Region (iii) chromosome 3, 150802997-150805168 Region (iv) chromosome 4, 141347993-141348489 Region (v) chromosome 4, 186048714-186050048 Region (vi) chromosome 5, 17216679-17219240 Region (vii) chromosome 6, 37663982-37664539 Region (viii) chromosome 6, 39281183-39282332 Region (ix) chromosome 7, 42273390-42277951 Region (x) chromosome 10, 13039715-13043422 Region (xi) chromosome 10, 81664401-81665076 Region (xii) chromosome 10, 88126287-88127189 Region (xiii) chromosome 11, 61595807-61596627 Region (xiv) chromosome 14, 23820337-23822266 Region (xv) chromosome 17, 44895317-44896749 Region (xvi) chromosome 19, region from 39520228 to 39523159.

15. The kit according to claim 14, wherein the primer set is a primer set for analyzing methylation of CpG sites by at least one method selected from the group consisting of methylation-specific PCR, sequencing, and mass spectrometry.

16. The kit according to claim 14 or 15, comprising a primer set capable of amplifying at least one of the following regions after bisulfite treatment when a CpG site contained in the region is methylated: Region including chromosome 2, 207308134 to 207308267 Region including chromosome 2, 241758885 to 241759011 Region including chromosome 3, 150804402 to 150804508 The region including 141348215 to 141348329 of chromosome 4 Region including 186049616-186049705 of chromosome 4 Region including 17216901-17217025 of chromosome 5 Region including 37664344-37664472 of chromosome 6 Region including chromosome 6, 39281671-39281814 Region including chromosome 7, 42276765-42276874 Region including 13043227-13043334 of chromosome 10 Region including 81664566-81664662 of chromosome 10 Region including chromosome 10, 88126244-88126334 Region including 61595787-61595864 of chromosome 11 Region including 23821996-23822092 of chromosome 14 The region including chromosome 17, 44896309-44896450 A region including chromosome 19 positions 39522494 to 39522608.

Images