Human metapneumovirus vaccine

Abstract

The present disclosure provides antigenic pre-fusion hMPV F polypeptides, nucleic acid sequences (e.g., RNA sequences, e.g., mRNA sequences) encoding pre-fusion hMPV F polypeptides, compositions comprising antigenic pre-fusion hMPV F polypeptides, compositions comprising nucleic acid sequences encoding pre-fusion hMPV F polypeptides, and hMPV vaccines.

Description

[Technical field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 284,405, filed November 30, 2021, which is incorporated by reference in its entirety for all purposes.

[0002] CRADA Declaration This invention was created in the fulfillment of a Cooperative Research and Development Agreement with the National Institutes of Health, an agency of the Department of Health and Human Services. The United States Government has certain rights in this invention. [Background technology]

[0003] Human metapneumovirus (hMPV) is a major cause of acute respiratory infections, especially in children, immunocompromised patients, and the elderly. Closely related to avian metapneumovirus subtype C, hMPV has been circulating for at least 65 years, and nearly all children are infected with hMPV by age 5. However, immunity is incomplete, and reinfection occurs throughout adulthood. Symptoms are similar to those of other respiratory viral infections, ranging from mild (e.g., cough, rhinorrhea, and fever) to severe (e.g., bronchiolitis and pneumonia).

[0004] Currently, despite the high disease burden, there are no licensed vaccines or therapeutics against hMPV. Due to the lack of available effective hMPV vaccines or therapeutics, there is a need for hMPV vaccines that induce strong immune responses for potent neutralization of hMPV infection. Summary of the Invention [Means for solving the problem]

[0005] In one aspect, an antigenic human metapneumovirus (hMPV) pre-fusion F polypeptide, or a nucleic acid molecule encoding same, is provided, wherein the pre-fusion F polypeptide lacks a transmembrane domain, lacks a cytoplasmic tail, and comprises a human rhinovirus 3C (HRV-3C) protease cleavage site.

[0006] In certain exemplary embodiments, the pre-fusion F polypeptide further comprises an F0 cleavage site mutation comprising the amino acid substitutions Q100R and S101R, which replace the glutamine at amino acid position 100 of SEQ ID NO:1 with arginine and the serine at amino acid position 101 of SEQ ID NO:1 with arginine.

[0007] In certain exemplary embodiments, the pre-fusion F polypeptide comprises a signal peptide.

[0008] In certain exemplary embodiments, the pre-fusion F polypeptide comprises at least one tag sequence, which may be a polyhistidine tag (e.g., a 6xHis tag, an 8xHis tag, etc.) and / or a Strep II tag.

[0009] In certain exemplary embodiments, the pre-fusion F polypeptide comprises a foldon domain.

[0010] In certain exemplary embodiments, the pre-fusion F polypeptide comprises an amino acid substitution that replaces the wild-type amino acid at position 160 of SEQ ID NO:1, and an amino acid substitution that replaces the wild-type amino acid at position 46 of SEQ ID NO:1.

[0011] In certain exemplary embodiments, the pre-fusion F2 polypeptide comprises an amino acid substitution at amino acid position 160 of SEQ ID NO:1 substituting a threonine and an amino acid substitution at amino acid position 46 of SEQ ID NO:1 substituting an asparagine.

[0012] In certain exemplary embodiments, the pre-fusion F1 polypeptide comprises an amino acid substitution that replaces the amino acid at position 160 with phenylalanine, tryptophan, tyrosine, valine, alanine, isoleucine, or leucine. In certain exemplary embodiments, the pre-fusion F1 polypeptide comprises an amino acid substitution that replaces the amino acid at position 160 with phenylalanine.

[0013] In certain exemplary embodiments, the pre-fusion F1 polypeptide comprises an amino acid substitution that replaces the amino acid at position 46 with valine, alanine, isoleucine, leucine, phenylalanine, tyrosine, or proline. In certain exemplary embodiments, the pre-fusion F1 polypeptide comprises an amino acid substitution that replaces the amino acid at position 46 with valine.

[0014] In certain exemplary embodiments, the hMPV is a strain A or B. In certain exemplary embodiments, the hMPV is an A1, A2, B1, or B2 subtype.

[0015] In certain exemplary embodiments, the pre-fusion F polypeptide comprises at least 95% sequence identity to or comprises SEQ ID NO:3.

[0016] In certain exemplary embodiments, a messenger RNA (mRNA) is provided that includes an open reading frame (ORF) encoding an F polypeptide.

[0017] In certain exemplary embodiments, a method of inducing an immune response in a subject in need thereof is provided, comprising administering to the subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a prophylactically effective amount of a vaccine.

[0018] In certain exemplary embodiments, a method of preventing hMPV infection or alleviating one or more symptoms of hMPV infection is provided, the method comprising administering to a subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a prophylactically effective amount of a vaccine.

[0019] In certain exemplary embodiments, the use of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a vaccine is provided for the manufacture of a medicament for use in treating a subject in need of treatment.

[0020] In certain exemplary embodiments, an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a vaccine is provided for use in treating a subject in need of treatment.

[0021] In certain exemplary embodiments, a kit is provided that includes a container containing a single or multiple dose of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of mRNA, or a vaccine, and optionally the container is a vial or a prefilled syringe or injector.

[0022] In certain exemplary embodiments, an expression vector encoding an F polypeptide, a nucleic acid molecule, or an mRNA is provided.

[0023] In certain exemplary embodiments, a cell is provided that comprises the expression vector.

[0024] In another aspect, an antigenic human metapneumovirus (hMPV) pre-fusion F polypeptide, or a nucleic acid molecule encoding the same, is provided, the pre-fusion F polypeptide lacking a transmembrane domain, lacking a cytoplasmic tail, and including amino acid substitutions Q100R and S101R, which substitute arginine for glutamine at amino acid position 100 of SEQ ID NO:1, and arginine for serine at amino acid position 101 of SEQ ID NO:1. 0 a cleavage site mutation; a human rhinovirus 3C (HRV-3C) protease cleavage site; a heterologous signal peptide; a polyhistidine tag (eg, 6xHis tag, 8xHis tag, etc.) and / or a Strep II tag; and a foldon domain.

[0025] In another aspect, an antigenic human pre-fusion metapneumovirus (hMPV) F polypeptide, or a nucleic acid molecule encoding same, is provided, wherein the pre-fusion F polypeptide lacks a transmembrane domain, lacks a cytoplasmic tail, and comprises an amino acid substitution substituting a threonine at amino acid position 160 of SEQ ID NO:1 and an amino acid substitution substituting an asparagine at amino acid position 46 of SEQ ID NO:1.

[0026] In certain exemplary embodiments, the pre-fusion F1 polypeptide comprises an amino acid substitution that replaces the threonine at amino acid position 160 with phenylalanine, tryptophan, or tyrosine. In certain exemplary embodiments, the pre-fusion F1 polypeptide comprises an amino acid substitution T160F that replaces the threonine at amino acid position 160 with phenylalanine.

[0027] In certain exemplary embodiments, the pre-fusion F polypeptide comprises an amino acid substitution that replaces the asparagine at amino acid position 46 with valine, alanine, glycine, isoleucine, leucine, or proline. In certain exemplary embodiments, the pre-fusion F polypeptide comprises an amino acid substitution N46V that replaces the asparagine at amino acid position 46 with valine.

[0028] In certain exemplary embodiments, the pre-fusion F polypeptide comprises at least 95% sequence identity to SEQ ID NO:7.

[0029] In certain exemplary embodiments, the pre-fusion F polypeptide further comprises an F0 cleavage site mutation comprising the amino acid substitutions Q100R and S101R, which replace the glutamine at amino acid position 100 of SEQ ID NO:1 with arginine and the serine at amino acid position 101 of SEQ ID NO:1 with arginine.

[0030] In certain exemplary embodiments, the pre-fusion F polypeptide comprises a signal peptide.

[0031] In certain exemplary embodiments, the pre-fusion F polypeptide comprises at least one tag sequence, which may be a polyhistidine tag (e.g., a 6xHis tag, an 8xHis tag, etc.) and / or a Strep II tag.

[0032] In certain exemplary embodiments, the pre-fusion F polypeptide comprises a foldon domain.

[0033] In certain exemplary embodiments, the hMPV is a strain A or B. In certain exemplary embodiments, the hMPV is an A1, A2, B1, or B2 subtype.

[0034] In certain exemplary embodiments, the pre-fusion F polypeptide comprises at least 95% sequence identity to or comprises SEQ ID NO:3.

[0035] In certain exemplary embodiments, a messenger RNA (mRNA) is provided that includes an open reading frame (ORF) encoding an F polypeptide.

[0036] In certain exemplary embodiments, a method of inducing an immune response in a subject in need thereof is provided, comprising administering to the subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a prophylactically effective amount of a vaccine.

[0037] In certain exemplary embodiments, a method of preventing hMPV infection or alleviating one or more symptoms of hMPV infection is provided, the method comprising administering to a subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a prophylactically effective amount of a vaccine.

[0038] In certain exemplary embodiments, the use of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a vaccine is provided for the manufacture of a medicament for use in treating a subject in need of treatment.

[0039] In certain exemplary embodiments, an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a vaccine is provided for use in treating a subject in need of treatment.

[0040] In certain exemplary embodiments, a kit is provided that includes a container containing a single or multiple dose of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of mRNA, or a vaccine, and optionally the container is a vial or a prefilled syringe or injector.

[0041] In certain exemplary embodiments, an expression vector encoding an F polypeptide, a nucleic acid molecule, or an mRNA is provided.

[0042] In certain exemplary embodiments, a cell is provided that comprises the expression vector.

[0043] In another aspect, an antigenic human metapneumovirus (hMPV) pre-fusion F polypeptide, or a nucleic acid molecule encoding same, is provided, the pre-fusion F polypeptide lacking a transmembrane domain, lacking a cytoplasmic tail, and including the amino acid substitutions T160F, which replaces the threonine at amino acid position 160 of SEQ ID NO:1 with a phenylalanine, and N46V, which replaces the asparagine at amino acid position 46 of SEQ ID NO:1 with a valine; the amino acid substitutions Q100R and S101R, which replace the glutamine at amino acid position 100 of SEQ ID NO:1 with an arginine, and the serine at amino acid position 101 of SEQ ID NO:1 with an arginine. 0 a cleavage site mutation; a human rhinovirus 3C (HRV-3C) protease cleavage site; a signal peptide; a polyhistidine tag (e.g., 6xHis tag, 8xHis tag, etc.) and / or a Strep II tag; and a foldon domain.

[0044] In certain exemplary embodiments, the hMPV is a strain A or B. In certain exemplary embodiments, the hMPV is an A1, A2, B1, or B2 subtype.

[0045] In certain exemplary embodiments, the pre-fusion F polypeptide comprises at least 95% sequence identity to or comprises SEQ ID NO:3.

[0046] In certain exemplary embodiments, a messenger RNA (mRNA) is provided that includes an open reading frame (ORF) encoding an F polypeptide.

[0047] In certain exemplary embodiments, a method of inducing an immune response in a subject in need thereof is provided, comprising administering to the subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a prophylactically effective amount of a vaccine.

[0048] In certain exemplary embodiments, a method of preventing hMPV infection or alleviating one or more symptoms of hMPV infection is provided, the method comprising administering to a subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a prophylactically effective amount of a vaccine.

[0049] In certain exemplary embodiments, the use of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a vaccine is provided for the manufacture of a medicament for use in treating a subject in need of treatment.

[0050] In certain exemplary embodiments, an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a vaccine is provided for use in treating a subject in need of treatment.

[0051] In certain exemplary embodiments, a kit is provided that includes a container containing a single or multiple dose of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of mRNA, or a vaccine, and optionally the container is a vial or a prefilled syringe or injector.

[0052] In certain exemplary embodiments, an expression vector encoding an F polypeptide, a nucleic acid molecule, or an mRNA is provided.

[0053] In certain exemplary embodiments, a cell is provided that comprises the expression vector.

[0054] In another aspect, there is provided a human metapneumovirus (hMPV) F polypeptide, or a nucleic acid molecule encoding same, comprising at least 95% sequence identity to SEQ ID NO:7.

[0055] In certain exemplary embodiments, the F polypeptide is a pre-fusion F polypeptide.

[0056] In certain exemplary embodiments, the F polypeptide is antigenic.

[0057] In certain exemplary embodiments, the F polypeptide comprises the amino acid substitution T160F, which replaces the threonine at amino acid position 160 with a phenylalanine, and the amino acid substitution N46V, which replaces the asparagine at amino acid position 46 with a valine.

[0058] In certain exemplary embodiments, the F polypeptide comprises SEQ ID NO:7.

[0059] In certain exemplary embodiments, a nucleic acid molecule is provided that encodes any of the polypeptides of any of the above aspects or embodiments. In certain exemplary embodiments, the nucleic acid molecule has at least 95% sequence identity to SEQ ID NO:8. In certain exemplary embodiments, the nucleic acid molecule comprises SEQ ID NO:8. In certain exemplary embodiments, the nucleic acid molecule has at least 95% sequence identity to SEQ ID NO:18. In certain exemplary embodiments, the nucleic acid molecule comprises SEQ ID NO:18. In certain exemplary embodiments, the nucleic acid molecule has at least 95% sequence identity to SEQ ID NO:19. In certain exemplary embodiments, the nucleic acid molecule comprises SEQ ID NO:19.

[0060] In certain exemplary embodiments, a pharmaceutical composition is provided that includes any of the polypeptides of the above embodiments, or any of the nucleic acid molecules encoding same, hi certain exemplary embodiments, the pharmaceutical composition is a vaccine.

[0061] In certain exemplary embodiments, a method of inducing an immune response against hMPV or protecting a subject from hMPV infection is provided, the method comprising administering a vaccine to a subject.

[0062] In certain exemplary embodiments, the subject has a comparable serum concentration of neutralizing antibodies to hMPV after administration of the vaccine compared to a subject administered a protein hMPV vaccine. In certain exemplary embodiments, the protein hMPV vaccine is co-administered with an adjuvant.

[0063] In certain exemplary embodiments, the vaccine increases serum concentrations of neutralizing antibodies in subjects with pre-existing hMPV immunity.

[0064] In certain exemplary embodiments, a vaccine is provided for use in eliciting an immune response against hMPV or protecting a subject from hMPV infection, comprising administering the vaccine to a subject.

[0065] In certain exemplary embodiments, there is provided the use of the vaccine in the manufacture of a medicament for inducing an immune response against hMPV or for protecting a subject from hMPV infection.

[0066] In certain exemplary embodiments, a messenger RNA (mRNA) is provided that includes an open reading frame (ORF) encoding an F polypeptide.

[0067] In certain exemplary embodiments, a method of inducing an immune response in a subject in need thereof is provided, comprising administering to the subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a prophylactically effective amount of a vaccine.

[0068] In certain exemplary embodiments, a method of preventing hMPV infection or alleviating one or more symptoms of hMPV infection is provided, the method comprising administering to a subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a prophylactically effective amount of a vaccine.

[0069] In certain exemplary embodiments, the use of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a vaccine is provided for the manufacture of a medicament for use in treating a subject in need of treatment.

[0070] In certain exemplary embodiments, an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a vaccine is provided for use in treating a subject in need of treatment.

[0071] In certain exemplary embodiments, a kit is provided that includes a container containing a single or multiple dose of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of mRNA, or a vaccine, and optionally the container is a vial or a prefilled syringe or injector.

[0072] In certain exemplary embodiments, an expression vector encoding an F polypeptide, a nucleic acid molecule, or an mRNA is provided.

[0073] In certain exemplary embodiments, a cell is provided that comprises the expression vector.

[0074] In another aspect, a messenger RNA (mRNA) is provided comprising an open reading frame (ORF) encoding a human metapneumovirus (hMPV) F polypeptide antigen, wherein the hMPV F polypeptide antigen comprises an amino acid sequence having at least 95% identity to SEQ ID NO:11, or consists of the amino acid sequence of SEQ ID NO:11.

[0075] In certain exemplary embodiments, the hMPV F polypeptide antigen is a pre-fusion F polypeptide.

[0076] In certain exemplary embodiments, the ORFs are codon optimized.

[0077] In certain exemplary embodiments, the mRNA comprises at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR), and at least one polyadenylation (poly(A)) sequence.

[0078] In certain exemplary embodiments, the mRNA comprises at least one chemical modification.

[0079] In certain exemplary embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of the uracil nucleotides in the mRNA are chemically modified.

[0080] In certain exemplary embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of the uracil nucleotides in the ORF are chemically modified.

[0081] In certain exemplary embodiments, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deaza-pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine and 2'-O-methyluridine. In certain exemplary embodiments, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof, hi certain exemplary embodiments, the chemical modification is N1-methylpseudouridine.

[0082] In certain exemplary embodiments, the mRNA is formulated in a lipid nanoparticle (LNP).

[0083] In certain exemplary embodiments, the LNP comprises at least one cationic lipid. In certain exemplary embodiments, the cationic lipid is biodegradable. In certain exemplary embodiments, the cationic lipid is not biodegradable. In certain exemplary embodiments, the cationic lipid is cleavable. In certain exemplary embodiments, the cationic lipid is not cleavable.

[0084] In certain exemplary embodiments, the cationic lipid is selected from the group consisting of OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10 and GL-HEPES-E3-E12-DS-3-E14. In certain exemplary embodiments, the cationic lipid is cKK-E10. In certain exemplary embodiments, the cationic lipid is GL-HEPES-E3-E12-DS-4-E10.

[0085] In certain exemplary embodiments, the LNP further comprises a polyethylene glycol (PEG)-conjugated (PEGylated) lipid, a cholesterol-based lipid, and a helper lipid.

[0086] In certain exemplary embodiments, the LNPs comprise cationic lipids in a molar ratio of 35% to 55%; polyethylene glycol (PEG)-conjugated (PEGylated) lipids in a molar ratio of 0.25% to 2.75%; cholesterol-based lipids in a molar ratio of 20% to 45%; and helper lipids in a molar ratio of 5% to 35%, all molar ratios being relative to the total lipid content of the LNP.

[0087] In certain exemplary embodiments, the LNPs comprise a 40% molar ratio of cationic lipid, a 1.5% molar ratio of PEGylated lipid, a 28.5% molar ratio of cholesterol-based lipid, and a 30% molar ratio of helper lipid.

[0088] In certain exemplary embodiments, the PEGylated lipid is dimyristoyl-PEG2000 (DMG-PEG2000) or 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

[0089] In certain exemplary embodiments, the cholesterol-based lipid is cholesterol.

[0090] In certain exemplary embodiments, the helper lipid is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) or 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0091] In certain exemplary embodiments, the LNPs comprise GL-HEPES-E3-E12-DS-4-E10 in a molar ratio of 40%, DMG-PEG2000 in a molar ratio of 1.5%, cholesterol in a molar ratio of 28.5%, and DOPE in a molar ratio of 30%.

[0092] In certain exemplary embodiments, the LNPs comprise cKK-E10 at a molar ratio of 40%, DMG-PEG2000 at a molar ratio of 1.5%, cholesterol at a molar ratio of 28.5%, and DOPE at a molar ratio of 30%.

[0093] In certain exemplary embodiments, the LNPs have an average diameter between 30 nm and 200 nm. In certain exemplary embodiments, the LNPs have an average diameter between 80 nm and 150 nm.

[0094] In certain exemplary embodiments, a pharmaceutical composition comprising the mRNA is provided, hi certain exemplary embodiments, the pharmaceutical composition comprises a vaccine.

[0095] In certain exemplary embodiments, a method of inducing an immune response against hMPV or protecting a subject from hMPV infection is provided, the method comprising administering a vaccine to a subject.

[0096] In certain exemplary embodiments, the subject has a comparable serum concentration of neutralizing antibodies to hMPV after administration of the vaccine compared to a subject administered a protein hMPV vaccine. In certain exemplary embodiments, the protein hMPV vaccine is co-administered with an adjuvant.

[0097] In certain exemplary embodiments, the vaccine increases serum concentrations of neutralizing antibodies in subjects with pre-existing hMPV immunity.

[0098] In certain exemplary embodiments, a vaccine is provided for use in eliciting an immune response against hMPV or protecting a subject from hMPV infection, comprising administering the vaccine to a subject.

[0099] In certain exemplary embodiments, there is provided the use of the vaccine in the manufacture of a medicament for inducing an immune response against hMPV or for protecting a subject from hMPV infection.

[0100] In certain exemplary embodiments, a method of inducing an immune response in a subject in need thereof is provided, comprising administering to the subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a prophylactically effective amount of a vaccine.

[0101] In certain exemplary embodiments, a method of preventing hMPV infection or alleviating one or more symptoms of hMPV infection is provided, the method comprising administering to a subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a prophylactically effective amount of a vaccine.

[0102] In certain exemplary embodiments, the use of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a vaccine is provided for the manufacture of a medicament for use in treating a subject in need of treatment.

[0103] In certain exemplary embodiments, an F polypeptide or nucleic acid molecule, a prophylactically effective amount of an mRNA, or a vaccine is provided for use in treating a subject in need of treatment.

[0104] In certain exemplary embodiments, a kit is provided that includes a container containing a single or multiple dose of an F polypeptide or nucleic acid molecule, a prophylactically effective amount of mRNA, or a vaccine, and optionally the container is a vial or a prefilled syringe or injector.

[0105] In certain exemplary embodiments, an expression vector encoding an F polypeptide, a nucleic acid molecule, or an mRNA is provided.

[0106] In certain exemplary embodiments, a cell is provided that comprises the expression vector.

[0107] In another aspect, a vaccine is provided comprising a human metapneumovirus (hMPV) F polypeptide antigen or a nucleic acid molecule encoding same, wherein the F polypeptide comprises an amino acid sequence having at least 95% identity to SEQ ID NO:7 or consists of the amino acid sequence of SEQ ID NO:7.

[0108] In certain exemplary embodiments, the hMPV F polypeptide is a pre-fusion F polypeptide.

[0109] In certain exemplary embodiments, a method of inducing an immune response against hMPV or protecting a subject from hMPV infection is provided, the method comprising administering a vaccine to a subject.

[0110] In certain exemplary embodiments, the vaccine is co-administered with an adjuvant. In certain exemplary embodiments, the vaccine is administered in combination with an additional vaccine. In certain exemplary embodiments, the additional vaccine is a respiratory syncytial virus (RSV) vaccine or an influenza vaccine.

[0111] In certain exemplary embodiments, the subject is a human, hi certain exemplary embodiments, the human subject is an infant, a young child, or an elderly person.

[0112] In certain exemplary embodiments, the vaccine increases serum concentrations of neutralizing antibodies and the subject has pre-existing hMPV immunity.

[0113] In certain exemplary embodiments, a vaccine is provided for use in eliciting an immune response against hMPV or protecting a subject from hMPV infection, comprising administering the vaccine to a subject.

[0114] In certain exemplary embodiments, there is provided the use of the vaccine in the manufacture of a medicament for inducing an immune response against hMPV or for protecting a subject from hMPV infection.

[0115] In certain exemplary embodiments, there is provided a method of inducing an immune response in a subject in need thereof, the method comprising administering to the subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of a vaccine.

[0116] In certain exemplary embodiments, a method is provided for preventing hMPV infection or alleviating one or more symptoms of hMPV infection, comprising administering to a subject, optionally intramuscularly, intranasally, intravenously, subcutaneously, or intradermally, a prophylactically effective amount of a vaccine.

[0117] In certain exemplary embodiments, there is provided a use of the vaccine for the manufacture of a medicament for use in treating a subject in need thereof.

[0118] In certain exemplary embodiments, a vaccine is provided for use in treating a subject in need of treatment.

[0119] In certain exemplary embodiments, a kit is provided that includes a container containing a single use dose or multiple use doses of the vaccine, optionally the container being a vial or a pre-filled syringe or injector.

[0120] In certain exemplary embodiments, an expression vector encoding an F polypeptide, a nucleic acid molecule, or an mRNA is provided.

[0121] In certain exemplary embodiments, a cell is provided that comprises the expression vector.

[0122] The above and other features and advantages of the present disclosure will be more fully understood from the following detailed description of exemplary embodiments taken in conjunction with the accompanying drawings. This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief description of the drawings]

[0123] [Figure 1] FIG. 1 shows design considerations for a panel of 21 candidate hMPV pre-fusion F antigens, shown as two exemplary constructs, D185P and T160_N46V. Construct D185P is used as a benchmark reference for measuring the activity of various novel constructs. "(mut)" = shaded "ENPRRRR" amino acid sequence and shaded "P", shaded "V" and shaded "F" single amino acids; "Linker" = bold, underlined "GGGGS", "GRS" and "G" amino acid sequences; "foldon" = underlined "GYIPEAPRDGQAYVRKDGEWVLLSTFL" amino acid sequence; "8xHIS" = shaded "HHHHHHHH" amino acid sequence; "StrepII" = shaded "SAWSHPQFEK" sequence. [Diagram 2] Mouse IgG antibody titers measured on days 0, 21, and 35 against four hMPV pre-fusion F antigen protein constructs (data points listed from left to right at each time point are as follows): (1) A2-F D185P, (2) A2-F T160F_N46V, (3) A2-F K138F, and (4) A2-F G366F_K362F, as well as controls: hMPV (5) A1-F pre-F lot 1, (6) A1-F pre-F lot 2, (7) A1-F postF, and (8) B2 pre-F. [Diagram 3] Figure 1 shows mouse hMPV microneutralizing antibody titers measured on days 21 and 35 against four hMPV pre-fusion F antigen protein constructs: (1) A2-F D185P, (2) A2-F T160F_N46V, (3) A2-F K138F, and (4) A2-F G366F_K362F and controls: hMPV (5) A1 pre-F lot 1, (6) A1 pre-F lot 2, (7) A1 postF, and (8) B2 pre-F. [Figure 4] FIG. 1 shows SEC-MALS results for the reference A1 proteins, A1-A185P and A1-postF and the A2 protein antigen candidates, A2-T160F_N46V and A2-D185P. [Diagram 5]Representative melting curves (upper panels), smoothed first derivative curves (middle panels), and light scattering [mAU] (lower panels) for A1-pre-F and A1-post-F [fluorescence emission at 330 and 350 nm] measured by nanoDSF. [Figure 6] Representative melting curves (top panel) and smoothed first derivative curves (middle panel) and light scattering [mAU] (bottom panel) for protein samples derived from A2-D185P and A2-T160F_N46V constructs [fluorescence emission at 330 and 350 nm] measured by nanoDSF. [Figure 7] FIG. 13 shows mouse hMPV F antigen IgG antibody titers upon administration of either hMPV pre-fusion F mRNA construct, A2-D185P or A2-T160F_N46V formulated with LNPs, measured on days 0, 21, and 35. [Figure 8] FIG. 13 shows mouse hMPV microneutralizing antibody titers upon administration of either hMPV pre-fusion F mRNA construct, A2-D185P or A2-T160F_N46V formulated with LNPs, measured on days 0, 21 and 35. [Figure 9] Figure 1 shows anti-RSV-F antibody titers in mice vaccinated with (1) RSV F mRNA, (2) RSV-F + hMPV-F mRNA, or (3) RSV proteins, as measured by end-point ELISA using RSV-pre-F protein as the binding antigen and detected with rabbit anti-mouse IgG. Readings from individual animals (n=8) are shown for the D35 time point as log2-transformed titers with mean + / - 95% confidence intervals. [Figure 10]1 shows anti-hMPV-F antibody titers in mice vaccinated with (1) hMPV F mRNA, (2) RSV-F+hMPV-F mRNA, or (3) hMPV proteins, as measured by end-point ELISA using hMPV-pre-F protein as binding antigen and detected with goat anti-mouse IgG. Readings from individual animals (n=8) are shown for the D35 time point as log2-transformed titers with mean + / - 95% confidence intervals. [Figure 11] Figure 1 shows RSV neutralizing antibody titers in mice vaccinated with (1) RSV F mRNA, (2) RSV-F+hMPV-F mRNA, or (3) RSV proteins, as measured by microneutralization assay using the RSV A2-GFP strain mixed with serially diluted sera from vaccinated mice on 96-well plates of Vero cells. Titers were determined by calculating the inverse reduction in fluorescent foci after 24 hours of incubation. Readings from individual animals (n=8) are shown for the D35 time point as log2-transformed titers with mean + / - 95% confidence intervals. [Figure 12] Figure 1 shows hMPV neutralizing antibody titers in mice vaccinated with (1) hMPV F mRNA, (2) RSV-F+hMPV-F mRNA, or (3) hMPV proteins, as measured by microneutralization assay using hMPV A2-GFP strain mixed with serially diluted sera from vaccinated mice on 96-well plates of Vero cells. Titers were determined by calculating the inverse decrease in fluorescent foci after 24 hours of incubation. Readings from individual animals (n=8) are shown for the D35 time point as log2-transformed titers with mean + / - 95% confidence intervals. [Figure 13] FIG. 1 shows an immunoblot of hMPV F protein expression levels for D185P and T160_N46V using 300,000 cells / well transfected with 1 μg of mRNA. [Figure 14]Figure 1 shows epitope expression in cells transfected with wild-type HMPV F, D185P or T160F_N46V using pre-F (panel A), post-F (panel B) or pre-F / post-F (panel C) antibodies. In each of panels A, B and C, the top line corresponds to MNR hMPV T160F_N46V, the middle line corresponds to MNR hMPV CAN97-83 and the bottom line corresponds to MNR hMPV D185P. [Figure 15] FIG. 1 shows the hMPV MIMIC setup to evaluate the immunogenicity of two hMPV candidates in 24 donors. [Figure 16] FIG. 1 shows human IgG antibody titers measured on day 14 recovered from supernatants of MIMIC co-cultures treated with either IPOL (polio vaccine) at 1:50 dilution against three polio strains - Polio 1 (Panel A), Polio 2 (Panel B) and Polio 3 (Panel C) or untreated control (no treatment and no human skeletal muscle cells in co-culture "No Antigen (No HSK)"). [Figure 17] Figure 1 shows human IgG antibody titers measured on day 14 harvested from supernatants of MIMIC co-cultures treated with 50 ng / ml RSV pre-F NP (RSV pre-F protein fused to ferritin nanoparticles) treatment against RSV pre-F (Panel A) and RSV post-F (Panel C). Panel C shows whether the antibodies were functional as measured by RSV neutralization assay. [Figure 18] FIG. 1 is a graphical representation of pre-F (Panel A) and post-F (Panel B) antibody responses. N=22; data are presented as geometric means with 95% CI. [Figure 19] FIG. 1 is a graphical representation of pre-F and post-F neutralizing antibody titers. N=22; data are presented as geometric mean with 95% CI. [Figure 20]Figure 14 shows human IgG antibody titers measured on day 14 harvested from supernatants of MIMIC co-cultures treated with experimental groups - hMPV pre-F protein (100 ng / ml or 500 ng / ml) or hMPV post-F antigen protein (100 ng / ml) or control groups - no antigen containing HSK, RSV pre-F NP, or IPOL against hMPV pre-F (panel A) or hMPV post-F antigen (panel B). [Figure 21] FIG. 1 shows hMPV microneutralizing antibody titers measured on day 14 using harvested supernatants of MIMIC cocultures treated with hMPV pre-F protein (100 ng / ml or 500 ng / ml), hMPV postF antigen protein (100 ng / ml), or no antigen without HSK. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0124] The present disclosure relates, inter alia, to antigenic pre-fusion hMPV F polypeptides, nucleic acid sequences (e.g., RNA sequences, e.g., mRNA sequences) encoding antigenic pre-fusion hMPV F polypeptides, compositions comprising antigenic pre-fusion hMPV F polypeptides, compositions comprising nucleic acid sequences encoding antigenic pre-fusion hMPV F polypeptides, and hMPV vaccines.

[0125] I. Definition Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. In case of conflict, the present specification, including definitions, will control. In general, the nomenclature and techniques used in connection with cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, pharmaceutical and medicinal chemistry, protein and nucleic acid chemistry, and hybridization described herein are those well known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. Furthermore, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. Throughout this specification and the embodiments, the words "have" and "comprise", or variations such as "has", "having", "comprises", or "comprising", are understood to imply the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of public documents are cited herein, this citation does not constitute an admission that any of these documents form part of the common general knowledge in the art.

[0126] The term "a" or "an" entity refers to one or more of that entity; for example, "a nucleotide sequence" is understood to refer to one or more nucleotide sequences. Thus, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein.

[0127] Furthermore, "and / or", when used herein, should be considered as a specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" as used in phrases such as "A and / or B" is intended herein to include "A and B", "A or B", "A" (single), and "B" (single). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to encompass each of the following embodiments: A, B, and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (single); B (single); and C (single).

[0128] Whenever an embodiment is described herein with the language "comprising," it is understood that similar embodiments that are otherwise described with the terms "consisting of" and / or "consisting essentially of" are also provided.

[0129] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this disclosure pertains. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press can provide those of ordinary skill in the art with a general dictionary of many of the terms used in this disclosure.

[0130] Units, prefixes and symbols are shown in the format accepted by the International System of Units (SI). Numerical ranges include the numbers defining the range. Unless otherwise indicated, amino acid sequences are written from left to right in amino to carboxy orientation. The headings provided herein are not limitations of the various aspects of the disclosure. Thus, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0131] The term "approximately" or "about" is used herein to mean approximately, around, or within the region. When the term "about" is used in connection with a numerical range, it modifies that range by extending the boundaries above and below the indicated numerical values. In general, the term "about" can modify a numerical value by a difference of, for example, 10 percent, above or below (higher or lower), above or below the indicated value. In some embodiments, the term indicates a deviation from the indicated numerical value of ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, ±0.1%, ±0.05%, or ±0.01%. In some embodiments, "about" indicates a deviation from the indicated numerical value of ±10%. In some embodiments, "about" indicates a deviation from the indicated numerical value of ±5%. In some embodiments, "about" refers to a ±4% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±3% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±2% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±1% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±0.9% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±0.8% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±0.7% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±0.6% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±0.5% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±0.4% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±0.3% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±0.1% deviation from the indicated numerical value. In some embodiments, "about" refers to a ±0.05% deviation from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.01% from the indicated numerical value.

[0132] As used herein, the term "messenger RNA" or "mRNA" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. An mRNA may contain one or more coding and non-coding regions. The coding region is alternatively referred to as an open reading frame (ORF). The non-coding region of an mRNA includes the 5' cap, 5' untranslated region (UTR), 3'UTR and poly(A) tail. An mRNA can be purified from a natural source, produced using a recombinant expression system (e.g., in vitro transcription), and optionally purified or chemically synthesized.

[0133] As used herein, the term "antigenic site φ" or "site φ epitope" refers to a site located in the prefusion form of the hMPV F trimer. The site φ epitope is a binding site for antibodies with specificity for prefusion hMPV F.

[0134] As used herein, the term "antigenic site V" or "site V epitope" refers to a site located in the pre-fusion form of the hMPV F trimer. The site V epitope is a binding site for antibodies with specificity for pre-fusion hMPV F.

[0135] As used herein, the term "antigen stability" refers to the stability of an antigen over time or in solution.

[0136] As used herein, the term "cavity-filling substitution" refers to engineered hydrophobic substitutions to fill a cavity present in the pre-fusion hMPV F trimer.

[0137] As used herein, the term "F protein" or "hMPV F protein" refers to the protein of hMPV involved in mediating the fusion of the viral envelope with the host cell membrane during viral entry. The F protein can mediate fusion between infected and uninfected cells to form multinucleated cells or syncytia.

[0138] As used herein, the terms "hMPV F polypeptide," "F polypeptide," or "F polypeptide antigen" refer to a polypeptide that includes at least one epitope of the hMPV F protein.

[0139] As used herein, the term "transmembrane domain" refers to an approximately 23 amino acid sequence near the c-terminus of hMPV F0 / F1 that spans the membrane of the hMPV virion. In certain embodiments, the transmembrane domain comprises the amino acid sequence GFIIVIILIAVLGSSMILVSIFII of SEQ ID NO:1.

[0140] As used herein, the term "cytoplasmic tail" refers to an approximately 25 amino acid sequence at the c-terminus of hMPV F0 / F1 that is located inside the virion. In certain embodiments, the transmembrane domain comprises the amino acid sequence IKKTKKPTGAPPELSGVTNNGFIPHN of SEQ ID NO:1.

[0141] As used herein, "foldon domain" refers to the trimerization domain of T4 fibritin.

[0142] As used herein, "signal peptide" or "signal sequence" refers to a peptide of about 16-30 amino acids in length present at the amino- or carboxy-terminus of a polypeptide that functions to translocate the polypeptide into the secretory pathway in the endoplasmic reticulum and Golgi apparatus. In certain embodiments, the signal sequence corresponds to amino acids 1-18 of any one of SEQ ID NOs: 1, 3, 5, and 7.

[0143] As used herein, a "tag sequence" or an "affinity tag" refers to a polypeptide sequence that can be used to purify a polypeptide or protein that contains the tag sequence. Examples of tag sequences include polyhistidine tags (e.g., hexahistidine (6xHis tag), octahistidine (8xHis tag), etc.), glutathione S-transferase (GST), FLAG, streptavidin-binding peptide (SBP), strep II, maltose-binding protein (MBP), calmodulin-binding protein (CBP), chitin-binding domain (CBD), S protein of RNase A, hemagglutinin (HA), c-Myc, etc.

[0144] As used herein, the term "intra-protomer stabilizing substitution" refers to an amino acid substitution in hMPV F that stabilizes the intra-protomer interactions of the hMPV F trimer, thereby stabilizing the pre-fusion conformation.

[0145] As used herein, the term "inter-protomer stabilizing substitution" refers to an amino acid substitution in hMPV F that stabilizes the interaction of the protomers of the hMPV F trimer, thereby stabilizing the prefusion conformation.

[0146] As used herein, the term "protease cleavage" refers to the proteolysis (sometimes referred to as "clipping") of a sensitive residue (e.g., lysine or arginine) at a protease cleavage site of a polypeptide sequence. Protease cleavage sites include viral protease cleavage sites, such as hMPV F0 protease cleavage site, respiratory syncytial virus (RSV) F0 protease cleavage site, and human rhinovirus 3C (HRV-3C) protease cleavage site.

[0147] As used herein, the term "post-fusion" with respect to hMPV F refers to the stable conformation of hMPV F that occurs after merging of viral and host cell membranes.

[0148] As used herein, the term "pre-fusion" with respect to hMPV F refers to the conformation of hMPV F adopted prior to virus-cell interaction.

[0149] As used herein, the term "protomer" refers to a structural unit of an oligomeric protein. In the case of hMPV F, the individual units of the hMPV F trimer are protomers.

[0150] As used herein, the term "immune response" refers to the reaction of a cell of the immune system, such as a B cell, T cell, dendritic cell, macrophage, or polymorphonuclear cell, to a stimulus, such as an antigen or a vaccine. An immune response can include any cell of the body that participates in a host defense response, including, for example, epithelial cells that secrete interferons or cytokines. Immune responses include, but are not limited to, an innate immune response and / or an adaptive immune response.

[0151] As used herein, a "protective immune response" refers to an immune response that protects a subject from infection (e.g., prevents infection or prevents the development of a disease associated with an infection). Methods of measuring immune responses include, for example, measuring lymphocyte (such as B cells or T cells) proliferation and / or activity, cytokine or chemokine secretion, inflammation, antibody production, and the like.

[0152] As used herein, an "antibody response" is an immune response in which antibodies are produced.

[0153] As used herein, "antigen" refers to an agent that, when exposed to or administered to an organism, elicits an immune response and / or binds to a T cell receptor (e.g., when presented by an MHC molecule) or an antibody (e.g., produced by a B cell). In some embodiments, the antigen elicits a humoral response in the organism (e.g., including production of antigen-specific antibodies). Alternatively or in addition, in some embodiments, the antigen elicits a cellular response in the organism (e.g., involving T cells whose receptors specifically interact with the antigen). A particular antigen may elicit an immune response in one or several members of a target organism (e.g., mice, rabbits, primates, humans), but not in all members of the target organism's species. In some embodiments, the antigen elicits an immune response in at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of members of the target species. In some embodiments, the antigen binds to an antibody and / or a T cell receptor and may or may not induce a specific physiological response in the organism. In some embodiments, for example, the antigen may bind to an antibody and / or a T cell receptor in vitro, regardless of whether such interactions occur in vivo. In some embodiments, the antigen reacts with the products of specific humoral or cellular immunity. Antigens include hMPV polypeptides described herein.

[0154] As used herein, "adjuvant" refers to a substance or vehicle that enhances the immune response to an antigen. Adjuvants can include, but are not limited to, suspensions of minerals (e.g., alum, aluminum hydroxide, or phosphates) to which antigens are adsorbed; water-in-oil or oil-in-water emulsions in which the antigen solution is emulsified in mineral oil or water (e.g., Freund's incomplete adjuvant). Killed mycobacteria are sometimes included to further enhance antigenicity (e.g., Freund's complete adjuvant). Immunostimulatory oligonucleotides (such as those containing CpG motifs) can also be used as adjuvants (see, for example, U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; 6,339,068; 6,406,705; and 6,429,199). Adjuvants can also include biological molecules such as Toll-like receptor (TLR) agonists and costimulatory molecules.

[0155] As used herein, an "antigenic hMPV polypeptide" refers to a polypeptide that includes all or a portion of an hMPV amino acid sequence of sufficient length that the molecule is antigenic to hMPV.

[0156] As used herein, a "subject" refers to any member of the animal kingdom. In some embodiments, a "subject" refers to a human. In some embodiments, a "subject" refers to a non-human animal. In some embodiments, a subject includes, but is not limited to, a mammal, a bird, a reptile, an amphibian, a fish, an insect, and / or a worm. In certain embodiments, a non-human subject is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, a cow, a primate, and / or a pig). In some embodiments, a subject may be a transgenic animal, a genetically engineered animal, and / or a clone. In some embodiments, the terms "individual" or "patient" are used and are intended to be interchangeable with "subject."

[0157] In some embodiments, the "subject" is selected from the group consisting of subjects aged 65 years or older, subjects aged 18-64 years (18-65 years), subjects aged 12 years or older, subjects aged 12-17 years (12-18 years), subjects aged 6-11 years (6-12 years), subjects aged 2-5 years (2-6 years), subjects aged 1-4 years (1-5 years), subjects aged 2 months to 1 year (2 months to 2 years), and subjects aged 0 months to 2 months (0 months to 3 months).

[0158] In some embodiments, the "subject" is selected from the group consisting of elderly (e.g., elderly or older adults), adults, adolescents, children, infants, and babies. In some embodiments, the "subject" is selected from the group consisting of elderly (e.g., 60 years or older), elderly (e.g., 65 years or older), adults (e.g., 18-50 years or 18-64 years), adolescents (e.g., 12-17 years) (e.g., 12-18 years), children (e.g., 6-11 years) (e.g., 6-12 years), children (e.g., 2-5 years) (e.g., 2-6 years), infants (e.g., 1-4 years) (e.g., 1-5 years), infants (e.g., 2 months to 2 years), newborns (e.g., 0-27 days), and premature infants (e.g., gestational age less than 37 weeks). In some embodiments, the subject belongs to the pediatric age group defined by the US FDA. Neonates (e.g., from birth to less than 1 month ("NEO"); infants (e.g., 1 month to less than 2 years ("INF"); children (e.g., 2 to less than 12 years "CHI"); and adolescents (e.g., 12 to less than 17 years ("ADO"). In some embodiments, the subject is an older adult, in the age groups defined by the U.S. FDA as 65 years or older or 75 years or older. In particularly exemplary embodiments, the subject is an infant (e.g., 1 month to less than 2 years), a toddler (e.g., 1 year to less than 5 years), or an elderly person (e.g., 60 years or older, 65 years or older, or 75 years or older).

[0159] As used herein, the term "vaccination" or "vaccinate" refers to the administration of a composition intended to generate an immune response, for example, against a disease-causing agent. Vaccination can occur before, during and / or after exposure to the disease-causing agent and / or before, during and / or after the onset of one or more symptoms, in some embodiments before, during and / or immediately after exposure to the disease-causing agent. In some embodiments, vaccination comprises multiple, appropriately or appropriately spaced administrations of the vaccinating composition.

[0160] As used herein, the term "therapeutic agent" or "therapeutic agent" refers to administration of a composition intended to reduce or eliminate one or more symptoms of hMPV infection. Therapeutic agents can be administered before, during, and / or after exposure to hMPV, and / or before, during, and / or after the onset of one or more symptoms. In some embodiments, the therapeutic agent is administered to the subject as multiple appropriately spaced doses of a vaccination composition, as appropriate.

[0161] This disclosure describes nucleic acid sequences (eg, DNA and RNA sequences) and amino acid sequences that have a degree of identity to a given nucleic acid sequence or amino acid sequence, respectively (eg, to a reference sequence).

[0162] The terms "% identical", "% identity" or similar terms are intended to refer in particular to the percentage of nucleotides or amino acids that are identical in optimal alignment between the sequences to be compared. "Sequence identity" between two nucleic acid sequences indicates the percentage of nucleotides that are identical between the sequences. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences. The percentage is purely statistical, and the differences between the two sequences may, but do not necessarily, have to be randomly distributed over the entire length of the sequences being compared. Comparison of two sequences is usually performed by comparing the sequences over a segment or "window of comparison" after optimal alignment in order to identify local regions of corresponding sequences. Optimal alignment for comparison can be performed manually or using the local homology algorithm of Smith and Waterman, 1981, Ads App. Math. 2, 482, using the local homology algorithm of Needleman and Wunsch, 1970, J. Mol. Biol. 48, 443, using the similarity search algorithm of Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or using computer programs which employ such algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N and TFASTA from the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).

[0163] The percentage of identity is obtained by determining the number of corresponding identical positions in the sequences being compared, dividing this number by the number of positions being compared (e.g., the number of positions in the reference sequence) and multiplying the result by 100.

[0164] In some embodiments, the degree of identity is given for a region that is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the entire length of the reference sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is given for at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 nucleotides, in some embodiments, in consecutive nucleotides. In some embodiments, the degree of identity is given for the entire length of the reference sequence.

[0165] A nucleic acid sequence or amino acid sequence that has a particular degree of identity to a given nucleic acid sequence or amino acid sequence, respectively, can have at least one functional characteristic of the given sequence, e.g., in some instances is functionally equivalent to the given sequence. In some embodiments, a nucleic acid sequence or amino acid sequence that has a particular degree of identity to a given nucleic acid sequence or amino acid sequence is functionally equivalent to the given sequence.

[0166] As used herein, the term "kit" refers to a packaged set of one or more compounds or compositions and one or more associated materials, such as solvents, solutions, buffers, instructions, or desiccants, or other associated components.

[0167] II. hMPV F Polypeptide Antigen Human metapneumovirus (hMPV) is a negative-sense single-stranded RNA virus that belongs to the Pneumovirus subfamily within the Paramyxovirus family. hMPV infects airway epithelial cells in the nose and lungs and is the second most common cause of lower respiratory tract infections in children after respiratory syncytial virus (RSV). hMPV is an enveloped virus that has a glycoprotein (G protein), a small hydrophobic protein (SH protein), and a fusion protein (F protein) on the virion surface.

[0168] Because hMPV is an enveloped virus, entry of hMPV into host cells requires fusion of the viral and cellular membranes. Paramyxovirus entry typically requires two viral glycoproteins, the fusion (F) and attachment (G, H, or HN) proteins, and membrane fusion promoted by all paramyxovirus glycoproteins examined occurs at neutral pH, with one possible exception (i.e., SER viruses). In addition to virus-cell membrane fusion, paramyxovirus glycoproteins also promote cell-cell fusion. Multinucleated giant cells, called syncytia, can be seen in tissues infected with various paramyxoviruses. Cultured cells infected with hMPV form syncytia, but examination of primary human airway epithelial cells infected with hMPV suggests that syncytium formation by this virus may not be a common in vivo occurrence.

[0169] hMPV F is a class I fusion glycoprotein that is synthesized as an inactive precursor (F0) that must be cleaved to become fusion-competent. Proteolytic cleavage generates two disulfide-linked subunits (N-terminus of F2 to F1) that assemble into a homotrimer. Cleavage occurs at a monobasic cleavage site immediately upstream of the hydrophobic fusion peptide. Cleavage can be achieved in tissue culture by adding exogenous trypsin to the medium or by adding a furin-expressing plasmid. However, in vivo, it is believed that other serine proteases, such as TMPRSS2, are more likely involved in cleavage. The F trimer is incorporated into the virus particle in a metastable "pre-fusion" or "pre-F" conformation. To initiate membrane fusion, hMPV F is activated and undergoes a series of stepwise conformational changes in the F protein that drive membrane fusion and result in hMPV F adopting a highly stable "post-fusion" or "post-F" conformation.

[0170] In certain exemplary embodiments, proteolytic cleavage of F0 is achieved by cotransfection of a plasmid encoding an hMPV F polypeptide with a plasmid encoding furin in a 4:1 ratio of hMPV plasmid:furin plasmid.

[0171] Provided herein are antigenic hMPV polypeptides, including hMPV F polypeptides. The hMPV F polypeptides can include the entire sequence of hMPV F or a portion of hMPV F. In certain embodiments, the portion is the ectodomain.

[0172] In some embodiments, the hMPV F polypeptide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.5% identity to any one of SEQ ID NOs:1, 3, 5 and 7.

[0173] In some embodiments, the hMPV F polypeptide comprises a modified hMPV F polypeptide having at least 80% identity to the polypeptide of any one of SEQ ID NOs: 1, 3, 5, and 7, wherein the hMPV F polypeptide is antigenic.

[0174] In some embodiments, the hMPV F polypeptide comprises only a portion of the ectodomain of the F protein.

[0175] The amino acid sequence of F0 of A2-CAN97-83 is as follows: [ka] (Accession number AAN52910; version AAN52910.1; DB source accession number AY145296.1). The transmembrane domain is bold and underlined, the cytoplasmic tail is bold.

[0176] The nucleotide sequence of F0 of A2-CAN97-83 is as follows: [ka]

[0177] In some embodiments, an epitope of the hMPV F protein shared between pre-F and post-F is blocked. Blocking the epitope reduces or eliminates the generation of antibodies against the epitope when an RNA (e.g., mRNA) encoding an antigenic hMPV F polypeptide is administered to a subject, or when an antigenic hMPV F polypeptide is administered to a subject. This can increase the proportion of antibodies targeting epitopes specific to a particular conformation of F, such as the pre-fusion conformation (e.g., antibodies targeting site φ and / or site V). Since F has a pre-fusion conformation in viruses that have not yet entered a cell, increasing the proportion of antibodies targeting pre-F can provide a greater degree of neutralization (e.g., expressed as a neutralization-to-binding ratio as described herein).

[0178] The hMPV F polypeptides described herein can have deletions or substitutions compared to the wild-type hMPV F protein (eg, SEQ ID NO:1).

[0179] For example, in certain embodiments, an hMPV polypeptide (a) lacks a transmembrane domain, lacks a cytoplasmic tail, and contains a human rhinovirus 3C (HRV-3C) protease cleavage site; (b) contains amino acid substitutions Q100R and S101R relative to SEQ ID NO: 1, which substitute an arginine for the glutamine at amino acid position 100 and an arginine for the serine at amino acid position 101. 0 (c) comprises a heterologous signal peptide; (d) comprises at least one tag sequence, which is optionally a polyhistidine tag (e.g., a 6xHis tag, an 8xHis tag, etc.) and / or a Strep II tag; and / or (e) comprises a foldon domain.

[0180] In certain embodiments, the hMPV polypeptide lacks a transmembrane domain, lacks a cytoplasmic tail, and comprises an F0 cleavage site mutation that includes amino acid substitutions Q100R and S101R relative to SEQ ID NO:1, which substitute arginine for glutamine at amino acid position 100 and arginine for serine at amino acid position 101; a human rhinovirus 3C (HRV-3C) protease cleavage site; a heterologous signal peptide; a polyhistidine tag (e.g., 6xHis tag, 8xHis tag, etc.) and / or a Strep II tag; and a foldon domain.

[0181] In certain embodiments, the hMPV polypeptide comprises a valine, alanine, glycine, isoleucine, leucine, or proline substitution at position 185 of SEQ ID NO:1.

[0182] In certain embodiments, the hMPV polypeptide includes a phenylalanine, tryptophan, tyrosine, valine, alanine, isoleucine, or leucine substitution at position 160 of SEQ ID NO:1, and / or a valine, alanine, isoleucine, leucine, phenylalanine, tyrosine, or proline substitution at position 46 of SEQ ID NO:1.

[0183] In certain embodiments, the hMPV polypeptide comprises a substitution at position 160 of SEQ ID NO:1 and a substitution at position 46 of SEQ ID NO:1, which are "stabilizing substitutions" that stabilize the tertiary and / or quaternary structure of the hMPV polypeptide. Stabilizing substitutions include, but are not limited to, hydrophobic amino acids (e.g., glycine, alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, tryptophan, proline, and methionine); hydrophilic amino acids (e.g., cysteine, serine, threonine, asparagine, and glutamine); amino acids that form disulfide bonds (e.g., cysteine); amino acids that form hydrogen bonds (e.g., tryptophan, histidine, tyrosine, and phenylalanine); charged amino acids (e.g., aspartic acid, glutamic acid, arginine, lysine, and histidine), and the like.

[0184] In certain embodiments, the hMPV polypeptide is derived from an A strain hMPV (eg, A1 or A2 subtype) or a B strain hMPV (eg, B1 or B2 subtype).

[0185] In certain embodiments, an amino acid sequence comprising a "backbone" F0 polypeptide sequence is provided and is described as follows: [ka]

[0186] In certain embodiments, a nucleotide sequence encoding a "backbone" F0 polypeptide sequence is provided and is described as follows: [ka]

[0187] In certain embodiments, an hMPV polypeptide comprises the "backbone" hMPV sequence set forth as SEQ ID NO:3, and may optionally include one or more amino acid substitutions. For example, in certain embodiments, an hMPV polypeptide comprises a valine, alanine, glycine, isoleucine, leucine, or proline substitution at position 185 of SEQ ID NO:3. In certain embodiments, an hMPV polypeptide comprises a phenylalanine, tryptophan, or tyrosine substitution at position 160 of SEQ ID NO:3, and / or a valine, alanine, glycine, isoleucine, leucine, or proline substitution at position 46 of SEQ ID NO:3. In certain embodiments, an hMPV polypeptide comprises an arginine substitution at one or both of positions 100 and 101 of SEQ ID NO:3.

[0188] In certain embodiments, the hMPV polypeptide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:3.

[0189] In certain embodiments, amino acid sequences comprising hMPV polypeptide sequences are provided and are set forth as follows: [ka] (D185P). (The amino acids in lower case indicate the linker, the foldon motif, the linker, the HRV-3C cleavage site, the linker, the 8X-His-tag and the strep-tagII region).

[0190] In certain embodiments, a nucleotide sequence encoding an hMPV polypeptide sequence is provided and is described as follows: [ka] (D185P).

[0191] In certain embodiments, a nucleotide sequence encoding an hMPV polypeptide sequence is provided and is described as follows: [ka] (D185P mRNA).

[0192] In certain embodiments, the hMPV polypeptide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:5. In certain embodiments, the hMPV polypeptide comprises SEQ ID NO:5. In certain embodiments, the hMPV polynucleotide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:6. In certain embodiments, the hMPV polynucleotide comprises SEQ ID NO:6. In certain embodiments, the hMPV polynucleotide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:17. In certain embodiments, the hMPV polynucleotide comprises SEQ ID NO:17.

[0193] In certain embodiments, an amino acid sequence is provided that includes an hMPV polypeptide sequence, described as follows: [ka] (T160F_N46V). (The amino acids in lower case indicate the linker, the foldon motif, the linker, the HRV-3C cleavage site, the linker, the 8X-His-tag and the strep-tagII region).

[0194] In certain embodiments, a nucleotide sequence encoding an hMPV polypeptide sequence is provided and is described as follows: [ka] (T160F_N46V).

[0195] In certain embodiments, a nucleotide sequence encoding an hMPV polypeptide sequence is provided and is described as follows: [ka] (T160F_N46V).

[0196] In certain embodiments, a nucleotide sequence encoding an hMPV polypeptide sequence is provided and is described as follows: [ka] (T160F_N46V).

[0197] In certain embodiments, the hMPV polypeptide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 7. In certain embodiments, the hMPV polypeptide comprises SEQ ID NO: 7. In certain embodiments, the hMPV polynucleotide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In certain embodiments, the hMPV polynucleotide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18. In certain embodiments, the hMPV polynucleotide comprises SEQ ID NO: 18. In certain embodiments, the hMPV polynucleotide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In certain embodiments, the hMPV polynucleotide comprises SEQ ID NO: 8. In certain embodiments, the hMPV polynucleotide has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 19. In certain embodiments, the hMPV polynucleotide comprises SEQ ID NO: 19.

[0198] In general, positions in the constructs described herein can be mapped to a reference sequence, e.g., the wild-type sequence of SEQ ID NO:1 or the backbone sequence of SEQ ID NO:3, by pairwise alignment, e.g., using the Needleman-Wunsch algorithm with standard parameters (EBLOSUM62 matrix, gap penalty of 10, gap extension penalty of 0.5).

[0199] III. Recombinant hMPV F Polypeptide Antigens In certain embodiments, the hMPV vaccine of the present disclosure may include at least one hMPV F polypeptide antigen. The hMPV F polypeptide antigen of the present disclosure may be produced by a variety of methods. In one embodiment, a host cell line, which may be of eukaryotic or prokaryotic origin, is used for the expression of the hMPV F polypeptide. In one embodiment, the host cell line used for the expression of the hMPV F polypeptide is of bacterial origin. In one embodiment, the host cell line used for the expression of the hMPV F polypeptide is of mammalian origin. The particular host cell line most suitable for the desired gene product to be expressed therein can be determined. Exemplary host cell lines include, but are not limited to, DG44 and DUXB11 (Chinese hamster ovary line, DHFR minus), HELA (human cervical carcinoma), CVI (monkey kidney line), COS (derivative of CVI with SV40 T antigen), CHO (Chinese hamster ovary), R1610 (Chinese hamster fibroblast) BALBC / 3T3 (mouse fibroblast), HAK (hamster kidney line), SP2 / O (mouse myeloma), BFA-1c1BPT (bovine endothelial cells), RAJI (human lymphocytes), and 293 (human kidney). Host cell lines are typically available from commercial services such as the American Tissue Culture Collection (ATCC) or from the public literature.

[0200] In certain embodiments, baculovirus cells can be used to express the hMPV F polypeptide antigens described herein. The baculovirus Autographa californica Nuclear Polyhedrosis Virus (AcNPV), for example, can be used to express hMPV F polypeptides.

[0201] Recombinant baculoviruses can be constructed to express hMPV F polypeptides by homologous recombination between baculovirus DNA and a chimeric plasmid containing the hMPV F sequence of interest. Recombinant viruses can be detected by their distinct plaque morphology and plaque purified to homogeneity.

[0202] Recombinant hMPV F polypeptides can be produced in cells, including, but not limited to, cells from the Lepidopteran species Spodoptera frugiperda. Other suitable insect cells that can be infected with baculovirus, such as those from the species Bombyx mori, Galleria mellanoma, Trichplusia ni, or Lamanthria dispar, can also be used as suitable substrates for producing recombinant hMPV F polypeptides.

[0203] Recombinant hMPV F polypeptide can also be expressed in other expression vectors, such as Entomopox virus (insect poxvirus), cytoplasmic polyhedrosis virus (CPV), and transformation of insect cells with constitutive expression of the recombinant hMPV F gene.

[0204] Baculovirus expression of recombinant proteins is further described in US Pat. No. 5,762,919, which is incorporated by reference in its entirety for all purposes.

[0205] In certain embodiments, algal cells, such as microalgal cells, can be used to express the recombinant hMPV F polypeptide antigens described herein. In some embodiments, the microalgal host cell is a heterokont or a stramenopile. In some embodiments, the microalgal host cell is a member of the phylum Labyrinthulomycota. In some embodiments, the Labyrinthulomycota host cell is a member of the order Thraustochytriles or Labyrinthulodales.

[0206] Expression systems used for expression of hMPV polypeptide antigens in microalgal host cells contain regulatory control elements active in microalgal cells. In some embodiments, the expression system contains regulatory control elements active in Labyrinthulomycota cells. In some embodiments, the expression system contains regulatory control elements active in Thraustochytri. In some embodiments, the expression system contains regulatory control elements that are active in Schizophyllum commune or Thraustochytrium. Many regulatory control elements, including various promoters, are active in many different species. Thus, the regulatory sequences can be utilized in the same cell type as the cell from which they were isolated, or can be utilized in a cell type different from the cell from which they were isolated.

[0207] In some embodiments, the expression system used for producing hMPV F polypeptide in microalgae cells comprises regulatory elements derived from Labyrinthulomycota sequences. In some embodiments, the expression system used for producing hMPV F polypeptide in microalgae cells comprises regulatory elements derived from non-Labyrinthulomycota sequences, including sequences derived from non-Labyrinthulomycota algae sequences. In some embodiments, the expression system comprises a polynucleotide sequence encoding an hMPV F polypeptide, the polynucleotide sequence being associated with any promoter sequence, any terminator sequence, and / or any other regulatory sequence that is functional in a microalgae host cell. Inducible or constitutively active sequences can be used. In certain embodiments, an expression cassette for expression of hMPV F polypeptide in a microalgae host cell, as well as an algae cell comprising the same, is provided.

[0208] Microalgal expression of recombinant proteins is described in WO 2011 / 082189 and WO 2011 / 090731, which are incorporated by reference in their entireties for all purposes.

[0209] In certain embodiments, CHO cells can be used to express the hMPV F polypeptides described herein. In certain embodiments, a CHO cell line is provided that contains a vector expressing hMPV F. In certain embodiments, the CHO cell line is transfected (either stably or transiently transfected) with the vector. In certain embodiments, the CHO cell line contains the vector integrated into its genome. CHO cell lines are commonly used for industrial protein production, and many CHO cell lines are known and commercially available, for example, from ATCC. For example, such CHO cell lines include, for example, CHO-K1 cell line (ATCC number: CCL-61), CHO DP-12 cell line (ATCC numbers CRL-12444 and 12445), and CHO1-15 cell line (ATCC number CRL-9606).

[0210] In vitro production allows for scale-up to obtain large amounts of the desired polypeptide. Techniques for culturing cells under tissue culture conditions are known in the art and include, for example, homogenous suspension culture in airlift or continuous stirred reactors, or culturing cells immobilized or entrapped, for example, in hollow fibers, in microcapsules, on agarose microbeads or on ceramic cartridges. If necessary and / or desired, the solution of the polypeptide can be purified using conventional chromatographic methods, such as gel filtration, ion exchange chromatography, chromatography on DEAE-cellulose, and / or (immuno) affinity chromatography.

[0211] IV. RNA In certain embodiments, the hMPV vaccines of the present disclosure may comprise at least one ribonucleic acid (RNA) comprising an ORF encoding an hMPV F polypeptide antigen. In certain embodiments, the RNA is a messenger RNA (mRNA) comprising an ORF encoding an hMPV F protein antigen. In certain embodiments, the RNA (e.g., mRNA) further comprises at least one of a 5'UTR, a 3'UTR, a poly(A) tail, and / or a 5' cap.

[0212] In certain embodiments, the hMPV F protein antigen is described as follows: [ka] (A2-D185P).

[0213] In certain embodiments, the hMPV F protein antigen is encoded by the mRNA ORF set forth as (SEQ ID NO:6) (A2-D185P mRNA ORF).

[0214] In certain embodiments, the hMPV F protein antigen is encoded by the codon-optimized mRNA ORF shown as (SEQ ID NO: 17) (AD185P mRNA ORF).

[0215] In certain embodiments, the hMPV F protein antigen is described as follows: [ka] (A2-T160F_N46V).

[0216] In certain embodiments, the hMPV F protein antigen is encoded by the mRNA ORF set forth as (SEQ ID NO:8) (A2-T160F_N46V mRNA ORF).

[0217] In certain embodiments, the hMPV F protein antigen is encoded by the codon-optimized mRNA ORF shown as (SEQ ID NO: 18) (T160F_N46V mRNA ORF).

[0218] In certain embodiments, the hMPV F protein antigen is encoded by the codon-optimized mRNA ORF shown as (SEQ ID NO: 19) (T160F_N46V mRNA ORF).

[0219] II.A.5' Cap The 5' cap of an mRNA provides resistance to nucleases found in most eukaryotic cells and can promote translation efficiency. Several types of 5' caps are known: 7-methylguanosine cap ("m-cap"); 7 The second transcribed nucleotide (also called "Cap-G" or "Cap-0") contains a guanosine linked to the first transcribed nucleotide via a 5'-5'-triphosphate bond.

[0220] A 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyltransferase, generating a 5'5'5 triphosphate linkage; then, the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp, (5'(A, G(5')ppp(5')A, and G(5')ppp(5')G. Additional cap structures are described in U.S. Patent Application Publication Nos. 2016 / 0032356 and 2018 / 0125989, which are incorporated herein by reference.

[0221] 5'-capping of polynucleotides can be completed simultaneously during in vitro transcription reactions using the following chemical RNA cap analogs to generate 5'-guanosine cap structures according to manufacturer's protocols: 3'-O-Me-m7G(5')ppp(5')G (ARCA cap); G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A; m7G(5')ppp(5')G; m7G(5')ppp(5')(2'OMeA)pG; m7G(5')ppp(5')(2'OMeA)pU; and m7G(5')ppp(5')(2'OMeG)pG (New England BioLabs, Ipswich, MA; TriLink Biotechnologies). 5'-capping of modified RNAs can be completed post-transcriptionally using vaccinia virus capping enzyme to generate Cap0 structures. m7G(5')ppp(5')G. The Cap1 structure can be generated using both vaccinia virus capping enzyme and 2'-O methyl-transferase to generate m7G(5')ppp(5')G-2'-O-methyl. The Cap2 structure can be generated from the Cap1 structure, followed by 2'-O-methylation of the 5'-penultimate nucleotide using 2'-O methyl-transferase. The Cap3 structure can be generated from the Cap2 structure, followed by 2'-O-methylation of the 5'-penultimate nucleotide using 2'-O methyl-transferase.

[0222] In certain embodiments, an mRNA of the disclosure comprises a 5' cap selected from the group consisting of 3'-O-Me-m7G(5')ppp(5')G (ARCA cap), G(5')ppp(5')A, G(5')ppp(5')G, m7G(5')ppp(5')A, m7G(5')ppp(5')G, m7G(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU and m7G(5')ppp(5')(2'OMeG)pG.

[0223] In certain embodiments, the mRNA of the disclosure comprises: [ka] Contains the 5' cap.

[0224] II.B. Untranslated Regions (UTRs) In some embodiments, an mRNA of the present disclosure comprises a 5' and / or 3' untranslated region (UTR). In an mRNA, the 5' UTR begins at the transcription initiation site and continues up to but not including the start codon. The 3' UTR begins immediately after the stop codon and continues to the transcription termination signal.

[0225] In some embodiments, the mRNA disclosed herein may comprise a 5'UTR that comprises one or more elements that affect mRNA stability or translation. In some embodiments, the 5'UTR may be about 10-5,000 nucleotides in length. In some embodiments, the 5'UTR may be about 50-500 nucleotides in length. In some embodiments, the 5'UTR may be at least about 10 nucleotides in length, about 20 nucleotides in length, about 30 nucleotides in length, about 40 nucleotides in length, about 50 nucleotides in length, about 100 nucleotides in length, about 150 nucleotides in length, about 200 nucleotides in length, about 250 nucleotides in length, about 300 nucleotides in length, about 350 nucleotides in length, about 400 nucleotides in length, about 450 nucleotides in length, about 500 nucleotides in length, about 550 nucleotides in length, about 600 nucleotides in length, about The length is 650 nucleotides, about 700 nucleotides, about 750 nucleotides, about 800 nucleotides, about 850 nucleotides, about 900 nucleotides, about 950 nucleotides, about 1,000 nucleotides, about 1,500 nucleotides, about 2,000 nucleotides, about 2,500 nucleotides, about 3,000 nucleotides, about 3,500 nucleotides, about 4,000 nucleotides, about 4,500 nucleotides, or about 5,000 nucleotides.

[0226] In some embodiments, the mRNAs disclosed herein may include a 3'UTR that includes one or more of a polyadenylation signal, a binding site for a protein that affects the stability of the mRNA's location in a cell, or one or more binding sites for an miRNA. In some embodiments, the 3'UTR may be 50-5,000 nucleotides in length or longer. In some embodiments, the 3'UTR may be 50-1,000 nucleotides in length or longer. In some embodiments, the 3'UTR is at least about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, or 5,000 nucleotides long.

[0227] In some embodiments, an mRNA disclosed herein may contain a 5' or 3' UTR that is derived from a gene that is different from the gene encoded by the mRNA transcript (i.e., the UTR is a heterologous UTR).

[0228] In certain embodiments, the 5' and / or 3' UTR sequences may be derived from stable (e.g., globin, actin, GAPDH, tubulin, histones, or citric acid cycle enzymes) mRNAs to enhance the stability of the mRNA. For example, the 5' UTR sequence may include a subsequence of the CMV immediate early 1 (IE1) gene or a fragment thereof to improve nuclease resistance and / or improve half-life of the mRNA. It is also contemplated to include a sequence encoding human growth hormone (hGH) or a fragment thereof at the 3' end or untranslated region of the mRNA. In general, these modifications include modifications made to improve the stability and / or pharmacokinetic properties (e.g., half-life) of the mRNA compared to the unmodified counterpart, e.g., to improve such mRNA resistance to in vivo nuclease digestion.

[0229] Exemplary 5'UTRs include sequences from the CMV immediate early 1 (IE1) gene (see U.S. Patent Application Publication Nos. 2014 / 0206753 and 2015 / 0157565, each of which is incorporated by reference herein), or the sequence GGGAUCCUACC (SEQ ID NO: 16) (see U.S. Patent Application Publication No. 2016 / 0151409, which is incorporated by reference herein in its entirety for all purposes).

[0230] In various embodiments, the 5'UTR may be derived from the 5'UTR of a TOP gene. TOP genes are typically characterized by the presence of a 5' terminal oligopyrimidine (TOP) tract. Furthermore, most TOP genes are characterized by growth-related translational regulation. However, TOP genes with tissue-specific translational regulation are also known. In certain embodiments, the 5'UTR derived from the 5'UTR of a TOP gene lacks a 5'TOP motif (oligopyrimidine tract) (e.g., U.S. Patent Application Publication Nos. 2017 / 0029847, 2016 / 0304883, 2016 / 0235864, and 2016 / 0166710, each of which is incorporated herein by reference).

[0231] In certain embodiments, the 5'UTR is derived from the ribosomal protein large 32 (L32) gene (US Patent Application Publication No. 2017 / 0029847, supra).

[0232] In certain embodiments, the 5'UTR is derived from the 5'UTR of the hydroxysteroid (17b) dehydrogenase 4 gene (HSD17B4) (US Patent Publication No. 2016 / 0166710, supra).

[0233] In certain embodiments, the 5'UTR is derived from the 5'UTR of the ATP5A1 gene (US Patent Application Publication No. 2016 / 0166710, supra).

[0234] In some embodiments, an internal ribosome entry site (IRES) is used in place of the 5'UTR.

[0235] In some embodiments, the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO: 13: [ka]

[0236] In some embodiments, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO: 14: CGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUC. The 5'UTR and 3'UTR are described in further detail in WO 2012 / 075040, which is incorporated herein by reference.

[0237] II.C. Polyadenylation Tail As used herein, the terms "poly(A) sequence," "poly(A) tail," and "poly(A) region" refer to a sequence of adenosine nucleotides at the 3' end of an mRNA molecule. The poly(A) tail may confer stability to the mRNA and protect it from exonuclease degradation. The poly(A) tail may enhance translation. In some embodiments, the poly(A) tail is essentially homopolymeric. For example, a poly(A) tail of 100 adenosine nucleotides may have a length of essentially 100 nucleotides. In certain embodiments, the poly(A) tail may be interrupted by at least one nucleotide that is different from an adenosine nucleotide (e.g., a nucleotide that is not an adenosine nucleotide). For example, a poly(A) tail of 100 adenosine nucleotides may have a length of more than 100 nucleotides (comprising 100 adenosine nucleotides and at least one nucleotide or stretch of nucleotides that is different from an adenosine nucleotide). In certain embodiments, the poly(A) tail comprises the sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 15).

[0238] As used herein, a "poly(A) tail" typically relates to RNA. However, in the context of the present disclosure, the term also relates to the corresponding sequence in a DNA molecule (e.g., a "poly(T) sequence").

[0239] The poly(A) tail can comprise from about 10 to about 500 adenosine nucleotides, from about 10 to about 200 adenosine nucleotides, from about 40 to about 200 adenosine nucleotides, or from about 40 to about 150 adenosine nucleotides. The length of the poly(A) tail can be at least about 10, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, or 500 adenosine nucleotides.

[0240] In some embodiments where the nucleic acid is RNA, the poly(A) tail of the nucleic acid is obtained from a DNA template during in vitro transcription of the RNA. In certain embodiments, the poly(A) tail is obtained in vitro by common chemical synthesis methods without being transcribed from a DNA template. In various embodiments, the poly(A) tail is generated by enzymatic polyadenylation of the RNA (after RNA in vitro transcription) using a commercially available polyadenylation kit and corresponding protocol, or alternatively by using immobilized poly(A) polymerase, for example, using the methods described in WO 2016 / 174271.

[0241] The nucleic acid may comprise a poly(A) tail obtained by enzymatic polyadenylation, with the majority of the nucleic acid molecules comprising from about 100 (+ / -20) to about 500 (+ / -50) or about 250 (+ / -20) adenosine nucleotides.

[0242] In some embodiments, the nucleic acid can include a poly(A) tail derived from the template DNA, and can further include at least one additional poly(A) tail generated by enzymatic polyadenylation, e.g., as described in WO 2016 / 091391.

[0243] In certain embodiments, the nucleic acid comprises at least one polyadenylation signal.

[0244] In various embodiments, the nucleic acid can include at least one poly(C) sequence.

[0245] As used herein, the term "poly(C) sequence" is intended to mean a sequence of up to about 200 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 10 to about 200 cytosine nucleotides, about 10 to about 100 cytosine nucleotides, about 20 to about 70 cytosine nucleotides, about 20 to about 60 cytosine nucleotides, or about 10 to about 40 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 30 cytosine nucleotides.

[0246] II.D. Chemical modification The mRNA disclosed herein may be modified or unmodified. In some embodiments, the mRNA may include at least one chemical modification. In some embodiments, the mRNA disclosed herein may include one or more modifications that typically enhance RNA stability. Exemplary modifications may include backbone modifications, sugar modifications, or base modifications. In some embodiments, the disclosed mRNA may be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides), including but not limited to purines (adenine (A) and guanine (G)) or pyrimidines (thymine (T), cytosine (C), and uracil (U)). In certain embodiments, the disclosed mRNAs may contain modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxymethylaminomethyl) ... uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, β-D-mannosyl-queosine, phosphoramidate, phosphorothioate, peptide nucleotide, methylphosphonate, 7-deazaguanosine, 5-methylcytosine, and inosine.

[0247] In some embodiments, the disclosed mRNA may comprise at least one chemical modification including, but not limited to, pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deaza-pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0248] In some embodiments, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof.

[0249] In some embodiments, the chemical modification comprises N1-methylpseudouridine.

[0250] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of the uracil nucleotides in the mRNA are chemically modified.

[0251] In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of the uracil nucleotides in the ORF are chemically modified.

[0252] The preparation of such analogs is described, for example, in U.S. Pat. Nos. 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530, and 5,700,642.

[0253] II.E. mRNA synthesis The mRNA disclosed herein can be synthesized according to any of a variety of methods. For example, the mRNA according to the present disclosure can be synthesized via in vitro transcription (IVT). Some methods for in vitro transcription are described, for example, in Geall et al. (2013) Semin. Immunol. 25(2): 152-159; Brunelle et al. (2013) Methods Enzymol. 530: 101-14. Briefly, IVT is typically performed using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, a suitable RNA polymerase (e.g., T3, T7 or SP6 RNA polymerase), DNase I, pyrophosphatase and / or RNase inhibitor. The exact conditions may vary depending on the particular application. The presence of these reagents is generally undesirable in the final mRNA product, and these reagents can be considered impurities or contaminants that can be purified or removed to provide clean and / or homogenous mRNA suitable for therapeutic use. In some embodiments, mRNA provided from an in vitro transcription reaction may be desired, although other sources of mRNA can be used in accordance with the present disclosure, including wild-type mRNA produced from bacteria, fungi, plants and / or animals.

[0254] V. Lipid Nanoparticles (LNPs) The LNPs of the present disclosure can include lipids from four categories: (i) ionizable lipids (e.g., cationic lipids); (ii) PEGylated lipids; (iii) cholesterol-based lipids (e.g., cholesterol), and (iv) helper lipids.

[0255] A. Cationic lipids Ionizable lipids promote mRNA encapsulation and can be cationic lipids. Cationic lipids provide a positively charged environment at low pH, promoting efficient encapsulation of negatively charged mRNA drug substances. Exemplary cationic lipids are shown in Table 1 below.

[0256] [Table 1]

[0257] [Table 2]

[0258] [Table 3]

[0259] [Table 4]

[0260] [Table 5]

[0261] The cationic lipids were [ckkE10] / [OF-02], [(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl] 4-(dimethylamino)butanoate (D-Lin-MC3-DMA); 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA); 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLin-DMA); di((Z)-non-2-en-1-yl) 9-((4 -(Dimethylamino)butanoyl)oxy)heptadecanedioate (L319);9-heptadecanyl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102);[(4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315);[3-(Dimethylamino)-2-[(Z)-octadec-9-enoyl]oxypropyl](Z)-octadec-9-enoate ( DODAP;2,5-bis(3-aminopropylamino)-N-[2-[di(heptadecyl)amino]-2-oxoethyl]pentanamide (DOGS);[(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]N-[2-(dimethylamino)ethyl]carbamate (DC-C hol);Tetrakis(8-methylnonyl)3,3',3'',3'''-(((methylazanediyl)bis(propane-3,1diyl))bis(azanetriyl))tetrapropionic acid (306Oi10);Decyl(2-(dioctylammonio)ethyl)phosphate (9A1P9);Ethyl 5,5-di((Z)-heptadec-8-en-1-yl)-1-(3-(pyrrolidin-1-yl)propyl)-2,5-dihydro-1H-imidazole-2-carboxylate (A2-iso5-2DC18);Bis(2-(dodecyldisulfanyl)ethyl)3,3'-((3-methyl-9-oxo-10-oxa-13,14-dithia-3,6-diazahexacosyl)azanediyl)dipropionate (BAME-O16B);1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200);3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione (cKK-E12);Hexa(octa) 9,9',9'',9''',9'''',9'''''-((((benzene-1,3,5-tricarbonyl)iris(azanediyl))tris(propane-3,1-diyl))tris(azanetriyl))hexanoate (FTT5);(((3,6-dioxopiperazine-2,5-diyl)bis(butane-4,1-diyl))bis(azanetriyl))tetrakis(ethane-2,1-diyl) (9Z,9'Z,9''Z,9''Z,12Z,12'Z,12''Z,12''Z)-tetrakis(octadeca-9,12-dienoate) (OF-Deg-Lin);TT3;N; 1 ,N 3 ,N 5 -tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide; N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarboxamide)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5); heptadecan-9-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (Lipid 5); and combinations thereof.

[0262] In certain embodiments, the cationic lipid is biodegradable.

[0263] In various embodiments, the cationic lipid is not biodegradable.

[0264] In some embodiments, the cationic lipid is cleavable.

[0265] In certain embodiments, the cationic lipid is not cleavable.

[0266] Cationic lipids are described in further detail in Dong et al. (PNAS.111;11:3955-60.2014); Fenton et al. (Adv Mater.28:2939.2016); U.S. Patent No. 9,512,073; and U.S. Patent No. 10,201,618, each of which is incorporated herein by reference.

[0267] B. PEGylated lipids PEGylated lipid components provide control of nanoparticle size and stability. The addition of such components can prevent complex aggregation, extend circulation life, and provide a means to increase the delivery of lipid-nucleic acid pharmaceutical compositions to target tissues (Klibanov et al., FEBS Letters 268(1):235-71990). These components can be selected to be rapidly exchanged from the pharmaceutical composition in vivo (see, for example, U.S. Patent No. 5,885,613).

[0268] Contemplated PEGylated lipids include C PEG-10 lipids, such as derivatized ceramides (e.g., N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)] (C PEG ceramide)). 6 ~C 20 (For example, C 8 , C 10 , C 12 , C 14 , C 16 Or C 18Examples of PEGylated lipids include, but are not limited to, polyethylene glycols (PEGs) of up to 5 kDa length covalently attached to lipids having alkyl chains of up to 5 kDa length. In some embodiments, the PEGylated lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG); 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DSPE-PEG); 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DLPE-PEG); or 1,2-distearoyl-rac-glycero-polyethylene glycol (DSG-PEG), PEG-DAG; PEG-PE; PEG-S-DAG; PEG-S-DMG; PEG-cer; PEG-dialkyloxypropyl carbamate; 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159); and combinations thereof.

[0269] In certain embodiments, the PEG has a high molecular weight, e.g., 2000-2400 g / mol. In certain embodiments, the PEG is PEG2000 (or PEG-2K). In certain embodiments, the PEGylated lipid herein is DMG-PEG2000, DSPE-PEG2000, DLPE-PEG2000, DSG-PEG2000, C8PEG2000, or ALC-0159 (2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide). In certain embodiments, the PEGylated lipid herein is DMG-PEG2000.

[0270] C. Cholesterol-based lipids The cholesterol component provides stability to the lipid bilayer structure within the nanoparticle. In some embodiments, the LNP comprises one or more cholesterol-based lipids. Suitable cholesterol-based lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao et al., Biochem Biophys Res Comm. (1991) 179:280; Wolf ...), and / or 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao et al., Biochem Biophys Res Comm. (1991) 179:280). al., BioTechniques (1997) 23:139; U.S. Patent No. 5,744,335), imidazole cholesterol esters ("ICE"; WO 2011 / 068810), sitosterol (22,23-dihydrostigmasterol), β-sitosterol, sitostanol, fucosterol, stigmasterol (stigmasta-5,22-dien-3-ol), ergosterol; desmosterol (3β-hydroxy-5,24-cholestadiene); lanosterol (8,24-lanostadien-3b-ol); 7-dehydrocholesterol (Δ5,7-cholesterol); dihydrolanosterol (24,25 -dihydrolanosterol); zymosterol (5α-cholest-8,24-dien-3β-ol); lathosterol (5α-cholest-7-en-3β-ol); diosgenin ((3β,25R)-spirost-5-en-3-ol); campesterol (campest-5-en-3β-ol); campestanol (5a-campestan-3b-ol); 24 methylene cholesterol (5,24(28)-cholestadien-24-methylene-3β-ol); cholesteryl margarate (cholest-5-en-3β-yl heptadecanoate); cholesteryl oleate; cholesteryl stearate and other modified forms of cholesterol. In some embodiments, the cholesterol-based lipid used in the LNP is cholesterol.

[0271] D. Helper lipids The helper lipid enhances the structural stability of the LNP and aids the LNP in endosomal escape, which improves the uptake and release of the mRNA drug payload. In some embodiments, the helper lipid is a zwitterionic lipid with fusogenic properties to enhance the uptake and release of the drug payload. Examples of helper lipids are 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phospho-L-serinecholine (DOPS), 1,2-dielideyl-sn-glycero-3-phosphoethanolamine (DEPE) and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), DMPC, 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC); 1,2-distearoylphosphatidylethanolamine (DSPE) and 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE).

[0272] Other exemplary helper lipids are dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), phosphatidylserine, sphingolipids, sphingomyelin, ceramide, cerebrosides, gangliosides, 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), or combinations thereof. In certain embodiments, the helper lipid is DOPE. In certain embodiments, the helper lipid is DSPC.

[0273] In various embodiments, the LNP comprises: (i) a cationic lipid selected from OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, or GL-HEPES-E3-E12-DS-3-E14; (ii) DMG-PEG2000; (iii) cholesterol; and (iv) DOPE.

[0274] E. Molar ratio of lipid components The molar ratio of the above components is important for the effectiveness of the LNP in delivering mRNA. The molar ratio of cationic lipid, PEGylated lipid, cholesterol-based lipid and helper lipid is A:B:C:D (where A+B+C+D=100%). In some embodiments, the molar ratio of cationic lipid in the LNP to total lipid (i.e., A) is 35-55%, such as 35-50% (e.g., 38-42%, such as 40% or 45-50%). In some embodiments, the molar ratio of PEGylated lipid component to total lipid (i.e., B) is 0.25-2.75% (e.g., 1-2%, such as 1.5%). In some embodiments, the molar ratio of cholesterol-based lipid to total lipid (i.e., C) is 20-50% (e.g., 27-30%, such as 28.5% or 38-43%). In some embodiments, the molar ratio of helper lipid to total lipid (i.e., D) is 5-35% (e.g., 28-32%, such as 30%, or 8-12%, such as 10%). In some embodiments, the (PEGylated lipid + cholesterol) components have the same molar amount as the helper lipid. In some embodiments, the LNPs have a molar ratio of cationic lipid to helper lipid of greater than 1.

[0275] In certain embodiments, the LNPs of the disclosure include cationic lipid in a molar ratio of 35% to 55% or 40% to 50% (e.g., 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54% or 55% cationic lipid); Polyethylene glycol (PEG) conjugated (PEGylated) lipids in a molar ratio of 0.25% to 2.75% or 1.00% to 2.00% (e.g., 0.25%, 0.50%, 0.75%, 1.00%, 1.25%, 1.50%, 1.75%, 2.00%, 2.25%, 2.50% or 2.75% molar ratio of PEGylated lipid); Cholesterol-based lipids in a molar ratio of 20% to 50%, 25% to 45%, or 28.5% to 43% (e.g., cholesterol-based lipids in a molar ratio of 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49% or 50%); and A molar ratio of helper lipid of 5% to 35%, 8% to 30%, or 10% to 30% (e.g., 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34% or 35% molar ratio of helper lipid), All molar ratios are relative to the total lipid content of the LNPs.

[0276] In certain embodiments, the LNP comprises a 40% molar ratio of cationic lipid, a 1.5% molar ratio of PEGylated lipid, a 28.5% molar ratio of cholesterol-based lipid, and a 30% molar ratio of helper lipid.

[0277] In certain embodiments, the PEGylated lipid is dimyristoyl-PEG2000 (DMG-PEG2000).

[0278] In various embodiments, the cholesterol-based lipid is cholesterol.

[0279] In some embodiments, the helper lipid is 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE).

[0280] In certain embodiments, the LNPs comprise OF-02 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DOPE in a molar ratio of 5% to 35%.

[0281] In certain embodiments, the LNPs comprise cKK-E10 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DOPE in a molar ratio of 5% to 35%.

[0282] In certain embodiments, the LNPs comprise GL-HEPES-E3-E10-DS-3-E18-1 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DOPE in a molar ratio of 5% to 35%.

[0283] In certain embodiments, the LNPs comprise GL-HEPES-E3-E12-DS-4-E10 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DOPE in a molar ratio of 5% to 35%.

[0284] In certain embodiments, the LNPs comprise GL-HEPES-E3-E12-DS-3-E14 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DOPE in a molar ratio of 5% to 35%.

[0285] In certain embodiments, the LNPs comprise SM-102 in a molar ratio of 35% to 55%; DMG-PEG2000 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DSPC in a molar ratio of 5% to 35%.

[0286] In certain embodiments, the LNPs comprise ALC-0315 in a molar ratio of 35% to 55%; ALC-0159 in a molar ratio of 0.25% to 2.75%; cholesterol in a molar ratio of 20% to 50%; and DSPC in a molar ratio of 5% to 35%.

[0287] In certain embodiments, the LNPs comprise OF-02 at a molar ratio of 40%; DMG-PEG2000 at a molar ratio of 1.5%; cholesterol at a molar ratio of 28.5%; and DOPE at a molar ratio of 30%.

[0288] In certain embodiments, the LNPs comprise cKK-E10 at a molar ratio of 40%; DMG-PEG2000 at a molar ratio of 1.5%; cholesterol at a molar ratio of 28.5% and DOPE at a molar ratio of 30%.

[0289] In certain embodiments, the LNPs comprise GL-HEPES-E3-E10-DS-3-E18-1 at a molar ratio of 40%; DMG-PEG2000 at a molar ratio of 1.5%; cholesterol at a molar ratio of 28.5% and DOPE at a molar ratio of 30%.

[0290] In certain embodiments, the LNPs comprise GL-HEPES-E3-E12-DS-4-E10 in a molar ratio of 40%; DMG-PEG2000 in a molar ratio of 1.5%; cholesterol in a molar ratio of 28.5% and DOPE in a molar ratio of 30%.

[0291] In certain embodiments, the LNPs comprise GL-HEPES-E3-E12-DS-3-E14 at a molar ratio of 40%; DMG-PEG2000 at a molar ratio of 1.5%; cholesterol at a molar ratio of 28.5%; and DOPE at a molar ratio of 30%.

[0292] In certain embodiments, the LNPs comprise 9-heptadecanyl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102) at a molar ratio of 50%; 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) at a molar ratio of 10%; cholesterol at a molar ratio of 38.5%; and 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000) at a molar ratio of 1.5%.

[0293] In certain embodiments, the LNPs comprise (4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) in a molar ratio of 46.3%; 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) in a molar ratio of 9.4%; cholesterol in a molar ratio of 42.7%; and 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159) in a molar ratio of 1.6%.

[0294] In certain embodiments, the LNPs comprise (4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315) in a molar ratio of 47.4%; 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) in a molar ratio of 10%; cholesterol in a molar ratio of 40.9%; and 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159) in a molar ratio of 1.7%.

[0295] To calculate the actual amount of each lipid contained in the LNP formulation, first determine the molar amount of cationic lipid based on the desired N / P ratio (where N is the number of nitrogen atoms in the cationic lipid and P is the number of phosphate groups in the mRNA to be transported by the LNP). Next, calculate the molar amount of each of the other lipids based on the molar amount of cationic lipid and the selected molar ratio. These molar amounts are then converted to weight using the molecular weight of each lipid.

[0296] F. Buffers and Other Ingredients The nucleic acids and / or LNPs can be formulated in combination with one or more carriers, targeting ligands, stabilizing reagents (e.g., preservatives and antioxidants) and / or other pharma- ceutically acceptable excipients to stabilize the nucleic acids and / or LNPs (e.g., to extend the shelf life of a vaccine product), facilitate administration of the LNP pharmaceutical composition, and / or enhance in vivo expression of the nucleic acids. Examples of such excipients are parabens, thimerosal, thiomersal, chlorobutanol, benzalkonium chloride, and chelating agents (e.g., EDTA).

[0297] The LNP compositions of the present disclosure can be provided in a frozen liquid form or in a lyophilized form. A variety of cryoprotectants can be used, including but not limited to sucrose, trehalose, glucose, mannitol, mannose, dextrose, and the like. The cryoprotectant can comprise 5-30% (w / v) of the LNP composition. In some embodiments, the LNP composition comprises, for example, 5-30% (e.g., 10%) (w / v) trehalose. When formulated with a cryoprotectant, the LNP composition can be frozen (or lyophilized and cryopreserved) at -20°C to -80°C.

[0298] The LNP compositions can be provided to the patient in a buffered aqueous solution (if previously frozen, they can be thawed, or if previously lyophilized, they can be reconstituted in the buffered aqueous solution at the bedside). The buffered solution can be isotonic, e.g., suitable for intramuscular or intradermal injection. In some embodiments, the buffer is phosphate buffered saline (PBS).

[0299] VI. Process for Producing LNP Vaccines The LNPs of the present invention can be prepared by various techniques. For example, multilamellar vesicles (MLVs) can be prepared according to conventional techniques, such as by dissolving the lipids in a suitable solvent, depositing the selected lipids on the inner wall of a suitable container or container, and then evaporating the solvent to leave a thin film on the inside of the container, or by spray drying. An aqueous phase can then be added to the vessel with a vortexing motion, which results in the formation of MLVs. Unilamellar vesicles (ULVs) can then be formed by homogenization, sonication, or extrusion of the multilamellar vesicles. Additionally, unilamellar vesicles can be formed by detergent removal techniques.

[0300] Various methods are described in US Patent Publication Nos. 2011 / 0244026, 2016 / 0038432, 2018 / 0153822, 2018 / 0125989, and 2021 / 0046192 and can be used to make LNP vaccines. One exemplary process involves encapsulating the mRNA by mixing with a mixture of lipids without first preforming the lipids into lipid nanoparticles, as described in US Patent Publication No. 2016 / 0038432. Another exemplary process involves encapsulating the mRNA by mixing preformed LNPs with the mRNA, as described in US Patent Publication No. 2018 / 0153822.

[0301] In some embodiments, the process of preparing mRNA-loaded LNPs comprises heating one or more solutions to a temperature above ambient temperature, where one or more solutions are solutions containing preformed lipid nanoparticles, the solutions containing mRNA, and the mixed solution contains the LNP-encapsulated mRNA. In some embodiments, the process comprises heating one or both of the mRNA solution and the preformed LNP solution prior to the mixing step. In some embodiments, the process comprises heating one or more of the solution containing the preformed LNP, the solution containing mRNA, and the solution containing the LNP-encapsulated mRNA during the mixing step. In some embodiments, the process comprises heating the LNP-encapsulated mRNA after the mixing step. In some embodiments, the temperature to which one or more of the solutions are heated is greater than or equal to about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C. In some embodiments, the temperature to which one or more of the solutions is heated ranges from about 25-70° C., about 30-70° C., about 35-70° C., about 40-70° C., about 45-70° C., about 50-70° C., or about 60-70° C. In some embodiments, the temperature is about 65° C.

[0302] Various methods may be used to prepare an mRNA solution suitable for the present disclosure. In some embodiments, the mRNA may be dissolved directly in a buffer solution as described herein. In some embodiments, the mRNA solution may be made by mixing the mRNA stock solution with a buffer solution before mixing with a lipid solution for encapsulation. In some embodiments, the mRNA solution may be made by mixing the mRNA stock solution with a buffer solution immediately before mixing with a lipid solution for encapsulation. In some embodiments, a suitable mRNA stock solution may contain mRNA in water or a buffer at a concentration of about 0.2 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml, or 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml, or 5.0 mg / ml or more.

[0303] In some embodiments, the mRNA stock solution is mixed with the buffer solution using a pump. Exemplary pumps include, but are not limited to, gear pumps, peristaltic pumps, and centrifugal pumps. Typically, the buffer solution is mixed at a faster rate than the mRNA stock solution. For example, the buffer solution may be mixed at a rate at least 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, or 20x greater than the rate of the mRNA stock solution. In some embodiments, the buffer solution is mixed at a flow rate in the range of about 100-6000 ml / min (e.g., about 100-300 ml / min, 300-600 ml / min, 600-1200 ml / min, 1200-2400 ml / min, 2400-3600 ml / min, 3600-4800 ml / min, 4800-6000 ml / min, or 60-420 ml / min). In some embodiments, the buffer solution is mixed at a flow rate of about 60 ml / min, 100 ml / min, 140 ml / min, 180 ml / min, 220 ml / min, 260 ml / min, 300 ml / min, 340 ml / min, 380 ml / min, 420 ml / min, 480 ml / min, 540 ml / min, 600 ml / min, 1200 ml / min, 2400 ml / min, 3600 ml / min, 4800 ml / min, or 6000 ml / min or greater.

[0304] In some embodiments, the mRNA stock solution is mixed at a flow rate in the range of about 10 to 600 ml / min (e.g., about 5 to 50 ml / min, about 10 to 30 ml / min, about 30 to 60 ml / min, about 60 to 120 ml / min, about 120 to 240 ml / min, about 240 to 360 ml / min, about 360 to 480 ml / min, or about 480 to 600 ml / min). In some embodiments, the mRNA stock solution is mixed at a flow rate of about 5 ml / min, 10 ml / min, 15 ml / min, 20 ml / min, 25 ml / min, 30 ml / min, 35 ml / min, 40 ml / min, 45 ml / min, 50 ml / min, 60 ml / min, 80 ml / min, 100 ml / min, 200 ml / min, 300 ml / min, 400 ml / min, 500 ml / min, or 600 ml / min or greater.

[0305] The process of incorporating desired mRNA into lipid nanoparticles is called "loading". Exemplary methods are described in Lasic et al., FEBS Lett. (1992) 312: 255-8. The nucleic acid incorporated into LNPs can be located completely or partially within the internal space of the lipid nanoparticle, within the bilayer membrane of the lipid nanoparticle, or on the outer surface of the lipid nanoparticle membrane. The incorporation of mRNA into lipid nanoparticles is also referred to herein as "encapsulation", and the nucleic acid is completely or substantially contained within the internal space of the lipid nanoparticle.

[0306] Suitable LNPs can be made in a variety of sizes.In some embodiments, the reduction in size of lipid nanoparticles is associated with more efficient delivery of mRNA.Selection of suitable LNP size can take into account the target cell or tissue site and the application for which lipid nanoparticles are made.

[0307] Various methods are available for sizing the population of lipid nanoparticles. In various embodiments, the methods herein utilize a Zetasizer Nano ZS (Malvern Panalytical) to measure LNP particle size. In one protocol, 10 μl of LNP sample is mixed with 990 μl of 10% trehalose. This solution is placed in a cuvette and then placed in the Zetasizer. The z-average diameter (nm) or cumulant average is considered to be the average size of the LNPs in the sample. The Zetasizer machine can also be used to measure the polydispersity index (PDI) using dynamic light scattering (DLS) and cumulant analysis of the autocorrelation function. The average LNP diameter can be reduced by sonication of the formed LNPs. Intermittent sonication cycles can be alternated with quasi-elastic light scattering (QELS) evaluation to guide efficient lipid nanoparticle synthesis.

[0308] In some embodiments, the majority of the purified LNPs, i.e., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the LNPs, have a size of about 70 to 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm or about 80 nm). In some embodiments, substantially all (e.g., greater than 80% or 90%) of the purified lipid nanoparticles have a size of about 70 to 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm).

[0309] In certain embodiments, the LNPs have an average diameter between 30 and 200 nm.

[0310] In various embodiments, the LNPs have an average diameter of 80-150 nm.

[0311] In some embodiments, the LNPs in the composition have an average size of less than 150 nm, less than 120 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 30 nm, or less than 20 nm.

[0312] In some embodiments, about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or greater than 99% of the LNPs in the composition have a size in the range of about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, or about 60-70 nm) or about 50-70 nm (e.g., about 55-65 nm) and are suitable for pulmonary delivery via nebulization.

[0313] In some embodiments, the dispersity or molecular size heterogeneity measure (PDI) of the LNPs in the pharmaceutical compositions provided by the present disclosure is less than about 0.5. In some embodiments, the LNPs have a PDI of less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.28, less than about 0.25, less than about 0.23, less than about 0.20, less than about 0.18, less than about 0.16, less than about 0.14, less than about 0.12, less than about 0.10, or less than about 0.08. The PDI can be measured by a Zetasizer machine as described above.

[0314] In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified LNPs in the pharmaceutical compositions provided herein encapsulate mRNA within each individual particle. In some embodiments, substantially all (e.g., greater than 80% or 90%) of the purified lipid nanoparticles in the pharmaceutical composition encapsulate mRNA within each individual particle. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of 50%-99% or greater than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 95%, 98%, or 99%. Typically, lipid nanoparticles for use herein have an encapsulation efficiency of at least 90% (e.g., at least 91%, 92%, 93%, 94%, or 95%).

[0315] In some embodiments, the LNPs have an N / P ratio of 1 to 10. In some embodiments, the lipid nanoparticles have an N / P ratio of greater than 1, about 1, about 2, about 3, about 4, about 5, about 6, about 7, or about 8. In certain embodiments, typical LNPs herein have an N / P ratio of 4.

[0316] In some embodiments, a pharmaceutical composition according to the present disclosure contains at least about 0.5 μg, 1 μg, 5 μg, 10 μg, 100 μg, 500 μg, or 1000 μg of encapsulated mRNA. In some embodiments, a pharmaceutical composition contains about 0.1 μg-1000 μg, at least about 0.5 μg, at least about 0.8 μg, at least about 1 μg, at least about 5 μg, at least about 8 μg, at least about 10 μg, at least about 50 μg, at least about 100 μg, at least about 500 μg, or at least about 1000 μg of encapsulated mRNA.

[0317] In some embodiments, mRNA can be produced by chemical synthesis of DNA template or by in vitro transcription (IVT). In this process, the IVT process, a cDNA template is used to generate mRNA transcripts, and the DNA template is degraded by DNase. The transcripts are purified by depth filtration and tangential flow filtration (TFF). The purified transcripts are further modified by adding caps and tails, and the modified RNA is purified again by depth filtration and TFF.

[0318] The mRNA is then prepared in an aqueous buffer and mixed with an amphipathic solution containing the lipid components of the LNP. The amphipathic solution for dissolving the four lipid components of the LNP can be an alcohol solution. In some embodiments, the alcohol is ethanol. The aqueous buffer can be, for example, a citrate, phosphate, acetate or succinate buffer and can have a pH of about 3.0 to 7.0, e.g., about 3.5, about 4.0, about 4.5, about 5.0, about 5.5, about 6.0 or about 6.5. The buffer can include other components such as salts (e.g., sodium salts, potassium salts and / or calcium salts). In certain embodiments, the aqueous buffer has 1 mM citrate, 150 mM NaCl, pH 4.5.

[0319] An exemplary, non-limiting process for making mRNA-LNP compositions includes mixing a buffered mRNA solution with a solution of lipids in ethanol in a controlled, homogenous manner, with the lipid:mRNA ratio being maintained throughout the mixing process. In this exemplary example, the mRNA is present in an aqueous buffer containing citric acid monohydrate, trisodium citrate dihydrate, and sodium chloride. The mRNA solution is added to the solution (1 mM citrate buffer, 150 mM NaCl, pH 4.5). A lipid mixture of four lipids (e.g., cationic lipid, PEGylated lipid, cholesterol-based lipid, and helper lipid) is dissolved in ethanol. The aqueous mRNA solution and the ethanolic lipid solution are mixed in a 4:1 volume ratio in a "T" mixer equipped with an approximately "pulseless" pump system. The resulting mixture is then subjected to downstream purification and buffer exchange. Buffer exchange can be achieved using a dialysis cassette or a TFF system. TFF can be used to concentrate and buffer exchange the nascent LNPs obtained immediately after formation by the T mixing process. The diafiltration process is a continuous operation in which the volume is kept constant by adding an appropriate buffer at the same rate as the permeate flow.

[0320] VII. Packaging and Use of hMPV Vaccines One or more hMPV F polypeptide antigens described herein may be administered to a subject as a vaccine. The hMPV vaccines described herein may be formulated or packaged for parenteral (e.g., intramuscular, intradermal, or subcutaneous) or nasopharyngeal (e.g., intranasal) administration. In various embodiments, the hMPV vaccines may be formulated or packaged for pulmonary administration. In various embodiments, the hMPV vaccines may be formulated or packaged for intravenous administration. The vaccine composition may be in the form of an extemporaneous preparation, where the composition is lyophilized and reconstituted with a physiological buffer (e.g., PBS) immediately prior to use. The vaccine composition may also be shipped and provided in the form of an aqueous or frozen aqueous solution, and may be administered directly to a subject without reconstitution (after thawing, if previously frozen).

[0321] Thus, the disclosure provides articles of manufacture such as kits that provide the hMPV vaccine in a single container, or that provide the hMPV vaccine in one container (e.g., a first container) and a physiological buffer for reconstitution in another container (e.g., a second container). The containers may contain single-use doses or multi-use doses. The containers may be pre-processed glass vials or ampoules. The articles of manufacture may also include instructions for use.

[0322] Methods of administration of the hMPV vaccine include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, intratracheal, epidural, and oral routes. The compositions may be administered by any convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.), and may be administered together with other biologically active agents.

[0323] In a particularly exemplary embodiment, the vaccine is administered intramuscularly (IM) by injection. The hMPV vaccine can be injected into a subject, for example, in the deltoid muscle of the upper arm. In such embodiments, the injectable is prepared in a conventional form, either as a liquid solution or suspension, as a solid form suitable for solution or suspension in a liquid prior to injection, or as an emulsion. In some embodiments, the injectable solutions and suspensions are prepared from sterile powders, lyophilized powders, or granules.

[0324] The pharmaceutical compositions described herein can be delivered, for example, intramuscularly, subcutaneously, or intravenously, using a standard needle and syringe, which is optionally pre-filled. Additionally, pen delivery devices (e.g., injectors (e.g., single or multi-chamber) or autoinjector pens) have utility for delivering the pharmaceutical compositions described herein. Such pen delivery devices can be reusable or disposable. In some embodiments, the vaccine is provided for use in inhalation and is provided in a pre-filled pump, aerosolization device, or inhaler. In certain embodiments, a pre-filled syringe can be utilized for dropwise administration for intranasal delivery.

[0325] The hMPV vaccine can be administered to a subject in need thereof in a prophylactically effective amount, i.e., an amount that provides sufficient immune protection against the target pathogen for a sufficient time (e.g., 1 year, 2 years, 5 years, 10 years, or a lifetime). Sufficient immune protection can be, for example, prevention or alleviation of symptoms associated with infection by the pathogen. In some embodiments, multiple doses (e.g., two doses) of the vaccine are administered (e.g., injections) to a subject in need thereof to achieve the desired prophylactic effect. The doses (e.g., a primary dose and a booster dose) can be separated by intervals of at least, for example, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year, 2 years, 5 years, or 10 years.

[0326] VIII. Pharmaceutical Compositions hMPV polypeptide antigens purified according to the present disclosure may be useful as components in pharmaceutical compositions for use, for example, as vaccines. These compositions typically include an RNA or binding polypeptide and a pharma- ceutically acceptable carrier. The pharmaceutical compositions of the present disclosure may also include one or more additional components, such as a small molecule immunostimulant (e.g., a TLR agonist). The pharmaceutical compositions of the present disclosure may also include a delivery system for the RNA, such as a liposome, an oil-in-water emulsion, or a microparticle. In some embodiments, the pharmaceutical composition includes a lipid nanoparticle (LNP). In certain embodiments, the composition includes an antigen-encoding nucleic acid molecule encapsulated within the LNP.

[0327] Methods are provided that include administering an hMPV binding polypeptide to a patient, where the hMPV binding polypeptide antagonist is included in a pharmaceutical composition. The pharmaceutical compositions described herein are formulated with suitable carriers, excipients, and other agents that provide for suitable entry, delivery, tolerance, etc. A large number of suitable formulations can be found in a formulary known to any medicinal chemist: Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA. These formulations include, for example, powders, pastes, ointments, jellies, waxes, oils, lipids, lipid (cationic or anionic)-containing vesicles (such as LIPOFECTIN™), DNA conjugates, anhydrous absorption pastes, oil-in-water and water-in-oil emulsions, emulsions carbowax (polyethylene glycols of various molecular weights), semi-solid gels, and semi-solid mixtures containing carbowax. See also Powell et al. "Compendium of excipients for parenteral formulations" PDA (1998) J Pharm Sci Technol. 52:238-311.

[0328] Various delivery systems are known and can be used to administer the pharmaceutical compositions described herein, for example, encapsulated in liposomes, microparticles, microcapsules, recombinant cells capable of expressing mutant viruses, receptor-mediated endocytosis (e.g., Wu et al., 1987, J. Biol. Chem. 262:4429-4432). Methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, intratracheal, epidural, and oral routes. The compositions can be administered by any convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.), and can be administered together with other biologically active agents.

[0329] The pharmaceutical compositions described herein can be delivered subcutaneously or intravenously using a standard needle and syringe (e.g., a prefilled syringe). Additionally, for subcutaneous delivery, pen delivery devices (e.g., autoinjector pens) readily find use in delivering the pharmaceutical compositions described herein.

[0330] For direct administration to the paranasal sinuses, the pharmaceutical compositions described herein can be administered, for example, using a microcatheter (e.g., an endoscope and a microcatheter), an aerosolization device, a powder dispenser, a nebulizer, or an inhaler. This method includes administration to a subject in need thereof of an hMPV binding polypeptide in an aerosolized formulation. Aerosolized antibodies can be prepared, for example, as described in U.S. Patent No. 8,178,098, which is incorporated herein by reference in its entirety.

[0331] The injectable preparation may be in the form of an intravenous injection, a subcutaneous injection, an intradermal injection, an intramuscular injection, or a drip infusion. These injectable preparations may be prepared by known methods. For example, the injectable preparation may be prepared by dissolving, suspending, or emulsifying the above-mentioned antibody or a salt thereof in a sterile aqueous or oily medium conventionally used for injection. Examples of the aqueous medium for injection include isotonic solutions containing physiological saline, glucose, and other adjuvants, and may be used in combination with a suitable solubilizing agent such as alcohol (e.g., ethanol), polyhydric alcohol (e.g., propylene glycol, polyethylene glycol), and nonionic surfactants (e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)). Examples of the oily medium include sesame oil, soybean oil, and the like, and may be used in combination with a solubilizing agent such as benzyl benzoate or benzyl alcohol. The injectable preparation thus prepared is typically filled into a suitable ampoule.

[0332] Advantageously, the pharmaceutical composition for oral or parenteral use is prepared in a dosage form of a unit dose suitable for the dosage of the active ingredient, such as tablets, pills, capsules, injections (ampoules), suppositories, etc.

[0333] IX. Vaccination Methods The hMPV vaccines disclosed herein can be administered to a subject to induce an immune response against the hMPV F protein, and the subject's anti-antigen antibody titer is increased following vaccination compared to the anti-antigen antibody titer of a subject not vaccinated with the hMPV vaccine disclosed herein or compared to an alternative vaccine against hMPV. An "anti-antigen antibody" is a serum antibody that specifically binds to an antigen.

[0334] In one aspect, the disclosure provides a method of inducing an immune response against hMPV or protecting a subject from hMPV infection, comprising administering to a subject an hMPV vaccine described herein. The disclosure also provides an hMPV vaccine described herein for use in inducing an immune response against hMPV or protecting a subject from hMPV infection. The disclosure also provides an hMPV mRNA described herein for use in the manufacture of a vaccine for inducing an immune response against hMPV or protecting a subject from hMPV infection.

[0335] In certain embodiments, a subject has a comparable serum concentration of neutralizing antibodies to hMPV following administration of the hMPV vaccine compared to a subject administered an hMPV protein vaccine co-administered with an adjuvant.

[0336] In certain embodiments, the hMPV vaccine increases serum concentrations of antibodies with binding specificity to site φ of the hMPV F protein.

[0337] In certain embodiments, the hMPV vaccine increases serum concentrations of antibodies with binding specificity to site V of the hMPV F protein.

[0338] In certain embodiments, the hMPV vaccine increases serum concentrations of neutralizing antibodies in subjects with pre-existing hMPV immunity.

[0339] In order that the present invention may be better understood, the following examples are set forth, which are for illustrative purposes only and should not be construed as limiting the scope of the invention in any way. EXAMPLES

[0340] The foregoing description of specific embodiments fully reveals the general nature of the present disclosure, so that others, by applying knowledge within the skill of those of ordinary skill in the art, can easily modify and / or adapt such specific embodiments to various applications without departing from the general concept of the present disclosure and without undue experimentation. Such adaptations and modifications are therefore intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It should be understood that the expressions or terms used herein are intended to be descriptive rather than limiting, as the terms or terms used herein would be interpreted by those of ordinary skill in the art in light of the teaching and guidance.

[0341] Example 1: Generation of prefusion stabilized hMPV F glycoprotein antigen constructs To improve the stability of the prefusion conformation, enhance purification, and induce higher neutralizing antibody titers, a panel of candidate hMPV prefusion F antigen constructs was designed with mutations in the wild-type hMPV-F antigen based on the A2 subtype from Canada, designated A2-CAN97-83 (SEQ ID NO: 1).

[0342] A graphical representation of the design considerations for a panel of candidate hMPV pre-fusion F antigen constructs is shown in Figure 1 for two exemplary constructs, D185P (SEQ ID NO:5) and T160F / N46V (SEQ ID NO:7). Each construct contained the following features: (1) a signal peptide; (2) a pre-F cleavage site mutation (QS to RR) at amino acids 100-101; (3) removal of the transmembrane domain and cytoplasmic tail; (4) addition of a fibritin motif (i.e., a foldon domain); (5) an HRV-3C cleavage site; (6) an 8xHis tag and a Strep II tag; and (7) an appropriate linker (SEQ ID NO:3) for items (4)-(6).

[0343] From this scaffold, in silico analysis was performed to determine single or double point mutations that would increase pre-F conformational stability by adding either packed cavity mutations or interface stabilizing mutations. In total, the panel of candidate hMPV pre-fusion F antigens consisted of 21 different constructs, as shown in column 1 of Table 1.

[0344] Example 2: Evaluation of protein expression of prefusion stabilized hMPV F antigen constructs Nucleic acid molecules for each of the candidate hMPV pre-fusion F antigen constructs were isolated and cloned into an expression vector. Production of protein expression of each construct was assessed upon mammalian transient transfection using Expi293F human cells. 24 hours after transfection of the constructs, cell lysates or supernatants were harvested for analysis by Western blot.

[0345] Of the 21 candidate designs, nine protein antigens were produced. However, only four protein antigens had a purity of 90% or higher as determined by SDS-PAGE from 1 L cultures. Protein expression characteristics of all 21 constructs are shown in Table 1. Constructs with high protein production and purity had the following mutations: D185P, T160F_N46V, K138F, and G366F_K362F.

[0346] [Table 6]

[0347] Example 3: Immunogenicity of prefusion stabilized hMPV F antigen protein constructs in mice Four candidate hMPV F antigen constructs with purities of 90% or higher, as described in Table 1, were then evaluated for immunogenicity in mice in comparison to the reference hMPV-F protein from the A1 strain.

[0348] Groups of eight BALB / c mice (N=8) shown in Table 2 were administered aluminum hydroxide (Al(OH) 3 A 0.5 μg dose of protein antigen adjuvanted with hMPV-F was administered by intramuscular (IM) injection on days 0 (D) and 21 (D). All mice were bled and serum was extracted before each vaccine administration and 2 weeks after the last vaccination (D35). Serum was then used to determine circulating anti-hMPV-F IgG titers as measured by enzyme-linked immunosorbent assay (ELISA) (Figure 2) and hMPV microneutralization assay (Figure 3) to determine the neutralizing activity of the antibody response. To ensure that all proteins in the post-F group were indeed in the post-F conformation, the proteins were heated to 70°C for 10 min prior to preparation for administration.

[0349] [Table 7]

[0350] The data show that the construct carrying the A2-K138F mutation induced the highest binding antibody titers by hMPV-F ELISA, followed by A2-T160F_N46V, A2-G366F_K362F, and finally A2-D185P (Figure 2). As assessed by microneutralization with hMPV A2-GFP virus, A2-T160F_N46V had the highest neutralization titers, followed by A2-K138F, A2-D185P, and A2-G366F_K362F (Figure 3).

[0351] Although A2-K138F had the highest binding and second highest neutralizing antibody titers, this construct was found to form aggregates in solution, indicating possible improper protein folding, and was therefore excluded from further evaluation. A2-G366F_K362F also had the second lowest binding and lowest neutralizing antibody titers, and was therefore excluded from further evaluation. Thus, A2-D185P and A2-T160F_N46V were found to induce the highest quality antibodies and were selected for advanced analytical analysis to assess purity, size, and thermal stability as described in Example 4.

[0352] Example 4: Physicochemical characterization of prefusion stabilized hMPV F antigen constructs To further characterize the purity, size and thermostability of proteins produced from the A2-D185P and A2-T160F_N46V constructs, HP-SEC, SEC-HPLC, SEC-MALS and nanoDSF analyses were performed.

[0353] Purity and Size The results of the HP-SEC, SEC-HPLC, and SEC-MALS analyses are summarized in Table 3 below.

[0354] [Table 8]

[0355] Molecular weights (MW) from MALS were determined for the trimer peak. SEC-HPLC conditions were as follows: TSK 3000SWxl SEC column, phosphate buffer (0.2 M NaH 2 PO 4 , 0.1 M arginine, 1% IPA, pH 6.5) at a flow rate of 0.5 ml / min. SEC-MALS conditions were as follows: 1.7 μM, 200 Å BEH protein column, and 50 mM Tris buffer, pH 7.5, at a flow rate of 0.3 ml / min.

[0356] Figure 4 shows the SEC-MALS results for the reference A1 proteins, A1-A185P and A1-post-F, and the following A2 protein antigen candidates, A2-T160F_N46V and A2-D185P. Data for all four proteins are also summarized in Table 3. Both A1 reference proteins show more than 98.8% trimer formation and MWs of 224 and 283 kDa for A1-A185P and A1-post-F, respectively. Proteins from the A2-T160F_N46V and A2-D185P constructs were composed of 97.4% and 97.1% trimers with MWs of 267 and 224 kDa, respectively.

[0357] thermal stability The onset temperature (Tonset) and melting temperature (Tm) of protein unfolding were determined using nanoscale differential scanning fluorimetry (nanoDSF) for both large and small batch lots of A1-pre-F and A1-post-F proteins and the A2 candidate protein antigens, A2-T160F_N46V and A2-D185P. Samples were diluted to a final concentration of 0.5 mg / ml in formulation buffer and loaded in duplicate into nanoDSF capillaries. All measurements were performed using the nanoDSF instrument. The heating rate was 1.5°C per minute from 20°C to 95°C. Data were recorded and analyzed using PR.Stability Analysis v1.01.

[0358] Figure 5 shows the melting curves of A1-preF(A185P) and A2-postF (n=3), resulting in Tm values ​​of 60.12°C and 86.7°C, respectively. This data indicates that nanoDSF can distinguish between pre- and post-fusion antigens of A1, with melting temperatures differing by approximately 27°C.

[0359] Interestingly, when comparing the thermostability profiles of the A2 hMPV-F candidate protein antigens, as seen in Figure 6, the protein derived from the A2-T160F_N46V construct was found to be more thermostable than the more minimally engineered protein produced from the A2-D185P construct, with an increase in melting temperature of approximately 9°C (Tm 70.4°C and 79.3°C, respectively).

[0360] Example 5: mRNA encoding a prefusion stabilized hMPV F antigen construct To determine whether the immunogenicity of the hMPV F antigen constructs can be further improved, the A2-D185P and A2-T160F_N46V constructs were selected for testing in an mRNA-based vaccine. The amino acid sequences of the A2-D185P and A2-T160F_N46V constructs are shown in SEQ ID NO:9 and SEQ ID NO:11, respectively. The mRNA ORFs of the A2-D185P and A2-T160F_N46V constructs are shown in SEQ ID NO:6 and SEQ ID NO:8, respectively. The codon-optimized mRNA ORFs for the A2-D185P and A2-T160F_N46V constructs are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively.

[0361] The mRNA described herein contained an open reading frame (ORF) encoding the hMPV F protein antigen, at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR), and at least one polyadenylation (poly(A)) sequence. The mRNA further contained a 5' cap having the following structure: [ka]

[0362] The nucleic acid sequences of the 5'UTR and 3'UTR are listed in SEQ ID NOs: 13 and 14, respectively.

[0363] Example 6: Immunogenicity of prefusion stabilized hMPV F antigen mRNA constructs in mice The relative immunogenicity of A2-D185P and A2-T160F_N46V constructs expressing mRNA was tested in mice by measuring circulating anti-hMPV-F titers before and after IM injection with mRNA formulated with lipid nanoparticles (LNPs). Each mRNA was encapsulated in LNPs composed of 40% cationic lipid OF-02, 30% phospholipid DOPE, 1.5% PEGylated lipid DMGPEG2000 and 28.5% cholesterol. Alternatively, the LNP lipids can be listed in the following ratio: cationic lipid:PEGylated lipid:cholesterol:phospholipid: 40:1.5:28.5:30.

[0364] Groups of eight BALB / c mice (N=8) were administered a 1 μg dose by IM injection on DO and D21. All mice were bled and serum was extracted before each vaccine administration and 2 weeks after the last vaccination (D35). Serum was then used to determine the neutralizing activity of the antibody response by determining circulating anti-hMPV-F IgG titers as measured by ELISA (FIG. 7) and hMPV microneutralization assay (FIG. 8).

[0365] Both mRNA expressing A2-D185P and A2-T160F_N46V constructs induced similar high titers of binding antibodies at all time points by hMPV-F ELISA (Figure 7). Similar strong neutralization titers were induced by both constructs when assessed by microneutralization with A2-GFP virus (Figure 8). Thus, both antigens were similarly immunogenic when expressed via mRNA-LNP.

[0366] Example 7: Rational design of an mRNA multi-pathogen vaccine targeting hMPV and RSV RSV and hMPV are respiratory viruses that cause widespread morbidity in human populations, second only to influenza viruses (Collins et al. 2013, Fields Virology. 6 ed: Lippincott Williams and Wilkins). Despite the disease burden, vaccine and treatment strategies against both viruses remain limited. Given the substantial homology between hMPV and RSV surface glycoproteins, as well as practical considerations that protection against both viruses would result in fewer injections and simplify vaccine schedules (Lauer et al. 2017, Clin Vaccine Immunol. 24(1):e00298-16), a mixed mRNA vaccine containing RSV and hMPV antigen constructs was designed.

[0367] Therefore, a combination vaccine was co-formulated containing two mRNAs: (1) an RSV F antigen construct, FD3; and (2) an hMPV F antigen construct, A2-CAN97-83.

[0368] The mRNA hMPV constructs and the 5' and 3' UTRs used are described in Example 6.

[0369] The mRNA RSV constructs used are described in US Provisional Patent Application No. 63 / 276,233, which is incorporated by reference in its entirety for all purposes.

[0370] Example 8: Immunogenicity of mRNA multi-pathogen vaccines against hMPV and RSV in mice The relative immunogenicity of the mRNA multipathogen vaccine against hMPV and RSV described in Example 7 was evaluated in mice by measuring circulating anti-RSV FD3 and anti-hMPV-F titers before and after IM injection of mRNA formulated with lipid nanoparticles (LNPs). Each mRNA was encapsulated in LNPs composed of 40% cationic lipid OF-02, 30% phospholipid DOPE, 1.5% PEGylated lipid DMGPEG2000, and 28.5% cholesterol. Alternatively, the LNP lipids can be listed in the following ratio: cationic lipid:PEGylated lipid:cholesterol:phospholipid: 40:1.5:28.5:30.

[0371] Five groups of BALB / c mice (N=8) were immunized via IM injection on DO and D21 according to the following regimen: (1) Group 1 - received a 1 μg dose of RSV mRNA formulated with cOrn-EE1 LNPs in a total volume of 50 μL administered to the right hind paw; (2) Group 2 - received a 1 μg dose of hMPV mRNA formulated with cOrn-EE1 LNPs in a total volume of 50 μL administered to the right hind paw; (3) Group 3 - received a co-formulation containing 1 μg of RSV and 1 μg of hMPV mRNA in a single cOrn-EE1 LNP in a total volume of 100 μL delivered in 50 μL to each hind paw; (4) Group 4 - received 1 μg of RSV pre-F protein nanoparticles adjuvanted with alum in a total volume of 50 μL administered to the right hind paw as an RSV immunogenicity control. (5) Group 5 - hMPV immunogenicity control received 1 μg of hMPV pre-F adjuvanted with alum in a total volume of 50 μL administered into the right hind paw.

[0372] All mice were bled before each vaccine administration and 2 weeks after the last vaccination (D35), and D35 sera were tested by ELISA to determine circulating anti-RSV and anti-hMPV-F titers and in microneutralization assays to determine the neutralizing activity of RSV and hMPV antibody responses.

[0373] RSV mRNA induced similar titers by RSV-F ELISA when given alone or co-formulated with hMPV (Figure 9). Similarly, hMPV mRNA induced similar titers by hMPV-F ELISA when given alone or co-formulated with RSV (Figure 10). RSV mRNA delivered alone or in combination with hMPV induced similarly strong neutralization titers as assessed by microneutralization with RSV A2-GFP virus (Figure 11). hMPV mRNA delivered alone or in combination with RSV induced similarly strong neutralization titers as assessed by microneutralization with hMPV A2-GFP virus (Figure 12). Thus, immunization with co-formulations of RSV and hMPV mRNA delivered as a single LNP is similarly immunogenic against either antigen delivered alone.

[0374] Example 9: Analysis of hMPV F Polypeptide Antigen-Antibody Binding Binding of antibodies to hMPV F constructs was tested in octets. All samples and antibodies were diluted in kinetic buffer (ForteBio kinetic buffer 1X dilution + PBS) to a final concentration of 5 μg / mL and 1 μg / mL, respectively. Antibodies were loaded onto Protein A biosensors and binding of all antigens was tested under the following conditions: initial baseline (120 sec), antibody loading (180 sec), second baseline (120 sec), antigen association (180 sec), antigen dissociation (120 sec). Binding results were analyzed using ForteBio Data Analysis 12.0 software.

[0375] Table 4 shows that A2-T160F_N46V and A2-D185P had the expected binding patterns for mAbs MPE8, 101F, 338 and DS7.

[0376] [Table 9]

[0377] Example 10: hMPV F antigen expression HEK293 cells - 300,000 cells / well HELA cells were then seeded in 6-well plates at 300,000 cells / well in 2mL DMEM + 10% FBS. The next day, cells were transfected with 1 μg / well of hMPV mRNA constructs with Lipofectamine 2000. The next day, cells were harvested and lysed in 500 μL / well of RIPA + 1xHALT + 0.2% Omnicleave. Lysates were incubated on ice for 10 min. 15 μL of lysate was combined with 5 μL of NuPAGE LDS sample buffer.

[0378] Samples were run on 8-16% gradient SDS-PAGE at 185V for 75 min. Proteins were transferred to nitrocellulose membranes. Blots were blocked with Intercept protein-free blocking buffer for 1 h at room temperature. Blots were stained with primary antibody NBP2-50505 mouse anti-hMPV-F (hMPV24) (Novus) in Intercept protein-free blocking buffer overnight at 4°C. Blots were washed 3x5 min with TBST. Blots were stained with donkey anti-mouse 800 secondary antibody in Intercept blocking buffer for 1 h at room temperature. Blots were washed 4x5 min with TBST and then scanned on a Licor Odyssey.

[0379] The results are shown in Figure 13. D185P showed strong expression around the expected molecular weight of 60 kDa. T160F_N46V showed protein expression, but the signal was significantly lower than D185P.

[0380] HSKM cells mRNA was transfected into human skeletal muscle (HSKM) cells in 24-well plates. After 24 hours, epitope expression was measured using flow cytometry. Number of cells / well = 100k. After 24 hours of transfection, wells were washed with PBS and trypsin (0.25%) was added to detach cells. Cells were distributed into 96-well plates for flow cytometry and processed for intracellular staining (Cytoperm) before adding antibodies. Secondary antibody was goat anti-human IgG (Jackson Immuno Research- Catalog No. 109-115-098).

[0381] MNR hMPV D185P expression levels were similar to MNR hMPV CAN97-83. MNR hMPV T160F_N46V showed higher expression levels for all epitopes.

[0382] Example 11: Immunogenicity of pre- and post-stabilized hMPV F antigen protein constructs in the MIMIC system Introduction: The MIMIC© (Modular Immune In vitro Construct) system can stimulate in vitro innate and adaptive immune responses that occur in vivo at the vaccination / inflection site. Williams et al. (2015) Sanofi Pasteur poster, “In vitro differentiation of class-switched YF specific antibody secreting cells from naive B cells”. Using the MIMIC system, it is possible to recapitulate several aspects unique to human physiology, such as HLA haplotype, age, autoimmune profile, and sex, thereby complementing immunogenicity studies performed in animal models. Higbee et al. (2009) ATLA 37:19-27.

[0383] To this end, pre- and post-hMPV F antigen protein constructs were tested in the MIMIC system to assess the quality of the immunogenic response compared to controls, which included: untreated control (no antigen without human skeletal muscle cells (HSK)), reference antigen-RSV pre-F protein fused to ferritin nanoparticles (pre-F NP) and polio vaccine (IPOL).

[0384] Materials and Methods Briefly, PBMCs were collected from 22 different human blood donors via magnetic bead separation kit. Human dendritic cells (DCs) and selected B cells were added to human skeletal muscle cells (HSKMCs) and co-cultured and stimulated with either hMPV pre-F antigen protein (100ng / ml or 500ng / ml) or hMPV post-F antigen protein (100ng / ml). For B cell responses, supernatants were collected after 14 days of co-culture and analyzed for antibody specificity and function.

[0385] result: Figure 15 shows the MIMIC setup. Similar levels of expression were observed for the common pre-F / post-F epitopes for T160F_N46V and D185P at doses of 75 ng / ml and 375 ng / ml (Figure 14, panels A-C). To confirm the activation of MIMIC co-cultures, previously analyzed polio vaccine (IPOL) and antigen (RSV pre-F-NP) were used as positive controls. As shown in Figure 16, panels A-C, IPOL treatment at 1:50 dilution induced antibody responses against three polio strains (poly 1, 2, and 3) compared to untreated controls. Similarly, 50 ng / ml RSV pre-F NP treatment of the co-cultures induced IgG-specific antibody responses against both RSV pre-F (Figure 17, panel A) and RSV post-F (Figure 17, panel B). Moreover, these antibodies were also functional as measured by RSV neutralization assay (Figure 17, panel C).

[0386] The pre-F and post-F proteins of hMPV elicited high pre-F and post-F antibody responses (Figure 18, panels A and B) and high neutralizing antibody titers (Figure 19).

[0387] Supernatants from co-cultures treated with experimental groups, hMPV pre-F antigen protein or hMPV post-F antigen protein, elicited robust IgG antibody responses to both hMPV pre-F (Figure 20, panel A) and hMPV post-F antigen (Figure 20, panel B) compared to the no antigen control. These antibodies were also functional as measured in the hMPV neutralization assay (Figure 21). Antibodies from all three treatment groups bound to hMPV pre- and post-fusion F antigens and neutralized viral infectivity, supporting the idea that pre- and post-hMPV share neutralizing epitopes.

[0388] Other embodiments of the present disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the disclosure disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the present disclosure being indicated by the following claims.

[0389] All patents and publications cited herein are hereby incorporated by reference in their entirety.

Claims

1. 1. An antigenic human metapneumovirus (hMPV) pre-fusion F polypeptide, or a nucleic acid molecule encoding the same, wherein the pre-fusion F polypeptide lacks a transmembrane domain, lacks a cytoplasmic tail, and comprises a human rhinovirus 3C (HRV-3C) protease cleavage site.

2. The pre-fusion F polypeptide comprises the amino acid substitutions Q100R and S101R, which substitute arginine for glutamine at amino acid position 100 of SEQ ID NO:1 and arginine for serine at amino acid position 101 of SEQ ID NO:

1. 0 further comprising a cleavage site mutation; the pre-fusion F polypeptide comprises a signal peptide; the pre-fusion F polypeptide comprises at least one tag sequence, optionally an 8xHis tag and / or a Strep II tag; the pre-fusion F polypeptide comprises a foldon domain; and / or 2. The F polypeptide or nucleic acid molecule of claim 1, wherein the pre-fusion F polypeptide comprises an amino acid substitution substituting threonine at amino acid position 160 of SEQ ID NO:1 and an amino acid substitution substituting asparagine at amino acid position 46 of SEQ ID NO:

1.

3. 1. An antigenic human metapneumovirus (hMPV) pre-fusion F polypeptide, or a nucleic acid molecule encoding same, wherein said pre-fusion F polypeptide lacks a transmembrane domain and lacks a cytoplasmic tail; F containing the amino acid substitutions Q100R and S101R, which substitute arginine for glutamine at amino acid position 100 of SEQ ID NO:1 and arginine for serine at amino acid position 101 of SEQ ID NO:

1. 0 cleavage site mutations; human rhinovirus 3C (HRV-3C) protease cleavage site; heterologous signal peptide; 8xHis tag and / or Strep II tag; and foldon domain 1. An antigenic human metapneumovirus (hMPV) pre-fusion F polypeptide, or a nucleic acid molecule encoding same, comprising:

4. 1. An antigenic human pre-fusion metapneumovirus (hMPV) F polypeptide, or a nucleic acid molecule encoding the same, wherein the pre-fusion F polypeptide lacks a transmembrane domain, lacks a cytoplasmic tail, and comprises an amino acid substitution substituting the wild-type amino acid at position 160 of SEQ ID NO:1 and an amino acid substitution substituting the wild-type amino acid at position 46 of SEQ ID NO:

1.

5. 1. An antigenic human pre-fusion metapneumovirus (hMPV) F polypeptide, or a nucleic acid molecule encoding the same, wherein the pre-fusion F polypeptide lacks a transmembrane domain, lacks a cytoplasmic tail, and comprises an amino acid substitution substituting threonine at amino acid position 160 of SEQ ID NO:1 and an amino acid substitution substituting asparagine at amino acid position 46 of SEQ ID NO:

1.

6. the pre-fusion F polypeptide comprises an amino acid substitution replacing the amino acid at position 160 with phenylalanine, tryptophan, tyrosine, valine, alanine, isoleucine, or leucine; and / or 6. The hMPV F polypeptide or nucleic acid molecule of claim 4 or 5, wherein the pre-fusion F polypeptide comprises an amino acid substitution replacing the amino acid at position 46 with valine, alanine, isoleucine, leucine, phenylalanine, tyrosine, or proline.

7. the pre-fusion F polypeptide comprises at least 95% sequence identity to or comprises SEQ ID NO:7; or 7. The hMPV F polypeptide or nucleic acid molecule of claim 6, wherein the pre-fusion F polypeptide comprises at least 95% sequence identity to or comprises SEQ ID NO:

11.

8. The pre-fusion F polypeptide comprises the amino acid substitutions Q100R and S101R, which substitute arginine for glutamine at amino acid position 100 of SEQ ID NO:1 and arginine for serine at amino acid position 101 of SEQ ID NO:

1. 0 further comprising a cleavage site mutation; the pre-fusion F polypeptide comprises a signal peptide; the pre-fusion F polypeptide comprises at least one tag sequence, optionally an 8xHis tag and / or a Strep II tag; the pre-fusion F polypeptide comprises a foldon domain; the pre-fusion F polypeptide comprises a human rhinovirus 3C (HRV-3C) protease cleavage site; and / or 8. The hMPV F polypeptide or nucleic acid molecule of any one of claims 4 to 7, wherein the hMPV is an A or B strain, and optionally the hMPV is an A1 subtype, an A2 subtype, a B1 subtype, or a B2 subtype.

9. 9. The F polypeptide or nucleic acid molecule of any one of claims 1 to 8, wherein the pre-fusion F polypeptide comprises at least 95% sequence identity to or comprises SEQ ID NO:

3.

10. A human metapneumovirus (hMPV) F polypeptide, or a nucleic acid molecule encoding the same, wherein the F polypeptide comprises at least 95% sequence identity to SEQ ID NO:7, and optionally, the F polypeptide is a pre-fusion F polypeptide; the F polypeptide is antigenic; the F polypeptide comprises the amino acid substitution T160F, which substitutes phenylalanine for the threonine at amino acid position 160, and N46V, which substitutes valine for the asparagine at amino acid position 46; and / or A human metapneumovirus (hMPV) F polypeptide, or a nucleic acid molecule encoding same, wherein the F polypeptide comprises SEQ ID NO:

7.

11. 11. A nucleic acid molecule encoding the polypeptide of claim 10, optionally wherein the nucleic acid molecule has at least 95% sequence identity with, or comprises, SEQ ID NO:8, SEQ ID NO:18 or SEQ ID NO:

19.

12. 12. A pharmaceutical composition comprising the F polypeptide of claim 10 or a nucleic acid molecule encoding same, or the nucleic acid molecule of claim 11, optionally including a vaccine.

13. A messenger RNA (mRNA) comprising an open reading frame (ORF) encoding the F polypeptide of any one of claims 1 to 10.

14. A messenger RNA (mRNA) comprising an open reading frame (ORF) encoding a human metapneumovirus (hMPV) F polypeptide antigen, wherein the hMPV F polypeptide antigen comprises an amino acid sequence having at least 95% identity to or consists of the amino acid sequence of SEQ ID NO:

11.

15. the ORF is codon-optimized; the mRNA comprises at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR) and at least one polyadenylation (poly(A)) sequence; the mRNA comprises at least one chemical modification; At least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of the uracil nucleotides in the mRNA are chemically modified; and / or At least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of the uracil nucleotides in the ORF are chemically modified, and optionally the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2' ... The mRNA of claim 14, wherein the mRNA is selected from the group consisting of uridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine and 2'-O-methyluridine.

16. The mRNA is formulated in a lipid nanoparticle (LNP), and optionally the LNP comprises at least one cationic lipid, and optionally the cationic lipid is biodegradable or non-biodegradable, or the cationic lipid is cleavable or non-cleavable, and optionally the cationic lipid is selected from the group consisting of OF-02, cKK-E10, GL-HEPES-E3-E10-DS-3-E18-1, GL-HEPES-E3-E12-DS-4-E10, and GL-HEPES-E3-E12-DS-3-E The mRNA of any one of claims 13 to 15, selected from the group consisting of 14.

17. The mRNA of claim 16, wherein the LNP further comprises a polyethylene glycol (PEG)-conjugated (PEGylated) lipid, a cholesterol-based lipid, and a helper lipid.

18. The LNP is a molar ratio of 35% to 55%, optionally 40%, of cationic lipid; polyethylene glycol (PEG) conjugated (PEGylated) lipids at a molar ratio of 0.25% to 2.75%, optionally 1.5%; a cholesterol-based lipid in a molar ratio of 20% to 45%, optionally 28.5%, and Helper lipid in a molar ratio of 5% to 35%, optionally 30% Including, 18. The mRNA of claim 16 or 17, wherein all of the molar ratios are relative to the total lipid content of the LNP.

19. The PEGylated lipid is dimyristoyl-PEG2000 (DMG-PEG2000) or 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159); the cholesterol-based lipid is cholesterol; and / or The mRNA according to claim 17 or 18, wherein the helper lipid is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) or 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

20. The LNP is GL-HEPES-E3-E12-DS-4-E10 or cKK-E10 in a molar ratio of 40%; DMG-PEG2000 at a molar ratio of 1.5%, Cholesterol at a molar ratio of 28.5%, and 30% molar ratio of DOPE The mRNA according to any one of claims 16 to 19, comprising:

21. A pharmaceutical composition comprising the mRNA according to any one of claims 13 to 20.

22. 21. A vaccine for use in eliciting an immune response against hMPV or protecting a subject from hMPV infection, comprising administering to a subject the pharmaceutical composition of claim 12 or 21 or the mRNA of any one of claims 13 to 20, and optionally the subject has a comparable serum concentration of neutralizing antibodies to hMPV after administration of the vaccine compared to a subject administered a protein hMPV vaccine; The protein hMPV vaccine is co-administered with an adjuvant; and / or A vaccine, wherein the vaccine increases serum concentrations of neutralizing antibodies in subjects with pre-existing hMPV immunity.

23. A prophylactically effective amount of the F polypeptide or nucleic acid molecule of any one of claims 1 to 10, the mRNA of any one of claims 13 to 20, or the pharmaceutical composition of claim 12 or 21, for use in treating a subject in need thereof.

24. A vaccine comprising a human metapneumovirus (hMPV) F polypeptide antigen or a nucleic acid molecule encoding the same, wherein the F polypeptide comprises an amino acid sequence that has at least 95% identity with SEQ ID NO: 7 or consists of the amino acid sequence of SEQ ID NO:

7. hmm.

Images