Small molecule trail gene induction by normal and tumor cells as an anticancer therapy
TIC10 upregulates TRAIL expression in cancer cells, addressing delivery and stability issues of recombinant TRAIL, enhancing apoptosis and providing a broad-spectrum cancer treatment with improved efficacy.
Patent Information
- Application Number
- JP2025133453
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2011-04-29
- Filing Date
- 2025-08-08
- Publication Date
- 2025-10-17
AI Technical Summary
Existing treatments using recombinant TRAIL and TRAIL agonist antibodies face limitations such as short serum half-life, stability issues, high cost, and difficulty in delivering these agents across the blood-brain barrier, hindering their effectiveness in cancer therapy.
The use of TIC10, a small molecule TRAIL gene inducer, which upregulates TRAIL expression in both normal and cancer cells through a p53-independent mechanism, enhancing TRAIL-mediated apoptosis by inducing TRAIL expression and sensitizing tumor cells to apoptosis.
TIC10 effectively induces TRAIL expression, leading to sustained apoptosis in cancer cells and a bystander effect against tumors, demonstrating potential as a first-line treatment for various cancer types, including brain tumors, with improved efficacy and broader applicability compared to traditional TRAIL therapies.
Smart Images

Figure 2025159099000020 
Figure 2025159099000021 
Figure 2025159099000022
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is a joint venture of U.S. Provisional Patent Application No. 61 / 480,743, filed April 29, 2011. This application claims priority to U.S. Provisional Patent Application No. 2004 / 011999, filed on May 1, 2004, the entire contents of which are incorporated herein by reference. can be.
[0002] Reference to assistance This application was made possible by grant number U54CA105008 awarded by the National Institutes of Health. This invention was made with federal support. The United States Government has certain rights in this invention.
[0003] FIELD OF THE INVENTION The present invention generally relates to the use of a method for treating a proliferative disease, such as cancer, in a subject in need of such treatment. The present invention relates to methods and compositions for treating diseases. [Background technology]
[0004] Background of the Invention TNF-related apoptosis-inducing ligand (TRAIL; Apo2L) induces apoptosis in cancer cells. It is an endogenous protein that selectively induces cytosis.
[0005] TRAIL inhibits cell surface apoptosis through the involvement of either the extrinsic or intrinsic apoptotic pathways. Pro-ptosis death receptor 4 (DR4; TRAIL-R1) and death receptor 5 (DR5;TRAIL-R2)-mediated apoptosis enhancement in a wide range of human cancer cell lines TRAIL is a potent inducer of tumor suppression through immune surveillance. However, this antitumor mechanism is lost during the progression of the disease. The ability to selectively induce apoptosis is due to the interaction of two pro-apoptotic death receptors. Recombinant TRAIL and longer-lived TRAIL agonist antibodies targeting either It is currently undergoing clinical trials using intravenous administration.
[0006] Despite its potential, recombinant TRAIL has properties that limit its effectiveness (e.g., Short serum half-life, stability, cost, and delivery. Delivery of IL agonist antibodies to the brain was achieved using recombinant TRAIL and TRAIL agonist antibodies. is limited by its inability to cross the blood-brain barrier.
[0007] There is a continuing need for anti-cancer compositions and methods. Summary of the Invention [Means for solving the problem]
[0008] Summary of the Invention According to an embodiment of the present invention,
[0009] [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or a prodrug; and a pharmaceutically acceptable carrier. The compositions are administered to subjects in need of disease treatment (human subjects as well as subjects of other species). The compositions have utility in treating such diseases in subjects, including cancer. Treating cancer in subjects in need of such treatment (including human subjects as well as subjects of other species). It is useful when placing
[0010] According to an embodiment of the present invention, TIC10, its pharmaceutically acceptable derivatives, salts, and esters , amides, hydrates, solvates and / or prodrugs; pharmaceutically acceptable carriers and a second therapeutic agent.
[0011] According to an embodiment of the present invention, TIC10, its pharmaceutically acceptable derivatives, salts, and esters , amides, hydrates, solvates and / or prodrugs; pharmaceutically acceptable carriers and a second anti-cancer agent, wherein TIC10, the agent and / or its physiologically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or propanediols. Prodrugs are the first anti-cancer drugs.
[0012] According to an embodiment of the present invention, TIC10, its pharmaceutically acceptable derivatives, salts, and esters , amides, hydrates, solvates and / or prodrugs; pharmaceutically acceptable carriers and mitotic inhibition Agent A pharmaceutical composition comprising:
[0013] According to an embodiment of the present invention, TIC10, its pharmaceutically acceptable derivatives, salts, and esters , amides, hydrates, solvates and / or prodrugs; pharmaceutically acceptable carriers and a pharmaceutical composition comprising paclitaxel, docetaxel, or a combination thereof. Things are provided.
[0014] According to an embodiment of the present invention, TIC10, its pharmaceutically acceptable derivatives, salts, and esters , amides, hydrates, solvates and / or prodrugs; pharmaceutically acceptable carriers and a pharmaceutical composition comprising an anti-angiogenic agent.
[0015] According to an embodiment of the present invention, TIC10, its pharmaceutically acceptable derivatives, salts, and esters , amides, hydrates, solvates and / or prodrugs; pharmaceutically acceptable carriers and a pharmaceutical composition comprising bevacizumab.
[0016] According to an embodiment of the present invention, TIC10, its pharmaceutically acceptable derivatives, salts, and esters , amides, hydrates, solvates and / or prodrugs; and pharmaceutically acceptable salts thereof. A pharmaceutical composition formulated for oral administration is provided, comprising a carrier comprising:
[0017] According to an aspect of the present invention, there is provided a method of treating a subject in need thereof, the method comprising: comprises a pharmaceutically effective amount of TIC10, its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and pharmaceutically acceptable Included is the step of administering a carrier.
[0018] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of TIC10, a pharmaceutically acceptable derivative thereof, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and The method includes administering a pharmaceutically acceptable carrier.
[0019] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. and a pharmaceutically acceptable carrier. Included is the step of administering a carrier.
[0020] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of a pharmaceutically acceptable derivative of TIC10. and administering a pharmaceutically acceptable carrier.
[0021] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of TIC10, a pharmaceutically acceptable salt thereof, , esters, amides, hydrates and / or solvates; and pharmaceutically acceptable salts thereof. The method includes administering a carrier.
[0022] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of TIC10 or a pharmaceutically acceptable salt thereof to a mammal. and a pharmaceutically acceptable carrier. Contains.
[0023] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of TIC10, a pharmaceutically acceptable derivative thereof, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and and administering a pharmaceutically acceptable carrier to the subject; TNF-related apoptosis-inducing ligand was assayed in the samples to assess the effect of the treatment. The method includes a step of evaluating the
[0024] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of TIC10, a pharmaceutically acceptable derivative thereof, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and and administering a pharmaceutically acceptable carrier to the subject; TNF-related apoptosis-inducing ligand (TNF-RAL) in blood, serum, plasma, or cerebrospinal fluid samples Assaying to assess the effectiveness of the treatment.
[0025] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of TIC10, a pharmaceutically acceptable derivative thereof, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and and administering a therapeutically effective amount of a second antibody to the subject. Administering a cancer agent, wherein TIC10, a pharmaceutically acceptable derivative thereof, The salts, esters, amides, hydrates, solvates and / or prodrugs of the first anticancer agent is.
[0026] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of TIC10, a pharmaceutically acceptable derivative thereof, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and and administering a therapeutically effective amount of an antimitotic agent to the subject. The method includes administering a cleaving agent.
[0027] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of TIC10, a pharmaceutically acceptable derivative thereof, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and and administering a pharmaceutically acceptable carrier; and further administering a therapeutically effective amount of paclitaxel. The method includes administering acetaminophen, docetaxel, bevacizumab, or any two or more thereof. Includes.
[0028] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of TIC10, a pharmaceutically acceptable derivative thereof, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and Oral administration in a pharmaceutically acceptable carrier is included.
[0029] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of TIC10, a pharmaceutically acceptable derivative thereof, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs; and The method includes administering a pharmaceutically acceptable carrier, wherein the administration is by rectal, nasal, or intravenous route. , pulmonary, epidural, ocular, ear, intra-arterial, intracardiac, intraventricular, intradermal, intravenous, intramuscular, intraperitoneal, bone Intrathecal, intravesical, subcutaneous, topical, transdermal, transmucosal, sublingual, buccal, vaginal and inhalation administration The administration is by a route selected from the group consisting of:
[0030] According to an embodiment of the present invention, a subject having or at risk of having a brain tumor is treated A method is provided, which comprises administering a pharmaceutically effective amount of TIC10, a pharmaceutically acceptable salt thereof, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof; and a pharmaceutically acceptable carrier. In a preferred embodiment of the present invention, for example, the following items are provided: (Item 1) [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or a prodrug; and a pharmaceutically acceptable carrier. (Item 2) 10. The pharmaceutical composition of claim 1, further comprising a second therapeutic agent. (Item 3) 3. The pharmaceutical composition of claim 2, wherein the second therapeutic agent is an anti-cancer agent. (Item 4) 4. The pharmaceutical composition of item 3, wherein the anti-cancer agent is a mitotic inhibitor. (Item 5) The anticancer agent is selected from the group consisting of paclitaxel, docetaxel, and combinations thereof. 4. The pharmaceutical composition according to item 3, selected from (Item 6) 3. The pharmaceutical composition of claim 2, wherein the second therapeutic agent is an anti-angiogenic agent. (Item 7) 7. The pharmaceutical composition of item 6, wherein the antiangiogenic agent is bevacizumab. (Item 8) Item 1. The pharmaceutical composition according to item 1, formulated for oral administration. (Item 9) 1. A method of treating a subject in need thereof, comprising: a pharmaceutically effective amount [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or a prodrug; and a pharmaceutically acceptable carrier. (Item 10) Assaying TNF-related apoptosis-inducing ligand in a sample obtained from the subject Item 10. The method according to Item 9, further comprising the step of: (Item 11) 10. The method of item 9, wherein the subject has or is at risk of having cancer. (Item 12) 12. The method of claim 11, further comprising administering an additional anti-cancer agent. (Item 13) 13. The method of claim 12, wherein the additional anti-cancer agent is an anti-mitotic agent. (Item 14) The additional anticancer drug is paclitaxel, docetaxel, bevacizumab, or any of them. Item 13. The method according to item 12, wherein the above two or more of the above are selected. (Item 15) In a blood sample obtained from the subject, increased TNF-associated apoptosis-induced risk 11. The method of claim 10, wherein a cancer is assayed. (Item 16) 10. The method of claim 9, wherein the administration is oral administration. (Item 17) The administration may be rectal, nasal, pulmonary, epidural, ocular, aural, intra-arterial, intracardiac, intracerebroventricular, intradermal, intravenous , intramuscular, intraperitoneal, intraosseous, intrathecal, intravesical, subcutaneous, topical, transdermal, transmucosal, sublingual, buccal 7. The method of claim 6, wherein the administration routes are selected from the group consisting of intravenous, intravenous, vaginal and inhalation. (Item 18) 1. A method of treating a subject having or at risk of having a brain tumor, comprising: a pharmaceutically effective amount [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or a prodrug; and a pharmaceutically acceptable carrier. (Item 19) 1. A method of treating a subject in need thereof, comprising: a pharmaceutically effective amount [ka] , a pharmaceutically acceptable salt, ester, amide, hydrate or solvate thereof; and The method comprises administering a physiologically acceptable carrier. (Item 20) for the manufacture of a medicament for treating cancer, [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or the use of prodrugs. (Item 21) Compounds for treating cancer [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. Or prodrugs. (Item 22) A pharmaceutical composition substantially as described herein. (Item 23) A method of treatment substantially as described herein. [Brief explanation of the drawings]
[0031] [Figure 1] Figure 1 is a graph showing the activity of a luciferase reporter in HCT116 Bax- / - cells under the transcriptional regulation of the first 504 base pairs of the human TRAIL gene promoter upstream of the transcription start; [Figure 2]Figure 2 is a graph showing RT-qPCR analysis of TRAIL mRNA levels in HCT116 p53- / - cells; [Figure 3] Figure 3 is a graph showing surface TRAIL levels induced by TIC10 in a panel of cancer cells; [Figure 4] Figure 4 is a graph showing surface TRAIL levels in HCT116 p53- / - cells after TIC10 treatment under the indicated conditions and time points; [Figure 5] Figure 5 is a graph showing HCT116 p53- / -TRAIL surface levels by flow cytometry 72 hours after the initiation of TIC10 treatment; [Figure 6] Figure 6 shows the cell cycle profiles of HCT116 p53- / - and human foreskin fibroblast (HFF) cells treated with TIC10; [Figure 7] Figure 7 is a graph showing quantification of colony formation assays of cancer cells treated with TIC10; [Figure 8] Figure 8 is a graph showing a similar experiment as in Figure 7 except that HFF cells were counted at the end time point; [Figure 9] Figure 9 is a graph showing sub-G1 analysis of HCT116 WT, p53- / - and Bax- / - cells after treatment with DMSO, TIC10, or rhTRAIL (25 ng / mL); [Figure 10] Figure 10 is an image showing the results of Western blot analysis; [Figure 11] Figure 11 is a graph showing sub-G1 analysis of TIC10-treated cancer cells preincubated with or without zVAD-fmk; [Figure 12] Figure 12 is a graph showing sub-G1 analysis of MDA-MB-231 cells in which TRAIL was stably knocked down by short hairpin RNA; [Figure 13]Figure 13 is a graph showing demonstration of MDA-MB-231 shTRAIL knockdown by flow cytometry analysis of TIC10-treated cells; [Figure 14] Figure 14 is a graph showing sub-G1 analysis of TIC10-induced cell death in H460 cells with overexpression of endogenous DR5 or a DR5 construct in which its death domain was replaced with EGFP; [Figure 15] Figure 15 is a graph showing sub-G1 analysis of HCT116 cells treated with DMSO, TIC10, or rhTRAIL in the presence or absence of RIK-2, a TRAIL-sequestering antibody; [Figure 16] Figure 16 is a graph showing surface TRAIL induced by TIC10 using freshly excised human colon cancer cells; [Figure 17] Figure 17 is a graph showing the results of a cell viability assay of the primary colon cancer cells of Figure 16 treated with DMSO, TIC10, or 5-FU; [Figure 18] Figure 18 is a graph showing that TIC10 or rhTRAIL can reduce cell viability of HCT116 cells after 1 hour of preincubation at the indicated temperatures; [Figure 19] Figure 19 is a graph showing HCT116 p53- / - xenografts treated with TIC10, TRAIL, or vehicle; [Figure 20] Figure 20 is a graph showing the results of bioluminescence imaging of luciferase-infected HCT116 p53- / - xenografts treated with TIC10 or vehicle; [Figure 21] Figure 21 is a graph showing RKO xenografts treated with TIC10, TRAIL or vehicle; [Figure 22] Figure 22 shows boxplots of tumor volumes in MDA-MB-231 vector or shTRAIL xenografts at day 9 after initiation of treatment with TIC10, TRAIL, or vehicle; [Figure 23] Figure 23 is a graph showing the relative tumor volume of DLD-1 xenografts treated with TRAIL, TIC10, or DMSO; [Figure 24] Figure 24 is a graph showing a comparison of ip and oral administration of TIC10 in SW480 xenografts; [Figure 25] Figure 25 is a graph showing TIC10 or vehicle administered as a single dose orally in HCT116 xenografts; [Figure 26] Figure 26 is a graph showing the body weight of athymic female nude mice treated with a single dose of TIC10; [Figure 27] Figure 27 is a graph showing the body weight of C57 / B6 female mice at the end of week 4 of treatment with oral TIC10; [Figure 28] Figure 28 is a graph showing overall survival of Εμ-myc treated with oral TIC10 weekly between weeks 9 and 12; [Figure 29] Figure 29 is a graph showing cell viability of DLD-1 cells treated with TIC10 together with paclitaxel; [Figure 30] Figure 30 is a graph showing cell viability of SW620 cells treated with TIC10 together with paclitaxel; [Figure 31] Figure 31 is a graph showing cell viability of DLD-1 cells treated with TIC10 together with Taxotere; [Figure 32] Figure 32 is a graph showing cell viability of SW620 cells treated with TIC10 together with Taxotere; [Figure 33] Figure 33 is a graph showing the percentage of the cohort retaining tumor tissue after treatment with TIC10 or Taxotere alone, in combination, or with vehicle in H460 xenografts; [Figure 34] Figure 34 is a graph showing a plot of relative tumor volume for Figure 33; [Figure 35]Figure 35 is a graph showing the percentage of cohorts retaining tumor tissue after treatment with TIC10 or paclitaxel alone, in combination, or with vehicle in H460 xenografts; [Figure 36] Figure 36 is a graph showing a plot of relative tumor volume for Figure 35; [Figure 37] Figure 37 is a graph showing the percentage of cohorts implanted intracecally with HCT116 p53- / - tumors and treated with TIC10, bevacizumab, or a combination of TIC10 and bevacizumab that had palpable tumors at primary and distant sites at the end point; [Figure 38] Figure 38 is a graph showing the body weight of mice implanted with intracecal HCT116 p53- / - tumors treated with vehicle, TIC10, bevacizumab, or the combination of TIC10 and bevacizumab; [Figure 39] Figure 39 is a graph showing TRAIL serum levels in tumor-free mice after TIC10 or doxorubicin; [Figure 40] Figure 40 is a graph showing the absorbance profile of TIC10 with peak absorbance at 239 nm; [Figure 41] Figure 41 is a graph showing the calibration curve for TIC10 spiked into mouse plasma and quantified using area under the curve (AUC) by HPLC analysis; [Figure 42] Figure 42 is a graph showing the plasma concentrations of TIC10 after intravenous administration to C57 / B6 female mice; [Figure 43] Figure 43 is a graph showing the analysis of surface TRAIL on HFF cells after TIC10 treatment (0, 2.5, 5 or 10 μM from left to right); [Figure 44] Figure 44 is a graph showing sub-G1 analysis of co-cultures of HCT116 p53- / - cells and pretreated HFFs; [Figure 45]Figure 45 is a graph showing surface TRAIL in GBM cell lines after incubation with TIC10; [Figure 46] Figure 46 is a graph showing extrapolated GI50 values from cell viability assays of the indicated GBM cell lines after 72 hours of treatment with TIC10 or DMSO; [Figure 47] Figure 47 shows the results of cell viability assays of freshly excised glioblastoma tissues treated with DMSO, TIC10, or temozolomide; [Figure 48] Figure 48 is a graph showing T98G subcutaneous xenografts in mice receiving a single dose of vehicle, TIC10, or bevacizumab; [Figure 49] Figure 49 is a graph showing overall survival of mice bearing SF767 intracranial tumors treated with a single oral dose of vehicle, TIC10, bevacizumab, or TIC10 and bevacizumab; [Figure 50] Figure 50 is a graph showing transcriptional changes associated with FOXO signaling from gene expression profiling of HCT116 p53- / - cells 48 hours after TIC10 treatment compared to DMSO; [Figure 51] Figure 51 is an image of Western blot analysis of DR5 in HCT116 cells treated with TIC10 or DMSO; [Figure 52] Figure 52 is a graph showing flow cytometry analysis of surface DR5 levels in cancer and normal cells treated with TIC10; [Figure 53] Figure 53 is an image of a Western blot analysis of whole cell lysates (W) and cytoplasmic (C) and nuclear (N) extracts of HCT116 cells treated with DMSO or TIC10; [Figure 54]Figure 54 is an image of the results of a chromatin immunoprecipitation assay for TIC10-induced translocation of Foxo3a to the TRAIL promoter 48 hours after TIC10 treatment (0, 2.5, 5, or 10 μM, from left to right) in HCT116 p53- / - cells; [Figure 55] Figure 55 is a graph showing the results of flow cytometry analysis of cell surface TRAIL levels induced by TIC10 with or without transient knockdown of Foxo1 and / or Foxo3a in HCT116 p53- / - cells using siRNA; [Figure 56] Figure 56 is a graph showing sub-G1 analysis of TIC10-induced cell death with or without stable knockdown of Foxo3a in HCT116 cells; [Figure 57] Figure 57 is a graph showing flow cytometry analysis of surface TRAIL induced by TIC10 with or without stable knockdown of Foxo3a in HCT116 cells; [Figure 58] Figure 58 is a graph showing tumor volume of HCT116 xenografts with or without stable knockdown of Foxo3a after a single oral dose of vehicle or TIC10; [Figure 59] Figure 59 is an image of Western blot analysis of HCT116 p53- / - cells treated with TIC10 (2.5, 5, 10 μM) for 72 hours; [Figure 60] Figure 60 is an image of Western blot analysis of HCT116 p53- / - cells treated with TIC10; [Figure 61] Figure 61 is a graph showing the time course of protein expression levels of TIC10-induced effects as measured by densitometry of Western blots of replicate experiments as in Figure 60; [Figure 62]Figure 62 is an image of Western blot analysis of the effect induced by TIC10 on Foxo3a in DLD1 human colon cancer cells, MDA-MB-468 human breast cancer cells, and T98G human glioblastoma multiforme cell line; [Figure 63] Figure 63 is an image of a Western blot analysis showing overexpression of myr-Akt; [Figure 64] Figure 64 is a graph showing flow cytometry analysis of surface TRAIL in HCT116 cells overexpressing empty vector or myristilated Akt (myr-Akt) subjected to TIC10 treatment; [Figure 65] Figure 65 is a graph showing the sub-G1 content of HCT116 cells overexpressing empty vector or myr-Akt subjected to TIC10 treatment; [Figure 66] Figure 66 is a graph showing RT-qPCR analysis of TRAIL mRNA in HCT116 p53- / - cells after incubation with A6730 (Akt inh), U0126 monoethanolate (MEK inh), or both; [Figure 67] Figure 67 is a graph showing the induction of surface TRAIL as in Figure 66 with or without stable knockdown of Foxo3a; [Figure 68] Figure 68 is a graph showing sub-G1 analysis of MDA-MB-231 cells with or without TRAIL knockdown by shRNA after incubation with Akt inh, MEK inh, or both; [Figure 69] Figure 69 is a graph showing surface TRAIL analysis of HCT116 p53- / - cells after incubation with A6730 (Akt inh), U0126 monoethanolate (MEK inh), or both; [Figure 70]Figure 70 is a graph showing RT-qPCR analysis of TRAIL mRNA levels after transient knockdown of Akt and / or ERK in HCT116 p53- / - cells; [Figure 71] Figure 71 is an image showing confirmation of Akt and ERK knockdown by Western blot analysis; [Figure 72] FIG. 72 is a graph showing surface TRAIL analysis after transient knockdown of Akt and / or ERK in HCT116 cells. DETAILED DESCRIPTION OF THE INVENTION
[0032] Detailed Description of the Invention Scientific and technical terms used herein have the meanings commonly understood by those of ordinary skill in the art. Such terms are used in various standard reference contexts. It has been found to be defined and used in various ways, and references to such things include, for example, , J. Sambrook and DWRussell, Molecular Cl. oning:A Laboratory Manual,Cold Spring Ha rbor Laboratory Press;3rd Ed.,2001;FMA usubel,Ed.,Short Protocols in Molecular Biology,Current Protocols;5th Ed.,2002;B .Alberts et al., Molecular Biology of the Cell, 4th Ed., Garland, 2002; DL Nelson and MM Cox,Lehninger Principles of Biochemistry ,4th Ed.,WHFreeman & Company,2004;Enge lke,DR,RNA Interference(RNAi):Nuts and Bolts of RNAi Technology,DNA Press LLC, Eagleville, PA, 2003; Herdewijn, P. (Ed.), Oli gonucleotide Synthesis:Methods and Appli cations,Methods in Molecular Biology,Hum ana Press,2004;A.Nagy,M.Gertsenstein,KV intersten,R.Behringer,Manipulating the M ouse Embryo:A Laboratory Manual,3rd edit ion, Cold Spring Harbor Laboratory Press; December 15,2002,ISBN-10:0879695919;Kurs ad Turksen(Ed.),Embryonic stem cells:met hods and protocols in Methods Mol Biol.2 002;185,Humana Press;Current Protocols i Stem Cell Biology, ISBN:9780470151808 It can be obtained.
[0033] The singular terms "a," "an," and "the" are not intended to be limiting; Unless something else is explicitly stated or the context clearly indicates otherwise To the extent possible, it includes multiple referents.
[0034] p53 is often inactivated in late-stage cancers, thereby preventing the development of 5-FU and chemotherapy. Many standard-of-care therapies, such as sorbic acid, es), so that methods and compositions according to embodiments of the invention include: TRAIL upregulates the TRAIL gene by a p53-independent mechanism Screening for inducing compounds identified small molecule transcription inducers of the TRAIL gene. The present invention relates to TRAIL-inducing compound 10 (TIC10) identified by the present inventors.
[0035] TIC10 induces TRAIL expression in both normal and cancer cells. 10 or a pharmaceutically acceptable derivative, salt, ester, amide, hydrate, solvate thereof The term "T" is used herein to describe the effect of a prodrug. "TIC10-induced TRAIL expression," "TIC10-induced TRAIL," and Grammatical equivalents of these include TIC10 or a pharmaceutically acceptable derivative, salt, or ester thereof. T by cells contacted with the amides, hydrates, solvates and / or prodrugs A detectable increase in TRAIL is achieved by: TRAIL protein or TRAI using well-known protein or nucleic acid assay methods It can be measured by an assay for L nucleic acid.
[0036] TIC10-induced TRAIL was expressed in cancer cells, normal cells, and serum. This is sustained by the presence of TRAIL, resulting in a TRAIL-mediated bystander effect against cancer cells and tumors. TIC10 inactivates Akt and ERK, leading to the nuclear translocation of Foxo3a and T This results in the induction of RAIL transcription.
[0037] TIC10-induced TRAIL is dependent on Foxo3a, and Foxo3a , upregulates the TRAIL death receptor DR5, among other targets, and several TIC10-induced sensitization of TRAIL-resistant tumor cells. Induction of RAIL is sustained in tumor cells, stromal cells, and host cells.
[0038] According to an embodiment of the present invention, TIC10 or a pharmaceutically acceptable derivative, salt, or ester thereof is provided. Pharmaceutical compositions containing esters, amides, hydrates, solvates and / or prodrugs, and methods for their use are provided.
[0039] According to an aspect of the present invention, there is provided a pharmaceutical composition comprising a compound of structure (I).
[0040] [ka] The compound of structure (I) is referred to herein as TRAIL-inducing compound 10 (TIC10) and Also known as NSC350625.
[0041] Compounds of structure (I) (TIC10) can be obtained commercially or by standard methods. It can be synthesized using chemical synthesis methods.
[0042] Pharmaceutical compositions according to aspects of the present invention comprise pharmaceutically acceptable derivatives of compounds of structure (I). It may also be a compound, salt, ester, amide, hydrate, solvate and / or prodrug. .
[0043] Pharmaceutically acceptable derivatives, salts, esters, amides, hydrates of compounds of structure (I), The solvates and / or prodrugs may be commercially available or may be prepared by standard methods. It can be synthesized using chemical synthesis methods.
[0044] The term "pharmaceutically acceptable derivatives" as used in reference to compounds of structure (I) means compounds of structure (I) Compound (I) substantially retains its demonstrated activity in inducing TRAIL expression in cells. Compounds of structure (I) further substituted at any substitutable position, such as compounds of structure (I) The compound of structure (I) may be any of the following: F, Cl, Br, a lower alkyl group, a lower alkoxy group, or Any substituted by one or more fluorinated lower alkyl groups (e.g., CF3) Further substitutions are made at positions as needed.
[0045] "Pharmaceutically acceptable" salts, esters, amides, hydrates, prodrugs or solvates The article is suitable for use in a subject without undue toxicity or irritation to the subject. and is effective for its intended use.
[0046] Pharmaceutically acceptable salts include pharmaceutically acceptable acid addition salts and base addition salts. Pharmaceutically acceptable salts are well known in the art and are available, for example, from SMBerge et al., J. Pharm. Sci., 66:1-19, 1977. Exemplary pharmaceutically acceptable salts are those that are compatible with the subject's immune system without undue toxicity or irritation to the subject. Salts that are suitable for use in the body and effective for their intended use. Their salts are formed from inorganic acids (e.g., hydrochloric acid, hydrobromic acid, hydroiodic acid, nitric acid, phosphoric acid). , sulfuric and sulfamic acids); organic acids (e.g., acetic acid, adipic acid, alginic acid, aspartic acid, Corbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 2-acetoxybenzoic acid , butyric acid, camphoric acid, camphorsulfonic acid, cinnamic acid, citric acid, digluconic acid, ethanol Sulfonic acid, formic acid, fumaric acid, glutamic acid, glycolic acid, glycerophosphate, hemisulfuric acid Hemisulfic acid, heptanoic acid, hexanoic acid, 2-hydroxyethanoic acid Isethionic acid, lactic acid, maleic acid, hydroxymaleic acid, malic acid, Malonic acid, mandelic acid, mesitylenesulfonic acid, methanesulfonic acid, naphthalenesulfonic acid Acid, Nicotinic acid, 2-naphthalenesulfonic acid, Oxalic acid, Pamoic acid, Pectic acid, Phenyl Acetic acid, 3-phenylpropionic acid, picric acid, pivalic acid, propionic acid, pyruvic acid, Pyruvic acid, salicylic acid, stearic acid, succinic acid, sulfanilic acid, tartaric acid, p-toluic acid enesulfonic acid, trichloroacetic acid, trifluoroacetic acid and undecanoic acid); inorganic bases ( For example, ammonia, ammonium hydroxides, carbonates and bicarbonates; organic bases ( For example, primary, secondary, tertiary and quaternary amine compounds, ammonium, arginine , Betaine, Choline, Caffeine, Diolamine, Diethylamine, Diethanolamine ethanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexyl Amines, dicyclohexylamine, dibenzylamine, N,N-dibenzylphenethylamine amine, 1-ephenamine, N,N'-dibenzylethylenediamine Amine, ethanolamine, ethylamine, ethylenediamine, glucosamine, histidine amine, hydrabamine, isopropylamine, 1h-imidazole, lysine, methylamine, N-Ethylpiperidine, N-Methylpiperidine, N-Methylmorpholine, N,N-Dimethyl aniline, piperazine, trolamine, methylglucamine, purine, piperidine, pyridine ammonium compounds, theobromine, tetramethylammonium compounds, tetraethylammonium compounds , trimethylamine, triethylamine, tripropylamine and tributylamine) and metal cations (e.g., aluminum, calcium, copper, iron, lithium, magnesium It is formed using sulphur dioxide (sodium, manganese, potassium, sodium and zinc).
[0047] Pharmaceutically acceptable solvates include, for example, hydrates, ethanolates, methanolates, and the like. Examples include:
[0048] Exemplary pharmaceutically acceptable amides include ammonia, primary C1-C6 alkyl amides, and the like. Amides (5- or 6-membered alkyl amines) obtained from alkylamines and secondary C1-C6 dialkylamines including amides in the form of nitrogen-containing heterocycles.
[0049] TIC10 prodrugs are compounds that convert TIC10 to intact, active TIC10. A form of TIC10 covalently linked to a moiety that is released. ,Sloan,KB,Prodrugs,M.Dekker,New York,1 992; and Testa, B. and Mayer, J.M., Hydrolysis in drug and prodrug metabolism:chemistr y,biochemistry,and enzymology,Wiley-VCH, It is well known in the art as exemplified in Zurich, 2003.
[0050] As a first-line treatment
[0051] [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or a prodrug; a pharmaceutically acceptable carrier; and a second treatment, such as an anti-cancer agent. A pharmaceutical composition containing the drug is provided.
[0052] According to an aspect of the present invention, there is provided a method of treating a subject in need thereof, the method comprising: is a pharmaceutically effective amount of:
[0053] [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or prodrug; and a pharmaceutically acceptable carrier.
[0054] A method of treating a subject in need thereof is provided, the method comprising administering to the subject a pharmaceutically effective amount effective to induce expression of TRAIL
[0055] [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or prodrug; and a pharmaceutically acceptable carrier.
[0056] Assaying TRAIL protein in a test sample obtained from the subject Thus, TIC10-induced TRAIL expression can be detected.
[0057] Enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunofiltration assay (ELIFA) , flow cytometry, immunoblotting, immunoprecipitation, immunohistochemistry, immunocytochemistry, luminescence Immunoassay (LIA), Fluorescence Immunoassay (FIA) and Radioimmunoassay Immunoassay methods, including but not limited to, assaying TRAIL in a sample Assay methods for obtaining qualitative and / or quantitative results. Assays suitable for both qualitative and quantitative assay of samples can be used. Specific details of the method are given in standard references, such as Illustratively, see E. Harlow and D. Lane, Antibodies: A Laboratory Manual,Cold Spring Harbor La boratory Press,1988;F.Breitling and S.Du ebel,Recombinant Antibodies,John Wiley & Sons, New York, 1999; H. Zola, Monoclonal An tibodies:Preparation and Use of Monoclon al Antibodies and Engineered Antibody De rivatives,Basics:From Background to Benc h,BIOS Scientific Publishers,2000;BKC Lo,Antibody Engineering:Methods and Prot ocols,Methods in Molecular Biology,Human a Press, 2003; F.M. Ausubel et al., Eds., Short Pro tocols in Molecular Biology, Current Prot ocols, Wiley, 2002; S. Klussman, Ed., The Apta mer Handbook: Functional Oligonucleotides and Their Applications, Wiley, 2006; Ormer od, M.G., Flow Cytometry: a practical appro ach, Oxford University Press, 2000; Givan, A .L., Flow Cytometry: first principles, Wile y, New York, 2001; Gorczyca, W., Flow Cytomet ry in Neoplastic Hematology: morphologic- immunophenotypic correlation, Taylor & Fr ancis, 2006; Crowther, J.R., The ELISA Guide book (Methods in Molecular Biology), Human a Press, 2000; Wild, D., The Immunoassay Han dbook, 3rd Edition, Elsevier Science, 2005 and J. Sambrook and D.W. Russell, Molecular C loning: A Laboratory Manual, Cold Spring H arbor Laboratory Press, 3rd Ed., 2001 are cited herein.
[0058] The aptamers can be used to assay a sample for TRAIL. An "aptamer" is a peptide and / or nucleic acid that binds substantially specifically to a particular substance. In the case of nucleic acid aptamers, the aptamer may be a second and / or third Target binding other than Watson / Crick base pairing or triple helix binding with nucleic acids Such bonding interactions include, for example, These include der Waals interactions, hydrophobic interactions, hydrogen bonding and / or electrostatic interactions. Similarly, peptide-based aptamers can be characterized by specific binding to a target. wherein the aptamer is not a naturally occurring ligand for the target. Methods for identifying and generating peptide and nucleic acid aptamers and their applications The use of the method is described, for example, in FMAsubel et al., Eds., Short Protocols ls in Molecular Biology,Current Protocol s,Wiley,2002;S.Klussman,Ed.,The Aptamer Handbook:Functional Oligonucleotides and Their Applications, Wiley, 2006; and J. Samb rook and DWRussell,Molecular Cloning:A Laboratory Manual,Cold Spring Harbor La As described in the International Journal of Clinical Chemistry, Vol. 1, No. 1, pp. 111-115, 2001. It is well known in the art.
[0059] Spectroscopic analysis is used to assay samples for TRAIL. Quantitative analysis can be used in assays according to aspects of the present invention. Mass spectrometry can be used to measure, for example, Time-of-flight (TOF) mass spectrometry or Fourier transform ion cyclotron resonance mass spectrometry was used. Mass spectrometry techniques are known in the art and are used to analyze proteins and / or peptides. An exemplary detailed description of methods for peptide assays can be found in Li J. et al., Clin Che m.,48(8):1296-304,2002;Hortin,GL,Clini cal Chemistry 52:1223-1237,2006;Hortin,G. L.,Clinical Chemistry 52:1223-1237,2006 ;AL Burlingame et al. (Eds.), Mass Spectrometry in Biology and Medicine,Humana Press,20 00; and D.M. Desiderio, Mass Spectrometry of Peptides, CRC Press, 1990.
[0060] By assaying the localization of TRAIL on the surface of cells, the pharmaceutical compositions of the present invention can be The effect of the composition can be detected. Detection of the localization of TRAIL can be performed by flow cytometry or the like. This can be done by immunoassay as well as immunohistochemistry.
[0061] The test sample may be any biological fluid, cell, or tissue (e.g., blood, plasma, Serum, urine, saliva, ascites, cerebrospinal fluid, ventricular fluid, pleural fluid, lungs and bronchi Alveolar lavage samples, mucus, sweat, tears, semen, bladder washing samples, amniotic fluid, lymph, ascites ( peritoneal fluid, synovial fluid, bone marrow aspirate, tumor cells or tissue, organ cells In a preferred embodiment, the test sample may be a cell or tissue (e.g., a biopsy). The sample may be blood, plasma or serum.
[0062] Test samples from subjects may be assayed for TRAIL or other biomarkers, as appropriate. Purified for assay. The term "purified" in the context of a test sample means TRAIL or another biomarker from at least one other component present in the test sample. Purification of the test sample illustratively involves electrophoretic methods (e.g., , gel electrophoresis and 2-D gel electrophoresis); chromatographic methods (e.g., HPLC C, ion exchange chromatography, affinity chromatography, size exclusion chromatography This is achieved by techniques including chromatography, thin layer chromatography, and paper chromatography. can be.
[0063] Assays for TRAIL can be performed in cells and tissues, e.g., immunohistochemistry. In situ hybridization and in situ hybridization in cell or tissue test samples It can be used to assay TRAIL protein and / or nucleic acid.
[0064] One or more standards are used to allow for quantitative measurement of TRAIL in the sample. obtain.
[0065] Assay of TRAIL in test samples was performed using the assay of TRAIL in control samples. A control sample can be compared to a control assay, for example, from one or more normal subjects. There is something to be gained.
[0066] According to an embodiment of the present invention, an assay for TRAIL is used to monitor a subject. Thus, for example, test samples may be used to assess the effectiveness of a treatment. one or more of the following: before, during and / or after treatment with the pharmaceutical composition of the present invention; In a further example, the test sample is obtained from the subject at the time point above. Tests are obtained from the subject at various time points to assess progression or healing.
[0067] In certain embodiments, to aid in monitoring treatment with the pharmaceutical compositions of the present invention, One or more additional biomarkers are assayed in a test sample obtained from the subject. For example, the localization of phospho-ERK, phospho-Akt, Foxo3a and / or One or more of the phosphorylations may be measured by a subject to aid in monitoring treatment with the pharmaceutical compositions of the present invention. Such additional biomarkers are assayed in a test sample obtained from the subject. The antibody may be assayed by immunoassay methods such as those described herein.
[0068] To detect TIC10-induced TRAIL expression, test samples obtained from subjects were TRAIL nucleic acids can be assayed in the presence of TRAIL nucleic acids, particularly mRNA or cDNA. Assays for detecting DNA include polymerase chain reaction (PCR) (e.g., RT-PCR), dot blot, in situ hybridization, Northern blot These include, but are not limited to, ATP and RNase protection.
[0069] In accordance with the present invention, methods and compositions for treating cancer are provided.
[0070] According to an aspect of the present invention, a method for treating a subject having or at risk of having cancer is provided. The method comprises administering a pharmaceutically effective amount of
[0071] [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or prodrug; and a pharmaceutically acceptable carrier.
[0072] Methods of treating a subject having or at risk of having cancer are provided, the methods comprising: a pharmaceutically effective amount effective to induce expression of TRAIL in the subject
[0073] [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or prodrug; and a pharmaceutically acceptable carrier.
[0074] Cancers treated using the methods and compositions described herein are characterized by abnormal cell proliferation ( including but not limited to preneoplastic hyperproliferation, carcinoma in situ, neoplasia, and metastasis) The methods and compositions of the present invention are characterized by the following: It can be used for prevention as well as recovery. Used to refer to the treatment of cancer in a subject. As used, the terms "treat" and "treatment" include preventing cancer in the subject, Inhibiting or ameliorating (e.g., slowing the progression of cancer and / or preventing cancer (reducing or reversing the signs or symptoms of
[0075] A pharmaceutically effective amount of the composition of the present invention has a beneficial effect in the treated subject. Preneoplastic hyperproliferation, carcinoma in situ, neoplasia, metastasis, tumor, benign growth, or abnormal cell proliferation, including but not limited to other conditions responsive to the compositions of the present invention. a subject having or at risk of having cancer, such as a condition characterized by proliferation In the present invention, a pharmaceutically effective amount of the composition of the present invention is administered to treat one or more symptoms and / or For example, a pharmaceutically effective amount of The compositions of the present invention detectably increase apoptosis and / or inhibit the growth of abnormal cells. Cellular proliferation (preneoplastic hyperproliferation, carcinoma in situ, neoplasia, metastasis, tumor, benign growth, or and other conditions responsive to the compositions of the present invention. It is effective in reducing the proliferation of cells in the associated cancerous condition.
[0076] TIC10 is a novel marker for inflammatory bowel disease in primary patient samples and cell lines that are resistant to conventional treatments. TIC10 has a broad spectrum of activity as described herein, which indicates that the therapeutic effects of TIC10 are molecules commonly altered in the This suggests that the therapeutic cellular mechanism of TIC10 is not solely dependent on TIC10. Resistance mechanisms (e.g., overactivated Akt) described in the specification have been identified and are thought to be involved in cancer. Phospho-ERK and phospho-A were shown to be correlated biomarkers of the therapeutic activity of TIC10 in kt, Foxo3a localization and phosphorylation, and surface and serum TRAIL provided will be done.
[0077] Thus, according to aspects of the present invention, one or more correlates of TIC10 therapeutic activity in cancer Sexual biomarkers are assayed to evaluate treatment with the pharmaceutical compositions of the present invention .
[0078] The subjects to be treated according to the methods and with the compositions of the present invention may be mammals or The mammalian subject may be any mammal, including, but not limited to, are humans; non-human primates; rodents (e.g., mice, rats, or guinea pigs); domestic animals Domesticated pets (e.g., cats or dogs); horses, cows, pigs, sheep, goats or The non-mammalian subject may be any non-mammalian animal, including, but not limited to, rabbits. These may include birds (e.g., ducks, geese, chickens, or pheasants). Subjects may be of either gender, The subject may be of any age. In embodiments, the subject is a human. The terms "subject" and "patient" are used herein. are used interchangeably throughout.
[0079] The pharmaceutical composition of the present invention generally contains about 0.1 to 99% of the TIC10, its pharmaceutically acceptable salt. and tolerable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof. and a pharmaceutically acceptable carrier. , at least one pharmaceutically acceptable derivative, salt, ester, amide, hydrate thereof; Solvates and / or prodrug combinations are also considered to be within the scope of the present invention. Furthermore, the pharmaceutically acceptable derivatives, salts, esters thereof in pharmaceutical compositions can be used. a combination of at least two of the following: an amide, a hydrate, a solvate, and a prodrug; are also considered to be within the scope of the present invention.
[0080] According to an aspect of the invention, a combination of therapeutic agents is administered. The method of treating cancer in a subject includes administering TIC10, a pharmaceutically acceptable derivative, salt, or esters, amides, hydrates, solvates and / or prodrugs; and at least According to an embodiment of the present invention, the subject is administered a pharmaceutical composition of one additional therapeutic agent. The method for treating cancer in a patient is characterized in that TIC10, its pharmaceutically acceptable derivatives, salts, esters, or the like are administered intravenously. amides, hydrates, solvates and / or prodrugs; and at least two It includes administering a pharmaceutical composition of an additional therapeutic agent.
[0081] The term "additional therapeutic agent" refers to a chemical compound, a mixture of chemical compounds, a biological macromolecule (e.g., a nucleic acid), or a an antibody, a protein or portion thereof, e.g., a peptide), or locally in a subject biologically, physiologically or pharmacologically active substance (singular or of biological material (e.g., bacteria, plants, fungi or animals (especially mammals) The term "extract" is used herein to refer to an extract prepared from a sample of a living organism (cell or tissue).
[0082] Additional therapeutic agents that may be included in accordance with aspects of the methods and compositions of the present invention include antibiotics. , antiviral agents, antineoplastic agents, analgesics, antipyretics, antidepressants, antipsychotics, anticancer agents, antihives Anti-osteoporosis drugs, anti-osteonecrosis drugs nts), anti-inflammatory agents, anti-anxiety agents, chemotherapy agents, diuretics, growth factors, hormones, non-steroidal These include, but are not limited to, diuretic anti-inflammatory agents, steroids and vasoactive agents.
[0083] TIC10, its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, and solvents Combination therapy using a dihydrate and / or prodrug and one or more additional therapeutic agents is and may exhibit synergistic effects, for example, when used in combination with TIC10, its pharmaceutically acceptable derivatives, as monotherapy. derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs or may be observed when using a pharmaceutical composition of the present invention comprising one or more additional therapeutic agents alone. It may show a greater therapeutic effect than the effect.
[0084] According to embodiments, the combination therapy can be (1) administered with one or more additional therapeutic agents as a single composition; TIC10 of the present invention, its pharmaceutically acceptable derivatives, salts, esters, and the like, which are formulated together and pharmaceutical compositions containing esters, amides, hydrates, solvates and / or prodrugs thereof. Pharmaceutical compositions; and (2) TIC10 of the present invention, its pharmaceutically acceptable derivatives, and salts. Pharmaceutical compositions comprising esters, amides, hydrates, solvates and / or prodrugs - Patent Application 20070122993 and one or more additional therapeutic agents (wherein TIC10 of the present invention, its pharmaceutically acceptable salts, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof and the one or more additional therapeutic agents are not formulated in the same composition) When a separate formulation is used, the TIC10 of the present invention, its pharmaceutically acceptable derivatives, Pharmaceutical compounds, including compounds, salts, esters, amides, hydrates, solvates and / or prodrugs The compositions may be administered simultaneously, at intermittent times, or over time relative to the administration of one or more additional therapeutic agents. At different times, administration of the one or more additional therapeutic agents may be preceded by administration of the one or more additional therapeutic agents. It may be administered after the administration of the drug, or in combination with them.
[0085] The combination treatment may comprise administering to a subject a compound of the present invention, a compound selected from the group consisting of TIC10, a pharmaceutically acceptable derivative, salt, ester, Amides, hydrates, solvates and / or prodrugs and compounds used in the methods of the present invention reducing the effective dosage of a pharmaceutical composition containing one or more additional therapeutic agents used in This may allow for an increased therapeutic index.
[0086] According to an embodiment, the combination therapy is (1) administered as a single composition with one or more additional anti-cancer agents. TIC10 of the present invention, its pharmaceutically acceptable derivatives, salts, esters, and the like, which are formulated together and pharmaceutical compositions containing esters, amides, hydrates, solvates and / or prodrugs thereof. Pharmaceutical compositions; and (2) TIC10 of the present invention, its pharmaceutically acceptable derivatives, and salts. Pharmaceutical compositions comprising esters, amides, hydrates, solvates and / or prodrugs - Patent Application 20070122993 and one or more additional anti-cancer agents (wherein TIC10 of the present invention, its pharmaceutically acceptable salts, derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof and the one or more additional therapeutic agents are not formulated in the same composition) When a separate formulation is used, the TIC10 of the present invention, its pharmaceutically acceptable derivatives, Pharmaceutical compounds, including compounds, salts, esters, amides, hydrates, solvates and / or prodrugs The composition may be administered simultaneously, at intermittent times, or over time relative to the administration of one or more additional anti-cancer agents. At a different time point, administration of the one or more additional anticancer agents may be preceded by administration of the one or more additional anticancer agents. The agent may be administered after the administration of the other agent, or in combination with them.
[0087] Anticancer agents are described, for example, in Goodman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutic s,8th Ed.,Macmillan Publishing Co.,1990 It is written.
[0088] Illustrative examples of anticancer drugs include acivicin, aclarubicin, and acodazole. azole), acronine, adzelesin, aldesleukin, a Litretinoin, allopurinol, altretamine, ambo ambomycin, amethantrone, amifo amifostine, aminoglutethimide, amsacrine, anastrozole ru, anthramycin, arsenic trioxide, asparaginase, asperlin n), azacitidine, azetepa, azotomycin in), batimastat, benzodepa , bevacizumab, bicalutamide, bisantrene, visnafide (bisnafide) dimesylate, bizelesin, bleomycin cin, brequinar, bropirimine, busulfan, cactinomycin, calsterone, Pecitabine, caracemide, carbetimer, carboplatin, carmustine, carubicin ( carubicin, carzelesin, cedefingol (c edefingol), celecoxib, chlorambucil, ciloremycin (cirole mycin, cisplatin, cladribine, crisnatol mesylate ol mesylate), cyclophosphamide, cytarabine, dacarbazine, dactinostat mycin, daunorubicin, decitabine, dexorumaplatin (dexormaplatin), desaguanine, desaguanine mesylate, diazicon, Docetaxel, doxorubicin, droloxifene, dromostanolone, zuazomycin (duazomycin), edatrexate, eflomitin (eflomithine), elsamitrucin, enro Platin (enloplatin), enpromate, epipro epipropidine, epirubicin, erbulozole ole), esorubicin, estramustine, etanidazole , etoposide, etoprine, fadrozole, fazarabine zarabine, fenretinide, floxuridine, Fludarabine, fluorouracil, flurocitabine, Fosquidone, fostriecin, fulvestrant, gemcitabine , hydroxyurea, idarubicin, ifosfamide, ilmofosin e), interleukin II (IL- including recombinant interleukin II or rIL2), 2), interferon alpha-2a, interferon alpha-2b, interferon Interferon alpha-n1, interferon alpha-n3, interferon beta-I a, interferon gamma-Ib, iproplatin, irino Tecan, lanreotide, letrozole, leuprolide, liarozol e), lometrexol, lomustine, losoxantrone (l osoxantrone, masoprocol, maytansine, Mechlorethamine hydrochloride, Megestrol, melengestrol acetate, melphalan, menogaril il), mercaptopurine, methotrexate, metoprine, me Meturedepa, Mitindomide, Mitoka Mitocarcin, mitochromin, mitogillin (mitogillin), mitomalcin, mitomycin, Mitosper, mitotane, mitoxantrone, mycophenolate, Larabine, nocodazole, nogalamycin, ormunaplatin ormnaplatin, oxisuran, paclitaxel, Pegaspargase, periomycin n), pentamustine, peplomycin, perfosfami perfosfamide, pipobroman, piposulfan n), piroxantrone hydrochloride, plicamycin, promethazine Stan (plomestane), porfimer, porfiromycin (porfiro mycin, prednimustine, procarbazine, Euromycin, pyrazofurin, ribopramine ine), rogletimide, safingol l), semustine, simtrazene, sparfosate fosate), sparsomycin, spirogermanium, spiromustine (spiro mustine, spiroplatin, streptonigrin, Streptozocin, sulofenur, tallysomycin omycin, tamoxifen, tecogalan, tegafur, te teloxantrone, temoporfin ), teniposide, teroxirone, testolactone, thiamipiri Thiamiprine, thioguanine, thiotepa, tiazofurin urin), tirapazamine, topotecan, toremifene, trestol one), triciribine, trimetrexate, triptore Triptorelin, tubulozole, uracilma Stard, uredepa, vapreotide, bell Teporfin, vinblastine, vincristine sulfate, vindesine, vinepidine (vin epidine), vinglycinate, vinleurosine ( vinleurosine, vinorelbine, vinrosidine , vinzolidine, vorozole, Zenip zeniplatin, zinostatin, zoledronate te) and zorubicin.
[0089] A pharmaceutical composition comprising TIC10 and one or more additional anti-cancer agents (e.g., one or more mitotic Cleft suppression Agent and / or one or more anti-angiogenic agents) unexpectedly demonstrated a synergistic effect of the combination treatment. has also been found as described herein.
[0090] According to an aspect of the present invention, a subject having or at risk of having cancer is treated The method comprises administering a therapeutically effective amount of TIC10, a pharmaceutically acceptable derivative, salt, ester, or derivative thereof to a subject. amides, hydrates, solvates and / or prodrugs; and mitotic inhibitors Agent Administration of Contains.
[0091] According to an aspect of the present invention, a subject having or at risk of having cancer is treated The method comprises administering a therapeutically effective amount of TIC10, a pharmaceutically acceptable derivative, salt, ester, or derivative thereof to a subject. amides, hydrates, solvates and / or prodrugs; and taxane antimitotics Agent (e.g., but not limited to, paclitaxel and docetaxel) Contains.
[0092] According to an aspect of the present invention, a subject having or at risk of having cancer is treated The method comprises administering a therapeutically effective amount of TIC10, a pharmaceutically acceptable derivative, salt, ester, or derivative thereof to a subject. and administration of anti-angiogenic agents. Includes.
[0093] According to an aspect of the present invention, a subject having or at risk of having cancer is treated The method comprises administering a therapeutically effective amount of TIC10, a pharmaceutically acceptable derivative, salt, ester, or derivative thereof to a subject. amides, hydrates, solvates and / or prodrugs; and anti-angiogenic agents (e.g., These include administration of anti-cancer drugs such as, but not limited to, bevacizumab.
[0094] In certain embodiments of the compositions of the present invention, the amount of adjunctive anti-cancer agent administered is a therapeutically effective amount of the structure (I), its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and and / or required to achieve a therapeutic effect when administered without administration of a prodrug. Therefore, in certain embodiments of the compositions of the present invention, The amount of adjunctive anti-cancer agent in a unit dose of the composition is a therapeutically effective amount of structure (I), its pharmaceutically acceptable salts. and tolerable derivatives, salts, esters, amides, hydrates, solvates and / or prodrugs thereof. less than the amount of adjuvant anticancer agent required to achieve a therapeutic effect when administered without At least 5%, at least 10%, at least 15%, at least 20%, at least 25%, At least 30%, at least 35%, at least 40%, at least 50%, at least At least 55%, at least 60%, at least 65%, at least 70%, at least 75% , at least 80%, at least 85% or at least 90% less.
[0095] According to an embodiment of the present invention, TRAIL is administered in addition to the administration of TIC10 in combination with one or more histopathological agents. HDAC inhibitors (e.g., Nebbioso, A. et al., 2005 , Nat Med 11, 77-84 one or more TRAIL agonist antibodies (e.g., lexatumumab); tumumab and mapatumumab); and / or combination Recombinant TRAIL (e.g., Abdulghani, J. et al., 2010, Exp. Opin Adenoviruses such as those described in Ther. Targets 14:1091-1108 or may be induced by a method or composition, such as by administration of viral TRAIL It can be provided.
[0096] Optionally, the method of treating a subject having or at risk of having cancer comprises: Further included are adjunctive anti-cancer treatments. Adjunctive anti-cancer treatments include radiation therapy of the subject or affected areas of the subject's body. It may be radiation treatment.
[0097] The TRAIL expression induced by the subject by administration of the pharmaceutical composition of the present invention is In a sample obtained from the subject (e.g., a blood sample obtained from the subject), It is detectable.
[0098] An embodiment of the present invention is a method for measuring secreted TRA over a period of 3 to 4 days after a single administration of TIC10. Upregulation of the TRAIL gene by normal and tumor tissues leads to persistent serum levels of IL. The serum half-life of TRAIL protein is typically 20-30 minutes. be.
[0099] TIC10 has a calculated mass of 387.21 and crosses the blood-brain barrier. Administration of 0 induces damage to cells of the central nervous system (e.g., glial and nitric oxide cells in the brain and spinal cord). Furthermore, TRAIL can be induced in the brain (including the brain). Pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates or the like of TIC10 Administration of a prodrug or its derivatives allows induction of TRAIL in cells of the central nervous system. become.
[0100] According to an embodiment of the present invention, a subject having or at risk of having cancer of the central nervous system (CNS) is Methods of treating a subject with a medicament for the treatment of a cancer include administering the medicament for the treatment of a cancer patient via a route of administration other than direct administration to the CNS. By way of administration, a pharmaceutically effective amount of:
[0101] [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. or prodrug; and a pharmaceutically acceptable carrier.
[0102] According to an embodiment of the present invention, primary CNS cancers and CNS metastases of non-CNS cancers (referred to herein as Primary CNS cancers treated according to embodiments of the present invention include: These include, but are not limited to, gliomas, meningiomas, pituitary adenomas, and nerve sheath tumors. Glioblastoma multiforme is a primary CNS cancer that may be treated according to embodiments of the present invention. Oligodendroglioma is a primary CNS cancer that is treated according to embodiments of the present invention.
[0103] The methods of the present invention may be administered orally, rectally, nasally, pulmonary, epidurally, ocularly, aurally, intra-arterially, intracardially, intraventricularly, Intradermal, intravenous, intramuscular, intraperitoneal, intraosseous, intrathecal, intravesical, subcutaneous, topical, transdermal and transcutaneous including, but not limited to, mucosal (e.g., sublingual, buccal, vaginal, and inhalation) routes of administration This includes administering the pharmaceutical composition of the present invention by any route of administration.
[0104] According to an aspect of the present invention, there is provided a method of treating a subject in need thereof, the method comprising: is a pharmaceutically effective amount formulated for oral administration of:
[0105] [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates, solvates and / or the like. Or oral administration of a prodrug.
[0106] The pharmaceutical compositions of the present invention may be in any dosage form suitable for administration to a subject (e.g., solid, semi-solid, or semi-solid). Solid and liquid dosage forms (e.g., tablets, capsules, powders, granules, suppositories, pills, solutions, suspensions) (including emulsions, ointments, lotions, creams, gels, pastes, sprays and aerosols) Liposomes and emulsions can be used to deliver pharmaceuticals, especially hydrophobic pharmaceuticals. The pharmaceutical compositions of the present invention are generally of the well-known type that can be used for the treatment of , a pharmaceutically acceptable carrier (e.g., excipient, diluent and / or vehicle) Delayed release formulations and systems of the composition (e.g., semi-solid hydrophobic polymers) Permeable matrices) may be used.
[0107] Pharmaceutical formulations of the compositions of the present invention may include a pharmaceutically acceptable carrier. A "pharmaceutical carrier" is a substance that can be administered to a subject without undue toxicity or irritation to the subject. Suitable for use in the body and compatible with other ingredients contained in the pharmaceutical composition. It refers to a career.
[0108] Pharmaceutically acceptable carriers, pharmaceutical compositions and methods for preparing various dosage forms and the mode of administration are described, for example, in the Pharmaceutical Dosage Form. rms:Tablets, eds. HALieberman et al., New York: Marcel Dekker, Inc., 1989; and L.V. Allen, Jr. et al., Ansel's Pharmaceutical Dosage Forms an d Drug Delivery Systems, 8th Ed., Philadelphia phia,PA:Lippincott,Williams & Wilkins,20 04;AR Gennaro,Remington:The Science and Practice of Pharmacy,Lippincott William s & Wilkins, 21st ed., 2005, especially chapter 89; and J.G. Hardman et al., Goodman & Gilman's The P harmacological basis of therapeutics,McG Detailed in Raw-Hill Professional, 10th ed., 2001 It is well known in the art that
[0109] Pharmaceutical compositions according to aspects of the present invention are formulated for oral administration.
[0110] Illustrative solid dosage forms for administration or for suspension in a liquid prior to administration include: These solid dosage forms include capsules, tablets, powders, and granules. The one or more active agents may be present in at least one carrier (e.g., a buffer (e.g., a chlorinated alcohol)). Sodium enoate or alkali metal phosphates (e.g., sodium phosphate, phosphate potassium and calcium phosphate); fillers (e.g., starch, lactose, sucrose, glucose, mannitol and silicic acid); binders (e.g., carboxymethyl Chilled cellulose, alginates, gelatin, polyvinylpyrrolide cellulose, sucrose, and acacia); hygroscopic agents (e.g., glycerol); disintegrants (e.g., agar, calcium carbonate, vegetable starch (e.g., potato or tapioca starch), alginic acid, certain complex silicates, and sodium carbonate); dissolution retarders (e.g., para fins); absorption enhancers (e.g., quaternary ammonium compounds); wetting agents (e.g., cetyl alcohol alcohol, glycerol monostearate and glycol); adsorbents (e.g., kaolin lubricants (e.g., talc, calcium stearate, stearic acid, magnesium phosphate, solid polyethylene glycol or sodium lauryl sulfate); storage antibacterial and antifungal agents (e.g., sorbic acid, gentamicin, and pheno and stabilizers (e.g., sucrose, EDTA, EGTA, and antioxidants). It is mixed with (including antiseptics).
[0111] Solid dosage forms optionally include a coating, such as an enteric coating. The enteric coating is typically a polymeric material. Preferred enteric coating materials are biocompatible. Characterized by endodegradable, gradually hydrolyzable and / or gradually water-soluble polymers. The amount of coating material applied to a solid dosage form generally determines the time between ingestion and drug release. The entire coating dissolves in gastrointestinal fluids with a pH below 3, which is associated with stomach acid. The coating is thick enough to dissolve at pH above 3 in the small intestine environment. Any anionic polymer that exhibits a pH-dependent solubility profile is It can be readily used as an enteric coating in the practice of the present invention to deliver active agents to the digestive tract. It is anticipated that the selection of a particular enteric coating material will depend on its properties (e.g., stomach resistance to disintegration in the stomach; impermeability to gastric juices and diffusion of active substances while in the stomach Ability to dissipate in the target intestinal region; Physical and chemical stability during storage; Non-toxic; and ease of application).
[0112] Suitable enteric coating materials include, illustratively, cellulose polymers (e.g., hydroxybenzoates ... Hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl Cellulose, methyl cellulose, ethyl cellulose, cellulose acetate, cellulose acetate phthalate Sucrose, cellulose acetate trimellitate, hydroxypropyl methylcellulose thalate, hydroxypropyl methylcellulose succinate and carboxymethylcellulose sodium cellulose); acrylic acid polymers and acrylic acid copolymers, preferably Acrylic acid, methacrylic acid, methyl acrylate, ammonium methyl acrylate, acrylic formed from ethyl acrylate, methyl and / or ethyl methacrylate; vinyl poly vinyl copolymers (e.g., polyvinylpyrrolidone, polyvinyl acetate, polyvinyl Vinyl acetate phthalate, vinyl acetate crotonic acid copolymer and ethylene vinyl acetate copolymer polymers); shellac; and combinations thereof. Examples of the adhesive material include acrylic adhesives described in U.S. Pat. No. 6,136,345. Acid polymers and acrylic acid copolymers.
[0113] Enteric coatings allow gastric juices to penetrate into the solid dosage form when necessary. Suitable plasticizers include those that prevent the formation of pores and cracks in the polymer. Triethyl citrate (Citroflex2), triacetin (glyceryl triacetate Acetyl triethyl citrate (Citroflec A2), Carbowax 4 00 (Polyethylene glycol 400), Diethyl phthalate, Tributyl citrate, Acetone Monoglycerides, glycerol, fatty acid esters, propylene glycol and In particular, dibutyl acrylate is used. The coating typically contains approximately 10% to 25% by weight of plasticizer, especially the capping agent. Contains dibutyl citrate, polyethylene glycol, triethyl citrate and triacetin The coating may be applied to solubilize or disperse the coating material, as well as Other coatings to improve coating performance and coated products Excipients (e.g., detackifiers, antifoaming agents, lubricants (e.g., magnesium stearate) and stabilizers (e.g., hydroxypropyl cellulose, acid or a base).
[0114] Liquid dosage forms for oral administration include emulsions, solutions, suspensions, syrups or elixirs. The composition comprises one or more active agents and a pharmaceutically acceptable carrier, which are formulated as a pharmaceutical preparation. The liquid formulation of the composition of the present invention may contain coloring agents, stabilizers, wetting agents, emulsifying agents, suspending agents, sweeteners, , flavorings or fragrances.
[0115] For example, compositions for parenteral administration may be formulated as injectable liquids. Examples of non-aqueous carriers include water, ethanol, polyols (e.g., propylene glycol, glycol, polyethylene glycol, glycerol, and the like), and suitable mixtures thereof; vegetable oils such as celery oil; and injectable organic esters such as ethyl oleate. The proper fluidity can be achieved, for example, by the use of a coating such as lecithin. In the case of dispersions, by maintaining the desired particle size and / or sodium lauryl sulfate. This can be maintained by using surfactants such as sodium. (e.g., sucrose, EDTA, EGTA, and antioxidants).
[0116] For topical administration, the composition is for administration to the skin for local effect and / or the like. or may be formulated as a "patch" formulation for transdermal delivery. Formulations include, for example, ointments, lotions, creams, gels, pastes, sprays, and Powders. Ointments, lotions, creams, gels and pastes may be one or more In addition to the active substance, a base (e.g., an absorbent base, a water-removable base, a water-soluble base, or oily base) and excipients (e.g., thickeners, gelling agents, colorants, stabilizers, emulsifiers, suspending agents , sweeteners, flavorings or fragrances).
[0117] Transdermal formulations may contain percutaneous absorption enhancers (e.g., acetone, azone, dimethylacetamide, Dimethylformamide, dimethyl sulfoxide, ethanol, oleic acid, polyethylene glycol, propylene glycol and sodium lauryl sulfate). Use of induction (Ionotophoresis) and / or sonophoresis This can facilitate transdermal delivery.
[0118] Powders and sprays for topical administration of one or more active substances may contain an excipient (e.g., talc). , lactose and one or more silicic acids). Sprays may contain pharmaceutical propellants (e.g. , fluorinated hydrocarbon propellant, carbon dioxide or suitable gas). The spray can be delivered from a pump-type spray device that does not require a propellant. The drug may contain a metered amount of the drug, for example, using a valve to control the amount delivered. The composition is delivered.
[0119] Ophthalmic preparations of one or more active substances contain preservatives, buffers and thickeners. It may contain ingredients such as a viscosity agent.
[0120] Useful as a pharmaceutically acceptable carrier or excipient in the pharmaceutical compositions of the present invention Suitable surfactants include non-ionic surfactants with good emulsifying, dispersing and / or wetting properties. Suitable anionic surfactants include cationic, cationic and / or anionic surfactants. Water-soluble surfactants include both water-soluble soaps and water-soluble synthetic surfactants. Suitable soaps include alkali metal salts or alkaline earth metal salts, higher fatty acids (C10 -C22) unsubstituted or substituted ammonium salts, for example, oleic acid or stearic acid Also included are the sodium salts of fatty acids or natural fatty acid mixtures available from coconut oil or tallow oil. Synthetic surfactants include sodium or potassium salts of polyacrylic acid. Calcium salts; fatty sulfonates and sulfates; sulfonated benzimidazoles Derivatives and alkylaryl sulfonates. The esters are usually alkali metal or alkaline earth metal salts, unsubstituted ammonium salts, or aryl substituted with alkyl or acyl radicals having 8 to 22 carbon atoms monium salts, for example, the sodium salts of lignosulfonic acid or dodecylsulfonic acid; or a mixture of calcium salts or fatty alcohol sulfates derived from natural fatty acids Alkali metal or alkaline earth metal salts of sulfates or sulfonates Metal salts (e.g., sodium lauryl sulfate) and fatty alcohol / ethylene oxide adducts The preferred sulfonated benzimidazole derivatives are Examples of alkylaryl sulfonates include dodecyl aryl sulfonates, which contain 8 to 22 carbon atoms. benzenesulfonic acid or dibutyl-naphthalenesulfonic acid or naphthalene-sulfonic acid / Sodium salt, calcium salt or alkanolamine salt of formaldehyde condensate The corresponding phosphates, e.g., salts of phosphoric acid esters, as well as p-nonylphenon Also suitable are adducts of ethanol with ethylene and / or propylene oxide or phospholipids. Suitable phospholipids for this purpose are naturally occurring (originating from animal or plant cells) Phospholipids or synthetic phospholipids of the cephalin or lecithin type (e.g., phosphatidylcholine ... Phosphatidylethanolamine, Phosphatidylserine, Phosphatidylglycerin, Lysolecithin cin, cardiolipin, dioctanylphosphatidylcholine, dipalmitoylphosphatidylcholine Dipalmitoylphoshatidyl-choline and its mixtures )
[0121] Useful as a pharmaceutically acceptable carrier or excipient in the pharmaceutical compositions of the present invention Suitable nonionic surfactants include alkylphenols, fatty alcohols, fatty acids, aliphatic amines or amides containing at least 12 carbon atoms in the molecule, alkyl Polyethoxylation and Polypropionation of Rhenesulfonates and Dialkyl Sulfosuccinates hydroxylated derivatives (e.g., aliphatic and alicyclic alcohols, saturated and unsaturated fatty acids) Polyglycol ether derivatives of fatty acids and alkylphenols (these derivatives are preferably Preferably, the (aliphatic) hydrocarbon moiety contains 3 to 10 glycol ether groups and 8 to 20 and alkyl phenols containing 6 to 18 carbon atoms in the alkyl portion Further suitable nonionic surfactants include polyethylene oxide and polyethylene glycol. Polypropylene glycol, alkyl chain with 1 to 10 alkyl groups Water-soluble adducts with ethylenediaminopolypropylene glycol containing carbon atoms (their The adduct may have 20 to 250 ethylene glycol ether groups and / or 10 to 100 Such compounds are usually Contains 1 to 5 ethylene glycol units per pyrene glycol unit. Non-ionic surface Representative examples of active substances are nonylphenol-polyethoxyethanol, castor oil polyglycol Lithium ethers, polypropylene / polyethylene oxide adducts, tributyl phenol Polyethoxyethanol, polyethylene glycol and octylphenoxypolyethylene Fatty acid esters of polyethylene sorbitan (e.g., polyoxyethanol) Diethylene sorbitan trioleate), glycerol, sorbitan, sucrose and Pentaerythritol is also a suitable non-ionic surfactant.
[0122] Useful as a pharmaceutically acceptable carrier or excipient in the pharmaceutical compositions of the present invention Suitable cationic surfactants include quaternary ammonium salts, preferably Four hydrocarbon radicals optionally substituted with halo, phenyl, substituted phenyl, or hydroxy Halides having at least one C8-C22 alkyl group as an N-substituent; alkyl radicals (e.g., cetyl, lauryl, palmityl, myristyl, oleyl, etc.), and further substituents may be unsubstituted or halogenated lower alkyl, benzyl and / or or quaternary ammonium salts containing a hydroxy-lower alkyl radical.
[0123] A more detailed description of surfactants suitable for this purpose can be found, for example, in "McCutcheon's s Detergents and Emulsifiers Annual”(MC Publishing Crop.,Ridgewood,New Jersey,19 81), “Tensid-Taschenbuch”, 2nd ed. (Hanser Verlag, Vienna, 1981) and “Encyclopaedia of Surfactants”(Chemical Publishing Co.,New York, 1981).
[0124] Structure-forming, thickening or gel-forming agents may be used in the pharmaceutical compositions and combination preparations of the present invention. Suitable such materials are, in particular, highly dispersed silicic acid (e.g., commercially available silica). Products commercially available under the trade name Aerosil; Bentonite; Montmorillonite tetraalkylammonium salts of (e.g., commercially available under the trade name Bentone) soluble products) (each of whose alkyl groups can contain 1 to 20 carbon atoms); tearyl alcohol and processed castor oil products (e.g., those sold under the trade names Antisettles and (commercially available products).
[0125] In certain embodiments, the pharmaceutically acceptable carrier is a particulate carrier (e.g., a granular carrier). Lipid containing vesicles, micelles, unilamellar or multilamellar vesicles Particles; polymer particles (e.g., hydrogel particles, polyglycolic acid particles, or polylactic acid particles) inorganic particles (e.g., inorganic particles, e.g., as described in U.S. Pat. No. 5,648,097); calcium phosphate particles); and granular inorganic / organic carriers (e.g., U.S. Pat. No. 6,499,139). Such as those described in US Pat. No. 6,630,486.
[0126] Particulate pharmaceutically acceptable carriers include lipid particles; polymer particles; inorganic particles; and The mixture of particle types may also be selected from granular pharmaceutically acceptable carriers. The carrier may be included as a carrier.
[0127] Granular carriers typically have particles with an average particle size ranging from about 1 nm to 10 microns. In certain embodiments, the particulate carrier is formulated to have particles of about 1 nm to 1 It is formulated to have an average particle size in the range of 00 nm.
[0128] The dosage of the pharmaceutical compositions of the present invention will depend on factors such as the route of administration; The subject's age, health, sex, and weight; the nature and extent of the subject's symptoms, if any; The dosage may vary based on, but is not limited to, the dosage and the desired effect. The amount of time spent in the treatment may be adjusted depending on whether the treatment is short-term or continuous. A pharmaceutically effective amount can be determined in light of these and other considerations.
[0129] Typically, the daily dosage of the pharmaceutical composition of the present invention is about 0.5 mg / kg of body weight of the subject. It is contemplated that the daily dose will be in the range of 0.01 to 100 milligrams to achieve the desired effect. The pharmaceutical composition of the present invention may be administered in two or more divided doses to achieve the desired effect. It may also be formulated for sustained release to obtain
[0130] Detailed information regarding customary ingredients, equipment, and processes for preparing dosage forms is available from Pha rmaceutical Dosage Forms:Tablets,eds.HA .Lieberman et al., New York: Marcel Dekker, Inc., 1989; and L.V. Allen, Jr. et al., Ansel's Pharmaceu tical Dosage Forms and Drug Delivery Sys tems, 8th Ed., Philadelphia, PA: Lippincott, Williams & Wilkins,2004;AR Gennaro, Remi ngton:The Science and Practice of Pharma cy, Lippincott Williams & Wilkins, 21st ed. ,,2005, especially chapter 89; and J.G. Hardman et al., Goodm an & Gilman's The Pharmacological Basis of Therapeutics,McGraw-Hill Professional ,10th ed.,2001.
[0131] A commercial package according to an aspect of the invention comprises a pharmaceutical composition described herein. According to an embodiment of the invention, instructions for administering the pharmaceutical composition are included.
[0132] According to an aspect of the present invention, the commercial package comprises:
[0133] [ka] , its pharmaceutically acceptable derivatives, salts, esters, amides, hydrates and a pharmaceutically acceptable carrier. can.
[0134] One or more auxiliary components (e.g., buffers or diluents) may optionally be added to the composition of the present invention. It is included in the commercial package.
[0135] Aspects of the compositions and methods of the present invention are illustrated in the following examples. The examples are provided for illustrative purposes and do not limit the scope of the compositions and methods of the present invention. shall not be considered a limitation. [Example]
[0136] Reagents and cell-based assays Bert Vogelstein (Johns Hopkins University HCT116 Bax obtained from the University of California, Baltimore, MA - / - and HCT 116 p53 - / - Cells and Akiva Mintz (Wake Forest) GBM cells obtained from the University of Winston-Salem, NC All cell lines were obtained from ATCC except for the TRAIL shRNA or vector. MDA-MB-231 cells were treated with Sigma-Aldrich ( Foxo3a shRNA or vector purchased from St. Louis, MO was used. HCT116 was used for lentiviral infection. cDNA encoding the 5 fragment was used to generate the DR5(1-298) fusion protein The amino acids 1 to 298 of the human DR5 gene were inserted into the pEGFP-N1 vector expressing the DR5 gene. H460 DR5ΔDD-EGFP cells were constructed by transfecting the fusion construct into Lipofectamine 2000 (Invitrogen) was used to infect H460 cells. Transfected and selected with G418. Positive clones were confirmed by microscopy and Western blot analysis. NCI diversity Bioluminescence high-throughput screening using Set II was performed to identify the human TRAIL gene The first 504 base pairs of the TRAIL promoter upstream of the transcription start of the scallop are under transcriptional control. HCT116 cells stably co-transfected to express the luciferase construct Bax - / - The experiments were carried out in cells. Compounds were tested at effective concentrations and transcribed at 12, 24, 36 and 48 hours after treatment. Bioluminescence assay of activity was performed. Details of this screening method are given in Wang et al., 200 6, PNAS 103:11003-11008). C350625) was obtained from NCI DTP and reconstituted at 20 mM in DMSO. The mixture was aliquoted and stored at -20°C. A6730 and U0126 monoethanolate were added to Sig Purified recombinant TRAIL was obtained from the University of California, San Diego, CA. ... The antibody was prepared as described in Iol. Chem. 279:40044-40052. RIK-2 antibody (Santa-Cruz Biotechnology) at 1μg / mL and zVAD-fmk (Promega) was used at 20 μM.
[0137] Primary specimens from human patients All primary specimens from human patients were used in the examples described herein. For this purpose, the cells were received immediately after harvest, manually digested in complete DMEM, and diluted to 100 μl. Filter through a nylon mesh and add 2 x 10 ml of complete DMEM. 5 cells / mL I rated it.
[0138] mouse For subcutaneous xenografts, 4-6 week old female athymic nu / nu mice (Charles R 1 x 10 sachets per dorsal flank (Iver Laboratories) 6 (For T98G 2.5×10 6 20 ml of 1:1 Matrigel (BD):PBS containing the indicated cell lines. All intraperitoneal and intravenous injections were performed in a 200 μL suspension. The oral formulation of TIC10 was administered by oral gavage and % Cremophor EL® (Sigma), 10% DMSO and 70% The dose was administered as a 200 μL suspension containing PBS. Tumors were monitored using a 100-mg ELISA. All subcutaneous tumors were 1-4 weeks post-injection, approximately 100 mg / kg / day before treatment initiation. 125mm3 The reduction in tumor burden was established 3 weeks after tumor disappearance. The animals were monitored over a 24-hour period and confirmed by visual inspection after euthanasia.
[0139] Intracecal transplantation was performed as described by Cespedes, MV et al., Am J Pathol, 2007, 170(3):pp.1077-1085.
[0140] For intracranial xenotransplantation, anesthetized athymic nude mice were inoculated with serum- and antibiotic-free medium. 2 x 10 cells as a suspension in 25 µL of no RPMI 5 SF767 cells were transplanted. The site was a burr hole made 1 mm lateral to the midline of the skull and 1 mm anterior to the coronal suture. The injectate was slowly administered over a 5-minute period using a Hamilton syringe, and the bone The burr hole was sealed using wax. Two weeks after implantation, tumor viability was monitored by bioluminescence imaging. The adhesion was evaluated. Wang et al., 2003, PNAS 100:15095-15100 Bioluminescence imaging of tumors on an IVIS imaging system as described was carried out.
[0141] Near-infrared imaging of mice was performed using AngioSense ( After tail vein injection of VisEn® 680 (VisEn Medical, Woburn, MA) The imaging was performed on a Pearl Impulse imaging system (LI-COR). Six-week-old Eμ-myc mice were obtained from The Jackson Laboratory (B6 .Cg-Tg(IghMyc)22Bri / J).
[0142] Terminal cardiac puncture of the left ventricle for CBC / differential and serum chemistry assays One mL of blood was collected from anesthetized mice by centrifugation. Five hundred microliters were used for serum chemistry. The serum was placed in a microtube, allowed to clot at room temperature for 30 minutes, and then centrifuged. Remove the supernatant and centrifuge again to remove any further clots and analyze the serum. For CBC / differential, 500 μL of blood was transferred to EDTA tube. The samples were collected and analyzed.
[0143] Statistical analysis. For pairwise comparisons, student's Data were analyzed using a two-tailed t-test. Log-rank statistical analysis was performed using a script.
[0144] RT-qPCR RNeasy Minikit (Qiagen) by following the manufacturer's instructions. Total RNA was extracted using SuperScript II (Invitrogen) ) was used with 1 μg of RNA and oligodT to generate cDNA. The timer is TRAIL forward (CAGAGGAAGAAGCAACACATT, SEQ ID NO: 1), TRAIL reverse (GGTTGATGATTCCCAGGAGTTTATTTTG , SEQ ID NO: 2), GAPDH forward (CCACATCGCTCAGACACCAT, sequence No. 3), GAPDH reverse (GGCAACAATATCCACTTTACCAGAGT , SEQ ID NO: 4). Applied Biosystems 7900HT Fast PCR amplification was performed using the Real-time Detection System. Samples were normalized to 10 ng / μl and then diluted with 20 ng of cDNA per sample. A was diluted with SYBR Green Master Mix (Qiagen Corp, USA) ) was used as a template for real-time PCR using the same Quantification was normalized to GAPDH, which was used as an endogenous control for normalization. GAPDH and Livak et al., 2001, Methods. 2001 Dec;25(4 The 2ΔΔCt method was used to cross the threshold described in ):402-8. Using a variable volume, on a 7900HT instrument (Applied Biosystems) Reactions were performed in 384-well optical plates. Data analysis was performed using ABI PRISM. 7900 Sequence Detection System 2.2 software To eliminate the possibility of genomic DNA contamination, gene-specific primer sequences were used. Control samples without cDNA template and without RT were used for each batch. Control PCR reactions were also performed. Each PCR reaction was performed in quadruplicate, and the resulting data were analyzed. Averaged.
[0145] Immunofluorescence The indicated cell lines were cultured in the absence or presence of the indicated working concentrations of TIC10 for 72 hours. Cells were grown in logarithmic phase growth in 6-well plates below. Cells were fixed and analyzed by Cyt ofix / Cytoperm solution (BD Biosciences, San Jose, Cells were permeabilized using Perm / Wash solution (BD Bios). Anti-TRAIL (ab2435, Abcam, 1:100) was used in Cambridge, MA) or at 1:250 with anti-active caspase-3 (55 9565, BD Pharmingen, San Diego, CA) and The antibody was incubated for 1 hour in the presence of anti-rabbit Alexa Fluor 488. Incubate in Perm / Wash solution 1:200 for 20 minutes at room temperature, Hoechst 33342 (Invitrogen) was prepared according to the manufacturer's instructions. It was used as a nuclear counterstain according to the protocol. Axiovert inverted microscope (Carl Zeiss M) was used with a iovision system. Fluorescence imaging was performed using a microImaging system.
[0146] Flow cytometry and cell death assays For all flow cytometry analyses, suspension and adherent cells were analyzed using Coulter Surface TRA was analyzed on a Beckman Elite Epics hemocytometer. For IL experiments, adherent cells were harvested by brief trypsinization and diluted in PBS for 4 h. % paraformaldehyde for 20 min and incubated with anti-TRAIL antibody for 2 h (A bcam), incubated, washed, and then incubated with anti-rabbit Alexafluor 488 (Invi The cells were incubated with ATP (protease inhibitor) for 30 minutes and then analyzed. Debris and dead cells were excluded from the analysis by gating on forward and side scatter. Surface TRAIL data are fluorescence intensities relative to control samples unless otherwise indicated. For sub-G1 and cell cycle profiling experiments, all All cells were pelleted, fixed in ethanol, and then iodide-treated in the presence of RNAse. Cells were stained with PrPidium (Sigma). omega) according to the manufacturer's protocol into a 96-well black-walled, clear-bottom plate. Cell viability assays were performed on the 100 cells. Imaging and quantification of these assays were performed. The imaging was performed on an IVIS imaging system (Xenogen).
[0147] Colony formation assay The indicated cell lines were plated at 500 cells per well and the following day, post-adhesion After 3 days of treatment, the medium was replaced with drug-free medium. The cells were grown for 10 days, with fresh medium fed once every 3 days. At the end of the incubation, cells were washed with PBS, fixed with methanol, and coomassieved for quantification. Dyed with roux, rinsed and dried.
[0148] Histological analysis. Mice were humanely sacrificed at the indicated time points, and excised normal or tumor tissues were analyzed. Tumors were fixed in 4% paraformaldehyde / PBS overnight at 4°C. If desired, 500 μL of blood can be collected by terminal cardiac puncture under anesthesia and placed in an EDTA-vacuum. Serum samples were collected in a similar manner except for the microcentrifuge tubes. After collection, the cells were incubated at room temperature for 30 minutes to allow clotting, followed by centrifugation for 5 minutes. The serum was then removed. Paraffin-embedded blocks, serial section slides, and hematoxylin-2 (HEMA) were Adoxylin and eosin staining was prepared according to standard procedures. Peroxidase In Situ Apoptosis Detecti TUNEL staining was performed using the on Kit (Millipore). For , slides were dewaxed in xylene and hydrated in decreasing grades of ethanol. Antigen retrieval was performed by boiling in 10 mM citric acid (pH 6.0) for 6 min. Streptavidin and biotin blocking solution and goat serum (Vector The samples were blocked with PBS (Bio-Rad Laboratories). The cells were incubated overnight at 4°C in a temperature chamber. Incubation and DAB deposition were performed according to the manufacturer's protocol (Vector Laboratories DAB Substrate Kit for Perox The samples were counterstained with hematoxylin (DAKO) for 6 minutes and then washed with dH2O The plates were then rinsed in PBS for 5 minutes, dehydrated, and sealed with a coverslip. Images were recorded on an Axioskop microscope using the software (QImaging). It was recorded.
[0149] co-culture HCT116 p53 - / - Co-culture of IL-17 and HFF cells was performed in complete DMEM and The cells were cultured in a 1:1 mixture of McCoy's 5A medium and McCoy's 5A medium. These two types of cells were linked using the Fluorescent Cell Linkers Kit or gene cell membrane labeling (Sigma) The antibodies were separately labeled using the protocol described by the author. Cells were counterstained with echst33342. For flow cytometry analysis of cell death The two populations of cells were then distinguished by differences in light scattering and analyzed using the sub- Analysis was performed as described for G1 analysis.
[0150] ELISA ELISA for TRAIL was performed using Quantikine® TRAIL / T The NFSF10 kit was used according to the manufacturer's protocol (DTRL00, R&D) (D Systems, Minneapolis, MN). Absorbance at 540 nm was used. Optical correction was performed as suggested by the manufacturer. The absorbance was measured using a Blackman Coulter.
[0151] Pharmacokinetic analysis of TIC10 The absorbance profile of TIC10 was measured using a Gene Spec III spectrometer (Hitac hi Solutions American,South San Francisco Measurements were performed on an Eclipse XDB-C18 column (Agilent, CA). ) and an Agilent 1200 series system (A) using a 100 μL injection loop Absorbance detection at 239 nm was performed using a 1000 Hz chromatograph (Digital Instruments, Santa Clara, CA). HPLC analysis was performed using an isocratic elution at 1 mL / min in dH2O. The elution was carried out in 0.1% trifluoroacetic acid in 0.1% acetonitrile (ACN) gradient. For elution, 15-20% ACN was used for 0-5 min, 20-23% for 5-12 min, and 12 At ~18 min, the concentration was increased to 25%. Blood collected from athymic nude mice in an unrelated experiment A calibration curve was constructed by adding a certain concentration of TIC10 to the plasma. For the sample, blood was obtained by terminal cardiac puncture of the left ventricle and placed in an EDTA tube (BD). The samples were centrifuged at 500 g for 10 minutes. The plasma was then diluted with 30 μL of perchloric acid. Deproteinize by adding 100 μL of ATP to the sample, vortex for 15 seconds, and After centrifugation for 2 minutes, the supernatant was immediately injected into HPLC. AUC was calculated based on a retention time of 8.1 minutes. The AUC data versus time were normalized to the internal serum peak with the e -αt +Be -βt (where t = time, and A and B are the two phases (distribution and First-order elimination from the central compartment using ) which is the extrapolated concentration at the onset of elimination The half-life was calculated as t 1 / 2α =.6 93 / α and t 1 / 2β = 0.693 / β. Other factors used for the calculation The formula is CL = dose / AUC 0-∞ and V d =dose / (AUC 0-∞ ×β) is mentioned. can be done.
[0152] Gene expression analysis HCT116 p53 - / - Cells were grown in logarithmic phase and treated with DMSO or TIC1 After 48 hours, the cells were treated with RNeasy Mini Kit (Qiagen). RNA was isolated using Illumina HT-12 Beadchip ( Microarray analysis was performed using a lab-based Illumina (Illumina) microarray system. RNA quality and concentration were assessed using a Agilent with RNA Nano LabChip® (Agilent) The assay was performed using a nt 2100 Bioanalyzer according to the manufacturer's instructions. TotalPrep TM 500n by Amplification (Ambion) cRNA was synthesized from the RNA of 1000 kJ / ml. The first strand cDNA was generated by the following procedure. Second strand synthesis and RNA degradation by DNA polymerase and RNase H are carried out using Afterwards, filtration purification was carried out. In vitro transcription (IVT) was used to generate multiple copy numbers of biotin. Labeled cRNA was purified using filtration and purified using NanoD The samples were quantified by rop and the volume was adjusted to a total of 750 ng / sample. The fragments were fragmented, denatured, and then hybridized at 58°C for 18 hours. After dimerization, the bead chip was washed and fluorescently labeled. The bead chip was scanned using a scanner (Illumina). Import the data into GenomeStudio 1.0 (Illumina) and run the project. The results were analyzed using GeneSpring Gxll (Agilent Technologies). The measurements were then exported to dsds.com / nologies. Any measurements less than 0.01 were then set to 0.01. The arrays were normalized to the 50th percentile and individual genes were compared against the control. The network of transcriptional changes induced by TIC10 was normalized to the median of the 100-kDa expression level. For gene analysis, Ingenuity Pathway Analysis software was used. (Ingenuity Systems) was used to analyze the data sets.
[0153] Western blot analysis NuPAGE 4-12% Bis-Tris was used. Wang, W. et al., PNAS Western blot as described in 103, 11003-11008, 2006 The analysis was carried out by the Supersignal West Femto (Thermo Science Visualization was performed using cytoplasmic lysis buffer (10 mM HEPES, 10 mM KCl and 2 mM MgCl2, 1 mM DTT) followed by Nuclear lysis buffer (20mM HEPES, 420mM NaCl, 1.5mM MgCl2 Nuclear and cytoplasmic extracts were prepared using a 250 μM EDTA buffer (250 μM EDTA, 25% glycerol). All lysis buffers were prepared using fresh protease inhibitors (Roche) and and 1 mM sodium orthovanadate were added immediately before use.
[0154] Chromatin immunoprecipitation assay Nebbioso, A. et al., Nat Med, 11(1), 77-84, 2005 As described for the RAIL promoter, ChIP fragments for Foxo3a were The antibody (Abcam) or an equal concentration of rabbit IgG (S) as a nonspecific control was used. Chromatin immunoprecipitation (ChiP) assay using OuthernBiotech was carried out.
[0155] TIC10 induces p53-independent transcriptional induction of the TRAIL gene TRAIL-resistant Bax-null HCT116 human ovarian tumor necrosis factor (BNCT) expressing the TRAIL gene promoter by cell-based bioluminescence reporter screening performed in human colon cancer cells , the small molecule TIC10 was obtained as a TRAIL-inducing compound.
[0156] TIC10 is a gene encoding a nucleotide sequence similar to that described by Takimoto et al., 2000, Oncogene 19, 1735- TRAIL promoter excluding the p53 DNA binding response element identified in 1743 TRA of a luciferase reporter construct under regulatory control of the first 504 base pairs of the motor Figure 1 shows the human TRAIL promoter upstream of the transcription initiation site. HCT116 Bax is under transcriptional control of the first 504 base pairs of the gene promoter - / - Thin Graph showing luciferase reporter activity in gills (n=3). The bars indicate the standard deviation of replicates. * P<0.05.
[0157] TIC10 caused a dose-dependent increase in TRAIL messenger RNA. 2, HCT116 p53 - / - RT-q of TRAIL mRNA levels in cells Graph showing PCR analysis (48 hours, n=4). Error bars indicate replicates. The sd images show TIC10, a TRAIL-1 receptor that localizes on the cell surface of several cancer cell lines. The results show that the IL-1 protein levels increased in a dose-dependent manner in a p53-independent manner. Figure 1 shows the surface TRAIL levels induced by TIC10 in the first panel. The error bars indicate the standard deviation of replicate experiments (10 μM, 72 h, n = 3). Between the display conditions and the control * P<0.05.
[0158] TIC10 exposure induces significant and sustained expression of TRAIL on the cell surface of cancer cells. Time course analysis revealed that TRAIL localized to the cell surface as a delayed event. This induction can be sustained even after TIC10 is removed from the culture medium. Figure 4 shows the HCT1 expression after TIC10 treatment under the indicated conditions and time points. 16 p53 - / - 1 is a graph showing surface TRAIL levels in cells (n= 3) Error bars indicate the standard deviation of replicate experiments. Between *P<0.05. Figure 5 shows the flow cytometry at 72 hours after the start of TIC10 treatment. HCT116 p53 by cytometry - / - TRAIL surface level indicator The cells were pre-incubated for the indicated times (5 μM, n=3). and then treated with drug-free medium for the remainder of the time until analysis at 72 hours. Error bars indicate the standard deviation of replicate experiments. Between * P<0.05.
[0159] TIC10 induces TRAIL-mediated apoptosis At equivalent doses, TIC10 did not alter the cell cycle profile of normal fibroblasts. , TRAIL-sensitive HCT116 p53 - / - Sub- indicating cell death in cells Figure 6 shows the DNA content of HCT116 p53 cells treated with TIC10. - / - and cell cycle profiles of HFF cells (5 μM, 72 h, n = 1). 3).
[0160] TIC10 reduces clonogenic survival of cancer cell lines while sparing normal fibroblasts Figure 7 shows the quantification of colony formation assays of cancer cells treated with TIC10. The graph shows the results (10 μM, 72 hours, n=3). Error bars represent the standard deviation (s Figure 8 shows the same results as in Figure 7 except that HFF cells were counted at the end of the study. The graph shows similar experiments (n=3). Error bars indicate replicates. The standard deviation (sd) of the
[0161] TIC10 induces sub-G1 content in a p53-independent and Bax-dependent manner. Figure 9 shows the effect of DMSO, TIC10 (1, 5 or 10 μM) or HCT116 WT, p53 after treatment with rhTRAIL (25 ng / mL) - / - and Bax - / - This is a graph showing sub-G1 analysis of cells (n=3). The bars indicate the standard deviation (sd) of replicate experiments. between the condition and the control * P<0.05.
[0162] HCT11 treated with 5 μM TIC10 for 72 h, consistent with apoptotic cell death 6 p53 - / - and 1 μM, 2.5 μM, by immunofluorescence assay in cells. HCT116 p53 treated with 5 μM or 10 μM TIC10 for 72 h - / - Thin TIC10 inhibits the production of active caspases as shown by Western blot analysis in cells. Figure 10 shows the results of Western blot analysis. The sub-G1 content induced by TIC10 was found to be due to the pan-caspase apoprotein B1. Co-incubation with the ptosis inhibitor zVAD-fmk significantly inhibited Figure 11 shows the results of the immunization with zVAD-fmk or zVAD Sub-G1 analysis of TIC10-treated cancer cells pre-incubated without -fmk The graph shows the results (10 μM, 72 hours, n=3). Error bars represent the standard deviation of replicate experiments. The mean deviation (sd) is shown. Unless otherwise indicated, the mean difference between the indicated condition and the control Between * P<0.05.
[0163] TIC10-induced apoptosis was suppressed by stable TRAIL expression via shRNA. TRA1 was significantly inhibited by TIC10, as shown by the inhibition of TIC10-induced cytotoxicity after its knockdown. Figure 12 shows that short hairpin RNA induces TRIP1 expression. Sub-G1 analysis of MDA-MB-231 cells in which AIL was stably knocked down is shown. The graph shows the results of the experiment (72 hours, n=3). Error bars represent the standard deviation (s. d.) are shown. Unless otherwise indicated, there was a significant difference between the indicated conditions and the control. * P<0.05. Figure 13 shows the MD by flow cytometry analysis of TIC10-treated cells. A-MB-231 is a graph showing demonstration of shTRAIL knockdown (5 μg). M, 72 h, n=3). Error bars indicate the standard deviation of replicate experiments. Unless otherwise specified, the display conditions and the control * P<0.05.
[0164] TRAIL is required for TIC10-induced tumor cell death. Additional evidence supports the role of DR5 desmopressin in regulating pro-apoptotic TRAIL signaling. Figure 14 shows that endogenous DR5 or its death domain is disrupted in E. TIC1 in H460 cells with overexpression of the DR5 construct replaced with GFP 10 μM, 72 hours, n = 3). Error bars indicate standard deviation (sd) of replicate experiments unless otherwise indicated. Between the display conditions and the control * P<0.05.
[0165] Experimental sequestration of TRAIL by using blocking antibodies inhibits TIC10-induced Figure 15 shows that TRAIL is required for tumor cell death. In the presence or absence of RIK-2, an isolating antibody, DMSO, TIC10 (10 μg) M) or rhTRAIL (25 ng / mL) treated HCT116 cells sub- Graph showing G1 analysis (72 hours, n=3). Error bars represent the mean values of replicate experiments. d. Unless otherwise indicated, there is a significant difference between the indicated conditions and the control. * P<0.05.
[0166] We investigated the activity of TIC10 in freshly excised colon tumor cells from human patients. Meanwhile, TIC10 induces TRAIL and has a potent cytotoxic effect different from that of 5-FU. Figure 16 shows the results of the experiment using freshly excised colon cancer cells. , is a graph showing surface TRAIL induced by TIC10 (10 μM, The tissue was a mucinous adenocarcinoma removed from an 85-year-old female patient. The values are expressed as median light intensity. Figure 17 shows the results for DMSO, TIC10 (0.6), 1.25 , 2.5, 5, 10, 20 μM) or 5-FU (5 μM). 1 is a graph showing the results of a cell viability assay of colon cancer cells (n=3). Bars indicate the sd of replicate experiments.
[0167] The cytotoxic activity of TIC10 is heat stable, unlike TRAIL. TIC10 (5 μM) or rhTRAIL (25 ng / mL) at the indicated temperatures Decreasing cell viability in HCT116 cells after 1 hour of pre-incubation This graph shows that the 72-hour experiment can be performed with 3-fold reduction (n=3). Error bars indicate the number of replicates. The standard deviation (sd) of the
[0168] TIC10 is a potent TRAIL-mediated antitumor agent in vivo TIC10 was observed when both were administered as multiple doses, but not when TRAIL was used. HCT116 p53 - / - Tumor regression in xenografts Figure 19 shows the results of the immunizations administered on days 0, 3, and 6 as indicated by the gray vertical bars. Three doses of TIC10 (ip), TRAIL (iv) or vehicle (i. p.)-treated HCT116 p53 - / - 1 is a graph showing xenografts ( n = 10). Error bars indicate standard deviation (sd) of replicate experiments. Unless otherwise specified, the display conditions and the control * P<0.05 and ** P<.0 05.
[0169] Single injection in mice bearing HCT116 (WT) and RKO human colon cancer xenografts Treatment experiments confirmed the potent antitumor activity of TIC10 in RKO xenografts under given conditions. Figure 20 clearly demonstrates the superiority of TRAIL in TIC10 or vehicle. Luciferase-infected HCT116 p53 mice received a single i.p. injection of - / - xenograft This graph shows the results of bioluminescence imaging of (n=6). Error bars indicate the number of reactions. The standard deviation (sd) of replicate experiments is shown. Unless otherwise indicated, the conditions and controls shown Between the rolls* P<0.05 and ** P<.005.
[0170] Figure 21 shows the effect of a single dose of TIC10 (ip), TRAIL (iv) or vehicle Graph showing RKO xenografts with ip (n=10). The symbols indicate the standard deviation (sd) of replicate experiments. Unless otherwise indicated, the conditions shown Between the * P<0.05 and ** P<.005.
[0171] TIC10 is an activity that is significantly inhibited by stable knockdown of TRAIL. induced regression of MDA-MB-231 human breast cancer xenografts, while treatment with TRAIL The tumors treated with MDA-MB-231 vector or shTRAI progressed. Single-dose administration of TIC10 (ip), TRAIL (iv) or Figure 1 shows box plots of tumor volume on day 9 after the start of treatment with DMSO or vehicle (DMSO, ip). (n=8). Error bars indicate standard deviation (sd) of replicate experiments. Unless otherwise specified, the display conditions and the control * P<0.05 and ** P<.0 05. Two days after treatment with 50 mg / kg or 100 mg / kg TIC10 Tunes of tumors from MDA-MB-231 vector and shTRAIL xenografts L staining indicates that TU in cells treated with vector but not with shTRAIL Increased NEL staining is shown.
[0172] This indicates that the antitumor activity of TIC10 was enhanced when administered as a single dose under these conditions. When administered intracellularly, it was superior to that of TRAIL and was suppressed by TRAIL produced by tumor cells. In DLD-1 xenografts, TI C10 induced tumor stasis after 1 week of treatment, whereas TRAIL-treated tumors Figure 23 shows the progression of TRAIL ( iv) DLD-treated with TIC10 (ip) or DMSO (ip) 1 is a graph showing the relative tumor volume of 1 xenograft (n=8).
[0173] TIC10 as a single dose via intraperitoneal or oral delivery significantly inhibited the proliferation of SW480 xenografts. It also induced sustained regression, suggesting favorable bioavailability. 4 was administered as a single dose at 30 mg / kg on day 0 in SW480 xenografts. 1 is a graph showing a comparison of ip and oral administration of TIC10 (n=6).
[0174] Use of a single dose of orally administered TIC10 in the HCT116 xenograft model Dose-finding revealed sustained antitumor efficacy at 25 mg / kg. 25 was administered as a single oral dose in HCT116 xenografts. or vehicle (n=6). Error bars represent standard deviation of replicate experiments. Differences (s.d.) are shown between the indicated conditions and controls unless otherwise indicated. Leave * P<0.05 and ** P<.005.
[0175] In addition to the absence of adverse effects on body weight or liver histology, previous xenotransplantation Multiple doses delivered at doses four times higher than this therapeutic dose in a single patient were associated with significant toxicity. The absence of TIC10 means that the TIC10 has a wide therapeutic window. Figure 26 shows the TIC10 (100 mg / kg, i FIG. 27 is a graph showing the body weight of athymic female nude mice treated with .p. , and treatment with oral TIC10 (25 mg / kg) once a week for 4 weeks. Graph showing the body weight of C57 / B6 female mice at the end of week 4. TIC Athymic female nude mice harvested 3 days after treatment with 10 (100 mg / kg, ip) Histological analysis of livers from mice by H&E staining revealed no obvious toxicity of TIC10. It showed that.
[0176] Immunocompetent mice were chronically exposed to oral TIC10 at 25 mg / kg weekly for 4 weeks. Exposure to HIV did not result in a panel of serum chemistry markers, as shown in Tables IA and IB. No significant changes occurred.
[0177] Tables IA and IB show the results of weekly administration of vehicle or TIC10 (25 mg / mL) for 4 weeks. Figure 1 shows serum chemistries of C57 / B6 mice treated with 100 mg / kg.
[0178] [Table 1] To test the efficacy of TIC10 in immunocompetent preclinical cancer models, we performed a multicenter study of lymphoma. We used Eμ-Myc transgenic mice, which spontaneously develop leukemia. The same oral dosing schedule as above was used, which has been proven safe in patients with TIC10. This significantly extended the survival time of these mice by 4 weeks. Overall survival of Eμ-myc mice treated with weekly oral TIC10 (25 mg / kg) is shown. P values were determined by the log-rank test. For the control group, tumor size is expressed relative to tumor size on day 0, defined as the day treatment began. Axillary lymph node analysis of Eμ-myc and WT C57 / B6 mice at 14 weeks of age. Histological analysis by H&E staining showed that TIC10 had no obvious toxicity.
[0179] Synergistic combination of TIC10 with chemotherapeutic agents Surprisingly, TIC10 and the taxane paclitaxel In vitro synergy between acetaminophen and docetaxel (trade name Taxotere) has been observed. Figure 29 shows the results of D cells treated with TIC10 together with paclitaxel under the indicated conditions. 1 is a graph showing cell viability of LD-1 cells (72 hours, n=3). Error bars The mean mean squares of replicate experiments are shown in Figure 30. Both graphs show the cell viability of SW620 cells treated with TIC10 ( (72 hours, n=3). Error bars indicate the standard deviation of replicate experiments. Figure 31 shows Cell survival of DLD-1 cells treated with TIC10 together with Taxotere under the conditions The graph shows the rate of thrombus formation (72 hours, n=3). Error bars represent the standard deviation of replicate experiments. Figure 32 shows the results of TIC10 treatment with taxotere under the indicated conditions. 1 is a graph showing cell viability of SW620 cells treated with ELISA (72 hours, n=3). Bars indicate sd of replicate experiments.
[0180] TIC10 in combination with either the taxanes paclitaxel or docetaxel Collaboration leads to durable cures in H460 non-small cell lung cancer xenografts Figure 33 shows the efficacy of TIC10 (30 mg / mL) as a single dose in H460 xenografts. kg, ip) or Taxotere (20 mg / kg, iv) alone or in combination Cohorts bearing tumor tissue were treated with either the DMSO or vehicle (DMSO, ip). Figure 34 is a graph showing the percentage of saturates relative to Figure 33 (n=8). 1 is a graph showing plots of tumor volume over time. Error bars represent the s.d. of replicate experiments. This shows:
[0181] Figure 35 shows the efficacy of TIC10 (30 mg / kg) as a single dose in H460 xenografts. , ip) or paclitaxel (20 mg / kg, iv) alone or in combination Cohorts retaining tumor tissue after treatment with DMSO or vehicle (DMSO, i.p.) Figure 36 is a graph showing the percentage of Graph showing plots of tumor volume. Error bars indicate sd of replicate experiments. is doing.
[0182] In this example, both TIC10 and bevacizumab were administered to metastatic p53-deficient colorectal cancer patients. TIC10 was as potent as bevacizumab when given once weekly in a transgenic orthotopic mouse model. By working together, the primary cecal tumor and distant metastatic sites (lung, liver, lymph nodes, and Figure 37 shows that administration of HC into the cecum reduced the incidence of tumors in the peritoneum. T116 p53 - / -Tumors were implanted and were evident at the primary and distal sites at the end of the study. Figure 1 shows the percentage of the cohort with tumors over time (n=5). Treatment was given once a week starting 2 weeks after transplantation, as indicated by the cohort. In the study, vehicle, TIC10 (25 mg / kg, oral), bevacizumab (bev, 10 mg / kg, iv) or a combination of TIC10 and bevacizumab.
[0183] TIC10 alone and in combination with bevacizumab was demonstrated using this multiple-dose regimen. When administered, the treatment was well tolerated and did not significantly alter body weight at endpoint. Graph showing mouse weights at endpoint. Error bars represent the weights of replicates. .d. is shown.
[0184] TIC10 inhibits TRAIL-mediated direct and bystander effects induces tumor-specific cell death HCT116 after a single dose of TIC10 (100 mg / kg, ip) on day 0 p53 - / - Immunohistochemical (IHC) analysis of xenograft tumors revealed that TRAIL and Cleaved caspase, an initiator caspase involved in TRAIL-mediated apoptosis Increased levels of enzyme-8 protein were found.
[0185] Fragmented nuclei observed by histological examination and TUNEL (TdT-mediated depletion of nuclei) Increased UTP nick end labeling (NIL) staining indicated that TIC10 was apoptotic in the treated tumors. Furthermore, two days after treatment, TIC10 (100 μM) HCT116 p53 after treatment with IgG4 (g / kg, ip) or vehicle- / - H&E and stromal fibroblast staining for TRAIL at the interface between tumor and stromal fibroblasts in xenograft tumors As shown by immunohistochemistry and IHC analysis, TIC10 is expressed not only in tumors but also in tumor tissues. TRAIL was also induced in stromal fibroblasts bordering the ulcer.
[0186] TIC10-induced TRAIL expression in fibroblasts was investigated by treatment with TIC10. Soluble TRAIL was assayed in tumor-free mice to determine whether normal cells were TRAIL-positive. We then determined whether TIC10 secretes TRAIL in response to recombinant TRAIL. Serum levels of TRAIL persist for over 72 hours, longer than the serum half-life of TRAIL (approximately 30 minutes). Figure 39 shows the effect of TIC10 (100 mg / kg, iv) or doxorubicin on the vasopressin receptor agonist (vasopressin receptor agonist) in the treatment of vasopressin receptor agonist (vasopressin receptor agonist). TRA in tumor-free mice after sorbicin (30 mg / kg, ip) Graph showing IL serum levels (n=2). Error bars represent sd of replicate experiments. . is shown.
[0187] Serum TRAIL induced by TIC10 was detected as early as 2 hours after administration. This is more rapid than the kinetics observed in vitro in the examples described herein. Pharmacokinetic analysis showed that TIC10 was rapidly distributed and reached plasma concentration within approximately 6.5 hours. Table II shows the half-life of TIC1 in the plasma of C57B6 mice. Figure 40 shows the results of the pharmacokinetic analysis of 0. Figure 41 is a graph showing the absorbance profile of TIC10 in mouse plasma. and quantified using area under the curve (AUC) by HPLC analysis. Figure 42 is a graph showing the standard curve for 25% of C57 / B6 female mice. 1 is a graph showing the plasma concentration of TIC10 after intravenous administration at 100 mg / kg (n= 3) Error bars indicate the mean standard error of replicate experiments.
[0188] [Table 2] TIC10 has a longer half-life than recombinant TRAIL, and the effect of TIC10, i.e. TRAIL induction continues over several days in vivo, as seen in vitro. sustained over time.
[0189] Tumor-free mice after administration of TIC10 (100 mg / kg, iv) on day 0 IHC analysis of normal tissues from athymic nude mice revealed histological examination and TUNEL staining. protein in the brain, kidney, and spleen of mice without apparent toxicity as determined by TRAIL was upregulated at the TIC1 level. Upregulation of TRAIL in response to 0 was observed in the liver at all time points. This was not evident in other tissues.
[0190] The effect of TIC10 on normal fibroblasts and its selectivity for normal cells were investigated. TIC10 induces apoptosis in p53-deficient tumor cells. Selectively induced HCT treated with TIC10 (10 μM) or DMSO for 3 days 116 p53 - / - and normal fibroblasts in co-culture experiments with HFF cells did not induce apoptosis.
[0191] TIC10 induces significant but moderate amounts of TRAIL on the surface of normal fibroblasts. Figure 43 shows the effect of TIC10 treatment (0, 2.5, 5 or 10 μM from left to right). ) (72 hours, n=3) ). Error bars indicate the standard deviation of replicate experiments. Unless otherwise indicated, the conditions shown Between the * P<0.05.
[0192] Normal cells suppress the antitumor activity of TIC10 through the TRAIL-mediated bystander effect. To test whether this contributes to efficacy, positive control cells pre-incubated with TIC10 were used. Normal fibroblasts were transplanted into co-culture with p53-deficient colon cancer cells. Figure 44 shows that TRAIL-specific cell death was moderately but significantly increased in a subpopulation of HC T116 p53 - / - Sub-G1 analysis of co-cultures of cells with pretreated HFFs is shown. This graph shows the results (24 hours, n = 3). Pretreatment of HFFs was performed at TIC10 (10 μM ) or DMSO for 72 hours. The experiments were performed in the presence or absence of a TRAIL-sequestering antibody (RIK-2). Scale bar is 100 μm. Error bars indicate the standard deviation of replicate experiments. Unless otherwise indicated, there is a significant difference between the conditions shown and the control. * P<0.05.
[0193] Thus, as demonstrated herein, TIC10 has a favorable therapeutic index. Induce TRAIL in tumor cells, stromal cells, and normal cells, which may be a direct mechanism These findings may contribute to the antitumor efficacy of TIC10 through both cytotoxic and bystander mechanisms.
[0194] TIC10 is an effective antitumor agent in glioblastoma multiforme (GBM) TIC10 induces TRAIL in the brain and is useful as an antitumor agent for brain tumors. In this example, the activity of TIC10 was tested in GBM cell lines. TIC10 induces TRAIL in the low micromolar range, similar to other cancer cell lines. It was found that the GI50 of the IL-10 gene was p53-independent. 1 is a graph showing surface TRAIL in GBM cell lines after incubation ( 5 μM, 72 hours, n=3). * P<0.05 Figure 46 shows the results of the indicated GBM cells 72 hours after treatment with TIC10 or DMSO. 1 is a graph showing extrapolated GI50 values from cell viability assays of cell lines (n= 3).
[0195] TIC10 is a temozolomide-resistant and pre-irradiated cell line in this example. Figure 47 shows that DMS has a cytotoxic effect on freshly isolated GBM cells. O, excised baculoblasts treated with TIC10 or temozolomide (TMZ, 10 μM) The results of cell viability assays of glioblastoma tissues are shown (72 hours, n=3). The tissue was taken from a 38-year-old female patient who had previously undergone cytoreductive surgery and radiation therapy. The tumor was a grade IV glioblastoma containing oligodendroglial cell components.
[0196] Preclinical studies of GBM as a monoagent and in combination with bevacizumab TIC10 was tested in a panel of GBM cell lines (including T98G). It exerts p53-independent cytotoxicity against GBM cell lines, including those resistant to temozolomide. When given as a single oral dose, it inhibits subcutaneous T9 to a similar extent as bevacizumab. induced sustained regression of 8G xenografts. a single dose of bevacizumab (30 mg / kg, PO) or bevacizumab (10 mg / kg, iv) 1 is a graph showing subcutaneous xenografts of T98G in mice (n=8). Between the condition and the control * P<0.05.
[0197] A single dose of TIC10 inhibits invasive intracranial xenografts of human GBM using the SF767 cell line As a single agent in transplantation, it significantly doubled overall survival in mice and cooperated with bevacizumab This tripled the survival time of mice bearing such brain tumors.
[0198] Figure 49 shows the results of a single oral administration of vehicle (n=8), TIC10 (2 5 mg / kg, n = 7), bevacizumab (10 mg / kg, iv, n = 6) or T SF767 intracranial tumor-bearing mice treated with IC10 and bevacizumab (n=7) 1 is a graph showing overall survival of mice.
[0199] Table III shows the overall survival of the SF767 intracranial tumor-bearing mouse cohort. do.
[0200] [Table 3] TIC10-induced TRAIL upregulation is Foxo3a dependent Identifying the molecular events supporting TIC10-induced TRAIL upregulation To investigate the effect of TIC10 on HCT116 p53 - / - Gene expression profiles in cells The FOXO family of transcription factors (Modur, V. et al., 2002) , J. Biol. Chem. 277:47928-47937 The TRAIL gene promoter is regulated by the binding site contained within the selected region. We observed changes in the transcription of target genes of the IL-1 receptor (including Foxo3a, as previously shown in Figure 5). 0 indicates the increase in HCT11 cells 48 hours after TIC10 treatment (10 μM) compared to DMSO. 6 p53 - / - Cellular gene expression profiling related to FOXO signaling This graph shows the transcriptional changes associated with DMS (n=3). P<0.05 between the O and TIC10 treatment groups. Error bars represent replicates. The standard deviations (s.d.) are shown. Unless otherwise indicated, there was no significant difference between the indicated conditions and the control. hand * P<0.05.
[0201] The FOXO target gene DR5 is expressed in several cancer cell lines and, to a lesser extent, in normal It was upregulated by TIC10 in cells treated with TIC10. Figure 51 shows the effect of TIC10 or DMSO at the indicated concentrations on tumor growth in vivo after 72 hours. Western blot analysis of DR5 in treated HCT116 cells. n is shown as a loading control. Figure 52 shows the results of TIC10-treated cancer cells. Graph showing flow cytometry analysis of surface DR5 levels in normal and normal cells. (72 hours, n = 3). Error bars indicate the standard deviation of replicate experiments. Unless indicated, between the display conditions and the control * P<0.05.
[0202] treated with vehicle (ip) or TIC10 (100 mg / kg, ip) IHC analysis of DR5 in HCT116 xenograft tumors confirmed the in vitro observations. Concordantly, high expression of DR5 was evident in xenograft tumors treated with TIC10 This shows that...
[0203] Foxo3a, a member of the FOXO family, inhibits the expression of Foxo3 in HCT116 cells. Immunofluorescence and Western blot analysis of xo3a and DMSO or TIC1 Foxo3a in H460 and SW480 cells treated with 0 and 10 μM for 48 h underwent nuclear translocation in response to TIC10 as measured by immunofluorescence analysis of Foxo1a did not).
[0204] Figure 53 shows HCT11 cells treated with DMSO or TIC10 (48 hours, 10 μM). Whole cell lysates (W) and cytoplasmic (C) and nuclear (N) extracts of 6 cells were analyzed. The images are from stain blot analysis. β-actin and lamin B1 are expressed in the cytoplasm and and nuclear filling controls.
[0205] Localized to the TRAIL promoter as demonstrated by chromatin immunoprecipitation assay A TIC10 dose-dependent increase in the amount of Foxo3a expressed in HCT116 cells was found. p53 - / - TIC10 treatment in cells (from left to right: 0, 2.5, 5 or TIC10 of Foxo3a against the TRAIL promoter after 48 hours of treatment with 10 μM 1 shows an image of the results of a chromatin immunoprecipitation assay for induced translocation.
[0206] Transient knockdown of Foxo3a and Foxo1 revealed that Foxo3a upregulates TIC10 It was found to specifically mediate the upregulation of inducible TRAIL. Figure 55 shows the HCT116 p53 - / - Foxo1 and TIC10 (10 μg) with or without transient knockdown of ATP and / or Foxo3a Flow cytometry analysis of cell surface TRAIL levels induced by M The graph shown is for 72 hours, n=3. Knockdown was measured by Western blot analysis. The error bars indicate the standard deviation of replicate experiments. Unless otherwise specified, the display conditions and the control * P<0.05.
[0207] Stable knockdown of Foxo3a upregulates TIC10-induced TRAIL production. Figure 56 shows that IFN-γ significantly inhibited the regulation of HCT116 cells and subsequent tumor cell death. TIC10 induction with or without stable knockdown of Foxo3a in the cells Graph showing sub-G1 analysis of cell death (10 μM, 72 hours, n=3). Error bars indicate the standard deviation of replicate experiments. Between the control * P<0.05. Figure 57 shows the effect of Fo Induced by TIC10 with or without stable knockdown of xo3a 1 is a graph showing flow cytometry analysis of surface TRAIL (10 μM, 72 (time, n=3). Error bars indicate the standard deviation of replicate experiments. Unless otherwise indicated. ,between the display conditions and the control * P<0.05. The results of the cut-down were confirmed by Western blot analysis.
[0208] Stable knockdown of Foxo3a in tumor cells results in tumor growth in vivo. , antitumor activity of TIC10, and TIC10-induced TRAIL-mediated apoptosis Figure 58 shows that the TIC10 cells treated with vehicle or TIC10 at day 0 showed significant inhibition of thrombus formation. Stable knockdown of Foxo3a after a single oral dose (25mg / kg) 1 is a graph showing tumor volume of HCT116 xenografts with or without (n= 10). Error bars indicate the standard deviation of replicate experiments. Between the condition and the control * P<0.05.
[0209] Three days after a single dose of TIC10 (25 mg / kg, orally), stable Foxo3a expression was observed. IHC analysis and TUNEL of HCT116 tumors with or without knockdown They performed staining and found that stable knockdown of Foxo3a in tumor cells resulted in Antitumor activity of TIC10 and TIC10-induced tumor growth in vivo It also demonstrated significant inhibition of TRAIL-mediated apoptotic signatures.
[0210] Dual inactivation of Akt and ERK by TIC10 cooperatively induces TRAIL R Regulators of Foxo3a (e.g., IKK, Akt, and ERK) are upregulated by TIC10. Figure 59 shows the changes induced by TIC10 (2.5, 5, 10 μM) at 72 Time-treated HCT116 p53 - / - This is an image of Western blot analysis of cells.
[0211] Both pAkt and pERK levels increased with dephosphorylation of their respective phosphorylation sites on Foxo3a. The phosphorylation was found to be abolished by simultaneous TIC10 treatment in a dose-dependent manner. Time course analysis revealed dephosphorylation of Foxo3a and upregulation of TRAIL. TIC10-induced inactivation of Akt and ERK, a dynamic that cooperates with Figure 60 shows the TIC10 over the indicated time periods. HCT116 p53 treated with (10 μM) - / - Western blot analysis of cells Figure 61 shows a densitogram of a Western blot of a repeat experiment as in Figure 60. Protein expression levels of TIC10-induced effects measured by TREE The graph shows the time course of the control group (n=3). The results are expressed for each sample and normalized to Ran. TRAIL was quantified by flow cytometry (n=3).
[0212] These TIC10-induced effects on Foxo3a were observed in various tumor types. Several cancer cell lines (various mutations containing oncogenic alterations in p53, KRAS, PTEN, etc.) Figure 62 shows the DLD1 human cancer cell line. Colon cancer cells, MDA-MB-468 human breast cancer cells, and T98G human glioblastoma multiforme cells Western blot analysis of TIC10-induced effects on Foxo3a in the mouse strain This is an image of a vitreous analysis (10 μM, 72 hours).
[0213] Akt mediates cytotoxicity to TIC10 and its TRAIL upregulation It has been found to be a determinant of sexual sensitivity, and TIC10 treatment (10 μM, 48 hours) induced by H overexpressing empty vector or myristylated Akt (myr-Akt). As shown by immunofluorescence analysis of Foxo3a in CT116 cells, Akt Overactivation of TRAIL can suppress even basal levels. Confirmation of overexpression of myr-Akt by TIC10 is shown in Figure 63. Figure 64 shows the TIC10 Treatment (10 μM, 48 h) with empty vector or myristylated Akt (myr- Flow cytometry of surface TRAIL in HCT116 cells overexpressing Akt Figure 65 is a graph showing a tree analysis of the empty vector subjected to TIC10 treatment. or myr-Akt overexpressing HCT116 cells showed sub-G1 content. This is a graph showing the results (10 μM, 72 hours, n=3).
[0214] Dual inhibition of the Akt and MAPK pathways cooperatively inhibits Foxo3a nuclear translocation and its subsequent A6730 and U0126 monoclonal antibodies result in the subsequent upregulation of TRAIL. The ethanolate is commercially available and is a soluble form of Akt1 / 2 (Desplat, V. et al., 2002). 008, J. Enz. Inhib. Med. Chem., 23:648-658) and MEK (Favata, MF et al., 1998, J. Biol. Chem., 273:1 8623-18632), which are previously reported inhibitors of Akt and Dual inhibition of MAPK pathways cooperatively induces Foxo3a nuclear translocation and subsequent TRAIL Each was used in this example to determine whether it resulted in upregulation of The combination of MEK and Akt inhibitors inhibited Foxo3a-dependent TRAIL-1 activation. L upregulation and synergistically induce TRAIL-mediated cell death Figure 66 shows the results of 10 μM A6730 (Akt inhibitor), with U0126 monoethanolate (MEK inhibitor (MEK inh)) or both HCT116 p53 after incubation in - / - TRAIL mRNA in cells A graph showing RT-qPCR analysis of A (48 hours, n=3). For K inh, P < .05 compared with all other conditions. Unless otherwise indicated, Between display conditions and controls * P<0.05.
[0215] Figure 67 shows the results of the analysis of the cells in Figure 66 with or without stable knockdown of Foxo3a. Graphs showing induction of surface TRAIL (n=3) unless otherwise indicated. ,between the display conditions and the control * P<0.05.
[0216] Figure 68 shows the effect of 10 μM Akt inhibition, MEK inhibition, or both at 48 h. After incubation for 1 h, with or without TRAIL knockdown by shRNA 1 is a graph showing sub-G1 analysis of MDA-MB-231 in (n=3). Unless otherwise indicated, there is a significant difference between the conditions shown and the control. *P<0.05. Figure 6 9 contains 10 μM A6730 (Akt inhibitor), U0126 monoethanolate (MEK HCT116 p53 after incubation with either - / - 1 is a graph showing surface TRAIL analysis of cells (48 hours, n=3).
[0217] The siRNA experiments in this example demonstrated that inhibition of ERK and Akt resulted in: Figure 70 shows that HCT116 can cooperatively upregulate TRAIL. p53 - / - After transient knockdown of Akt and / or ERK in cells (knockout RT-qPCR analysis of TRAIL mRNA levels after 48 hours of down-regulation. The graph shows the results (n=3). The combination of siERK and siAkt was similar to other P<.05 compared with all conditions.
[0218] Figure 71 shows confirmation of Akt and ERK knockdown by Western blot analysis. The images shown are from the same experiment. Error bars indicate the standard deviation of replicates. After transient knockdown of Akt and / or ERK in T116 cells 10 is a graph showing surface TRAIL analysis after 48 hours of treatment with IFN-γ (n=3).
[0219] TIC10 mediates the regulation of Akt and ERK, which mediate cell death and potent cytokines in vivo. Transcriptionally induces TRAIL as a unique target gene to enhance antitumor effects This results in the dual inactivation of their mutual substrate, Foxo3a, which cooperatively results in the nuclear translocation of Foxo3a. Rub.
[0220] Any patents or publications mentioned in this specification are hereby incorporated by reference as if each individual publication were incorporated by reference. and the like are incorporated herein by reference to the same extent as if each such individual were specifically and individually indicated to be incorporated by reference. It is cited.
[0221] The compositions and methods described herein are presently representative of preferred embodiments and are exemplary. The present invention is not intended to be limiting on the scope of the present invention. Such modifications and other uses are intended to be encompassed by the appended claims. Such modifications may be made without departing from the scope of the invention.
Claims
1. A composition for treating a subject having or at risk of having cancer, said composition comprising the compound NSC350625, or a pharmaceutically acceptable salt, ester, amide, hydrate, or solvate thereof, wherein said composition is administered in combination with radiation treatment.
2. A composition for treating a subject having or at risk of having cancer, said composition comprising the compound NSC350625, or a pharmaceutically acceptable salt, ester, amide, hydrate, or solvate thereof, wherein said composition is administered in combination with bevacizumab.
3. A composition for treating a subject having or at risk of having cancer, said composition comprising bevacizumab, wherein said composition is administered in combination with the compound NSC350625, or a pharmaceutically acceptable salt, ester, amide, hydrate, or solvate thereof.
4. A composition for treating a subject having or at risk of having cancer, said composition comprising the compound NSC350625, or a pharmaceutically acceptable salt, ester, amide, hydrate, or solvate thereof, wherein said composition is administered in combination with a taxane mitotic inhibitor.
5. A composition for treating a subject having or at risk of having cancer, the composition comprising a taxane mitotic inhibitor, the composition being administered in combination with the compound NSC350625, or a pharmaceutically acceptable salt, ester, amide, hydrate, or solvate thereof.
6. A composition described in any one of claims 4 or 5, wherein the taxane mitotic inhibitor comprises paclitaxel, docetaxel or a combination thereof.
7. The composition described in any one of claims 1 to 6, wherein the cancer is selected from the group consisting of intracranial tumors, brain tumors, colon cancer, breast cancer, glioblastoma multiforme (GBM), and colorectal cancer.
8. The composition described in claim 7, wherein the cancer is a brain tumor.
9. The composition described in claim 7, wherein the cancer is glioblastoma multiforme (GBM).
Citation Information
Patent Citations
Methods for amplifying expression from cell-specific promoters
JP2005502645A
Antibodies selective for tumor necrosis factor-related apoptosis-inducing ligand receptors and their uses
JP2005509414A
Combinations containing cdk inhibitors and growth factor antibodies or antimitotic agents
JP2009526009A
TRAIL variants for cancer treatment
JP2011506592A
Therapeutic combination comprising an aurora kinase inhibitor and antiproliferative agents
WO2010009985A2