Function-deficient granular starch synthase gene and buckwheat plant using the same

Abstract

To provide a function-deficient granular starch synthase gene and a Fagopyrum plant using the same.SOLUTION: A granular starch synthase gene highly expressed in the endosperm of a Fagopyrum plant is identified from granular starch synthase genes identified from the decoding result of the genome sequence of the Fagopyrum plant, and a function-deficient granular starch synthase gene produced by deleting the function of the identified granular starch synthase gene by mutation induction and a Fagopyrum plant which is a double-recessive homozygote having the function-deficient granular starch synthase gene homozygously are produced.SELECTED DRAWING: Figure 5

Description

[Technical Field]

[0001] The present invention relates to a function-deficient granular starch synthase gene and a buckwheat plant utilizing the same, and in particular to a function-deficient granular starch synthase gene that enables the production of a buckwheat plant (waxy buckwheat) with a waxy trait, and a buckwheat plant utilizing the same. [Background technology]

[0002] Amylose and amylopectin are important substances that greatly affect the starch properties of cereals. Granule bound starch synthase (GBSS) synthesizes amylose using ADP-glucose as a substrate. In grasses and other crops, lack of GBSS function prevents amylose synthesis, resulting in the accumulation of waxy starch, which consists solely of amylopectin, in the endosperm.

[0003] Starch containing amylose stains blue-purple with iodine solution, while starch lacking amylose stains red-purple. Therefore, using iodine solution is generally used to easily screen for individuals that accumulate waxy starch in their endosperm.

[0004] The use of loss-of-function genes to generate buckwheat plants with waxy traits has attracted attention. Attempts to improve the characteristics of plants other than buckwheat using loss-of-function genes are known from Patent Documents 1 and 2, etc.

[0005] However, no waxy individuals have been identified in buckwheat plants using a loss-of-function gene. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Japanese Patent Application Laid-Open No. 2016-86761 [Patent Document 2] Japanese Patent Application Publication No. 2018-186835 Summary of the Invention [Problem to be solved by the invention]

[0007] An object of the present invention is to provide a function-deficient granule-type starch synthase gene and a Fagopyrum plant utilizing the same.

[0008] The inventors discovered five GBSS genes from the buckwheat genome sequence. Furthermore, transcriptome analysis using RNA sequencing revealed that the FeGBSS1 and FeGBSS2 proteins are highly expressed in the endosperm.

[0009] Therefore, we used EMS to develop FeGBSS1-wx1 and FeGBSS2-wx1, which encode functionally defective FeGBSS1 and FeGBSS2 proteins, respectively. Furthermore, by crossbreeding, we created individuals homozygous for both FeGBSS1-wx1 and FeGBSS2-wx1 (double recessive homozygous individuals). When the endosperm of the double recessive homozygous individuals was stained with iodine solution, it turned reddish-purple, demonstrating that these double recessive homozygous individuals are buckwheat plants with the waxy trait (waxy buckwheat). [Means for solving the problem]

[0010] The functionally deficient granular starch synthase gene of the invention of claim 1 is characterized in that it is produced by identifying two granular starch synthase genes that are highly expressed in the endosperm of buckwheat plants from among five granular starch synthase genes identified from the results of decoding the genome sequence of buckwheat plants, and by deleting the functions of these two identified granular starch synthase genes through mutation induction.

[0011] The invention of claim 2 is characterized in that, in the invention described in claim 1, the five granule starch synthase genes are identified based on the CuriE sequences of granule starch synthase genes previously obtained from the genome sequences of Fagopyrum plants.

[0012] The invention of claim 3 is the invention of claim 2, wherein the five granule starch synthase genes are: FesPL4_sc0224.1.g147573.t3 FesPL4_sc0077.1.g193457.t1 FesPL4_sc0224.1.g149056.t1 FesPL4_sc0065.1.g82828.t1 FesPL4_sc0217.1.g44280.t1 It is characterized in that:

[0013] The invention of claim 4 is characterized in that, in the invention described in any one of claims 1 to 3, the two granule starch synthase genes are identified from the number of reads based on transcriptome analysis of the five granule starch synthase genes.

[0014] The invention of claim 5 is characterized in that, in the invention of claim 4, the two granule starch synthase genes are FesPL4_sc0224.1.g147573.t3 and FesPL4_sc0217.1.g44280.t1.

[0015] The invention of claim 6 is characterized in that, in the invention described in any one of claims 1 to 5, the mutation induction is carried out by deleting the functions of the two granular starch synthase genes by treatment with ethyl methanesulfonate, thereby generating functionally deficient FeGBSS1-wx1 genes and FeGBSS2-wx1 genes.

[0016] The invention of claim 7 is characterized in that, in the invention described in claim 6, the FeGBSS1-wx1 gene has the 522nd base of the cDNA sequence modified from G to A, and the 174th amino acid encoded by the FeGBSS1-wx1 gene has been mutated from Trp (codon TGG) to a stop codon (TGA), and the FeGBSS2-wx1 gene has the 513th base of the cDNA sequence modified from G to A, and the 171st amino acid encoded by the FeGBSS2-wx1 gene has been mutated from Trp (codon TGG) to a stop codon (TGA).

[0017] The buckwheat plant of the invention of claim 8 is characterized in that it is a doubly recessive homozygous individual that is homozygous for a function-deficient granular starch synthase gene, which is generated by identifying a granular starch synthase gene that is highly expressed in the endosperm of buckwheat plants from among the granular starch synthase genes identified from the results of decoding the genome sequence of buckwheat plants, and by deleting the function of this identified granular starch synthase gene through mutation induction. [Effects of the Invention]

[0018] According to the present invention, a granular starch synthase gene that is highly expressed in the endosperm of a buckwheat plant is identified from among the granular starch synthase genes identified from the results of decoding the genome sequence of a buckwheat plant, and the function of this identified granular starch synthase gene is deleted by mutation induction, thereby obtaining a buckwheat plant that is a doubly recessive homozygous individual that is homozygous for a function-deficient granular starch synthase gene.This has the effect of providing a buckwheat plant that has a glutinous trait and produces noodles that are less likely to deteriorate, without the need to add any other ingredients. [Brief explanation of the drawings]

[0019] [Figure 1] FIG. 1 shows the nucleotide sequence (SEQ ID NO: 1) of FeGBSS1_cDNA (normal type), which is a granule-type starch synthase gene. [Figure 2]FIG. 2 is a diagram showing the nucleotide sequence (SEQ ID NO: 2) of FeGBSS1-wx1_cDNA (mutant type), which is a clearly functionally deficient granular starch synthase gene according to the present invention. [Figure 3] FIG. 3 shows the nucleotide sequence (SEQ ID NO: 3) of FeGBSS2_cDNA (normal type), which is a granule-type starch synthase gene. [Figure 4] FIG. 4 is a diagram showing the base sequence (SEQ ID NO: 4) of FeGBSS2-wx1_cDNA (mutant type), which is a function-deficient granular starch synthase gene according to the present invention. [Figure 5] FIG. 5 is a photograph showing the screening of individuals that accumulate waxy starch in endosperm using an iodine solution in a Fagopyrum plant according to the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0020] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings.

[0021] In the examples of the present invention, nuclear DNA from the buckwheat intermediate parent line No. 1 was extracted according to the method of Yasui et al. (2016a) (Draft genome sequence of an inbred line of Chenopodium quinoa, an allotetraploid crop with great environmental adaptability and outstanding nutritional properties, DNA Research, 23, 535-546.), and the DNA sequence was assembled using the DenovoMAGIC method to obtain the buckwheat genome sequence. Assembly using the DenovoMAGIC method was outsourced to NRGene, Inc. Kazusa DNA Research Institute, a subcontractor, predicted all genes in the buckwheat genome sequence.

[0022] Identification of the GBSS gene A TBLASTX analysis was performed on the buckwheat genome sequence using the GBSS gene (sc0002521) detected by Yasui et al. (2016b) as the query sequence. As a result, the following five GBSS genes were found to exist.

[0023] FesPL4_sc0224.1.g147573.t3 FesPL4_sc0077.1.g193457.t1 FesPL4_sc0224.1.g149056.t1 FesPL4_sc0065.1.g82828.t1 FesPL4_sc0217.1.g44280.t1 The results of the TBLASTX analysis (E value) are shown below.

[0024] Gene name E value FesPL4_sc0224.1.g147573.t3 0.0 FesPL4_sc0077.1.g193457.t1 0.0 FesPL4_sc0224.1.g149056.t1 5e-180 FesPL4_sc0065.1.g82828.t1 1e-161 FesPL4_sc0217.1.g44280.t1 1e-157 Transcriptome analysis RNA was extracted from immature buckwheat seeds 12–14 days after cross-pollination according to the method described by Yasui et al. (2012) (A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.), and libraries for NGS analysis were prepared using Illumina's TruSeq RNA Sample Prep Kit v2. After obtaining sequence reads using Illumina's HiseqX, read cleaning was performed using trimmomatic 0.3.2 (Bolger, AM et al. 2014). Using the five genes listed above as reference sequences, mapping was performed using BWA. The number of reads that ultimately mapped to the genes in the reference sequence was used to determine expression intensity.

[0025] The results were as follows: two GBSS genes, FesPL4_sc0224.1.g147573.t3 and FesPL4_sc0217.1.g44280.t1, were found to be highly expressed in the endosperm. The gene with the highest expression level, FesPL4_sc0224.1.g147573.t3, was named FeGBSS1, and the gene with the highest expression level, FeGBSS2.

[0026] Predicted gene read count FesPL4_sc0224.1.g147573.t3 7,295,100 FesPL4_sc0077.1.g193457.t1 1,342 FesPL4_sc0224.1.g149056.t1 754 FesPL4_sc0065.1.g82828.t1 11,395 FesPL4_sc0217.1.g44280.t1 6,210,988 Mutation induction population development Mutation induction using EMS was performed to eliminate the function of FeGBSS1 and FeGBSS2. Approximately 4,600 seeds were treated with 0.33% EMS solution for 15 hours and cultivated at the Kyoto University Farm. Three to six seeds were collected from each plant, yielding 7,490 seeds. These seeds were then treated with 0.6% EMS for 15 hours, and finally seeds were collected from 2,710 plants. One to two seeds were collected per plant. These seeds were sown and cultivated at the Kyoto University Farm, and seeds were collected individually from 3,336 plants. Furthermore, DNA was extracted from equal amounts of leaves from 12 plants during cultivation, resulting in 278 DNA bulks (12 plants x 278 bulks = 3,336).

[0027] Development of FeGBSS1-wx1 and FeGBSS2-wx1 using mutation detection PCR primers for FeGBSS1 and FeGBSS2 were designed, and PCR amplification was performed using 278 DNA bulk as a template under the following conditions.

[0028] 98 degrees 2 minutes, (98 degrees 10 seconds, 58 degrees 5 seconds, 72 degrees 90 seconds) x 30 times, 72 degrees 5 seconds The PCR primers are as follows: Primers for amplifying FeGBSS1 GBSS_sc0005258_Fw1; GACGTCACTCACAATCACAAGTAGC Primers for amplifying FeGBSS2 GBSS_sc0002521_Fw3; AATACCGCTGTGTGTATGGCAAG GBSS_sc0002521_Rv1205; GGTCCTGAGAAAAATTTGTTGTTG After PCR, the PCR products were bulk-prepared into libraries using the Nextera XT DNA Library Prep kit (Illumina), and sequence reads were obtained using Hiseq X (Illumina). The reads were then cleaned using trimmomatic 0.3.2 and mapped to the reference sequence (FeGBSS1 and FeGBSS2 gene sequences) using BWA (Li and Durbin, 2009) (Draft genome sequence of an inbred line of Chenopodium quinoa, an allotetraploid crop with great environmental adaptability and outstanding nutritional properties, DNA Research, 23, 535-546.).

[0029] The sequences were then processed (BAM conversion, sorting, and mpileup) using samtools (Li et al., 2009) (The Sequence Alignment / Map format and SAMtools, Bioinformatics, 25, 2078-2079.), Vcf generation was performed using VarScan (Koboldt et al., 2009) (VarScan: variant detection in massively parallel sequencing of individual and pooled samples. Bioinformatics (Oxford, England), 25, 2283-2285 PMID: 19542151), and mutation detection was performed using SnpEff (Cingolani et al., 2012) (A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.).

[0030] As a result, we developed the FeGBSS1-wx1 gene, in which the 522nd base of the FeGBSS1 cDNA sequence was altered from G to A, as shown in Figure 1. Furthermore, as shown in Figure 2, the 174th amino acid encoded by the FeGBSS1-wx1 gene was mutated from Trp (codon TGG) to a stop codon (TGA), which is thought to result in a loss of function of the FeGBSS1 protein.

[0031] Furthermore, as shown in Figure 3, we developed the FeGBSS2-wx1 gene, in which the 513th base of the FeGBSS2 cDNA sequence was altered from G to A. Furthermore, as shown in Figure 4, the 171st amino acid encoded by the FeGBSS2-wx1 gene was mutated from Trp (codon TGG) to a stop codon (TGA), which is thought to result in a loss of function of the FeGBSS2 protein.

[0032] -Development of glutinous buckwheat through hybridization The two genes, FeGBSS1 and FeGBSS2, are highly expressed. To confer the waxy trait to buckwheat, it is necessary to breed individuals that simultaneously possess both FeGBSS1-wx1 and FeGBSS2-wx1 homozygotes (double recessive homozygotes). Therefore, we first bred double heterozygotes (genotypes: FeGBSS1 / FeGBSS1-wx1, FeGBSS2 / FeGBSS2-wx1), and then crossed these double heterozygotes to develop waxy buckwheat individuals (genotypes: FeGBSS1-wx1 / FeGBSS1-wx1, FeGBSS2-wx1 / FeGBSS2-wx1). To identify the genotypes, the FeGBSS1 and FeGBSS2 genes were PCR-amplified and sequenced by the Sanger method. The PCR conditions were as described above, and the following PCR primers were used for Sanger sequencing:

[0033] Sequencing primer for detecting GBSS1-wx1, AGCTGAGGTAAAAGTGGGAGATAAG Sequencing primer for GBSS2-wx1 detection: GGGGTTGATCGTGTCTTCGT Staining with iodine solution Buckwheat seeds were cut, and iodine solution (0.37 g of purified iodine and 0.74 g of KI dissolved in 400 ml of distilled water) was dropped onto the cut surface to stain the buckwheat starch. As a result, the starch from waxy buckwheat was stained reddish-brown, as shown in Figure 5(A), while the starch from regular buckwheat used as a control was stained dark blue, as shown in Figure 5(B).

[0034] In addition, it is believed that the amylose content of the endosperm of the above-mentioned Fagopyrum plant according to the present invention is 20% or less of the total starch.

[0035] The present invention is not limited to the above-described embodiments, and many modifications can be made by those skilled in the art within the scope of the technical concept of the present invention.

Claims

1. Among the five granule starch synthase genes identified from the genome sequence of buckwheat plants, two granule starch synthase genes that are highly expressed in the endosperm of buckwheat plants were identified. The functions of the two identified granule-specific starch synthase genes were deleted by mutagenesis. A functionally defective granular starch synthase gene characterized by:

2. The five granule starch synthase genes are: Identified based on the CRIER sequence of the granule starch synthase gene, which was previously determined from the genome sequence of buckwheat plants. The function-deficient granular starch synthase gene according to claim 1.

3. The five granule starch synthase genes are: FesPL4_sc0224.1.g147573.t3 FesPL4_sc0077.1.g193457.t1 FesPL4_sc0224.1.g149056.t1 FesPL4_sc0065.1.g82828.t1 FesPL4_sc0217.1.g44280.t1 is The function-deficient granular starch synthase gene according to claim 2 .

4. The two granule starch synthase genes are Identified from the number of reads based on transcriptome analysis of the five granule starch synthase genes The function-deficient granular starch synthase gene according to any one of claims 1 to 3.

5. The two granule starch synthase genes are FesPL4_sc0224.1.g147573.t3 and FesPL4_sc0217.1.g44280.t1 The function-deficient granular starch synthase gene according to claim 4.

6. The mutagenesis may be The functions of the two granule starch synthase genes are deleted by ethyl methanesulfonate treatment to generate the functionally deficient FeGBSS1-wx1 gene and FeGBSS2-wx1 gene. The function-deficient granular starch synthase gene according to any one of claims 1 to 5.

7. The FeGBSS1-wx1 gene is The 522nd base of the cDNA sequence was changed from G to A, and the 174th amino acid encoded by the FeGBSS1-wx1 gene was mutated from Trp (codon TGG) to a stop codon (TGA), The FeGBSS2-wx1 gene The 513th base of the cDNA sequence was changed from G to A, and the 171st amino acid encoded by the FeGBSS2-wx1 gene was mutated from Trp (codon TGG) to a stop codon (TGA). The function-deficient granular starch synthase gene according to claim 6.

8. A buckwheat plant characterized by being a doubly recessive homozygous individual that has a functionally deficient granular starch synthase gene homozygous, generated by identifying a granular starch synthase gene that is highly expressed in the endosperm of buckwheat plants from among the granular starch synthase genes identified from the results of decoding the genome sequence of buckwheat plants, and by eliminating the function of this identified granular starch synthase gene through mutation induction.

Images