A tumor treatment method combining oncolytic virus vaccines and immune cells.

The combination of oncolytic virus vaccines expressing tumor antigens with immune cells and cytokines addresses the limitations of immunotherapies in treating solid tumors by effectively targeting and destroying tumor cells while ensuring safety for normal cells.

JP2026509604APending Publication Date: 2026-03-19JOINT BIOSCIENCES (SH) LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025555663
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-03-30
Filing Date
2024-03-18
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

Current immunotherapies, including CAR-T cell therapy, face limitations in treating solid tumors due to heterogeneity of tumor-associated antigens and difficulty penetrating the tumor microenvironment, leading to relapses in some patients.

Method used

A combination therapy using an oncolytic virus vaccine that expresses tumor-associated antigens and immune cells with chimeric antigen receptors to target and destroy tumor cells, enhanced by the inclusion of cytokines to boost the immune response.

Benefits of technology

The method effectively targets and destroys tumor cells by guiding immune cells to the tumor site, enhancing the therapeutic effect beyond the capabilities of individual components, while maintaining safety for normal cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026509604000001_ABST
    Figure 2026509604000001_ABST
Patent Text Reader

Abstract

The present invention relates to a tumor therapy combining an oncolytic virus vaccine and immune cells in the field of biomedical technology. Specifically, it includes a step of treating a tumor by using immune cells and an oncolytic virus vaccine in combination, wherein the oncolytic virus vaccine contains recombinant oncolytic viruses that express tumor antigens and are intended to target tumor cells, and the immune cells are chimeric into antigen receptors that pair with the tumor antigens and are intended to kill or destroy the targeted tumor cells, and the recombinant oncolytic virus contains site-directed mutation M protein, G protein, N protein, P protein, and L protein. By using the oncolytic virus vaccine and immune cells that kill or destroy the tumor antigens, tumor cells are killed in a combined attack, the tumor antigens expressed by the oncolytic virus vaccine can not only guide immune cells to reach the center of the target tumor tissue, but the oncolytic virus, when used in combination with immune cells, kills tumor cells, achieving an effect greater than 1+1 = 2, and the tumor cell killing rate can reach up to 100%.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application relates to the biomedical technology field, and more specifically to a tumor therapy combining an oncolytic virus vaccine and immune cells. [Background technology]

[0002] Immunotherapy is expected to be a groundbreaking strategy for "curing" cancer. Chimeric antigen receptor T-cell immunotherapy (CAR-T) has achieved remarkable results in the treatment of various hematological malignancies. To date, seven CAR-T cell therapy products are marketed worldwide, three of which are sold in China.

[0003] While CAR-T cell therapy has been successful in treating hematological malignancies, it still has many limitations in treating solid tumors. The main factors contributing to these limitations are as follows:

[0004] (1) The heterogeneity of tumor-associated antigens in solid tumor cells results in a lack of antigenic targets for CAR-T cells to attack.

[0005] (2) CAR-T cells lack the ability to penetrate the microenvironment system of solid tumor tissue and ultimately reach the target tumor tissue.

[0006] Similarly, other immunotherapies, including but not limited to TCR-T cells, γδ-T cells, Crispered-T cells, STAR-T cells, CAR-NK cells, and CAR-M cells, as well as autologous cells, allogeneic cells, or iPSC-derived cells, are subject to the same two limitations as described above.

[0007] Furthermore, among patients who respond to treatment for hematological malignancies, a significant number still experience relapses after treatment. These patients lose the target of the CAR-T cell therapy they previously received, making it impossible to use the same target again for treatment. [Overview of the project] [Problems that the invention aims to solve]

[0008] This application provides a tumor therapy method that combines an oncolytic virus vaccine with immune cells to further improve the therapeutic effect of tumor cells. [Means for solving the problem]

[0009] Oncolytic viruses are tumor-killing viruses with replication capabilities and are now widely accepted as an important area of ​​tumor immunotherapy. Oncolytic viruses specifically target infected tumor cells, selectively infecting them, for example, by inactivating or deleting tumor suppressor genes in the tumor cells. After infecting the tumor cells, the oncolytic viruses replicate rapidly within the tumor cells, ultimately destroying the tumor cells and thus killing them. At the same time, oncolytic viruses can also attract more immune cells by providing the necessary immune stimulating signals to enhance the host's own anti-cancer response, thus continuing to kill the remaining tumor cells. Therefore, oncolytic viruses have the ability to disrupt the tumor tissue microenvironment and transform "cold tumors" into "hot tumors."

[0010] Simultaneously, oncolytic viruses express tumor-associated antigens in tumor cells to form an oncolytic virus vaccine. When this vaccine is used, not only can the oncolytic virus itself kill tumor cells, but it also disrupts the tumor tissue microenvironment and targets tumor cells (MARK) using the tumor-associated antigens expressed by the oncolytic virus, transforming "tumors that cannot be treated without tumor-associated antigen targets" into "tumors that have tumor-associated antigen targets and are treatable." By using the oncolytic virus vaccine and immune cells against the tumor-associated antigen targets, a combined attack kills tumor cells. The tumor antigens expressed by the oncolytic virus vaccine can guide immune cells to reach the center of the target tumor tissue, and the oncolytic virus, in combination with immune cells, kills tumor cells, achieving an effect greater than 1+1.

[0011] Furthermore, cytokines may be inserted into the oncolytic virus to improve therapeutic efficacy. The synergistic effect of the antitumor mechanisms of the oncolytic virus, cytokines, and immune cells results in a stronger antitumor effect.

[0012] The tumor therapy combining an oncolytic virus vaccine and immune cells provided in this application employs the following technical solutions.

[0013] A tumor treatment method combining an oncolytic virus vaccine and immune cells, wherein the tumor is treated by using immune cells and the oncolytic virus vaccine in combination, the oncolytic virus vaccine contains recombinant oncolytic viruses that express tumor antigens and are intended to target tumor cells, and the immune cells are chimeric into antigen receptors that pair with the tumor antigens and are intended to kill or destroy the targeted tumor cells.

[0014] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein.

[0015] Compared with the amino acid sequence shown in SEQ ID NO: 1, the site mutations of the M protein include M51R, V221F, S226R; or the site mutations of the M protein include N32S, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutations of the M protein include N32S, N49D, M51R, H54Y, knockout of the leucine-coding base at site 111, V221F, V225I, S226R; or the site mutations of the M protein include N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R; or the site mutations of the M protein include G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutations of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutations of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutations of the M protein include N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutations of the M protein include N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutations of the M protein include N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.

[0016] Compared with the amino acid sequence shown in SEQ ID NO: 12, the site mutations of the G protein include V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H.

[0017] Compared with the amino acid sequence shown in SEQ ID NO: 14, the site mutations of the N protein include I14V, R155K, S353N.

[0018] Compared with the amino acid sequence shown in SEQ ID NO: 16, the site mutations of the P protein include R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, N237D.

[0019] Compared with the amino acid sequence shown in SEQ ID NO: 18, the site mutations of the L protein include S87P, I487T.

[0020] In the present application, the M protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO: 1.

[0021] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 2.

[0022] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 3.

[0023] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 4.

[0024] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 5.

[0025] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 6.

[0026] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 7.

[0027] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 8.

[0028] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 9.

[0029] In one specific embodiment, the M protein includes the amino acid sequence shown in SEQ ID NO: 10.

[0030] In one specific embodiment, the M protein includes the amino acid sequence shown in SEQ ID NO: 11.

[0031] In this application, the G protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in Sequence ID No. 12.

[0032] In one specific embodiment, the G protein includes the amino acid sequence shown in SEQ ID NO: 13.

[0033] In this application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO: 14.

[0034] In one specific embodiment, the N protein includes the amino acid sequence shown in SEQ ID NO: 15.

[0035] In this application, the P protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in Sequence ID No. 16.

[0036] In one specific embodiment, the N protein includes the amino acid sequence shown in SEQ ID NO: 17.

[0037] In this application, the L protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in Sequence ID No. 18.

[0038] In one specific embodiment, the L protein includes the amino acid sequence shown in SEQ ID NO: 19.

[0039] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutation based on a baculovirus.

[0040] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutation based on Vesicular Stomatitis Virus (VSV virus).

[0041] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutation based on the VSV Indiana MuddSummer subtype.

[0042] Furthermore, the tumor antigen is selected from solid tumor antigens or hematopoietic tumor antigens.

[0043] Furthermore, the solid tumor antigens include 5T4, ROR1, EGFR, FcγRI (CD64), FcγRIIa (CD32a), FcγRIIb (CD32b), CD28, CD137 (4-1BB), CTLA-4, HER-2, FAS, FAP (fibroblast activating protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, glucocorticoid-inducible TNFR-related (GITR) protein, lymphotoxin-β receptor (LTβR), and tumor necrosis factor-associated apoptosis-inducing ligand receptor. 1 (TRAIL receptor 1), TRAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), human epidermal growth factor receptor 1 (EGFR1), EGFRvIII, ErbB3 (HER3), folate receptor, ephrin receptor, PDGFRa, ErbB-2, CD2, CD40, CD74, CD80, CD86, CCAM5 (CD66e), CCAM6 (CD66c), p53, cMet (tyrosine protein kinase Met), HGFR, MAGE-A1, MAGE -A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin (Myo statin)(GDF8), Cripto(TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, Annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα,This includes, but is not limited to, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, Neuropilin 1 (NRP-1), Phosphatidylinositol proteoglycans (glypican2 / 3, GPC2 / 3), EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL, Claude 18.2, MUC1, and TPBG.

[0044] Furthermore, the aforementioned hematopoietic tumor antigens are BCMA (TNFRSF17), CD4, CD5 (Leu-1), CD7, CD10, FcγRIIIa (CD16a), FcγRIIIb (CD16b), CD19, CD20 (MS4A1), CD22 (Siglec-2), CD23, CD30 (TNFRSF8), CD33 (Siglec-3), CD34, CD37, CD38, CD44, CD47, CD56 (NCAM1), CD70, C This list includes, but is not limited to, D117, CD123 (IL3RA), CD138 (SDC1), CD174, CLL-1, ROR1, NKG2DL1 / 2 (ULBP1 / 2), IL1R3 (IL-1-RAP), FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3 (CD229), SLAMF7 (CD319), TCR B-chain, ITGB7, k-1gG, TACI, TRBCI, LeY, and MUC1.

[0045] Furthermore, the tumor antigen is selected from one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, TPBG, AFP, and MAGE A10.

[0046] In one specific embodiment, the tumor antigen is CD19.

[0047] In one specific embodiment, the tumor antigen is CD22.

[0048] In one specific embodiment, the tumor antigen is BCMA.

[0049] In one specific embodiment, the tumor antigen is MUC-1.

[0050] In one specific embodiment, the tumor antigen is NY-ESO-1.

[0051] In one specific embodiment, the tumor antigen is MAGEA4.

[0052] In one specific embodiment, the tumor antigen is cMet.

[0053] In one specific embodiment, the tumor antigen is Claude 18.2.

[0054] In one specific embodiment, the tumor antigen is MSLN.

[0055] In one specific embodiment, the tumor antigen is EGFR.

[0056] In one specific embodiment, the tumor antigen is VEGFR2.

[0057] In one specific embodiment, the tumor antigen is HER-2.

[0058] In one specific embodiment, the tumor antigen CD19 includes the amino acid sequence shown in SEQ ID NO: 20.

[0059] In one specific embodiment, the tumor antigen CD22 includes the amino acid sequence shown in SEQ ID NO: 21.

[0060] In one specific embodiment, the tumor antigen BCMA includes the amino acid sequence shown in SEQ ID NO: 22.

[0061] In one specific embodiment, the tumor antigen MUC-1 includes the amino acid sequence shown in SEQ ID NO: 23.

[0062] In one specific embodiment, the tumor antigen NY-ESO-1 includes the amino acid sequence shown in SEQ ID NO: 24.

[0063] In one specific embodiment, the tumor antigen MAGEA4 includes the amino acid sequence shown in SEQ ID NO: 25.

[0064] In one specific embodiment, the tumor antigen cMet comprises the amino acid sequence shown in SEQ ID NO: 26.

[0065] In one specific embodiment, the tumor antigen Claude 18.2 includes the amino acid sequence shown in SEQ ID NO: 27.

[0066] In one specific embodiment, the tumor antigen MSLN includes the amino acid sequence shown in SEQ ID NO: 28.

[0067] In one specific embodiment, the tumor antigen EGFR comprises the amino acid sequence shown in SEQ ID NO: 29.

[0068] In one specific embodiment, the tumor antigen VEGFR2 includes the amino acid sequence shown in SEQ ID NO: 30.

[0069] In one specific embodiment, the tumor antigen HER-2 includes the amino acid sequence shown in SEQ ID NO: 31.

[0070] In one specific embodiment, the tumor antigen TPBG comprises the amino acid sequence shown in SEQ ID NO: 32.

[0071] Furthermore, the tumor antigen expressed by the recombinant oncolytic virus is at least one or more.

[0072] Furthermore, the immune cells are selected from T cells, NK cells, and M cells.

[0073] Furthermore, the immune cells are selected from CAR-T cells, TCR-T cells, CAR-γδ-T cells, CAR-Crispered-T cells, STAR-T cells, CAR-NK cells, and CAR-M cells.

[0074] Furthermore, the immune cells are selected from autologous cells, allogeneic cells, or iPSC-derived immune cells.

[0075] Furthermore, the immune cells include immune cells that have proliferated outside the body.

[0076] Furthermore, the number of antigen receptors expressed by the immune cells is at least one or more.

[0077] Furthermore, the recombinant oncolytic virus further contains cytokines encoded by exogenous genes.

[0078] Furthermore, the cytokines are selected from interleukins, interferons, tumor necrosis factor, colony-stimulating factor, transforming growth factor β, and the chemokine family.

[0079] Furthermore, the cytokines are selected from one or more of the following: GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β, and TNF-α.

[0080] Furthermore, the cytokine is selected from one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, and IFN-β.

[0081] In one specific embodiment, the cytokine is GM-CSF.

[0082] In one specific embodiment, the cytokine is IL-2.

[0083] In one specific embodiment, the cytokine is IL-12.

[0084] In one specific embodiment, the cytokine is IL-15.

[0085] In one specific embodiment, the cytokine is IL-18.

[0086] In one specific embodiment, the cytokine is TNF-α.

[0087] In one specific embodiment, the cytokine is IFN-β.

[0088] In one specific embodiment, the cytokine IL-12 includes the amino acid sequence shown in SEQ ID NO: 33.

[0089] In one specific embodiment, the cytokine IL-12 includes the amino acid sequence shown in SEQ ID NO: 34.

[0090] In one specific embodiment, the cytokine IL-15 includes the amino acid sequence shown in SEQ ID NO: 35.

[0091] In one specific embodiment, the cytokine IL-18 includes the amino acid sequence shown in SEQ ID NO: 36.

[0092] In some specific embodiments, the recombinant oncolytic virus comprises a nucleic acid molecule, the nucleic acid molecule comprising a nucleic acid sequence encoding the M protein having a site mutation, a nucleic acid sequence encoding the G protein having a site mutation, a nucleic acid sequence encoding the N protein having a site mutation, a nucleic acid sequence encoding the P protein having a site mutation, a nucleic acid sequence encoding the L protein having a site mutation, a nucleic acid sequence encoding the tumor antigen, and a nucleic acid sequence encoding the cytokine.

[0093] In one specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the tumor antigen is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having a site mutation.

[0094] In one specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation.

[0095] In one specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the tumor antigen and the nucleic acid sequence encoding the site-mutated L protein, or between the nucleic acid sequence encoding the site-mutated G protein and the nucleic acid sequence encoding the tumor antigen.

[0096] In some specific embodiments, the oncolytic virus vaccine combined with immune cells is used to continuously kill abnormally proliferating cells.

[0097] In some specific embodiments, the abnormally proliferating cells are selected from tumor cells or tumor tissue-associated cells.

[0098] In some specific embodiments, the tumor includes a solid tumor or a hematoma.

[0099] In some specific embodiments, the tumor is acute lymphoblastic leukemia, acute B-cell lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymal tumor, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensory neuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor. This includes, but is not limited to, hepatocellular carcinoma, hypopharyngeal carcinoma, Kaposi's sarcoma, renal carcinoma, Langhans cell proliferative disorder, pharyngeal carcinoma, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal carcinoma, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and hemangiomas.

[0100] This application further provides a composition comprising the oncolytic virus vaccine and immune cells described above. [Effects of the Invention]

[0101] In short, this application has the following beneficial effects.

[0102] The method for treating tumors by combining an oncolytic virus vaccine and immune cells provided in this application exhibits good in vitro killing ability against abnormally proliferating cells (tumor) LLC cells, but low in vitro killing ability against normal MEF cells. Therefore, the method for treating tumors by combining an oncolytic virus vaccine and immune cells provided in this application can be effectively used for infecting and killing tumor and cancer cells, and is not easily removed within tumor and cancer cells, further improving the cure rate of recombinant oncolytic viruses against tumor and cancer cells. At the same time, the method for treating tumors by combining an oncolytic virus vaccine and immune cells provided above does not damage normal cells, and recombinant oncolytic viruses are more easily removed when present within normal cells, further ensuring the safety of normal cells. [Brief explanation of the drawing]

[0103] [Figure 1] Figure 1 shows a method for treating tumors by combining oncolytic virus vaccines and immune cells provided in Preparation Examples 9-83 of this application, and the results of detecting the in vitro killing ability of wild-type oncolytic virus against LLC cells. [Figure 2] Figure 2 shows methods for treating tumors by combining oncolytic virus vaccines and immune cells provided in Preparation Examples 9-83 of this application, and the results of detecting the in vitro killing ability of wild-type oncolytic viruses against MEF cells. [Figure 3] Figure 3 shows the results of detecting the in vitro killing ability of the oncolytic virus vaccines provided in Preparation Examples 84-95, the immune cells provided in Preparation Examples 96-113, and the wild-type oncolytic virus against LLC cells. [Figure 4] These are the results of detecting the in vitro killing ability of the oncolytic virus vaccines provided in Preparation Examples 84-95 of this application, the immune cells provided in Preparation Examples 96-113, and the wild-type oncolytic virus against MEF cells. [Figure 5] Figure 5 shows the tumor cell killing rate of methods for treating tumors by combining oncolytic virus vaccines and immune cells, as provided in Preparation Examples 9-83 of this application. [Figure 6] Figure 6 shows the tumor cell killing rates of the oncolytic virus vaccines provided in Preparation Examples 84-95 and the immune cells provided in Preparation Examples 96-113 of this application.

[0104] In the attached figure above, number 0 on the horizontal axis represents wild-type oncolytic virus, and numbers 9 to 113 on the horizontal axis represent preparation examples 9 to 113, respectively.

[0105] Vertical axis OD 570 This represents the OD value of the cell, OD 570 The larger the value, the lower the killing ability of the recombinant oncolytic virus to the cells, indicating OD 570A smaller value indicates that the recombinant oncolytic virus has a better ability to kill the cells in question.

[0106] Those skilled in the art will readily understand other aspects and advantages of this application from the following detailed description. Only exemplary embodiments of this application are shown and described in the following detailed description. As those skilled in the art will understand, depending on the content of this application, those skilled in the art may modify the specific embodiments disclosed without departing from the spirit and scope of the invention. Correspondingly, the drawings and description of this application are illustrative and not limiting. [Modes for carrying out the invention]

[0107] The embodiments of the present invention will be described below with specific examples, but those skilled in the art will be able to easily understand the other advantages and effects of the present invention from the information disclosed herein. Term definition

[0108] In this application, the term “oncolytic virus” typically refers to a virus that can replicate in tumor cells and kill them. Oncolytic viruses include, but are not limited to, Vesicular Stomatitis Virus (abbreviated as “VSV virus”), poxvirus, herpes simplex virus (HSV), measles virus, Semryki Forest virus, poliovirus, reovirus, Seneca Valley virus (SVV), echotype enterovirus, coxsackievirus, Newcastle disease virus (NDV), and Malabar virus. In some embodiments, the oncolytic virus is modified to improve its selectivity for tumor cells. In some embodiments, the oncolytic virus is modified to reduce its immunogenicity.

[0109] In some embodiments, the VSV virus is a variant of the VSV virus Indiana MuddSummer subtype strain and can be used to treat tumors. Such viruses do not interact with endogenous IFN-β in normal cells and can selectively proliferate and grow only in tumor cells.

[0110] VSV viruses can express a variety of cell surface molecules, including low-density lipoprotein receptors, phosphatidylserine, salivary lipids (sialolipid), and heparan sulfate, which allow them to adhere to the cell surface. Compared to other oncolytic virus platforms currently under development, VSV viruses have the following advantages: (1) a small genome, short replication time, and fast transsynaptic rate; (2) very high exogenous gene expression, resulting in high titers and the possibility of large-scale production; and (3) an independent cell cycle, eliminating the risk of transformation within the host cell cytoplasm. Such oncolytic viruses do not integrate into DNA and, after detoxification, can avoid the development of neurological inflammation caused by wild-type viruses. Given these characteristics, VSV holds great potential in tumor immunotherapy.

[0111] In some embodiments, site-directed gene mutations may be performed on the M protein and / or G protein and / or N protein and / or P protein and / or L protein of the VSV virus.

[0112] In one embodiment, the recombinant oncolytic virus described in this application is genetically modified, for example, by modification of one or more genes, thereby improving its tumor selectivity and / or preferentially replicating in dividing cells. The genetically modified gene may be a modification of a gene involved in the processes of DNA / RNA replication, nucleic acid metabolism, host orientation, surface adhesion, toxicity, lysis, and diffusion, or it may be a modification that incorporates an exogenous gene. The exogenous gene may include an exogenous immunomodulatory gene, an exogenous screening gene, an exogenous reporter gene, etc. The modified oncolytic virus is an amino acid-level modified oncolytic virus, for example, by insertion, deletion, or substitution of one or more amino acids.

[0113] In this application, the term "M protein" usually refers to the VSV virus matrix protein. The M protein is an important toxic factor of the VSV virus and is also a protein known to interfere with the mouse innate immune response to the VSV virus. The term "M protein" further includes its homologs, orthologous forms, variations, functionally active fragments, etc. In this application, the M protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 1. In this application, the M protein of the oncolytic virus may include the amino acid sequences shown in SEQ ID NOs: 2 to 11.

[0114] In this application, the term "G protein" usually refers to the glycoprotein of the VSV virus, also known as the envelope protein. The term "G protein" further includes its homologs, orthologous forms, variations, functionally active fragments, etc. In this application, the G protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 12. In this application, the G protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 13.

[0115] In this application, the term “N protein” typically refers to the nucleocapsid protein of the VSV virus. The term “N protein” further includes its homologs, orthologous forms, variations, functionally active fragments, etc. In this application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 14. In this application, the N protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 15.

[0116] In this application, the term "P protein" generally refers to the phosphoprotein of the VSV virus. The term "P protein" further includes its homologs, orthologous forms, variations, functionally active fragments, etc. In this application, the P protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 16. In this application, the P protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 17.

[0117] In this application, the term “L protein” typically refers to the VSV virus RNA polymerase protein. The L gene of the VSV virus encodes the RNApoly E protein. The term “L protein” further includes its homologs, orthologous forms, variations, functionally active fragments, etc. In this application, the L protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 18. In this application, the L protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 19.

[0118] In this application, protein mutation sites are typically expressed as "amino acid + number of amino acid sites + mutated amino acid". In this application, such mutations include, but are not limited to, the addition, substitution, deletion, and / or deletion of amino acids. For example, the term "M51R" typically refers to a mutation from methionine M to arginine R at site 51.

[0119] In this application, the term "amino acid substitution" usually means replacing one amino acid residue present in a parent sequence with another amino acid residue. The amino acids in the parent sequence may be substituted, for example, by chemical synthesis or by recombination methods known to those skilled in the art. Therefore, "substitution at position xx" usually means replacing the amino acid present at position xx with an alternative amino acid residue. In this application, such amino acid substitution may include amino acid mutations.

[0120] In this application, the term "mutation" generally means altering the nucleotide or amino acid sequence of a wild-type molecule. Amino acid changes may include substitution, deletion, insertion, addition, cleavage, or modification or cutting of proteins.

[0121] In this application, the recombinant oncolytic virus performs site-directed mutagenesis on the M protein and / or G protein and / or N protein and / or P protein and / or L protein of the VSV virus, while simultaneously integrating a foreign gene. The foreign gene is specifically a gene encoding a tumor antigen and / or cytokine.

[0122] In this application, the term "antigen" refers to any substance that can trigger the production of antibodies or immune cells, and is capable of inducing an immune response in the body. That is, it is a substance that is specifically recognized and bound by antigen receptors (TCR / BCR) on the surface of T / B lymphocytes, activates T / B cells, causes them to proliferate and differentiate, generates immune response products (sensitized lymphocytes or antibodies), and can specifically bind to the corresponding products inside and outside the body. Therefore, antigenic substances have two important properties: immunogenicity and immunoreactivity. Immunogenicity refers to the ability of an antigen to induce a specific immune response in the body and produce antibodies and / or sensitized lymphocytes, while immunoreactivity refers to the ability to generate a specific binding reaction inside and outside the body with the corresponding immune effector substance (antibody or sensitized lymphocyte).

[0123] In one specific embodiment, the oncolytic virus is engineered to carry an antigen coding sequence that is recognizable by immune cells (e.g., CAR-T cells).

[0124] In some specific embodiments, the antigen is exogenous, meaning that the antigen originates from a different species.

[0125] In some specific embodiments, the antigen is an endogenous antigen. Specifically, the antigen is an antigen that is typically expressed in tumor cells.

[0126] In one specific embodiment, the antigen is a tumor-associated antigen (TAA) or a tumor-specific antigen (TSA).

[0127] In one specific embodiment, TAA or TSA covers molecules or a portion thereof that are presented on the cell surface (antigens recognized by CAR), within the cell membrane (antigens recognized by TCR), or in the tumor environment (e.g., in the tumor microenvironment).

[0128] In some specific embodiments, the cells are tumor cells.

[0129] In some specific embodiments, the TAA or TSA comprises a tumor-associated antigen or tumor-specific antigen on the cell surface or within the cell membrane.

[0130] In some specific embodiments, the cells are non-tumor cells present in the tumor environment. For example, they may be present in cells within vascular tissue associated with a tumor or cancer, but are not limited to these.

[0131] In some specific embodiments, TAA or TSA is an antigen generated by blood vessels in the tumor microenvironment.

[0132] In some specific embodiments, TAA or TSA is an antigen on the blood vessels in the tumor microenvironment.

[0133] In some specific embodiments, the cells are stromal cells present in the tumor environment.

[0134] In some specific embodiments, TAA or TSA is an stromal cell antigen in the tumor microenvironment.

[0135] In some specific embodiments, the TAA or TSA includes an extracellular epitope of a tumor cell surface antigen, an intracellular or extracellular tetramer of a tumor cell membrane, or other structures recognizable by antibodies or immune cells.

[0136] In some specific embodiments, TAA or TSA comprises an extracellular matrix antigen.

[0137] In some specific embodiments, TAA or TSA comprises antigens present in the tumor microenvironment (TME).

[0138] In some specific embodiments, TAA or TSA comprises molecules secreted to the TME by tumor cells.

[0139] In some specific embodiments, TAA or TSA comprises effector molecules secreted to the TME by tumor cells.

[0140] In some specific embodiments, TAA or TSA comprises an effector molecule secreted by tumor cells to the TME to downregulate or inhibit the activity of cytotoxic natural killer (NK) cells or T cells.

[0141] In some specific embodiments, TAA or TSA comprises a soluble activating receptor ligand that is secreted by tumor cells to the TME and inhibits the recognition of NK cells or T cells against tumor cells.

[0142] In some specific embodiments, examples of TAA or TSA include 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa, FcγRIIIb, CD28, CD137, CTLA-4, FAS, FAP (fibroblast activating protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, and glucocorticoid-induced TNFR-related (GI) TR) protein, lymphotoxin-β receptor (LTβR), Toll-like receptor (TLR), tumor necrosis factor-associated apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), human epidermal growth factor receptor 1 (EGFR1), EGFRvIII, human epidermal growth factor receptor 2 (Her2 / neu;Erb2, ErbB3 (Her3), folate receptor, ephrin receptor, PDGFRa, ErbB2, CD2, CD20, CD22, CD30, CD33, CD40, CD37, CD38, CD70, CD74, CD56, CD80, CD86, CD123, CCAM5, CCAM6, BCMA, p53, cMet (tyrosine protein kinase Met), hepatocyte growth factor receptor (HGFR), MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MA GE-A10, MAGE-A12, BAGE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, Wilms tumor antigen (WT1), TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC1, MU C2, P-cadherin, Myostatin (GDF8), Cripto (TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, WT1, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, Myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP This includes, but is not limited to, Annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin, DR5, PD-1, PD-L1, HER-2, IGF-1R, CXCR4, Neuropilin 1, Phosphatidylinositol Proteoglycan, EphA2, CD138, B7-H3, B7-H4, gpA33, GPC3, SSTR2, or VEGF-R2.

[0143] The exemplary immune cells to which this application applies include, but are not limited to, dendritic cells (including immature and mature dendritic cells), T lymphocytes (e.g., naive T cells, effector T cells, memory T cells, cytotoxic T lymphocytes, helper T cells, natural killer T cells, Treg cells, tumor-infiltrating lymphocytes (TILs), and lymphokine-activated killer (LAK) cells), B cells, natural killer (NK) cells, NKT cells, αβT cells, γδT cells, monocytes, macrophages, neutrophils, granulocytes, peripheral blood mononuclear cells (PBMCs), and combinations thereof. Immune cell subsets may be defined by the presence or absence of one or more cell surface labels known in the art (e.g., CD3, CD4, CD8, CD19, CD20, CD11c, CD123, CD56, CD34, CD14, CD33, etc.). If a pharmaceutical composition contains multiple engineered mammalian immune cells, these engineered mammalian immune cells may be a specific subset of immune cell types, a combination of subsets of immune cell types, or both, or a combination of more immune cell types.

[0144] NK cells are innate lymphocytes, the third type of lymphocyte after T cells and B cells, that nonspecifically kill tumor cells without pre-sensitization to antigens.

[0145] In adoptive NK cell therapy, the cells injected into the patient are healthy cytokine-activated NK cells. NK cells are collected through different pathways, such as peripheral blood NK cells, umbilical cord blood or placental-derived NK cells, and NK cells differentiated from induced pluripotent stem cells (IPSCs), and then injected after ex vivo enhancement to increase their tumor-killing capacity within the patient's body.

[0146] In genetically engineered NK cell therapy, the difference from adoptive NK cell therapy is that this treatment method employs injections of genetically modified NK cells (including CAR-NK cells) to achieve targeted killing and enhance their antitumor effect. Compared to CAR-T therapy, CAR-NK cells have advantages such as a lower risk of cytokine release syndrome. Building on the success of CAR-T, CAR-NK therapy is gaining popularity year by year, and researchers are developing innovative solutions to the challenges of CAR-NK therapy, such as difficulty in proliferating in vitro, low transfection efficiency, and poor cell persistence.

[0147] In some specific embodiments, the immune cells exist in a homogeneous cell population. In some specific embodiments, the immune cells exist in a heterogeneous cell population that can be enhanced with immune cells. In some specific embodiments, the immune cells are lymphocytes. In some specific embodiments, the immune cells are not lymphocytes. In some specific embodiments, the immune cells are applied to adoptive immunotherapy. In some specific embodiments, the immune cells are PBMCs. In some embodiments, the engineered immune cells are derived from PBMC immune cells. In some specific embodiments, the immune cells are T cells. In some specific embodiments, the immune cells are CD4+ T cells. In some specific embodiments, the immune cells are CD8+ T cells. In some specific embodiments, the immune cells are T cells expressing TCRα and TCRβ chains (i.e., αβT cells). In some specific embodiments, the immune cells are T cells expressing TCRγ and TCRδ chains (i.e., γδT cells). In some specific embodiments, the immune cells are γ9δ2T cells. In some specific embodiments, the immune cells are δ1 T cells. In some specific embodiments, the immune cells are δ3 T cells.

[0148] In some specific embodiments, the immune cell is a B cell. In some specific embodiments, the immune cell is an NK cell. In some specific embodiments, the immune cell is an NK-T cell. In some specific embodiments, the immune cell is a dendritic cell (DC). In some specific embodiments, the immune cell is a DC-activated T cell.

[0149] In some specific embodiments, the immune cells are derived from primary cells. In some specific embodiments, the immune cells are primary cells isolated from an individual. In some specific embodiments, the immune cells are proliferated (e.g., proliferated and / or differentiated) from primary cells isolated from an individual. In some specific embodiments, the primary cells are obtained from the thymus. In some specific embodiments, the primary cells are obtained from lymph or lymph nodes (e.g., tumor drainage lymph nodes). In some specific embodiments, the primary cells are obtained from the spleen. In some specific embodiments, the primary cells are obtained from bone marrow. In some specific embodiments, the primary cells are obtained from blood, e.g., peripheral blood. In some specific embodiments, the primary cells are peripheral blood mononuclear cells (PBMCs). In some specific embodiments, the primary cells are derived from plasma. In some specific embodiments, the primary cells are derived from a tumor. In some specific embodiments, the primary cells are obtained from the mucosal immune system. In some specific embodiments, the primary cells are obtained from a biopsy sample.

[0150] In some specific embodiments, the immune cells are derived from a cell line. In some specific embodiments, the immune cells are obtained from a commercially available cell line. In some specific embodiments, the immune cells are grown (e.g., grown and / or differentiated) from a cell line established from primary cells isolated from an individual. In some specific embodiments, the cell line is a mortal cell line. In some specific embodiments, the cell line is an immortalized cell line. In some specific embodiments, the cell line is a tumor cell line, e.g., a leukemia or lymphoma cell line. In some specific embodiments, the cell line is a cell line derived from PBMCs. In some specific embodiments, the cell line is a stem cell line. In some specific embodiments, the cell line is NK-92. In some specific embodiments, the engineered immune cells are derived from stem cells. In some specific embodiments, the stem cells are embryonic stem cells (ESCs). In some specific embodiments, the stem cells are hematopoietic stem cells (HSCs). In some specific embodiments, the stem cells are mesenchymal stem cells. In some embodiments, the stem cells are induced pluripotent stem cells (IPSCs).

[0151] In this application, the term "cytokines" refers to physiologically active substances synthesized and secreted by immune cells (lymphocytes, monocytes, macrophages, etc.) and their related cells (vascular endothelial cells, fibroblasts, etc.) that regulate the function of other immune cells or target cells, and belong to the category of small molecule peptides or glycoproteins. All cytokines with immunomodulatory effects can be expressed by recombinant oncolytic viruses. Depending on their main function, cytokines are classified into interleukins (IL), interferons (IFN), tumor necrosis factor (TNF), colony-stimulating factor (CSF), transforming growth factor-β family (TGF-β family), growth factors (GF), and chemokine family.

[0152] Interleukins include IL-1, IL-2, IL-7, IL-9, IL-15, IL-21, IL-4, IL-12, IL-18.

[0153] Specifically, regarding interleukin-1 (IL-1), IL-1 is a pleiotropic cytokine involved in cortical inflammatory responses, cell growth, and tissue repair. The IL-1 superfamily has 11 members, such as IL-1A, IL-1B, IL-1Ra, and IL-18. IL-1 is a drug target for some cancers and is also used in cell therapy. In cellular immunotherapy, IL-1 stimulates the proliferation of CD4+ T cells in vitro, induces the production of IL-2, and simultaneously stimulates the activation of CD8+ / IL1R+ T cells, thereby stimulating the proliferation of mature B cells and the secretion of immunoglobulin proteins.

[0154] Specifically, regarding interleukin-2 (IL-2), also known as T cell growth factor, it is produced when T cells respond to antigens or are stimulated to promote cell division, and is widely used to promote the activation and proliferation of T cells and NK cells. IL-2 stimulates the proliferation of NK cells, increases their cytotoxicity, and enables NK cells to secrete various cytokines. However, further research has shown that IL-2 causes overdifferentiation of T cells, induces apoptosis of activated T cells, and activates CD4+FoxP3 Treg regulatory cells, thereby inhibiting T cell activation and tumor-killing activity. Therefore, IL-2 is considered to be a T cell regulator rather than simply an activator, and some studies use IL-7, IL-15, or IL-21 instead of IL-2.

[0155] Specifically, regarding interleukin-7 (IL-7), IL-7 is a hematopoietic growth factor secreted by matrix cells in the bone marrow and thymus. It shares a γc receptor subunit with IL-2 and stimulates the proliferation of lymphocyte progenitor cells. IL-7 provides continuous stimulating signals to naive T cells and memory T cells. As mentioned above, IL-7 does not activate CD4+FoxP3+Treg cells during CD8+ T cell activation. Clinically, IL-7 can also be used to restore T cell counts after chemotherapy or hematopoietic stem cell transplantation. Furthermore, IL-7 can play a major role in influencing the proliferation of B cells at a certain stage of maturation. IL-7 may also act as a regulator of intestinal mucosal lymphocytes.

[0156] Specifically, regarding interleukin-15 (IL-15), IL-15 has a structure similar to IL-2, shares a γc receptor subunit, and possesses four α-helix bundle families (the others being, for example, IL-2, IL-4, IL-7, IL-9, G-CSF, and GM-CSF). IL-15 regulates the activation and proliferation of T cells and NK cells. IL-15 is primarily responsible for killing viral infections in the innate immune system. At the same time, IL-15 can activate NKT cells and γδT cells. In immunotherapy, IL-15 induces apoptosis of activated T cells and does not activate CD8+ effector T cells. IL-15 plays an important role in long-term antitumor activity by maintaining the survival of memory T cells.

[0157] Specifically, regarding interleukin-21 (IL-21), IL-21 also belongs to the IL-2 family, shares a γc receptor subunit, and exerts a very strong regulatory effect on immune system cells, inducing cell division and proliferation in its target cells. In cellular immunotherapy, IL-21 promotes the proliferation of CD4+ and CD8+ T cells, enhances the cytotoxicity of CD8+ T cells and NK cells, and does not cause apoptosis of cells through activation. IL-21 preferentially proliferates "young" CD27+CD28+ CD8+ T cells, and such cells exhibit stronger cytotoxicity. Of course, since IL-21 does not cause Treg proliferation, its application in cellular immunotherapy is becoming increasingly widespread.

[0158] Specifically, regarding interleukin-4 (IL-4), IL-4 activates the proliferation of activated B and T cells and regulates the expression of Fc receptors in lymphocytes and monocytes. IL-4 induces Th1 cells to transform into Th2 cells. IL-4 stimulates Th2 cells to secrete IL-4, IL-5, IL-6, IL-10, and IL-13. IL-4 guides monocytes to differentiate towards dendritic cells by inhibiting macrophage growth. In the absence of additional IL-4 in the culture system, monocytes differentiate into macrophages. IL-4 plays an important role in humoral and adaptive immunity, converting B cell antibody classes to IgE and upregulating the production of MHC class II molecules. When both IL-4 and GM-CSF act, they can selectively differentiate monocytes into immature dendritic cells (DCs). These DCs have strong antigen uptake and processing capabilities but weak antigen presentation capabilities. By sequentially using IL-4 and TNF-α, the maturation of DCs can be promoted.

[0159] Specifically, regarding interleukin-12 (IL-12), IL-12 acts on activated T and NK cells, possesses broad physiological activity, and acts on lymphocytes through the activator of the transcription protein STAT4. IL-12 is necessary for T cell-independent induction of IFN-γ and plays an important role in the differentiation of Th1 and Th2 cells. IL-12B binds with IL-23A to form IL-23 interleukin, which has adaptive immune function. IL-12 is a drug target. In cellular immunotherapy, IL-12 promotes the differentiation of CD4+ T cells into CD4+ Th1 T cells and enhances CD8+ CTL cell activity. The therapeutic effect of IL-12 is related to its dosage, duration of action, and other cytokines that interact with it, and it promotes the tumor-killing activity of immune cells through various mechanisms. In a mouse anti-melanoma model, high doses of IL-12 exert their effects via NK cells, while low doses of IL-12 exert their tumor-killing effects via NKT cells.

[0160] Specifically, regarding interleukin-18 (IL-18), also known as interferon-γ inducer, it belongs to the pro-inflammatory cytokines and is produced by macrophages and other cells. IL-18 can promote the secretion of IFN-γ by NK cells and CD8+ T cells, thereby enhancing the cytotoxic effects of NK cells and CD8+ T cells. IL-18 can also activate macrophages, promote the development of Th1 CD4+ T cells, and encourage lymphocytes to express functions such as FasL. IL-18 offers a potential therapeutic target for allergic diseases. Furthermore, IL-18, IL-12, and IL-15, when acting synergistically, can maintain the Th1 response and monokine production in their own immune diseases.

[0161] Gamma interferons are type II interferons, primarily produced by NK and NKT cells, possessing antiviral, antitumor, and immunomodulatory effects, and include IFN-γ and IFN-β. IFN-γ has an antiproliferative effect on transformed cells and can enhance the antiviral and antitumor effects of type I interferons. IFN-γ induces the expression of MHC I, MHC II, and co-activating molecules in antigen-presenting cells (APCs) by activating macrophages. Furthermore, IFN-γ can enhance antigen-presenting ability by inducing changes in protein enzyme expression. IFN-γ can also promote the differentiation of CD4+ T cells into Th1 cells and inhibit subtype switching of IL-4-dependent B cells. IFN-γ activates the JAK-STAT cell pathway through phosphorylation of JAK1 and JAK2 proteins. In cellular immunotherapy, IFN-γ acts on host immune cells, exhibiting certain effects on macrophages, T cells, B cells, and NK cells. IFN-γ enhances antigen presentation ability by promoting the expression of MHC class II molecules in macrophages or by inducing MHC class II expression in cells that normally do not express MHC class II molecules (e.g., vascular endothelial cells, certain epithelial cells, and connective tissue cells). IFN-γ can promote the differentiation of B cells and CD8+ T cells, but not their proliferation. IFN-γ can enhance the activity and immune function of TH1 cells. IFN-γ can enhance neutrophil phagocytosis, activate NK cells, and enhance their cytotoxic activity. Abnormal IFN-γ expression is associated with many autoinflammatory and autoimmune diseases.

[0162] Tumor necrosis factor (TNF-α) belongs to the TNF superfamily of cytokines and is a multifunctional molecule that regulates biological processes, including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. TNF-α is involved in antitumor activity. In cellular immunotherapy, TNF-α differentiates immature dendritic cells (DCs) into mature DCs. This process is achieved by TNF-α downregulating macropinocytosis and surface Fc receptor expression in immature DCs, while upregulating the expression of cell surface MHC class I, class II molecules, and B7 family molecules (CD80, CD86, etc.). Mature DCs have significantly reduced uptake and processing capabilities, but significantly increased antigen-presenting capabilities, and can strongly activate T cells. TNF-α can influence the production of other cytokines, for example, by stimulating monocytes and macrophages to secrete IL-1, enhancing the proliferative capacity of IL-2-dependent thymocytes and T cells, promoting the production of lymphokines such as IL-2, CSF, and IFN-γ, and enhancing the stimulation of B cell proliferation and Ig secretion by mitogens or exogenous antigens.

[0163] Granule cell macrophage colony-stimulating factor (GM-CSF) plays a crucial role in embryo transfer and development. GM-CSF was one of the first cytokines discovered to act on dendritic cells (DCs). In DC culture, GM-CSF promotes the differentiation of monocytes into macrophage-like cells, enhances the expression of cell surface MHC class II molecules, and strengthens the antigen-presenting function of cells. GM-CSF can also promote DC survival. In cellular immunotherapy, GM-CSF can activate immune responses and generate antitumor activity through the activation of macrophages and DCs. Regarding antigen presentation, GM-CSF can promote the maturation of DC cells, upregulate costimulatory molecules, and promote CD1d receptor expression. Recent research has shown that GM-CSF stimulates hematopoietic progenitor cells to differentiate into monocytes and neutrophils, reducing the risk of febrile neutropenia in cancer patients. Other studies have shown that GM-CSF induces differentiation of bone marrow dendritic cells, promotes Th1 cell bias towards immune responses, stimulates angiogenesis, and influences the development of allergic inflammation and autoimmune diseases. Therefore, GM-CSF is clinically used in the treatment of malignancies.

[0164] In this application, the term “nucleic acid molecule” usually means a nucleotide of any length. In this application, the term “nucleic acid molecule” can encode a protein contained in the oncolytic virus. In this application, the nucleic acid molecule may include DNA and / or RNA. In some cases, the RNA may include single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA), and the single-stranded RNA may include sense RNA, antisense RNA, or ambisense RNA.

[0165] In this application, the term “prevention” usually means preventing the onset, development, recurrence, and / or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In this application, the term “treatment” usually means eliminating or improving a disease or one or more symptoms associated with a disease. In some embodiments, treatment usually means eliminating or relieving a disease by administering one or more drugs to a patient suffering from the disease. In some embodiments, “treatment” may be the pharmaceutical composition and / or drug product administered after the onset of symptoms of a particular disease, with or without the presence of other drugs. For example, the pharmaceutical composition and / or drug product described in this application may be used to prevent the onset, development, recurrence, and / or progression of a tumor.

[0166] In this application, the term “tumor” generally means any new growth of pathological tissue. Tumors can be benign or malignant. In this application, such tumors may be solid tumors and / or hematopoietic tumors. For research purposes, these tissues can be isolated from readily available sources by methods well known to those skilled in the art.

[0167] In some specific embodiments, the tumor is acute lymphoblastic leukemia, acute B lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, breast cancer (BRCA), cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymal tumor, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensory neuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoma This includes, but is not limited to, tumors such as hepatocellular carcinoma, hypopharyngeal carcinoma, Kaposi's sarcoma, renal carcinoma, Langhans cell proliferative disorder, pharyngeal carcinoma, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal carcinoma, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and hemangiomas. Details of the invention

[0168] The wild-type VSV virus is specifically the VSV virus Indiana strain and the VSV virus Indiana MuddSummer subtype strain. The amino acid sequence of its M protein is shown in SEQ ID NO: 1, the amino acid sequence of its G protein is shown in SEQ ID NO: 12, the amino acid sequence of its N protein is shown in SEQ ID NO: 14, the amino acid sequence of its P protein is shown in SEQ ID NO: 16, and the amino acid sequence of its L protein is shown in SEQ ID NO: 18. In this application, the M protein, G protein, N protein, P protein, and L protein can all be modified.

[0169] A recombinant oncolytic virus, said oncolytic virus is obtained by mutating the amino acid sequences of the M protein, G protein, N protein, P protein, and L protein of the wild-type VSV virus described above.

[0170] 1. This application provides a tumor therapy combining an oncolytic virus vaccine and immune cells, and specifically includes the following:

[0171] The tumor is treated using a combination of immune cells and oncolytic virus vaccines.

[0172] Oncolytic virus vaccines contain recombinant oncolytic viruses that express tumor antigens and are designed to target tumor cells (MARK). These recombinant oncolytic viruses not only kill tumor cells themselves but can also target tumor cells, thereby transforming "untreated and untargeted tumors" into "targeted and treatable tumors."

[0173] Immune cells chimerize with antigen receptors that pair with the tumor antigen, killing or destroying targeted tumor cells, and supplying and killing tumor cells targeted by the oncolytic virus vaccine, thereby achieving an effect where 1+1 is greater than 2.

[0174] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein.

[0175] Compared to the amino acid sequence shown in Sequence ID No. 1, the site mutations of the M protein include M51R, V221F, S226R, or the site mutations of the M protein include N32S, N49D, M51R, H54Y, V221F, V225I, S226R, or the site mutations of the M protein include N32S, N49D, M51R, H54Y, and the leucine codec at site 111. The knockout of the ing base includes V221F, V225I, S226R, or the site mutation of the M protein includes N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R, or the site mutation of the M protein includes G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R, or the M The site mutations of the protein include G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R, or the site mutations of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R, or the site mutations of the M protein include N32S, M33A, N4 The site mutations of the M protein include 9D, M51R, H54Y, V221F, V225I, and S226R, or the site mutations of the M protein include N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R, or the site mutations of the M protein include N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R.

[0176] Compared to the amino acid sequence shown in Sequence ID No. 12, the site variations of the G protein include V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0177] Compared to the amino acid sequence shown in Sequence ID No. 14, the site mutations in the N protein include I14V, R155K, and S353N.

[0178] Compared to the amino acid sequence shown in Sequence ID No. 16, the site mutations of the P protein include R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0179] Compared to the amino acid sequence shown in Sequence ID No. 18, the site mutations in the L protein include S87P and I487T.

[0180] Furthermore, the recombinant oncolytic virus is obtained by introducing an exogenous gene encoding a tumor antigen into the recombinant oncolytic virus.

[0181] Furthermore, the tumor antigen is selected from blood cancer antigens and solid tumor antigens.

[0182] Furthermore, the tumor antigen is selected from one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGEA4, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, and HER-2.

[0183] Furthermore, the immune cells are selected from T cells, NK cells, and M cells.

[0184] Furthermore, the immune cells are selected from CAR-T cells, TCR-T cells, CAR-γδ-T cells, CAR-Crispered-T cells, STAR-T cells, CAR-NK cells, and CAR-M cells.

[0185] Furthermore, the recombinant oncolytic virus further contains cytokines encoded by exogenous genes.

[0186] Furthermore, the cytokines are selected from interleukins, interferons, tumor necrosis factor, colony-stimulating factor, transforming growth factor β, chemokine family, and growth factors.

[0187] Furthermore, the cytokine is selected from one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, and IFN-β.

[0188] The recombinant oncolytic virus comprises a nucleic acid molecule, the nucleic acid molecule comprising a nucleic acid sequence encoding the M protein having a site mutation, a nucleic acid sequence encoding the G protein having a site mutation, a nucleic acid sequence encoding the N protein having a site mutation, a nucleic acid sequence encoding the P protein having a site mutation, a nucleic acid sequence encoding the L protein having a site mutation, a nucleic acid sequence encoding the tumor antigen, and a nucleic acid sequence encoding the cytokine.

[0189] In this application, recombinant oncolytic viruses described herein can be obtained by a viral packaging process and a viral rescue process. A specific process may include infecting and inoculating BSR-T7 cells with poxvirus vTF7-3 expressing T7 RNA polymerase, and performing lipofectamine transfection using expression plasmids and backbone plasmids that clone the VSV N, VSV P, and VSV L genes, respectively, to obtain the target oncolytic virus.

[0190] This application provides a composition comprising the above-mentioned recombinant oncolytic virus and immune cells.

[0191] In some embodiments, the composition may comprise one or more suitable formulations of pharmaceutically effective adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, and / or preservatives. The acceptable components of the composition are preferably non-toxic to subjects at the doses and concentrations used. The compositions of this application include, but are not limited to, liquid, cryogenic, and lyophilized compositions.

[0192] In one embodiment, the pharmaceutically acceptable carrier comprises any and all solvents, dispersions, coatings, isotonic agents, and absorption retarders suitable for drug administration, and is generally safe and non-toxic.

[0193] In some embodiments, the composition comprises a pharmaceutical product for parenteral, transdermal, intraluminal, intra-arterial, intravenous, subarachnoid and / or intranasal administration or direct injection into tissue. For example, the composition may be administered to a patient or subject by infusion or injection. In some embodiments, the composition may be administered by different means, such as intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal or intratissue administration. In some embodiments, the composition may be administered without interruption. Such uninterrupted (or continuous) administration may be achieved by measuring the flow of the therapeutic agent into the patient's body using a small pump system worn by the patient, as described in International Publication No. 2015 / 036583.

[0194] This application further provides uses of the above composition in the preparation of agents for preventing and / or treating diseases and / or illnesses.

[0195] In the method for treating tumors by combining an oncolytic virus vaccine and immune cells provided in this application, the recombinant oncolytic virus in the oncolytic virus vaccine undergoes site-directed mutagenesis of amino acids in the M, G, N, P, and L proteins of the oncolytic virus, and simultaneously inserts into tumor antigens and / or cytokines encoded by foreign genes. At the same time, antigen receptors that kill or injure tumor cells are chimerically formed on immune cells, thereby further enhancing the infectivity of the oncolytic virus against abnormally proliferating (tumor) LLC cells. Simultaneously, the prepared recombinant oncolytic viruses all have low infectivity to normal cells (normal MEF cells), indicating that the recombinant oncolytic viruses prepared in this application can be effectively used to infect tumor and cancer cells while simultaneously having broad application potential without damaging normal cells.

[0196] In this application, recombinant oncolytic viruses in oncolytic virus vaccines are not readily removed in abnormally proliferating (tumor) LLC cells. Relatively speaking, wild-type oncolytic viruses are even more readily removed in LLC sporangia. The recombinant oncolytic viruses provided in this application undergo site-directed mutations in the amino acids of the M, G, N, P, and L proteins of the oncolytic virus, and simultaneously insert antigens and / or cytokines encoded by exogenous genes, making the oncolytic viruses even more difficult to remove in LLC cells, 4T1 cells, MC38 cells, and HeLa sporangia, further ensuring that the oncolytic viruses exert their infective and killing capabilities in LLC cells, 4T1 cells, MC38 cells, and HeLa sporangia, while simultaneously making the recombinant oncolytic viruses provided in this application even more readily removed in normal MEF sporangia, further ensuring the safety of normal MEF cells, and thus improving the safety of the oncolytic viruses.

[0197] The present application will be described in more detail below with reference to Preparation Examples 1 to 113 and the Examples. Preparation example Preparation Examples 1-8 Preparation Example 1

[0198] Preparation Example 1 provides a method for constructing CAR-T cells. Specifically, it includes the following steps.

[0199] (1) Production of retrovirus for CAR expression

[0200] A CD19-CAR sequence is constructed, the constructed CD19-CAR sequence is inserted into a lentiviral system, and each plasmid is transfected into PhoenixECO cell line (ATCC) using lipofectamin 3000 (Invitrogen). The culture supernatant containing the ecotropic retrovirus secreted for 24-48 hours is added to the PG13 retroviral packaging cell line (ATCC) and spin infection (2500 rpm, 90 min) is performed.

[0201] The culture supernatant of the PG13 retrovirus-producing cell line prepared by the above method is harvested and filtered (through a 0.45 μm filter) to remove residual cell particles. After concentrating four times using a centrifugal filtration device (Millipore Amicon 100KD cut-off), the CD19-CAR retrovirus is obtained and used as a retrovirus concentrate for CAR-T cell construction.

[0202] (2) Preparation of CAR-T cells

[0203] White cells obtained by leukapheresis from normal human cells were added to a 24-well plate coated with anti-CD3 antibody (OKT3, 10 μg / ml, BioXcell) along with anti-CD28 antibody (CD28.2, 2 μg / ml, BD Biosciences), and cultured for 48 hours to activate T cells. After washing the activated T cells twice, they were used for retroviral transduction.

[0204] After coating the wells overnight with fibronectin (20 μg / ml, TaKaRa) at 4°C, 2% BSA-DPBS was added to the washed 24-well plate, and the plate was blocked at 37°C for 30 minutes. After washing, 1 ml of retrovirus concentrate was added, and the plate was centrifuged at 2000 × g and 32°C for 2 hours to allow the retrovirus to adhere to the bottom of the wells. After removing the retrovirus concentrate and washing the wells, 1 ml of activated T cells (1 × 10⁶) were added. 6 Add cells / ml to the wells and centrifuge for 10 minutes (1000×g, 32℃) to allow the cells to attach to the retrovirus.

[0205] Then, the cells are cultured for 48 hours in the presence of human IL-2 (300 IU / ml, Proleukin, Novartis). In this way, the retrovirus-transmitted T cells are washed twice, then added to a fresh culture medium containing human IL-2 (200 IU / ml) and grown for 3-6 days to be used as CAR-T cells.

[0206] To assess the expression of CAR proteins on the cell surface, CAR-T cells that have been transmitted by retrovirus and proliferated for 3 days are stained with CD19-Ck protein (a fusion protein of the extracellular domain of CD19 and the constant domain of the human immunoglobulin κ chain (Ck)) and APC-labeled anti-Ck antibody (anti-Ck-APC, BioLegend), and then detected by flow cytometry (FACS-Calibur, BDBiosciences).

[0207] As can be seen from the detection results, the construction of CD19-CAR-T cells was successful. Here, CD19 CAR-T cells (3 rd The amino acid sequence of generation is shown in SEQ ID NO: 66.

[0208] According to the construction method described in Preparation Example 1, other types of tumor antigen-CAR-T cells can be obtained by using other types of tumor antigens instead of CD19. The types of tumor antigens may be CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, TPBG, AFP, etc. In addition to the difference in the CARs loaded onto the T cells, those skilled in the art can construct and detect successful construction using the same method.

[0209] If the tumor antigens are CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, and TPBG, then CD22-CAR-T cells, BCMA-CAR-T cells, MUC-1-CAR-T cells, cMet-CAR-T cells, Claude 18.2-CAR-T cells, MSLN-CAR-T cells, EGFR-CAR-T cells, VEGFR2-CAR-T cells, HER-2-CAR-T cells, TPBG-CAR-T cells, and AFP-CAR-T cells, respectively, are obtained.

[0210] In one specific embodiment, the amino acid sequence of the antigen receptor CD19 paired with the tumor antigen is shown in SEQ ID NO: 37.

[0211] In one specific embodiment, the antigen receptor CD22 that pairs with the tumor antigen has the amino acid sequence of its heavy chain variable region shown in SEQ ID NO: 38, and the amino acid sequence of its light chain variable region shown in SEQ ID NO: 39.

[0212] In one specific embodiment, the antigen receptor BCMA that pairs with the tumor antigen has the amino acid sequence of its heavy chain variable region shown in SEQ ID NO: 40, and the amino acid sequence of its light chain variable region shown in SEQ ID NO: 41.

[0213] In one specific embodiment, the antigen receptor cMet that pairs with the tumor antigen has the amino acid sequence of its heavy chain variable region shown in SEQ ID NO: 42, and the amino acid sequence of its light chain variable region shown in SEQ ID NO: 43.

[0214] In one specific embodiment, the antigen receptor Claude 18.2, which pairs with the tumor antigen, has the amino acid sequence of its heavy chain variable region shown in SEQ ID NO: 44, and the amino acid sequence of its light chain variable region shown in SEQ ID NO: 45.

[0215] In one specific embodiment, the antigen receptor MSLN paired with the tumor antigen has the amino acid sequence of its heavy chain variable region shown in SEQ ID NO: 46, and the amino acid sequence of its light chain variable region shown in SEQ ID NO: 47.

[0216] In one specific embodiment, the antigen receptor EGFR that pairs with the tumor antigen has the amino acid sequence of its heavy chain variable region shown in SEQ ID NO: 48, and the amino acid sequence of its light chain variable region shown in SEQ ID NO: 49.

[0217] In one specific embodiment, the antigen receptor VEGFR2 that pairs with the tumor antigen has the amino acid sequence of its heavy chain variable region shown in SEQ ID NO: 50, and the amino acid sequence of its light chain variable region shown in SEQ ID NO: 51.

[0218] In one specific embodiment, the antigen receptor HER-2, which pairs with the tumor antigen, has the amino acid sequence of its heavy chain variable region shown in SEQ ID NO: 52, and the amino acid sequence of its light chain variable region shown in SEQ ID NO: 53.

[0219] In one specific embodiment, the antigen receptor TPBG paired with the tumor antigen has the amino acid sequence of its heavy chain variable region shown in SEQ ID NO: 54, and the amino acid sequence of its light chain variable region shown in SEQ ID NO: 55.

[0220] In one specific embodiment, the antigen receptor AFP paired with the tumor antigen has the amino acid sequence of its heavy chain variable region shown in SEQ ID NO: 56, and the amino acid sequence of its light chain variable region shown in SEQ ID NO: 57.

[0221] In one specific embodiment, the antigen receptor PD-L1 paired with the tumor antigen has the amino acid sequence shown in SEQ ID NO: 72, and PD-L1 CAR-T cells (3 rd The amino acid sequence of generation 73 is shown. Preparation Example 2

[0222] Preparation Example 2 provides a method for constructing TCR-T cells. Specifically, it includes the following steps.

[0223] (1) Cloning and sequencing of specific T cells

[0224] Genotype-specific peripheral blood mononuclear cells (PBMCs) are stimulated in vitro using chemically synthesized tumor-specific short-chain peptides or specific antigens (NY-ESO-1). After repeating peptide stimulation twice, polyclonal T cells are stimulated with tumor-specific short-chain peptides or specific antigens and co-cultured overnight at 37°C. Target T cells positive for T cell activation markers are then selected using flow cytometry.

[0225] Selected T cells (1 × 10) 6 After the supernatant is removed by centrifugation, the sample is resuspended in 1 mL of Trizol (RNeasy Plusuniversal Mini Kit, QIAGEN), rapidly frozen in liquid nitrogen, and then sent to a CRO for sequencing (immunorepertory sequencing).

[0226] Based on the sequencing results, the TCRα and TCRβ chains are paired, and the PCR construct includes the full-length TCR of the constant region (schematic diagram of TCR sequence elements: TCRα variable region - TCRα, constant region - P2A - TCRβ, variable region - TCRβ constant region), which is then inserted into a retroviral vector.

[0227] (2) Preparation of specific TCR-T cells

[0228] Target T cells are transferred to the retroviral vector pMSGV1 (addgene) to construct the pMSGV1-TCR vector. Viral packaging cell line 293GP cells are transfected with pMSGV1-TCR and pVSV-G plasmid to prepare retroviruses, which are then transmitted to T cells using the viral supernatant.

[0229] The transfection procedure is as follows: On day 0, 293GP cells are placed in a 6-well plate (6 × 10⁶). 5 Inoculated into a well, 293GP cells were transfected with pMSGV1-TCR and pVSV-G plasmids on day 1 (2 μg pMSGV1-TCR and 1.4 μg pVSV-G / well). On the same day, healthy human PBMCs were activated using anti-human CD3 antibody (OKT3). On day 3, the culture medium containing the viral supernatant was collected, fresh culture medium (DMEM containing 10% fetal bovine serum) was added to the 293GP cells, and the activated T cells were transfected by centrifugation using the collected viral supernatant. On day 4, the activated T cells were transfected a second time using the same method, and on day 5, the transfected T cells were collected in a T25 culture flask and cultured (the culture medium was X-VIVO (Lonza) containing 10% fetal bovine serum and 300 IU / mL IL2). On day 10, the expression level of the target TCR is detected by flow cytometry, and the expression rate of the TCRβ chain constant region (TRBC) is detected using an antibody to determine the TCR-T cell positivity rate.

[0230] As the detection results show, the construction of NY-ESO-1 TCR-T cells was successful.

[0231] According to the construction method described in Preparation Example 2, other types of tumor antigen-TCR-T cells can be obtained by using other types of tumor antigens instead of NY-ESO-1. The types of tumor antigens may include MAGE A4, AFP, MAGE-A10, MAGE-1, MAGE-B2, MAGE-3, MAGE-6, BAGE, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7b, SAGE, HAGE, SSX, SCP1, LAGE, and melanoma differentiation antigens (including Melan-A, Mart-1, gp100, gp75, TRP21, TRP22, etc.). Aside from the difference in the TCRs mounted on the T cells, those skilled in the art can construct and detect successful construction in the same manner.

[0232] If the tumor antigens are MAGE A4, AFP, MAGE-A10, MAGE-1, MAGE-2, MAGE-3, MAGE-6, BAGE, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7b, SAGE, HAGE, SSX, SCP1, LAGE, and melanoma differentiation antigens (including Melan-A, Mart-1, gp100, gp75, TRP21, TRP22), then MAGE A4 TCR-T cells, AFP-1 TCR-T cells, MAGE-A10 TCR-T cells, MAGE-1 TCR-T cells, MAGE-2 TCR-T cells, MAGE-3 TCR-T cells, MAGE-6 TCR-T cells, and BAGE TCR-T cells, GAGE-1TCR-T cells, GAGE-2TCR-T cells, GAGE-8TCR-T cells, GAGE-3TCR-T cells, GAGE-4TCR-T cells, GAGE-5TCR-T cells, GAGE-6TCR-T cells, GAGE-7b TCR-T cells, SAGE TCR-T cells, HAGE TCR-T cells, SSX Obtain TCR-T cells, SCP1TCR-T cells, LAGE TCR-T cells, Melan-ATCR-T cells, Mart-1 TCR-T cells, gp100 TCR-T cells, gp75 TCR-T cells, TRP21 TCR-T cells, and TRP22 TCR-T cells, respectively.

[0233] In one specific embodiment, the antigen receptor NY-ESO-1, which pairs with the tumor antigen, has the amino acid sequence of the TCRα chain shown in SEQ ID NO: 58, and the amino acid sequence of the TCRβ chain shown in SEQ ID NO: 59.

[0234] In one specific embodiment, the antigen receptor MAGEA4, which pairs with the tumor antigen, has the amino acid sequence of the TCRα chain shown in SEQ ID NO: 60 and the amino acid sequence of the TCRβ chain shown in SEQ ID NO: 61.

[0235] In one specific embodiment, the antigen receptor AFP paired with the tumor antigen has the amino acid sequence of the TCRα chain shown in SEQ ID NO: 62, and the amino acid sequence of the TCRβ chain shown in SEQ ID NO: 63.

[0236] In one specific embodiment, the antigen receptor MAGE-B2, which pairs with the tumor antigen, has the amino acid sequence of the TCRα chain shown in SEQ ID NO: 64 and the amino acid sequence of the TCRβ chain shown in SEQ ID NO: 65. Preparation Example 3

[0237] Preparation Example 3 provides a method for constructing CAR-γδ-T cells. Specifically, it includes the following steps.

[0238] (1) Lentivirus packaging

[0239] Plasmid transfection: Construct the CD19-CAR sequence, insert the constructed CD19-CAR sequence into the lentiviral packaging system, place the plasmid, PEI, and Opti-MEM medium at room temperature for 5 min, take 436 μl of Opti-MEM into a 1.5 ml EP tube, add 64 μl of PEI, mix uniformly, let stand at room temperature for 5 min, add pLP1, pLP2, pLP-BaEVTR according to 6:9:9:16, add the expression plasmid, add Opti-MEM to 500 μl, let stand at room temperature for 5 min, add the prepared PEI-Opti-MEM solution to the Opti-MEM containing the plasmid, let stand at room temperature for 20 min, slowly drop 1 ml of the DNA / PEI mixture into 293T cells, gently mix uniformly, incubate in an incubator at 37 °C, after 16 - 18 h, change to fresh medium, place in an incubator with 5% CO2 at 37 °C and continue incubation to obtain CD19-CAR retrovirus.

[0240] Virus collection and concentration: After performing plasmid transfection for 48 h, collect the supernatant, centrifuge at 2820 g for 20 min at 4 °C to remove cell debris, filter with a 0.45 μm filter to obtain the supernatant, transfer the filtered virus supernatant into an ultracentrifugation tube, centrifuge at 50000 g for 2 h, remove the supernatant, add an appropriate amount of medium to dissolve the precipitate, obtain the virus solution, dispense into cryotubes, store at -80 °C, take 200 μl of the virus for titer measurement.

[0241] Virus titer detection: Seed 5 1×10 cells into a 24-well plate, add different volumes of virus concentrate, culture in an incubator with 5% CO2 at 37 °C, after 72 h, detect the positive rate of the cells to calculate the virus titer.

[0242] (2) Preparation of CAR-γδ-T cells

[0243] PBMC Isolation: Collect 50 ml of peripheral blood and, under normal working conditions in a clean bench, add 15 ml of lymphocyte separatory to each of two sterile 50 ml centrifuge tubes. Slowly inject peripheral whole blood into the upper layer of lymphocyte separatory in both centrifuge tubes, and add 25-30 ml of peripheral blood to each centrifuge tube. Centrifuge at 700 g x 20 min at room temperature with speed 1 and speed 2. After centrifugation, the blood will be separated into four layers: plasma (upper layer), mononuclear cells between the plasma and separatory (second layer), separatory (third layer), and red blood cell layer (bottom layer). Collect the mononuclear cells from the second layer using a straw and transfer them to a new centrifuge tube. Add 20 ml of diluted PBS cell suspension and centrifuge at 500 g for 10 min.

[0244] Day 0: Stimulation of γδ-T cells: Remove the supernatant, add 10 ml of GT-T551 H3 medium and resuspend the PBMCs, then take 20 μl of the cell suspension and count. The above cell suspension is divided into 2 × 10⁶ 6 Inoculate individual cells / mL into cell culture flasks, and add 10% (v / v) FBS so that the final concentration of zoledronic acid is 5 μM, the final concentration of IL2 is 500 IU / mL, and the final concentration of IL21 is 10 ng / mL.

[0245] Viral Infection: Day 3: Coat a non-tissue culture-treated 24-well plate with RetroNectin. Dilute RetroNectin mother liquor to 40 ug / mL with PBS solution, add 1 mL to the 24-well plate, seal with Parafilm, and incubate overnight at 4°C. Day 4: Aspirate the RetroNectin, seal the plate at room temperature for 30 minutes with 2% human serum white protein (0.5 mL / well), then wash once with PBS. Add lentivirus to the coated wells, centrifuge the culture plate at 32°C and 1500 g for 2 hours. The medium used is GT-T551 H3 medium, and 10% (v / v) FBS is added to achieve a final IL2 concentration of 500 IU / mL and a final IL21 concentration of 10 ng / mL (unless otherwise specified, this medium is used). Aspirate the virus and wash the wells once with PBS (PBS is aspirated only when adding cells). γδT cells collected by centrifugation were placed in fresh complete medium at a rate of 1 × 10⁶ 6 Resuspend the cells to a concentration of individual cells / mL (500uL / well, i.e., 5E5 individual cells / well), shake the cells evenly back and forth and side to side, centrifuge the well plate at 32°C and 1500g for 30 minutes to 2 hours, and then continue to culture overnight in a 37°C incubator.

[0246] Day 5: Repeat the above operations, such as coating, loading, and infection, once more.

[0247] Day 6: Collect cells from each well, centrifuge, wash once with PBS, resuspend in complete medium, and inoculate into a new well plate with an inoculation density of 1-1.5 × 10⁶. 6 It is individual cells / mL.

[0248] Removal of αβ T cells: Collect and count the cells, wash them with pre-cooled DPBS, centrifuge, add working buffer (PBS, pH 7.2, 0.5% BSA, 2 mM EDTA) and resuspend, then add 10 μL of Anti-TCRγ / δHapten-Antibody / 10 7Add cells, incubate at 4°C for 10 minutes, add working buffer and MACS Anti-Hapten MicroBeads-FITC and mix uniformly, then incubate at 4°C for 15 minutes, wash cells with working buffer, centrifuge, and resuspend with 500 μL of working buffer to produce CD19-CAR-γδ-T cells.

[0249] Detection of CAR expression rate: CAR-γδ-T cells and virus-untransmitted γδ-T cells (Mock control) were taken on D10, D12, D14, D16, and D18. After adding Protein L and staining, the positive rate of CAR-γδ-T cells was 35% to 50%, indicating that expression stabilized during the culture process, slightly decreased on D18, and that Mock control cells did not express CAR.

[0250] As the detection results show, the construction of CD19-CAR-γδ-T cells was successful.

[0251] According to the construction method described in Preparation Example 3, other types of tumor antigens-CAR-γδ-T cells can be obtained by using other types of tumor antigens instead of CD19. The types of tumor antigens may be CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, TPBG, etc. In addition to the difference in the CARs loaded onto the T cells, those skilled in the art can construct and detect successful construction using the same method.

[0252] CD22-CAR-γδ-T cells, BCMA-CAR-γδ-T cells, MUC-1-CAR-γδ-T cells, cMet-CAR-γδ-T cells, Claude 18. Obtain 2-CAR-γδ-T cells, MSLN-CAR-γδ-T cells, EGFR-CAR-γδ-T cells, VEGFR2-CAR-γδ-T cells, HER-2-CAR-γδ-T cells, and TPBG-CAR-γδ-T cells, respectively. Preparation Example 4

[0253] Preparation Example 4 provides a method for constructing CAR-Crispered T cells. Specifically, it includes the following steps.

[0254] (1) T cell immune checkpoint gene knockout

[0255] Based on the sequence structures of the human PD-1, CTLA4, LAG-3, and Tim-3 genes, and referring to previous research on related CRISPR gene editing tools, each gene's sgRNA sequence was designed. Here, the sgRNA for the PD-1 gene is gaggaccgca gccagcc, the sgRNA for the CTLA4 gene is ctgcaaagca atgcacg, the sgRNA for the LAG-3 gene is ggtgtgggcc caggagg, and the sgRNA for the Tim-3 gene is ggtcatcaaa ccagcca. The above sgRNA nucleic acid sequences were commissioned to Bioengineering (Shanghai) Co., Ltd. for synthesis and inserted into standard vectors, which were then linked to the CRISPR / CAS9 expression vector pX330A to obtain the pX330A-PD-1, pX330A-CTLA4, pX330A-LAG-3, and pX330A-Tim-3 vectors.

[0256] The above vector is electrically transfected into T cells, and the specific procedure is as follows: 1 × 10 7Take individual T cells, add 500 μL of electroporation buffer to resuspend the cells, inflate evenly up and down, add the above vector plasmid (10 ug) to the cell suspension, inflate evenly up and down, transfer to a sterile, clean electroporation cuvette, set the preset condition parameters to 300 V, 10 ms, administer two electric shocks, and after completing the electric shocks, incubate the electroporation cuvette on ice for 10 minutes to allow the nucleic acid to fully enter the cells, remove the electroporation cuvette from the ice, transfer the cells from the electroporation cuvette, filter, count, and inoculate into fresh DMEM medium according to the predetermined cell density, and culture in an incubator at 37°C and 5% CO2.

[0257] Two to three days after electroporation, T cell target expression was detected by flow cytometry. The target gene knockout efficiency was calculated as (control group expression level - experimental group expression level) / control group expression level × 100%, and as a result, the knockout efficiencies for the T cell PD-1, CTLA4, LAG-3, and Tim-3 genes were 98.5%, 98.7%, 99.2%, and 97.2%, respectively.

[0258] (2) Production of retrovirus for CAR expression

[0259] A CD19-CAR sequence is constructed, the constructed CD19-CAR sequence is inserted into a lentiviral system, and each plasmid is transfected into PhoenixECO cell line (ATCC) using lipofectamin 3000 (Invitrogen). The culture supernatant containing the ecotropic retrovirus secreted for 24-48 hours is added to the PG13 retroviral packaging cell line (ATCC) and spin infection (2500 rpm, 90 min) is performed.

[0260] The culture supernatant of the PG13 retrovirus-producing cell line prepared by the above method is harvested and filtered (through a 0.45 μm filter) to remove residual cell particles. After concentrating four times using a centrifugal filtration device (Millipore Amicon 100KD cut-off), the CD19-CAR retrovirus is obtained and used as a retrovirus concentrate for CAR-T cell construction.

[0261] (3) Preparation of CAR-Crispered T cells

[0262] Immune checkpoint gene knockout T cells were added to 24-well plates coated with anti-CD3 antibody (OKT3, 10 μg / ml, BioXcell) along with anti-CD28 antibody (CD28.2, 2 μg / ml, BD Biosciences), and then cultured for 48 hours to activate the T cells. After washing the activated T cells twice, they were used for retroviral transduction.

[0263] After coating the wells overnight with fibronectin (20 μg / ml, TaKaRa) at 4°C, 2% BSA-DPBS was added to the washed 24-well plates, and the plates were blocked at 37°C for 30 minutes. After washing, 1 ml of retrovirus concentrate was added, and the plates were centrifuged at 2000 × g and 32°C for 2 hours to allow the retrovirus to adhere to the bottom of the wells. After removing the virus concentrate and washing the wells, 1 ml of activated T cells (1 × 10⁶) were added. 6 Add cells / ml to the wells and centrifuge for 10 minutes (1000×g, 32℃) to allow the cells to attach to the retrovirus.

[0264] Then, the cells are cultured for 48 hours in the presence of human IL-2 (300 IU / ml, Proleukin, Novartis). After washing the retrovirus-transmitted T cells twice, they are added to a fresh culture medium containing human IL-2 (200 IU / ml) and grown for 3-6 days to be used as CAR-Crispered T cells.

[0265] CAR-Crispered T cells, which have been transmitted by retrovirus and proliferated for 3 days, are stained with CD19-Ck protein (a fusion protein of the extracellular domain of CD19 and the constant domain of the human immunoglobulin κ chain (Ck)) and APC-labeled anti-Ck antibody (anti-Ck-APC, BioLegend). The CAR-Crispered T cells are then detected by flow cytometry (FACS-Calibur, BDBiosciences).

[0266] As can be seen from the detection results, the results indicate that the construction of CD19-CAR-Crispered-T cells was successful.

[0267] According to the construction method described in Preparation Example 4, other types of tumor antigens-CAR-Crispered T cells can be obtained by using other types of tumor antigens instead of CD19. The types of tumor antigens may be CD22, BCMA, MUC-1, cMet, Claude18.2, MSLN, EGFR, VEGFR2, HER-2, TPBG, etc. In addition to the difference in the CARs loaded onto the T cells, those skilled in the art can construct and detect successful construction using the same method.

[0268] If the tumor antigens are CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, and TPBG, then CD22-CAR-Crispered-T cells, BCMA-CAR-Crispered-T cells, MUC-1-CAR-Crispered-T cells, cMet-CAR-Crispered-T cells, Claude 18.2-CAR-Crispered-T cells, MSLN-CAR-Crispered-T cells, EGFR-CAR-Crispered-T cells, VEGFR2-CAR-Crispered-T cells, HER-2-CAR-Crispered-T cells, and TPBG-CAR-Crispered-T cells are obtained, respectively. Preparation Example 5

[0269] Preparation Example 5 provides a method for constructing EGFR-targeted STAR-T cells. Specifically, it includes the following steps.

[0270] (1) Determination of the TCR constant region sequence

[0271] The constant regions (C regions) of the α and β chains of the TCR in STAR were both obtained from human peripheral blood T cell cDNA by PCR molecular cloning. Based on the original TCR sequence, the 48th and 57th amino acid sites of the constant regions of the α and β chains were mutated to cysteine, respectively, contributing to the formation of an additional disulfide bond between the α and β chains, thereby increasing the efficiency of their mutual matching. This was named E1-TCR. Here, the amino acid sequence of the constant region of the TCR α chain is shown in SEQ ID NO: 67, and the amino acid sequence of the constant region of the TCR β chain is shown in SEQ ID NO: 68.

[0272] (2) Sequencing of antibodies targeting EGFR

[0273] Cetuximab (abbreviated as Cetux) was selected as the antibody heavy chain variable region (VH) and antibody light chain variable region (VL), and is used only as an example to illustrate the content of the present invention; it can be replaced with other known antibodies.

[0274] (3) Construction of STAR targeting EGFR

[0275] STAR contains two polypeptide chains, fusing Cetux-VL and TCR-β chain as the first polypeptide chain, and fusing Cetux-VH and TCR-α chain as the second polypeptide chain. The gene sequence of STAR is connected to the p2A protein restriction enzyme cleavage site peptide segment by furin, and the two polypeptide chains are transcribed and translated together as one fusion peptide, and then cut into two independent protein subunits by the corresponding proteases of furin and p2A. These two subunits are covalently bonded by disulfide bonds and form a complex with the endogenous CD3 subunits (ε, δ, γ, ζ) of T cells.

[0276] The whole gene is inserted into the lentiviral expression vector pHAGE by the restriction enzyme sites NheI and NotI. The vector carries ampicillin resistance, the EF1α promoter and the IRES-RFP fluorescent reporter gene.

[0277] (4) Cloning and assembly of gene fragments

[0278] The four obtained fragments "Cetux VL", "TCRβ-C", "Cetux-VH", "TCRα-C" are respectively cloned from the pHAGE-Cetux-28zCAR vector and the pHAGE-E1-TCR vector. Each primer pair has 25bp bases with homology before and after, and the four fragments are reconnected in one step into the lentiviral vector by the method of Gibson Assembly. Thus, STAR is obtained.

[0279] Here, the amino acid sequence of the Cetux VL is shown in SEQ ID NO: 69, and the amino acid sequence of the Cetux VL is shown in SEQ ID NO: 70.

[0280] (5) Vector transformation and sequencing

[0281] The Gibson Assembly product is transformed into the DH5α strain and cultured overnight in an ampicillin-containing LB plate. Monoclonal bacteria are selected and sequenced, with seq-pHAGE-F and seq-pHAGE-R primers from the pHAGE vector selected as sequencing primers.

[0282] (6) Plasmid extraction

[0283] Bacteria with accurate sequencing results are inoculated into LB liquid medium and cultured overnight. Plasmids are extracted using a kit with endotoxin removal capabilities. Plasmid concentration is measured with Nanodrop, and the final plasmid concentration is approximately 1000 ng / μl, with an A260 / A280 value greater than 1.8.

[0284] (7) Lentivirus packaging

[0285] Transfection of 293T cells with a pHAGE vector carrying the target gene and packaging plasmids pMD2.G and psPAX2 in a specified ratio (PEI transfection). Cell medium supernatants are collected at 48h and 72h, mixed with PEG8000, left overnight, and then centrifuged to obtain a virus precipitate. The precipitate is resuspended in a small volume of culture medium to concentrate the virus.

[0286] (8) Isolation, culture, and lentiviral infection of human primary T cells

[0287] Human peripheral blood cells are taken, and CD4 and CD8 T cells are purified using a whole T cell magnetic bead separation kit. Subsequently, the T cells are stimulated and activated for 48-72 hours in a Petri dish coated with anti-CD3 / CD28 antibody, resulting in an increase in T cell volume, accumulation growth, and shape polarization. At this time, a lentiviral vector is used to introduce the target gene into the T cells, and infection is performed by centrifugation at 32°C and 1500 rpm for 2 hours. After viral infection, the cells are cultured in RPMI 1640 medium containing 20% ​​serum and 200 IU IL-2 until sufficient quantities are reached.

[0288] (9) Detection of EGFR-targeting localization status and antigen-binding ability on the STAR membrane

[0289] T cells were taken 3 days after infection, stained with an anti-human TCRα / β-BV421 flow cytometry antibody, and then flow cytometry was performed. The results showed that STAR could be stained by the anti-TCRα / β antibody compared to non-recombinant negative control cells, and the staining level was equivalent to that of native E1-TCR. This result indicates that the STAR molecule can localize on the membrane and that its α and β chains can form pairings.

[0290] T cells were taken 3 days after infection, stained with flow cytometry antibodies against the antigen proteins EGFR-His and anti-His-APC, and then flow cytometry was performed. The results showed that STAR cells stained more strongly than negative control cells of native E1-TCR (not specific to EGFR), indicating that the staining level corresponds to that of anti-EGFR CAR. This result suggests that STAR cells possess antigen recognition and binding ability corresponding to CAR molecules.

[0291] (10) Co-incubation of EGFR-targeting STAR-T cells with target cells and detection of the activation capacity of the mediated T cells

[0292] T cells were taken 3 days after infection, cultured in a cell culture plate coated with EGFR antigen, and incubated with tumor cells A549 (EGFR-positive human lung cancer cell line). After 24 hours, the cells were collected, stained with anti-human CD69-FITC flow cytometry antibody, and then flow cytometry was performed. The results showed that STARs could cause T cells to express the CD69 activation marker upon antigen stimulation, indicating that STARs mediate T cell activation after antigen stimulation, and that the degree of activation corresponds to CARs. At the same time, in a resting state without antigen stimulation, STARs did not exhibit self-activation, while CARs had a high level of self-activation.

[0293] According to the construction method described in Preparation Example 5, other types of tumor antigens-STAR-T cells can be obtained by using other types of tumor antigens instead of CD19. The types of tumor antigens may be CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, TPBG, etc. In addition to the difference in the STARs loaded onto the T cells, those skilled in the art can construct and detect successful construction in the same manner.

[0294] If the tumor antigens are CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, and TPBG, respectively, CD22-STAR-T cells, BCMA-STAR-T cells, MUC-1-STAR-T cells, cMet-STAR-T cells, Claude 18.2-STAR-T cells, MSLN-STAR-T cells, EGFR-STAR-T cells, VEGFR2-STAR-T cells, HER-2-STAR-T cells, and TPBG-STAR-T cells are obtained. Preparation Example 6

[0295] Preparation Example 6 provides a method for constructing CAR-NK cells. Specifically, it includes the following steps.

[0296] (1) Preparation of NK cells

[0297] Peripheral blood mononuclear cells (PBMCs) of the patient are obtained by density gradient centrifugation.

[0298] The specific steps include extracting 20 mL of human peripheral blood into a centrifuge tube with an anticoagulant, centrifuging at 2000 rpm for 10 min, collecting the upper plasma, adding an equal volume of warmed physiological saline to the remaining blood cell pellet, resuspending and mixing well, preparing another centrifuge tube, gently adding the uniformly mixed blood cell pellet onto the surface of lymphocyte separation medium at a volume ratio of 1:1, centrifuging at 18000 rpm for 25 min, carefully aspirating the white blood cell layer, transferring the white film layer into a new centrifuge tube, supplementing with PBS to 45 mL, centrifuging at 1500 rpm for 5 min, washing twice, and adding an appropriate amount of RPMI1640 complete medium (containing 10% FBS) to resuspend and count the cells.

[0299] NK cells are sorted using an NK cell sorting kit (purchased from biolegend), expanded and cultured using RPMI1640 (containing 10% FBS), and activated by adding cytokines IL-18 (100 U / mL) and IL-15 (100 U / mL).

[0300] (2) Preparation of CAR-NK cells

[0301] The chimeric antigen receptor gene fragment (CD19) provided by the present invention is introduced into the psb1576 vector, and then the above vector is introduced into competent cells. The plasmid is extracted using a plasmid extraction kit (purchased from Axygen), and sequencing is performed to identify whether the target gene sequence is correct. The positive clone plasmid is sent to a CRO company to synthesize lentiviral vectors respectively.

[0302] The prepared NK cells are activated, added to fresh medium, cultured in an environment of 37 °C and 5% CO2 for 10 days, then centrifuged to collect the cells, resuspended in fresh medium, and the cell density is adjusted to 1×10 6After adjusting the cell / mL to the required number of cells / mL, lentiviruses were added to each 24-well culture plate according to MOI=10, mixed uniformly, and then cultured in a 37°C, 5% CO2 incubator for 48-96 hours. After the culture medium was replaced with fresh medium, the transfer efficiency of CAR-NK cells (CD19-CAR-NK cells) was measured by PCR, and the positive rate exceeded 95%, meeting the experimental requirements.

[0303] According to the construction method described in Preparation Example 6, other types of tumor antigen-CAR-NK cells can be obtained by using other types of tumor antigens instead of CD19. The types of tumor antigens may be CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, TPBG, etc. In addition to the difference in the CARs loaded onto the T cells, those skilled in the art can construct and detect successful construction in the same manner.

[0304] If the tumor antigens are CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, and TPBG, then CD22-CAR-NK cells, BCMA-CAR-NK cells, MUC-1-CAR-NK cells, cMet-CAR-NK cells, Claude 18.2-CAR-NK cells, MSLN-CAR-NK cells, EGFR-CAR-NK cells, VEGFR2-CAR-NK cells, HER-2-CAR-NK cells, and TPBG-CAR-NK cells are obtained, respectively. Preparation Example 7

[0305] Preparation Example 7 provides a method for constructing IPSC CAR-NK cells. For the construction method in this preparation example, refer to the construction method mentioned in CN114958771A. Specifically, it includes the following steps.

[0306] S1: A lentiviral vector containing the chimeric antigen receptor CAR gene (CD19) is used to infect induced pluripotent stem cells (IPSCs) obtained from the reprogramming of blood cells, thereby obtaining IPSC cells that express the chimeric antigen receptor CAR.

[0307] S2: IPSC cells expressing the chimeric antigen receptor CAR are cultured in a medium containing 55 ng / ml of stem cytokine SCF, 2 μm / ml of GSK3β inhibitor, 28 ng / ml of bone morphogenetic protein BMP, 55 ng / ml of FGF2, and 35 mg / ml of VEGF. Targeted differentiation is then induced by adding 30 ng / ml of FLT-3L ligand, 60 ng / ml of thrombopoietin TPO, and 20 ng / ml of IL7 to obtain hematopoietic progenitor cells (HPCs).

[0308] S3: Hematopoietic progenitor cells (HPCs) were introduced into serum-free DMEM medium containing 1.0% P / S biantibody, 60 ng / ml TGF-β transforming growth factor, 15 ng / ml cytokines, 5 μM phosphatidylinositol 3 kinase inhibitor, and 4 μM antagonist. The antagonists were 1 μM angiotensin II type 1 receptor AT1 antagonist (sartan), 1 μM Mek / Erk antagonist (PD0325901), and 1 μM TGFβ antagonist (SB431542). The cytokines were a combination of 3 ng / ml SCF, 4 ng / ml TPO, 3 ng / ml IL-3, 3 ng / ml IL-11, and 2 ng / ml IL-15. The medium was replaced with fresh medium every 18 hours, and the cells were cultured for 5 days.

[0309] Cell density 2×10 2 The cells / mL were adjusted and introduced into a first growth medium containing 0.2 g / L tranexamic acid and a second growth medium containing 0.8 g / L tranexamic acid for growth. The first growth medium was DMEM medium containing 6% volume ratio autoinactivated serum, 100 ng / mL IL-2, 3 ng / mL FGF2, 0.008 g / L i-inositol, 0.04 g / L folic acid, 0.15 g / L sheep placenta, 0.7 g / L pyridoxine hydrochloride, and 0.2 g / L tranexamic acid. After 24 hours, the same growth medium was replaced.

[0310] After being cultured for 48 hours in the first growth medium, the cells are transferred to the second growth medium, which is DMEM medium containing 2.5% by volume of autoinactivated serum, 110 ng / mL of IL-2, 4 ng / mL of FGF2, 0.013 g / L of i-inositol, 0.04 g / L of folic acid, 0.2 g / L of sheep placentalin, 1.3 g / L of pyridoxine hydrochloride, and 0.8 g / L of tranexamic acid. The cells are then cultured for up to 72 hours to obtain antigen-specific IPSC-CAR-NK cells (CD19-IPSC CAR-NK cells).

[0311] According to the construction method described in Preparation Example 7, other types of tumor antigens-IPSC CAR-NK cells can be obtained by using other types of tumor antigens instead of CD19. The types of tumor antigens may be CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, TPBG, etc. Aside from the difference in the CARs mounted on the T cells, those skilled in the art can construct and detect successful construction using the same method.

[0312] If the tumor antigens are CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, and TPBG, then CD22-IPSC CAR-NK cells, BCMA-IPSC CAR-NK cells, MUC-1-IPSC CAR-NK cells, cMet-IPSC CAR-NK cells, Claude 18.2-IPSC CAR-NK cells, MSLN-IPSC CAR-NK cells, EGFR-IPSC CAR-NK cells, VEGFR2-IPSC CAR-NK cells, HER-2-IPSC CAR-NK cells, and TPBG-IPSC CAR-NK cells, respectively, are obtained. Preparation Example 8

[0313] Preparation Example 8 provides a method for constructing CAR-M cells. Specifically, it includes the following steps.

[0314] 1) Construction of PD-L1-CAR lentiviral vectors and preparation of PD-L1-CAR lentivirals

[0315] (1) Construction of the PD-L1-CAR lentiviral vector

[0316] Through preliminary experimental screening and research, the PD-L1-CAR sequence (SEQ ID NO: 71) was designed and synthesized, consisting of, from the 5' end to the 3' end, the signal peptide SP, the PD-L1 scFv antibody, the transmembrane domain of CD8α, the intracellular functional domain of CD86, and the intracellular functional domain of FcγR I. The synthesized PD-L1-CAR sequence was cloned into the pLVX-EF1α-AcGFP1-N1 vector to obtain the PD-L1-CAR lentiviral vector.

[0317] (2) Preparation of PD-L1-CAR lentivirus

[0318] The above PD-L1-CAR lentiviral vector is transfected with the lentiviral packaging vectors pMD2.G and psPAX2 to prepare D-L1-CAR lentivirus. Lentiviral packaging is performed when the degree of fusion of 293T cells is 70% to 80%. After 24 hours and 48 hours following lentiviral packaging, the viral supernatant is collected, centrifuged at 4000 rpm for 10 minutes, cell debris is filtered through a 0.45 μm filter membrane, and the concentrate is obtained by ultra-high-speed centrifugation at 25000 rpm at 4°C for 2 hours. The concentrate is then divided into smaller portions and stored at -80°C.

[0319] (3) Identification of the PD-L1-CAR lentiviral vector

[0320] After cutting the constructed PD-L1-CAR lentivirus expression plasmid using restriction enzymes EcoRI and BamHI, the plasmid is detected by electrophoresis on a 1.2% agarose gel at 120V for 40 minutes, and the electrophoretic bands are analyzed to determine whether the recombinant PD-L1-CAR lentivirus expression plasmid was accurately inserted into the PD-L1 gene fragment.

[0321] 2) Proliferation and culture of hematopoietic stem cells derived from human umbilical cord blood

[0322] Preparation of complete hematopoietic stem cell culture medium: StemSpan (a serum-free medium for hematopoietic cells) TM The SFEM (StemCell, 09600) is supplemented with the following cytokines: SCF (100 ng / ml), Flt-3L (100 ng / ml), TPO (50 ng / ml), IL-6 (50 ng / ml), LDL (10 ug / ml), SR1 (750 nM), and UM171 (35 nM).

[0323] Day 1: Peripheral blood mononuclear cells (PBMCs) were isolated from umbilical cord blood, and the PBMCs were resuspended in prepared hematopoietic stem cell complete medium until the cell density reached 5 × 10⁶. 6 The concentration is cells / ml. Take 10 mL and inoculate into a T25 cell culture flask. Place the T25 cell culture flask vertically into a shaker, set the shaker rotation speed to 100 rpm / min, and incubate in a carbon dioxide incubator at 37°C and 5% CO2. From day 2 to day 5, add 2-3 mL of fresh CD34 daily. + Add hematopoietic stem cell complete medium, and when the culture volume in each culture flask reaches 20 ml to 25 ml, adjust the shaker rotation speed to 110 to 120 rpm / min. From day 6 to day 9, add 4 to 6 ml of fresh CD34 daily. + Add hematopoietic stem cell complete medium. On day 9, sample and count CD34 cells. + The proportion of hematopoietic stem cells (HSCs) is detected by flow cytometry.

[0324] 3) Preparation of PD-L1-CAR-HSCs cells

[0325] Infection of HSC cells with PD-L1-CAR lentivirus: HSC cells (MOI=60) were infected with PD-L1-CAR lentivirus, and 48 hours after infection, they were treated with puromycin (0.25 μg / ml) for 3 days to select HSC cells that stably express PD-L1-CAR. A stable PD-L1-CAR-HSC cell line was constructed, and after large-scale amplification, it was frozen in liquid nitrogen for later use.

[0326] GFP+ By detecting the ratio of PD-L1-CAR-HSC cells, the infection efficiency of HSC cells by PD-L1-CAR lentivirus can be indirectly detected.

[0327] 4) Induction and differentiation of PD-L1-CAR-HSCs cells into PD-L1-CAR-M cells

[0328] Preparation of macrophage differentiation medium M1: Add 2% (v / v) B27 additive, 2 mM Glutamax, 1% (v / v) non-essential amino acids (NEAA), 50 ng / ml vitamin C, 10 ng / ml human interleukin-3 (IL-3), and 50 ng / ml human macrophage colony-stimulating factor (M-CSF) to RPMI1640 culture medium.

[0329] Preparation of macrophage differentiation medium M2: Add 2% (v / v) B27 additive, 2 mM Glutamax L-alanyl-L-glutamine, 1% (v / v) non-essential amino acids (NEAA), 50 ng / ml vitamin C, and 50 ng / ml human macrophage colony-stimulating factor (M-CSF) to RPMI1640 culture medium.

[0330] PD-L1-CAR-HSCs cells from step 3 are resuspended in M1 medium and cultured for 5 days in an incubator at 37°C and 5% CO2, with half of the M1 medium being replaced every other day. After 5 days, the cells are collected, centrifuged, resuspended in M2 medium, and cultured for another 3 days in an incubator at 37°C and 5% CO2 to obtain human hematopoietic stem cell-derived CAR macrophages (PD-L1-CAR-M).

[0331] 5) Identification of PD-L1-CAR-M cells

[0332] PD-L1-CAR-M cells obtained by induced differentiation were collected, washed with PBS containing 0.1% BSA, and resuspended. After incubation for 20 minutes at room temperature in the dark using CD14-PE (399204, Biolegend) and CD11b-FITC (301330, Biolegend) antibodies, the expression of CD14 and CD11b on the surface of the PD-L1-CAR-M cells was detected and analyzed by flow cytometry. This demonstrates that we successfully obtained CAR-macrophages derived from human HSCs through induced differentiation.

[0333] According to the construction method described in Preparation Example 8, other types of tumor antigen-CAR-M cells can be obtained by using other types of tumor antigens instead of PD-L1. The types of tumor antigens may be CD19, CD22, BCMA, MUC-1, cMet, Claude18.2, MSLN, EGFR, VEGFR2, HER-2, TPBG, etc. In addition to the difference in the CARs loaded onto the T cells, those skilled in the art can construct and detect successful construction using the same method.

[0334] If the tumor antigens are CD19, CD22, BCMA, MUC-1, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, and TPBG, respectively, CD19-CAR-NK cells, CD22-CAR-NK cells, BCMA-CAR-NK cells, MUC-1-CAR-NK cells, cMet-CAR-NK cells, Claude 18.2-CAR-NK cells, MSLN-CAR-NK cells, EGFR-CAR-NK cells, VEGFR2-CAR-NK cells, HER-2-CAR-NK cells, and TPBG-CAR-NK cells are obtained. Preparation Examples 9-12

[0335] Each of the preparation examples 9-12 provides a tumor therapy combining an oncolytic virus vaccine and immune cells.

[0336] This method treats tumors using a combination of an oncolytic virus vaccine and immune cells. The oncolytic virus vaccine contains recombinant oncolytic viruses that express tumor antigens and are intended to target tumor cells, while the immune cells chimerically combine with the antigen receptor.

[0337] The recombinant oncolytic virus comprises an M protein, a G protein, an N protein, a P protein, an L protein, and a tumor antigen. Here, the M protein, G protein, N protein, P protein, and L protein are all obtained by point mutation based on the wild-type VSV virus Indiana MuddSummer subtype, and the tumor antigen is obtained by insertion into the gene encoding the tumor antigen.

[0338] The main difference between the preparations lies in the mutation sites of the M protein. The mutation sites of the M protein are the amino acid sequences shown in SEQ ID NOs: 3, 9, 10, and 11, respectively. The G protein contains the amino acid sequence shown in SEQ ID NO: 13, the N protein contains the amino acid sequence shown in SEQ ID NO: 15, the P protein contains the amino acid sequence shown in SEQ ID NO: 17, and the L protein contains the amino acid sequence shown in SEQ ID NO: 19. The mutation sites and tumor antigen types for each protein are shown in Table 1.

[0339] 1. The method for constructing the recombinant oncolytic virus provided in each of the above preparation examples is as follows:

[0340] (1) Construction of vectors

[0341] Using the pRV-core plasmid (BioVector NTCC plasmid vector cell gene preservation center) as a template, the M protein mutation sites, G protein mutation sites, N protein mutation sites, P protein mutation sites, and L protein mutation sites shown in Table 1 are introduced using PCR technology.

[0342] Gene fragments containing XbaI and MluI restriction enzyme cleavage sites and the aforementioned protein mutation sites are synthesized, and these are used as templates for PCR amplification. Subsequently, the PCR products are subjected to 1% agarose gel electrophoresis, double enzyme cleavage is performed with XbaI and MluI, and then rubber tapping recycling is performed using a gel recovery kit to obtain gene fragments containing M protein mutation sites, G protein mutation sites, N protein mutation sites, P protein mutation sites, and L protein mutation sites, respectively. The RV-core plasmid is double enzyme cleaved with XbaI and MluI, and rubber tapping recycling is performed using a gel recovery kit to obtain pRV-core enzyme cleavage recovered skeleton fragments.

[0343] Gene fragments containing M protein mutation sites, G protein mutation sites, N protein mutation sites, P protein mutation sites, and L protein mutation sites are each converted by connecting and modifying the pRV-core enzyme-cleaved and recovered skeleton fragments, and then coated onto a plate. Monoclonal bacteria are selected and PCR validation is performed to extract the plasmids and obtain the constructed plasmid pRV-core Mut, which is then sent to a sequencing company for sequencing.

[0344] (2) Insertion of foreign genes

[0345] The plasmid pRV-core Mut obtained in step (1) is subjected to double enzymatic cleavage with Xho I and Mlu I to recover long fragments.

[0346] After the foreign gene encoding the tumor antigen is synthesized by a gene synthesis company, it is amplified with the corresponding primers, subjected to double enzyme cleavage with XhoI and NheI, the target gene fragment is recovered, the pRV-core Mut processed by the above double enzyme cleavage is ligated to the foreign gene fragment and converted, the monoclonal is selected, PCR or enzyme cleavage identification is performed, and then it is sent to a sequencing company for sequencing to obtain the plasmid pRV-core Mut that carries the foreign gene, as shown in Table 1. Table 1: Recombinant oncolytic viruses and immune cells in preparation examples 9-12 [Table 1]

[0347] (3) Virus Rescue

[0348] Using a calcium phosphate transfection kit (Thermo Fisher Scientific), the plasmid pRV-core Mut, which carries foreign genes, is transfected into BSR-T7 cells (purchased from ATCC (American Type Culture Collection, also known as the American Center for Bacteriological Preservation)) using cell transfection technology.

[0349] The four plasmids were mixed according to the mass ratio of pRV-core Mut, pP, pN, and pL, which was 10:5:4:1, resulting in a total plasmid volume of 5 μg. The plasmids were diluted in 200 μl of opti-MEM medium (Thermo Fisher Scientific), and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) was added to obtain a transfection plasmid premix. Here, pP (plasmid carrying the baculovirus phosphoprotein gene), pN (plasmid carrying the baculovirus nucleoprotein gene), and pL (plasmid carrying the baculovirus polymerase protein gene) were used, and the corresponding parent vectors for the three plasmids pN, pP, and pL were all pCAGGS (purchased from ATCC).

[0350] Dilute 10 μl of lipofectamine LTX (Thermo Fisher Scientific) in 200 μl of opti-MEM medium to obtain an LTX mixture.

[0351] Plasmid transfection was performed according to the instructions for use of lipofectamine LTX. After 6 hours, BSR-T7 cells were washed twice with PBS, and then inoculated into 10% fetal bovine serum DMEM medium (Thermo Fisher Scientific) and cultured for 3 days.

[0352] The supernatant obtained from culturing BSR-T7 cells is transferred to Vero cells (Thermo Fisher Scientific), and the Vero cells are cultured for 3 days under environmental conditions of 37°C. The status of virus rescue is identified by observing the green fluorescence within the sacral cells using a fluorescence microscope. Furthermore, the rescued mutant baculovirus library is passaged through Vero cells, and monoclonal virus strains are picked from the constructed plaque screening system.

[0353] (4) Gene sequencing. Viral genomic RNA is extracted using a Trizol kit, and a reverse transcription reaction is performed using random primers. PCR is then performed on the reverse-transcribed cDNA using primers designed for the M protein gene sequence, G protein gene sequence, N protein gene sequence, P protein gene sequence, L protein gene sequence, and the gene sequence encoding the tumor antigen.

[0354] The primer sequences designed for the M protein gene sequence are: PF:ATGAGTTCCTTAAAGAA, PR:TCATTTGAAGTGG

[0355] The primer sequences designed for the G protein gene sequence are: PF:ATGAAGTGCCTTTTGTACTTAG, PR:TTACTTTCCAAGTCGGTTCATCT

[0356] The primer sequences designed for the N protein gene sequence are: PF:ATGTCTGTTACAGTCAAGAG, PR:TCATTTGTCAAATTCTGACTT

[0357] The primer sequences designed for the P protein gene sequence are: PF:ATGGATAATCTCACAAAAGTTCG, PR:CTACAGAGAATATTTGACTCTCG

[0358] The primer sequences designed for the L protein gene sequence are: PF:ATGGAAGTCCACGATTTTGAGA, PR:TTAATCTCTCCAAGAGTTTTCCT

[0359] The primer sequences designed for the gene sequences encoding tumor antigens are: CD19 F:ACGCTCGAGATGCCACCTCCTGCGCCTCC, CD19 R:TCTGGCTAGCTCATCTTTTCCTCCTCAGG

[0360] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1.

[0361] 2. The method for constructing the oncolytic virus vaccine provided in each of the above preparation examples is as follows:

[0362] (1) The packaging process for the recombinant oncolytic virus provided above specifically includes the following steps:

[0363] 1) BSR-T7 cells (purchased from ATCC) are infected and inoculated using poxvirus vTF7-3 (BioVectorNTCC plasmid carrier cell gene reservoir) that expresses T7 RNA polymerase.

[0364] Specific process: BSR-T7 cells are laid in a 6-well plate, with a cell count of 3 × 10⁶ per well. 5 The cells are controlled to reach a certain temperature, and 14-16 hours after laying, poxvirus vTF7-3 expressing T7 RNA polymerase is added to infect the BSR-T7 cells with poxvirus vTF7-3. After 6 hours of infection, the BSR-T7 cells are rinsed once with DPBS buffer (Thermo Fisher Scientific) and transfection is performed.

[0365] 2) Transfection process

[0366] Specifically, the process includes the following steps: The four plasmids are mixed according to the mass ratio of pRV-core Mut, pP, pN, and pL of 10:5:4:1, resulting in a total plasmid volume of 5 μg. The plasmids are diluted with 200 μl of opti-MEM medium (Thermo Fisher Scientific), and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) is added to obtain a transfection plasmid premix. Here, pP (plasmid carrying the baculovirus phosphoprotein gene), pN (plasmid carrying the baculovirus nucleoprotein gene), and pL (plasmid carrying the baculovirus polymerase protein gene). The corresponding parental carriers for the three plasmids pN, pP, and pL are all pCAGGS (purchased from ATCC).

[0367] Dilute 10 μl of lipofectamine LTX (Thermo Fisher Scientific) in 200 μl of opti-MEM medium to obtain an LTX mixture.

[0368] Mix 200 μl of LTX mixture with 200 μl of transfection plasmid premix, incubate at room temperature for 15 minutes, and obtain the LTX-DNA mixture.

[0369] Step 1) involves switching the DPBS buffer in the 6-well plate to Opti-MEM medium, adding the LTX-DNA mixture to the 6-well plate where the BSR-T7 cells are cultured, gently shaking the 6-well plate to evenly distribute the LTX-DNA mixture, and performing transfection for 6-8 hours. After that, the transfection reagent is aspirated, 3 ml of fresh complete medium (Thermo Fisher Scientific) is added, and after 72 hours, the supernatant of the BSR-T7 cells is obtained, filtered using a 0.22 μm filter, and the recombinant oncolytic virus corresponding to each preparation is obtained, i.e., the oncolytic virus vaccine is obtained.

[0370] 4. Immune cells

[0371] The immune cells are those prepared by the construction method provided in Preparation Example 1. Preparation Examples 13-29

[0372] Each of the preparation examples 13-29 provides a tumor therapy combining an oncolytic virus vaccine and immune cells.

[0373] This method treats tumors using a combination of an oncolytic virus vaccine and immune cells. The oncolytic virus vaccine contains recombinant oncolytic viruses that express tumor antigens and are intended to target tumor cells. The immune cells and their antigen receptors are specifically shown in Table 2.

[0374] The recombinant oncolytic virus contains M protein, G protein, N protein, P protein, L protein, and tumor antigen. Here, the mutation sites of the M protein, G protein, N protein, P protein, and L protein are the same as the corresponding mutation sites in Preparation Example 9. The difference lies in the type of tumor antigen, which is specifically shown in Table 2.

[0375] 1. The method for constructing the recombinant oncolytic virus provided in the above preparation example is the same as the method for constructing in Preparation Example 9, and the differences in the construction method are as follows:

[0376] In step (2), the insertion of foreign genes, tumor antigens shown in Table 2 are introduced using PCR technology.

[0377] Step (4) involves sequencing for each type of tumor antigen. Viral genomic RNA is extracted using a Trizol kit, reverse transcription is performed using random primers, and PCR is performed on the reverse-transcribed cDNA using primers designed for the gene sequence encoding the tumor antigen.

[0378] The primer sequences designed for the gene sequence encoding the antigen are as follows: 1)CD22 F:ATGCATCTCCTCGGCCCCT、 CD22 R:TCAGAGCCCACAGATTGCCAGG。 2)BCMAF:ACGCTCGAGATGTTGCAGATGGCTGGGC、 BCMAR:TCTGGCTAGCTTATAGCAAAAACATTAGC。 3)MUC-1F:ACGCTCGAGATGTCTGGTCATGCAAGC、 MUC-1-R:TCTGGCTAGCTTACAAGGCAATGAGATAG。 4)NY-ESO-1F:ACGCTCGAGATGCAGGCAGAAGGAAG、 NY-ESO-1R:TCTGGCTAGCTCATCTTCTCTGTCCGCTA。 5)MAGE A4 F:ACGCTCGAGACAGAGGAGCACCAAGGAG、 MAGEA4 R:TCTGGCTAGCATAGACTGAGGCATAAGGC。 6)cMetF:ACGCTCGAGATGGAGTGCAAGGAGGCC、 cMet R:TCTGGCTAGCTTACAGCCACAGGAAGAAG。 7)Claude 18.2F:ACGCTCGAGATGGACCAGTGGAGCACCC、 Claude 18.2R:TCTGGCTAGCTTAGGCGATGCACATCATC。 8)MSLN F:ACGCTCGAGATGGAAGTGGAGAAGACAG、 MSLN R:TCTGGCTAGCTCAGGCCAGGGTGGAGGCT。 9)EGFR F:ACGCTCGAGATGCGACCCTCCGGGACGG、 EGFR R:TCTGGCTAGCTTACATGAAGAGGCCGAT。 10)VEGFR2 F:ACGCTCGAGATGCAGAGCAAGGTGCTG、 VEGFR2 R:TCTGGCTAGCTCAGATGATGACAAGAAGT. 11) HER-2F: ATGGAGCTGGCGGCCTTGTGCC, HER-2R:TTAGATGAGGATCCCAAAGACCA. 12)TPBG F:ATGTCTTCTCCCACCTCCTCGGCAT, TPBG R:TCACAAATACAAAACCAGGAGGAAA.

[0379] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 3.

[0380] 2. Immune cells

[0381] The immune cells are those prepared by the construction methods provided in Preparation Examples 1-8. Table 2 Recombinant oncolytic viruses and immune cells in preparation examples 9, 13-29 [Table 2] Preparation Examples 30-83

[0382] Each of the preparation examples 30-83 provides a tumor therapy combining an oncolytic virus vaccine and immune cells.

[0383] The method includes an oncolytic virus vaccine and immune cells. Here, the oncolytic virus vaccine contains recombinant oncolytic viruses that express tumor antigens and are intended to target tumor cells, and the immune cells chimeric with antigen receptors.

[0384] The difference between the above preparation example and preparation examples 13-29 is that the recombinant oncolytic virus contains cytokines in addition to the M protein, G protein, N protein, P protein, L protein, and tumor antigen. Here, the mutation sites of the M protein, G protein, N protein, P protein, and L protein are the same as the corresponding mutation sites in preparation example 9. The difference lies in the type of tumor antigen and the type of cytokine, which are specifically shown in Table 3.

[0385] Specifically, it is as follows:

[0386] The cytokine contained in the recombinant oncolytic viruses provided in Preparation Examples 30-47 is IL-12, and the cytokine IL-12 includes the amino acid sequences shown in SEQ ID NOs. 33 and 34, specifically shown in Table 3.

[0387] The cytokine contained in the recombinant oncolytic viruses provided in Preparation Examples 48-65 is IL-15, and the cytokine IL-15 contains the amino acid sequence shown in SEQ ID NO: 35, specifically as shown in Table 3.

[0388] The cytokine contained in the recombinant oncolytic viruses provided in Preparation Examples 66-83 is IL-18, and the cytokine IL-18 contains the amino acid sequence shown in SEQ ID NO: 36, specifically as shown in Table 3.

[0389] 1. The method for constructing the recombinant oncolytic virus provided in the above preparation example is the same as the method for constructing in Preparation Example 9, and the differences in the construction method are as follows:

[0390] In step (2), the insertion of the foreign gene involves introducing cytokines shown in Table 3 using PCR technology. The tumor antigen and cytokine are inserted between the G protein and the L protein. The insertion order may be either inserting the cytokine first and then the tumor antigen, or inserting the tumor antigen first and then the cytokine. In this application, the cytokine is inserted first, and then the tumor antigen is inserted.

[0391] Step (4) further includes cytokine sequencing. Viral genomic RNA is extracted using a Trizol kit, reverse transcription is performed using random primers, and PCR is performed on the reverse-transcribed cDNA using primers designed for the cytokine gene sequence.

[0392] The primer sequences designed for the cytokine-coding gene sequences are as follows: IL12 F:CCCTCGAGATGTGGCCCCCTGGGT, IL12 R:CGGCTAGCTTAACTGCAGGGCACAGATG. IL-15F:CCGCTCGAGATGAGAATTTCGAAACC, IL-15R:CGGCTAGCTCAAGAAGTGTTGATGAAC. IL-18F: CCCTCGAGATGGCTGCTGAACCAGTAG, IL-18R:CGGCTAGCCTAGTCTTCGTTTTGAAC.

[0393] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 3.

[0394] 2. The method for constructing immune cells provided in the above preparation example is the same as described above. Table 3: Mutation table of recombinant oncolytic viruses in preparation examples 30-83 [Table 3] JPEG2026509604000005.jpg203170 Preparation example 84~95

[0395] Each of the preparation examples 84-95 provides a method for treating tumors using an oncolytic virus vaccine.

[0396] The recombinant oncolytic viruses in the above preparation examples are the oncolytic virus vaccines in preparation examples 9 and 13-29, respectively. Specifically, these are shown in Table 4. The main difference lies in the type of tumor antigen. Table 4: Mutation table of recombinant oncolytic viruses in preparation examples 84-95 [Table 4] Preparation Examples 96-113

[0397] Each of the preparation examples 96-113 provides a method for treating tumors using immune cells.

[0398] The immune cells in the above preparation examples are the same immune cells as those in preparation examples 9 and 13-29, respectively. Specifically, these are shown in Table 5. The differences lie in the type of immune cells and the antigen receptors of the chimeric cells. Table 5: Immune cells in preparation examples 96-113 [Table 5]

[0399] Examples

[0400] In this example, the methods for treating tumors using oncolytic virus vaccines and / or immune cells provided in Preparation Examples 9-113 are subjected to in vitro toxicity testing for different cell types.

[0401] The detection method is the CCK8 detection method, in which oncolytic virus vaccines and / or immune cells provided in Preparation Examples 9-113 and wild oncolytic viruses are added to the culture media of different cells, and cell activity is detected after 24 hours by the MTT detection method.

[0402] The detected cells included LLC cells and MEF cells.

[0403] 1. Oncolytic virus vaccines and immune cells provided in Preparation Examples 9-83 - The specific detection method is as follows.

[0404] (1) Add 100 μl of Vero(LLC / MEF) cell suspension to each well of a 96-well culture plate, and increase the cell volume to 4 × 10 3 Ensure the culture density reaches cells / well, and incubate the 96-well culture plate for 16 hours under environmental conditions of 37°C and 5% CO2.

[0405] (2) The oncolytic virus vaccine prepared in the above preparation example is diluted until the MOI (Multiple Infection Infections) is 0.001, 0.01, 0.1, and 1.0, respectively, and the recombinant oncolytic virus of each dilution gradient is inoculated into the 96-well culture plate of step (1), with 100 μl inoculated into each well and 3 wells for each dilution gradient.

[0406] Simultaneously, the immune cells are diluted according to the effector:target ratio (E:T) to create four dilution gradients such as 1:1, 5:1, 10:1, and 20:1. The immune cells from each dilution gradient are then inoculated into the 96-well culture plate from step (1), with 100 μL inoculated into each well, and three wells inoculated for each dilution gradient. The 96-well culture plate is then cultured at 37°C in 5% CO2 for 48 hours.

[0407] (3) Remove the cell supernatant from the 96-well culture plate from step (2), add fresh DMED medium (100 μL / well) to the 96-well culture plate, then add CCK8 solution (10 μL / well), and culture the 96-well culture plate at 37°C and 5% CO2 for 4 hours.

[0408] (4) Centrifuge the 96-well culture plate at room temperature for 5 minutes, set the rotation speed to 2500 rpm / min, gently aspirate the supernatant using a 1 mL disposable sterile syringe, add DMSO to each well of the 96-well culture plate at a volume of 100 ul / well, and leave for 10 minutes under ambient conditions of 37°C. Using a multifunctional microplate reader, shake for 2 minutes and measure the OD value of each well on the 96-well culture plate at a wavelength of 570 nm or 490 nm to calculate the tumor cell elimination rate.

[0409] Tumor cell killing rate (%) = (Tumor cell control group OD value - Experimental group OD value) / Tumor cell control group OD value × 100%.

[0410] 2. Oncolytic virus vaccines and wild oncolytic viruses provided in Preparation Examples 84-95 - The specific detection methods are as follows.

[0411] (1) Add 100 μL of Vero(LLC / MEF) tumor cell suspension to each well of a 96-well culture plate, and increase the cell volume to 4 × 10 3 Ensure the culture density reaches cells / well, and incubate the 96-well culture plate for 16 hours under environmental conditions of 37°C and 5% CO2.

[0412] (2) The oncolytic virus vaccine and wild oncolytic virus prepared in the above preparation example are diluted until the MOI (Multiple Infection Intake) is 0.001, 0.01, 0.1, and 1.0, respectively, into four dilution gradients. The oncolytic virus vaccine and wild oncolytic virus of each dilution gradient are inoculated into the 96-well culture plate of step (1), with 100 μL inoculated into each well, and three wells inoculated for each dilution gradient. The 96-well culture plate is then cultured at 37°C and 5% CO2 for 48 hours.

[0413] (3) Remove the supernatant from the 96-well culture plate from step (2), add fresh DMED medium (100 μL / well) to the 96-well culture plate, then add CCK8 solution (10 μL / well), and incubate the 96-well culture plate at 37°C and 5% CO2 for 4 hours.

[0414] (4) Centrifuge the 96-well culture plate at room temperature for 5 minutes, set the rotation speed to 2500 rpm / min, gently aspirate the supernatant using a 1 mL disposable sterile syringe, add DMSO to each well of the 96-well culture plate at a volume of 100 ul / well, and leave for 10 minutes under ambient conditions of 37°C. Using a multifunctional microplate reader, shake for 2 minutes and measure the OD value of each well on the 96-well culture plate at a wavelength of 570 nm or 490 nm to calculate the tumor euthanasia rate.

[0415] III. Immune cells provided in Preparation Examples 96-113 - The specific detection method is as follows.

[0416] (1) Add 100 μL of Vero(LLC / MEF) tumor cell suspension to each well of a 96-well culture plate, and increase the cell volume to 4 × 10 3 Ensure the culture density reaches cells / well, and incubate the 96-well culture plate for 16 hours under environmental conditions of 37°C and 5% CO2.

[0417] (2) Dilute the immune cells according to the effector:target ratio (E:T) to obtain four dilution gradients such as 1:1, 5:1, 10:1 and 20:1, and inoculate the immune cells of each dilution gradient into the 96-well culture plate from step (1), inoculating 100 μL into each well, with 3 wells inoculated for each dilution gradient, and culture the 96-well culture plate at 37°C and 5% CO2 for 48 hours.

[0418] (3) Remove the supernatant from the 96-well culture plate from step (2), add fresh DMED medium (100 μL / well) to the 96-well culture plate, then add CCK8 solution (10 μL / well), and incubate the 96-well culture plate at 37°C and 5% CO2 for 4 hours.

[0419] (4) Centrifuge the 96-well culture plate at room temperature for 5 minutes, set the rotation speed to 2500 rpm / min, gently aspirate the supernatant using a 1 mL disposable sterile syringe, add DMSO to each well of the 96-well culture plate at a volume of 100 ul / well, and leave for 10 minutes under ambient conditions of 37°C. Using a multifunctional microplate reader, shake for 2 minutes and measure the OD value of each well on the 96-well culture plate at a wavelength of 570 nm or 490 nm to calculate the tumor euthanasia rate.

[0420] The detection results are shown in Figures 1 to 6. Here, the horizontal axis 0 represents wild-type oncolytic virus, the horizontal axis 9 to 113 represents preparation examples 9 to 113, and the vertical axis OD. 570 This represents the OD value of the cell, OD 570 The larger the value, the lower the killing ability of the recombinant oncolytic virus to the cells, indicating OD 570 A smaller value indicates that the recombinant oncolytic virus has a better ability to kill the cells in question.

[0421] Figure 1 shows a method for treating tumors by combining oncolytic virus vaccines and immune cells provided in Preparation Examples 9-83 of this application, and the results of detecting the in vitro killing ability of wild-type oncolytic virus against LLC cells.

[0422] Figure 2 shows methods for treating tumors by combining oncolytic virus vaccines and immune cells provided in Preparation Examples 9-83 of this application, and the results of detecting the in vitro killing ability of wild-type oncolytic viruses against MEF cells.

[0423] Figure 3 shows the results of detecting the in vitro killing ability of the oncolytic virus vaccines provided in Preparation Examples 84-95, the immune cells provided in Preparation Examples 96-113, and the wild-type oncolytic virus against LLC cells.

[0424] Figure 4 shows the results of detecting the in vitro killing ability of the oncolytic virus vaccines provided in Preparation Examples 84-95, the immune cells provided in Preparation Examples 96-113, and the wild-type oncolytic virus against MEF cells.

[0425] Figure 5 shows the tumor cell killing rate of methods for treating tumors by combining oncolytic virus vaccines and immune cells, as provided in Preparation Examples 9-83 of this application.

[0426] Figure 6 shows the tumor cell killing rates of the oncolytic virus vaccines provided in Preparation Examples 84-95 and the immune cells provided in Preparation Examples 96-113 of this application.

[0427] As can be seen from the above drawings, the methods for treating tumors by combining oncolytic virus vaccines and immune cells provided in Preparation Examples 1 to 83 of this application have good in vitro killing ability against LLC cells, and all of them are superior to the in vitro killing ability against LLC cells of the oncolytic virus vaccines provided in Preparation Examples 84 to 95 and the immune cells provided in Preparation Examples 96 to 113.

[0428] As can be seen from the above detection results, the method of treating tumors by combining the oncolytic virus vaccine and immune cells provided in this application has good in vitro killing ability against LLC cells. The method of treating tumors by combining the oncolytic virus vaccine and immune cells provided in this application can be judged to have good in vitro killing ability against cancer cells (4T1 cells, MC38 cells, and HeLa cells, etc.). At the same time, the method of treating tumors by combining the oncolytic virus vaccine and immune cells provided in this application has almost no killing effect on MEF cells, and the method of treating tumors by combining the oncolytic virus vaccine and immune cells provided in this application can be effectively used to damage and kill abnormal cells such as tumors and cancers, while simultaneously not damaging normal cells. The method of treating tumors by combining the oncolytic virus vaccine and immune cells provided in this application guarantees safety for normal cells while also guaranteeing killing ability against tumor and cancer cells, and has the potential for a wide range of clinical applications.

[0429] This specific embodiment is merely a description of the present application and does not limit it. Those skilled in the art may, after reading this specification, make amendments to this embodiment as necessary, without making any creative contribution, but all such amendments will be protected under patent law as long as they are within the scope of the claims of this application.

Claims

1. This is a tumor treatment method that combines an oncolytic virus vaccine with immune cells. By using immune cells and oncolytic virus vaccines in combination, The aforementioned oncolytic virus vaccine contains recombinant oncolytic viruses that express tumor antigens and is intended to target tumor cells. The aforementioned immune cells are intended to chimeric into antigen receptors that pair with the tumor antigen, thereby killing or destroying target tumor cells. The recombinant oncolytic virus contains M protein, G protein, N protein, P protein, and L protein. Compared to the amino acid sequence shown in Sequence ID No. 1, The site mutations of the aforementioned M protein include M51R, V221F, and S226R. Alternatively, the site mutations of the M protein include N32S, N49D, M51R, H54Y, V221F, V225I, and S226R. Alternatively, the site mutations of the M protein include N32S, N49D, M51R, H54Y, knockout of the leucine coding base at site 111, V221F, V225I, S226R, Alternatively, the site mutations of the M protein include N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R. Alternatively, the site mutations of the M protein include G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R, or the site mutations of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R, Alternatively, the site mutations of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R, Alternatively, the site mutations of the M protein include N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R, or the site mutations of the M protein include N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R, Alternatively, the site mutations of the M protein include N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R, and compared to the amino acid sequence shown in Sequence ID No. 12, the site mutations of the G protein include V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H, Compared to the amino acid sequence shown in Sequence ID No. 14, the site variation of the N protein includes I14V, R155K, S353N, and compared to the amino acid sequence shown in Sequence ID No. 16, the site variation of the P protein includes R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, N237D. Compared to the amino acid sequence shown in Sequence ID No. 18, the site mutations in the L protein include S87P and I487T. A tumor treatment method characterized by combining an oncolytic virus vaccine with immune cells.

2. The recombinant oncolytic virus includes baculovirus. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

3. The aforementioned baculovirus includes vesicular stomatitis virus. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in item 2.

4. The tumor antigen is selected from hematopoietic tumor antigens and solid tumor antigens. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

5. The solid tumor antigens mentioned above are 5T4, RORl, EGFR, FcγRI, FcγRIIa, FcγRIIb, CD28, CD137, CTLA-4, HER-2, FAS, FAP, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related protein, LTβR, TRAIL receptor 1, TRAIL receptor 2, prostate-specific membrane antigen protein, prostate stem cell antigen protein, tumor-associated protein carbonic anhydrase IX, EGFR1, EGFRvIII, ErbB3, folate receptor, ephrin receptor, and PD. GFRa, ErbB-2, CD2, CD40, CD74, CD80, CD86, CCAM5, CCAM6, p53, cMet, HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, Chi Rosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin, Cripto, MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, Annexin I I, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, Neuropilin 1, Phosphatidylinositol Proteoglycan, EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGF-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL,This includes, but is not limited to, Claude 18.2, MUC1, and TPBG. The aforementioned hematopoietic tumor antigens are BCMA, CD4, CD5, CD7, CD10, FcγRIIIIa, FcγRIIIIb, CD19, CD20, CD22, CD23, CD30, CD33, CD34, CD37, CD38, CD44, CD47, CD56, CD70, CD117, CD123, CD138, CD174, CLL-1, ROR1, NKG2DL1 / 2, IL1R3, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3, SLAMF7, TCR This includes, but is not limited to, B-chain, ITGB7, k-1gG, TACI, TRBCI, LeY, and MUC1. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in feature 4.

6. The tumor antigen is selected from one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, cMet, Claude 18.2, MSLN, EGFR, VEGFR2, HER-2, TPBG, AFP, and MAGE-A10. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in item 5.

7. The tumor antigen expressed by the recombinant oncolytic virus is at least one or more. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

8. The immune cells are selected from T cells, NK cells, and M cells. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

9. The immune cells are selected from CAR-T cells, TCR-T cells, CAR-γδ-T cells, CAR-Crispered-T cells, STAR-T cells, CAR-NK cells and CAR-M cells. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

10. The immune cells are selected from autologous cells, allogeneic cells, or immune cells derived from IPSCs. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

11. The aforementioned immune cells include immune cells that have proliferated outside the body. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

12. The number of antigen receptors expressed by the immune cells is at least one or more. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

13. The recombinant oncolytic virus further comprises cytokines encoded by exogenous genes. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

14. The cytokines are selected from interleukins, interferons, tumor necrosis factor, colony-stimulating factor, transforming growth factor β, and the chemokine family. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in 13.

15. The cytokines are selected from one or more of the following: GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β, and TNF-α. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in 14.

16. The cytokine is selected from one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, IFN-β, and TNF-α. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in 15.

17. The recombinant oncolytic virus comprises a nucleic acid molecule, the nucleic acid molecule comprising a nucleic acid sequence encoding the M protein having site mutations, a nucleic acid sequence encoding the G protein having site mutations, a nucleic acid sequence encoding the N protein having site mutations, a nucleic acid sequence encoding the P protein having site mutations, a nucleic acid sequence encoding the L protein having site mutations, a nucleic acid sequence encoding the tumor antigen, and a nucleic acid sequence encoding the cytokine. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

18. In the nucleic acid molecule, the nucleic acid sequence encoding the tumor antigen is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having a site mutation. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in 17.

19. In the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in 17.

20. In the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the tumor antigen and the nucleic acid sequence encoding the site-mutated L protein, or between the nucleic acid sequence encoding the site-mutated G protein and the nucleic acid sequence encoding the tumor antigen. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in 17.

21. The aforementioned oncolytic virus vaccine combined with immune cells is used as a tumor therapy to continuously kill abnormally proliferating cells. A tumor treatment method combining the oncolytic virus vaccine and immune cells as described in item 1.

22. The abnormally proliferating cells are selected from tumor cells or tumor tissue-associated cells. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in 21.

23. The aforementioned tumor includes a solid tumor or a hematoma. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in 21.

24. The aforementioned tumors include acute lymphoblastic leukemia, acute B lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymal tumor, esophageal cancer, diffuse large B cell lymphoma, sensory neuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma, hypopharyngeal cancer, and This includes, but is not limited to, Posi's sarcoma, renal cancer, Langhans cell proliferative disorder, pharyngeal cancer, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and hemangiomas. A tumor treatment method combining an oncolytic virus vaccine and immune cells as described in 21.

25. A composition, The composition comprises the oncolytic virus vaccine and immune cells described in claim 1. A composition characterized by the following features.