RNA molecule encoding RSV-F and vaccine containing it

RNA-LNPs encoding RSV proteins address the challenge of maintaining the pre-fusion conformation of the F protein, inducing robust immune responses to enhance RSV vaccine efficacy.

JP2026512632AInactive Publication Date: 2026-04-20PFIZER INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025523515
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-09-26
Filing Date
2023-10-26
Publication Date
2026-04-20
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Existing RSV vaccines, particularly those based on the F protein, face challenges in maintaining the pre-fusion conformation of the RSV F protein, which is crucial for inducing effective neutralizing antibodies, and there is a need for improved immunogenic compositions to provide protection against RSV infection.

Method used

Development of immunogenic RNA compositions, including RNA molecules encoding RSV proteins or their variants, optimized with structural elements and complexed with lipids and/or proteins to form RNA-LNPs, which are administered to induce both B cell- and T cell-mediated immune responses.

Benefits of technology

The RNA-LNPs effectively induce immune responses, including antibody production and T cell activation, enhancing protection against RSV infection by promoting the formation of pre-fusion-specific antibodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026512632000065
    Figure 2026512632000065
  • Figure 2026512632000066
    Figure 2026512632000066
  • Figure 2026512632000067
    Figure 2026512632000067
Patent Text Reader

Abstract

This disclosure relates to RNA molecules encoding respiratory syncytial virus (RSV). This disclosure further relates to compositions comprising RNA molecules formulated in lipid nanoparticles (RNA-LNPs). This disclosure further relates to the use of RNA molecules, RNA-LNPs, and compositions for the treatment and / or prevention of RSV infection-induced acute respiratory tract diseases, including pneumonia and bronchitis.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the benefits of U.S. Provisional Application No. 63 / 585,254, filed on 26 September 2023, and U.S. Provisional Application No. 63 / 381,238, filed on 27 October 2022. The entire contents of each of the above applications are incorporated herein by reference.

[0002] Sequence listing reference This application has been filed electronically via EFS-Web and includes an electronically filed sequence listing in .xml format. The .xml file contains a sequence listing named "PC072895A Sequence Listing.xml", created on September 25, 2023, and having a size of 145KB. The sequence listing contained in this .xml file is part of this specification and is incorporated herein by reference in its entirety. [Background technology]

[0003] Respiratory syncytial virus (RSV) is a respiratory virus that infects the lungs and respiratory tract. RSV is a leading cause of serious viral lower respiratory tract illness in infants worldwide, and a significant cause of respiratory illness in the elderly. Two RSV protein subunit vaccines, ABRYSVO (Pfizer) and AREXVY (GSK), were approved in 2023. However, RNA vaccines are not approved for the prevention of RSV infection.

[0004] RSV is a member of the Pneumoviridae family. Its genome consists of a single-stranded minus-sense RNA molecule encoding 11 proteins, including 9 structural proteins (3 glycoproteins and 6 internal proteins) and 2 non-structural proteins. The structural proteins include three transmembrane surface glycoproteins: adhesion protein G, fusion protein F, and small hydrophobic SH protein. There are two subtypes of RSV, A and B. They differ mainly in the G glycoprotein, but the sequence of the F glycoprotein is more conserved between the two subtypes.

[0005] Mature F glycoprotein has three common domains: an ectodomain (ED), a transmembrane domain (TM), and a cytoplasmic tail (CT). The CT contains a single palmitoylated cysteine ​​residue.

[0006] The human RSV F glycoprotein is first translated from mRNA as a single 574-amino acid polypeptide precursor (referred to as "F0" or "F0 precursor") containing a signal peptide sequence (amino acids 1-25) at its N-terminus. During translation, the signal peptide is removed in the endoplasmic reticulum by signal peptidases. The remaining portion of the F0 precursor (i.e., residues 26-574) can be further cleaved at two polybasic sites (aa109 / 110 and 136 / 137) by cellular proteases (particularly furin), removing a 27-amino acid intervening sequence designated as pep27 (amino acids 110-136) and generating two ligated fragments designated as F1 (C-terminal portion; amino acids 137-574) and F2 (N-terminal portion; amino acids 26-109). F1 contains a hydrophobic fusion peptide and two heptad repeat regions (HRA and HRB) at its N-terminus. HRA is close to the fusion peptide, and HRB is close to the TM domain. The F1 and F2 fragments are linked to each other through two disulfide bonds. Either the uncleaved F0 protein without the signal peptide sequence or the F1-F2 heterodimer can form the RSV F protomer. Three such protomers assemble to form the final RSV F protein complex, which is a homotrimer of the three protomers.

[0007] Subtypes A and B of the F protein are approximately 90 percent identical in their amino acid sequences. An example of the F0 precursor polypeptide sequence for subtype A is provided in SEQ ID NO: 1 (A2 strain; GenBank GI: 138251; Swiss Prot P03420), and an example for subtype B is provided in SEQ ID NO: 2 (18537 strain; GenBank GI: 138250; Swiss Prot P13843). Both SEQ ID NO: 1 and SEQ ID NO: 2 are 574 amino acid sequences. The signal peptide sequences for SEQ ID NO: 1 and SEQ ID NO: 2 are also reported as amino acids 1-25 (GenBank and UniProt). In both sequences, the TM domain is approximately amino acids 530-550, but is alternatively reported as 525-548. The cytoplasmic tail begins at either amino acid 548 or 550 and ends at amino acid 574, with a palmitoylated cysteine ​​residue located at amino acid 550.

[0008] The RSV F protein is the primary antigen being investigated for RSV vaccines. The RSV F protein trimer mediates fusion between the virion membrane and the host cell membrane and also promotes syncytial formation. In virions before fusion with the host cell membrane, the largest population of F molecules forms a lollipop-shaped structure, and the TM domain is tethered to the viral envelope [Dormitzer, PR, Grandi, G., Rappuoli, R., Nature Reviews Microbiol, 10, 807, 2012]. This conformation is referred to as the pre-fusion conformation. Pre-fusion RSV F is recognized by monoclonal antibodies (mAbs) D25, AM22, and MPE8 without distinguishing between oligomeric states. The pre-fusion F trimer is specifically recognized by mAb AM14 [Gilman MS, Moin SM, Mas V et al., PLoS Pathogens, 11(7), 2015]. As the RSV enters the cell, the F protein rearranges from its pre-fusion state (sometimes referred to herein as "pre-F") to its post-fusion state ("post-F") through an intermediate extended structure. During this rearrangement, the C-terminal coiled coil of the pre-fusion molecule dissociates into its three constituent chains, which then encapsulate a spherical head and, together with three additional helices, form a post-fusion six-helix bundle. The pre-fusion RSV F trimer undergoes structural changes when subjected to increasingly severe chemical or physical conditions, such as increased temperature. This first involves loss of trimer structure (at least locally within the molecule), followed by rearrangement to the post-fusion form, and then domain denaturation.

[0009] To prevent viral entry, F-specific neutralizing antibodies must bind, presumably, to the pre-fusion conformation of F on the virion, or potentially to a spread intermediate, before the viral envelope fuses with the cell membrane. Therefore, the pre-fusion form of the F protein is considered to be a preferred conformation as a desired vaccine antigen [Ngwuta, JO, Chen, M., Modjarrad, K., Joyce, MG, Kanekiyo, M., Kumar, A., Yassine, HM, Moin, SM, Killikelly, AM, Chuang, GY, Druz, A., Georgiev, IS, Rundlet, EJ, Sastry, M., Stewart-Jones, GB, Yang, Y., Zhang, B., Nason, MC, Capella, C., Peeples, M., Ledgerwood, JE, McLellan, JS, Kwong, PD, Graham, BS, Science Translat. Med., 14, 7, 309 (2015)].During extraction from membranes with surfactants such as Triton X-100, Triton X-114, NP-40, Brij-35, Brij-58, Tween 20, Tween 80, octylglucoside, octylthioglucoside, SDS, CHAPS, CHAPSO, etc., or during expression as an ectodomain, physical or chemical stress, or storage, F glycoproteins are readily converted to their post-fusion form. [McLellan JS, Chen M, Leung S et al., Structure of RSV fusion glycoprotein trimer bound to a pre-fusion-specific neutralizing antibody. Science 340, 1113~1117 (2013); Chaiwatpongsakorn, S., Epand, RF, Collins, PL, Epand RM, Peeples, ME, J Virol. 85(8):3968~77 (2011); Yunus, AS, Jackson] [TP, Crisafi, K., Burimski, I., Kilgore, NR, Zoumplis, D., Allaway, GP, Wild, CT, Salzwedel, K. Virology. 2010 Jan 20;396(2):226~37]. Therefore, the preparation of pre-fusion F as a vaccine antigen remains a challenge. Since neutralizing and protective antibodies function by preventing viral entry, it is assumed that F antigens that do not induce pre-fusion specific antibodies are not expected to be as effective as F antigens that induce pre-fusion specific antibodies. Therefore, it is considered more desirable to use an F protein vaccine containing a pre-fusion form of F protein immunogen. Mutants of the RSV F protein have been provided to increase pre-fusion stability (see, for example, PCT application 2017 / 109629 brochure) and are promising vaccine candidates.

[0010] RSV vaccines incorporating the F protein antigen are under development. Clinical studies have shown that some F protein subunit-based vaccine candidates are safe and immunogenic, although improvements in protective efficacy and duration of protection are desirable. [Overview of the project] [Problems that the invention aims to solve]

[0011] Therefore, improved immunogenic compositions are needed to provide protection against RSV infection.

[0012] [Means for solving the problem]

[0013] This disclosure, as provided herein, provides, among other things, an unmet need for improved immunogenic compositions for RSV infection. In one embodiment, this disclosure provides immunogenic compositions and methods for preventing, treating or alleviating an infection, disease or condition in a subject, comprising the administration of an amino acid sequence, for example, an RNA molecule encoding an immunogenic antigen, for example, an immunogenic RNA polynucleotide, comprising a respiratory syncytial virus (RSV) protein, its immunogenic variant, or an immunogenic fragment of the RSV protein or its immunogenic variant, for example, an antigen peptide or protein. Thus, the immunogenic antigen comprises an epitope of the RSV protein for inducing an immune response against RSV in a subject. The RNA polynucleotide encoding the immunogenic antigen is administered to provide the antigen (after expression of the polynucleotide by appropriate target cells) for an immune response, for example, induction of antibodies and / or immune effector cells, for example, stimulation, priming, and / or proliferation. In one embodiment, the immune response induced in accordance with this disclosure is both a B cell-mediated immune response, e.g., an antibody-mediated immune response, and a T cell-mediated immune response. In one embodiment, the immune response is an anti-RSV immune response.

[0014] The immunogenic compositions described herein include an RNA molecule (as an active ingredient) containing RNA that can be translated into one or more proteins in recipient cells. In addition to wild-type, codon-optimized, or mutant sequences encoding an antigen sequence, the RNA molecule may contain one or more structural elements (5' cap, 5' UTR, subgenome promoter, 3' UTR, poly-A tail) optimized for the maximum efficacy of the RNA in terms of stability and translation efficiency. In one embodiment, the RNA molecule contains all of these elements. The RNA molecules described herein may be complexed with lipids and / or proteins to generate RNA particles (e.g., lipid nanoparticles (LNPs)) for administration. In one embodiment, the RNA molecule described herein is complexed with lipids to generate RNA-lipid nanoparticles (e.g., RNA-LNPs) for administration. In one embodiment, the RNA molecule described herein is complexed with proteins for administration. In one embodiment, the RNA molecule described herein is complexed with lipids and proteins for administration. When different combinations of RNA molecules are used, the RNA molecules may be complexed with lipids and / or proteins to produce RNA particles for administration, or they may be complexed separately from lipids and / or proteins.

[0015] This disclosure provides RNA molecules and RNA-LNPs comprising at least one open reading frame (ORF) encoding an RSV antigen. In some embodiments, the RSV antigen is an RSV polypeptide. In some embodiments, the RSV polypeptide is an RSV F protein. In some embodiments, the RSV F protein is its full length, cleaved form, fragment, or variant. In some embodiments, the RSV F protein comprises at least one mutation.

[0016] This disclosure provides RNA molecules and RNA-LNPs comprising at least one ORF encoding an RSV polypeptide from Table 1. In some embodiments, the RSV polypeptide comprises an amino acid sequence selected from SEQ ID NOs: 1-6 or 71-74. In some embodiments, the RSV polypeptide has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity to any of the amino acid sequences from Table 1, for example, SEQ ID NOs: 1-6 or 71-74, or has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity, or has up to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity. In some embodiments, the RSV polypeptide consists of any of the amino acid sequences in Table 1, for example, SEQ ID NOs: 1-6 or 71-74.

[0017] This disclosure provides RNA molecules and RNA-LNPs comprising at least one ORF transcribed from at least one DNA nucleic acid from Table 2. In some embodiments, the RNA molecule is transcribed from a nucleic acid sequence selected from SEQ ID NOs. 7-10 or 59-62. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher % identity to any of the nucleic acid sequences in Table 2, for example, SEQ ID NOs. 7-10 or 59-62, or having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher % identity, or having up to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher % identity. In some embodiments, the RNA molecule includes an ORF transcribed from one of the nucleic acid sequences in Table 2, for example, one of the nucleic acid sequences consisting of SEQ ID NOs. 7-10 or 59-62.

[0018] This disclosure further provides RNA molecules and RNA-LNPs comprising at least one ORF containing an RNA nucleic acid sequence from Table 3. In some embodiments, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NOs. 11-16 or 63-70. In some embodiments, the RNA molecule comprises a nucleic acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any of the nucleic acid sequences from Table 3, for example, SEQ ID NOs. 11-16 or 63-70, or having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, or having up to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. In some embodiments, the RNA molecule comprises a nucleic acid sequence consisting of one of the nucleic acid sequences in Table 3, for example, one of sequence numbers 11-16 or 63-70. In some embodiments, each uridine in one of sequence numbers 11-16 is replaced by N1-methylpseudridine (Ψ) (e.g., modified RNA; modRNA).

[0019] This disclosure further provides RNA molecules and RNA-LNPs comprising a 5' untranslated region (5'-UTR) and / or a 3' untranslated region (3'-UTR). In some embodiments, the RNA molecule comprises a 5' untranslated region (5'-UTR). In some embodiments, the 5'UTR comprises a sequence selected from any of SEQ ID NOs. 17-19. In some embodiments, the 5'UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity to any of SEQ ID NOs. 17-19.

[0020] In some embodiments, RNA molecules and RNA-LNPs include a 3' untranslated region (3'-UTR). In some embodiments, the 3'UTR includes a sequence selected from any of SEQ ID NOs. 20-25. In some embodiments, the 3'UTR includes a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity to any of SEQ ID NOs. 20-25. In some embodiments, the 3'UTR includes a sequence selected from any of SEQ ID NOs. 20-25. In some embodiments, the 3'UTR includes a sequence consisting of any of SEQ ID NOs. 20-25.

[0021] This disclosure further provides RNA molecules and RNA-LNPs including a 5' cap portion. In some embodiments, the 5' cap portion is (3'OMe)-m2 7,3’-O Gppp(m1 2’-O This is ApG. The disclosure further provides RNA molecules and RNA-LNPs comprising a 3' polyA tail. In some embodiments, the polyA tail comprises a sequence having SEQ ID NO: 26.

[0022] In some embodiments, the RNA molecule includes a 5'UTR and a 3'UTR. In some embodiments, the RNA molecule includes a 5' cap, a 5'UTR, and a 3'UTR. In some embodiments, the RNA molecule includes a 5' cap, a 5'UTR, a 3'UTR, and a poly-A tail. In some embodiments, the RNA molecule includes a 5' cap, a 3'UTR, and a poly-A tail. In some embodiments, the RNA molecule includes a 5'UTR, a 3'UTR, and a poly-A tail. In some embodiments, one, two, three, or more of the above elements may be excluded from the RNA molecule. In some embodiments, each of the uridines in either the 5'UTR, the 3'UTR, or the poly-A tail is replaced by N1-methylpseudridine (Ψ) (e.g., modified RNA; modRNA).

[0023] In some embodiments, the length of the poly-A tail may contain +1 / -1 A. In some embodiments, the uridine is N1-methylpseudridine (Ψ).

[0024] This disclosure provides RNA molecules as listed in Table 5. In some embodiments, the RNA molecule comprises the 5'UTR of SEQ ID NO: 18, the RSV ORF of SEQ ID NO: 11, the 3'UTR of SEQ ID NO: 21, and / or the poly-A tail of SEQ ID NO: 26. In another embodiment, the RNA molecule comprises the 5'UTR of SEQ ID NO: 18, the RSV ORF of SEQ ID NO: 12, the 3'UTR of SEQ ID NO: 21, and / or the poly-A tail of SEQ ID NO: 26. In another embodiment, the RNA molecule comprises the 5'UTR of SEQ ID NO: 18, the RSV ORF of SEQ ID NO: 63, the 3'UTR of SEQ ID NO: 21, and / or the poly-A tail of SEQ ID NO: 26. In another embodiment, the RNA molecule comprises the 5'UTR of SEQ ID NO: 18, the RSV ORF of SEQ ID NO: 65, the 3'UTR of SEQ ID NO: 21, and / or the poly-A tail of SEQ ID NO: 26. In another embodiment, the RNA molecule comprises the 5'UTR of SEQ ID NO: 18, the RSV ORF of SEQ ID NO: 67, the 3'UTR of SEQ ID NO: 21, and / or the poly-A tail of SEQ ID NO: 26. In another embodiment, the RNA molecule comprises the 5'UTR of SEQ ID NO: 18, the RSV ORF of SEQ ID NO: 69, the 3'UTR of SEQ ID NO: 21, and / or the poly-A tail of SEQ ID NO: 26. In some embodiments, the RSV ORF further comprises the stop codons described herein. In some embodiments, the length of the poly-A tail may contain +1 / -1 A or +2 / -2 A. In some embodiments, each uridine in the RNA molecule is replaced by N1-methylpseudridine (Ψ) (e.g., modified RNA; modRNA).

[0025] This disclosure further provides RNA molecules comprising at least one open reading frame generated from codon-optimized DNA. In some embodiments, the open reading frame comprises at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%, up to 50%, 51%, 52%. , 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%, exactly 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63 %, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%, or 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 7 The G / C content includes a G / C content between any two of 4% or 75% (inclusive or exclusive), for example, at least 55%, at least 60%, at least 65%, at least 70%, and at least 75%, which are 50% to 75%, or about 50% to 75%, or 55% to 70%, or about 55% to 70%. In some embodiments, the G / C content is 58%, or about 58%, 66%, or about 66%, or 62%, or about 62%.

[0026] This disclosure further provides RNA molecules, including stabilized RNA. This disclosure further provides RNA molecules, including RNA having at least one modified nucleotide (e.g., modified RNA; modRNA). In some embodiments, the modified nucleotide is pseudouridine, N1-methylpseudridine, N1-ethylpseudridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudridine, 2-thio-1-methylpseudridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudridine, 2-thio-dihydrouridine, 2-thiopseudridine, 4-methoxy-2-thiopseudridine, 4-methoxypseudridine, 4-thio-1-methylpseudridine, 4-thiopseudridine, 5-aza-uridine, dihydropseudridine, 5-methoxyuridine, or 2'-O-methyluridine. In some embodiments, the modified nucleotide is N1-methylpseudridine(Ψ). In some embodiments, one, two, three, four, five, or more of the above modified nucleotides can be excluded from the RNA molecule.

[0027] This disclosure further provides RNA molecules that are messenger RNA (mRNA) or self-replicating RNA. In some embodiments, RNA is mRNA.

[0028] This disclosure further provides immunogenic compositions comprising RNA molecules as described herein. The RNA molecules may be formulated in lipid nanoparticles (LNPs) (e.g., RSV RNA-LNPs) in such immunogenic compositions, encapsulated therein, complexed therewith, bound thereto, or adsorbed thereto. In some embodiments, the lipid nanoparticles comprise at least one of cationic lipids, lipids conjugated to polymers (e.g., PEGylated lipids), and at least one structural lipid (e.g., neutral lipids and steroids or steroid analogs). In some embodiments, one, two, three, or more of the above lipids may be excluded from the lipid nanoparticles.

[0029] In some embodiments, the lipid nanoparticles include cationic lipids. In some embodiments, the cationic lipid is (4-hydroxybutyl)azandiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

[0030] In some embodiments, the lipid nanoparticles include lipids conjugated to a polymer. In some embodiments, the lipid nanoparticles include PEGylated lipids, also referred to as PEG lipids. In some embodiments, PEGylated lipids include glycol lipids containing PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxypolyethylene glycol)2000)carbamoyl]-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA), and PEG-2000-DMG, PEGylated diacylglycerol (PEG-DAG), e.g., 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG), and PEGylated These include phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG), e.g., 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanediate (PEG-S-DMG), PEGylated ceramide (PEG-cer), or PEG dialkoxypropyl carbamate, e.g., co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate. In some embodiments, 1, 2, 3, 4, 5, or more of the above PEGylated lipids may be excluded from the RNA molecule. In some embodiments, the PEGylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

[0031] In some embodiments, the lipid nanoparticles include at least one structural lipid, such as a neutral lipid. In some embodiments, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl These are 2-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), and / or 1,2-dierydoyl-sn-glycero-3-phosphoethanolamine (trans-DOPE). In some embodiments, 1, 2, 3, 4, 5, or more of the above structural lipids may be excluded from the RNA molecule. In some embodiments, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0032] In some embodiments, the lipid nanoparticles include a second structural lipid, such as a steroid or steroid analog. In some embodiments, the steroid or steroid analog is cholesterol.

[0033] In some embodiments, lipid nanoparticles range from approximately 1 to approximately 500 nm, for example, at least 1 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, 300 nm, 310 nm, 320 nm, 330 nm, 340 nm, 350 nm, 360 nm, 3 70nm, 380nm, 390nm, 400nm, 410nm, 420nm, 430nm, 440nm, 450nm, 460nm, 470nm, 480nm, 490nm, or 500nm, up to 1nm, 10nm, 20nm, 30nm, 40nm, 50nm, 60nm, 70nm, 80nm, 90nm, 100nm, 110nm, 120nm, 130nm, 140nm, 150nm, 160nm, 170nm, 180nm, 190nm, 200nm, 210nm, 220nm, 230nm, 240nm, 250nm, 260nm, 270nm, 280 nm, 290nm, 300nm, 310nm, 320nm, 330nm, 340nm, 350nm, 360nm, 370nm, 380nm, 390nm, 400nm, 410nm, 420nm, 430nm, 440nm, 450nm, 460nm, 470nm, 480nm, 490nm, or 500nm, exactly 1nm, 10nm, 20nm, 30nm, 40nm, 50nm, 60nm, 70nm, 80nm, 90nm, 100nm, 110nm, 120nm, 130nm, 140nm, 150nm, 160nm, 170nm, 180nm, 190nm m, 200nm, 210nm, 220nm, 230nm, 240nm, 250nm, 260nm, 270nm, 280nm, 290nm, 300nm, 310nm, 320nm, 330nm, 340nm, 350nm, 360nm, 370nm, 380nm, 390nm, 400nm, 410nm, 420nm, 430nm, 440nm, 450nm, 460nm, 470nm, 480nm, 490nm, or 500nm, or 1nm, 10nm, 20nm, 30nm, 40nm, 50nm, 60nm, 70nm, 80nm, 90nm, 100nm,It has an average diameter between any two of the following (inclusive or exclusive): 110nm, 120nm, 130nm, 140nm, 150nm, 160nm, 170nm, 180nm, 190nm, 200nm, 210nm, 220nm, 230nm, 240nm, 250nm, 260nm, 270nm, 280nm, 290nm, 300nm, 310nm, 320nm, 330nm, 340nm, 350nm, 360nm, 370nm, 380nm, 390nm, 400nm, 410nm, 420nm, 430nm, 440nm, 450nm, 460nm, 470nm, 480nm, 490nm, or 500nm.

[0034] In some embodiments, the RNA-LNP immunogenic composition is 0.8 to 0.95 mg / mL or approximately 0.8 to 0.95 mg / mL (for example, at least 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, and at most 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, precisely). to 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, or between any two of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL (inclusive or exclusive)), cationic lipids in concentrations of 0.05-0.15 mg / mL or approximately 0.05-0.15 mg / mL ( For example, at least 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, up to 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, exactly 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, or 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, PEGylated lipids at concentrations between any two of 0.13, 0.14, or 0.15 mg / mL (inclusive or exclusive), 0.1–0.25 mg / mL, or approximately 0.1–0.25 mg / mL (e.g., at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, with a maximum of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, or between any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL (inclusive or exclusive) The concentration of the first structural lipid, and 0.3-0.45 mg / mL or approximately 0.3-0.45 mg / mL (for example, at least 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, and at most 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, exactly 0. An LNP having a lipid composition containing a second structural lipid at a concentration between any two of the following (inclusive or exclusive): 30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, or 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL (inclusive or exclusive), encapsulated within an LNP Also 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, at most 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL (inclusive or exclusive), preferably 0.01 to 0.09 mg / mL or about 0.01 to 0.The liquid RNA-LNP composition comprises a polynucleotide encoding an RNA molecule / RSV polypeptide disclosed herein at a concentration of 0.9 mg / mL. In some embodiments, the liquid composition is 0.1–0.3 mg / mL or about 0.1–0.3 mg / mL (e.g., at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, with a maximum of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21) 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, or 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0. A first buffer at a concentration between any two of the following (inclusive or exclusive): 21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, with a maximum of 1.25–1.4 mg / mL or approximately 1.25–1.4 mg / mL (e.g., at least 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL, with a maximum of 1.25, 1.26 , 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL, exactly 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL, or 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.A second buffer at a concentration between any two of 36, 1.37, 1.38, 1.39, or 1.40 mg / mL (inclusive or exclusive), and 95-110 mg / mL or approximately 95-110 mg / mL (e.g., at least 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL, and at most 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 1 The buffering composition further comprises a stabilizer in a concentration of 0.6, 10.7, 10.8, 10.9, or 110 mg / mL, precisely 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 10.9, or 110 mg / mL, or between (inclusive or exclusive) any two of the following: 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 10.9, or 110 mg / mL. In some embodiments, one, two, three, four, five, or more of the above elements may be excluded from the liquid RNA-LNP composition. In some embodiments, one, two, three, four, five, or more of the above element concentrations may be excluded from the liquid RNA-LNP composition.

[0035] In a specific embodiment, the liquid RNA-LNP immunogenic composition is 0.8 to 0.95 mg / mL or approximately 0.8 to 0.95 mg / mL (for example, at least 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, and at most 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, positive ((4-hydroxybutyl)azandiyl)bis(hexane-6,1-diyl)bis(2) mg / mL at concentrations of exactly 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, or between any two of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL (inclusive or exclusive). -Hexyldecanoate) (ALC-0315), 0.05~0.15 mg / mL or approximately 0.05~0.15 mg / mL (for example, at least 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, up to 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, exactly 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, also Alternatively, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159) at a concentration of 0.15 mg / mL, or between any two of the following (inclusive or exclusive): 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, or 0.1-0.25 mg / mL or approximately 0.1-0.25 mg / mL (for example, at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, up to 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, or 0.10, 0.11, 0.12, 0.13, 0.14, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) at concentrations between any two of the following (inclusive or exclusive): 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, and 0.3-0.45 mg / mL or approximately 0.3-0.45 mg / mL (e.g., at least 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0. 45 mg / mL, up to 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, exactly 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, or 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40 Encapsulated within LNPs having a lipid composition containing cholesterol at a concentration between any two of the following (inclusive or exclusive): at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to a maximum of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or 0.01, 0.15, 0.The solution contains polynucleotides encoding the RNA molecule / RSV polypeptide disclosed herein, in a concentration between (inclusive or exclusive) any two of 30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably 0.01–0.09 mg / mL or about 0.01–0.09 mg / mL. In some embodiments, the liquid composition is 0.1 to 0.3 mg / mL or about 0.1 to 0.3 mg / mL (for example, at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, with a maximum of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0. 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, precisely 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, or 0.10, 0.11, 0.12, 0.13, Tromethamine in concentrations between any two of the following (inclusive or exclusive): 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL, and 1.25–1.4 mg / mL or approximately 1.25–1.4 mg / mL (e.g., at least 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1. 33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL, up to a maximum of 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL, exactly 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.Tris hydrochloride (HCl) at concentrations of 39 or 1.40 mg / mL, or between any two of 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL (inclusive or exclusive), and 95–110 mg / mL or approximately 95–110 mg / mL (for example, at least 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL, maximum The Tris buffering composition further comprises sucrose in a concentration of 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL, precisely 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL (either between any two of these (inclusive or exclusive)). In some embodiments, one, two, three, four, five, or more of the above elements may be excluded from the liquid RNA-LNP composition. In some embodiments, one, two, three, four, five, or more of the above element concentrations may be excluded from the liquid RNA-LNP composition.

[0036] In some embodiments, the liquid RNA-LNP immunogenic composition contains encapsulated LNPs in a concentration of at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to a maximum of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL (inclusive or exclusive), preferably 0.01 to 0.09 mg / mL or about 0.01 to 0.0 A polynucleotide encoding an RNA molecule / RSV polypeptide disclosed herein, at a concentration of 9 mg / mL, and with a range of 7.0–8.0 or approximately 7.0–8.0 (e.g., at least 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, at most 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, exactly 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.A pH between any two of 0 (inclusive or exclusive) of 5-15 mM or approximately 5-15 mM Tris buffer (e.g., at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mM, up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mM, exactly 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 1 5 mM, or any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mM (inclusive or exclusive)), and sucrose in 200-400 mM or approximately 200-400 mM (e.g., at least 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 35 mM 0, 360, 370, 380, 390, or 400mM, with a maximum of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400mM, precisely 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, The composition further includes concentrations of 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 mM, or between any two of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 mM (inclusive or exclusive). In some embodiments, one, two, three, or more of the above elements may be excluded from the liquid RNA-LNP composition. In some embodiments, one, two, three, four, five, or more of the above element concentrations may be excluded from the liquid RNA-LNP composition.

[0037] In some embodiments, the RNA-LNP immunogenic composition is 0.8 to 0.95 mg / mL or approximately 0.8 to 0.95 mg / mL (for example, at least 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, and at most 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, precisely). to 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, or between any two of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL (inclusive or exclusive)), cationic lipids in concentrations of 0.05-0.15 mg / mL or approximately 0.05-0.15 mg / mL ( For example, at least 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, up to 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, exactly 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, or 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, PEGylated lipids at concentrations between any two of 0.13, 0.14, or 0.15 mg / mL (inclusive or exclusive), 0.1–0.25 mg / mL, or approximately 0.1–0.25 mg / mL (e.g., at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, with a maximum of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, or between any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL (inclusive or exclusive) The concentration of the first structural lipid, and 0.3-0.45 mg / mL or approximately 0.3-0.45 mg / mL (for example, at least 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, and at most 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, exactly 0. An LNP having a lipid composition containing a second structural lipid at a concentration between any two of the following (inclusive or exclusive): 30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, or 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL (inclusive or exclusive), encapsulated within an LNP Also 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, at most 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL (inclusive or exclusive), preferably 0.01 to 0.09 mg / mL or about 0.01 to 0.The lyophilized (restored) RNA-LNP composition contains polynucleotides encoding the RNA molecule / RSV polypeptide disclosed herein at a concentration of 0.9 mg / mL. In some embodiments, the lyophilized composition is 0.01–0.15 mg / mL or about 0.01–0.15 mg / mL (e.g., at least 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, and at most 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12) 0.13, 0.14, or 0.15 mg / mL, exactly 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, or between any two of 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL A first buffering agent at a concentration of (inclusive or exclusive) 0.5-0.65 mg / mL or approximately 0.5-0.65 mg / mL (e.g., at least 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, up to 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, exactly 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, or 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.A second buffer at a concentration between any two of the following (inclusive or exclusive) (65 mg / mL), 35-50 mg / mL or approximately 35-50 mg / mL (for example, at least 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, up to 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, exactly 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, or 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 4 The solution further comprises a stabilizer in a concentration between any two of 6, 47, 48, 49, or 50 mg / mL (inclusive or exclusive), and a salt diluent in a concentration of 5–15 mg / mL or approximately 5–15 mg / mL (for example, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, up to a maximum of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, exactly 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, or between any two of any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL (inclusive or exclusive)). In a specific embodiment, the lyophilized composition contains 0.6 to 0.75 mL or about 0.6 to 0.75 mL of salt diluent (e.g., at least 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL, and a maximum of 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70) 0.71, 0.72, 0.73, 0.74, or 0.75 mL, exactly 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL, or 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.The RNA-LNP composition is restored within any two of the 75 mL (inclusive or exclusive). The concentration in the lyophilized RNA-LNP composition is determined after restoration. In some embodiments, one, two, three, four, five, or more of the above elements may be excluded from the lyophilized RNA-LNP composition. In some embodiments, the concentrations of one, two, three, four, five, or more of the above elements may be excluded from the lyophilized RNA-LNP composition.

[0038] In a specific embodiment, the lyophilized (restored) RNA-LNP composition contains 0.8–0.95 mg / mL or approximately 0.8–0.95 mg / mL (for example, at least 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, and at most 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0. ALC-0315 at concentrations of 95 mg / mL, exactly 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL, or between any two of the following (inclusive or exclusive): 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL (inclusive or exclusive), 0.05~0.15 mg / mL, or approximately 0.05 ~0.15 mg / mL (for example, at least 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, with a maximum of 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, exactly 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, or 0.05, 0.06, 0.07, 0.08, 0.09, 0.10) ALC-0159 at concentrations between any two of the following (inclusive or exclusive): 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, 0.1 to 0.25 mg / mL, or approximately 0.1 to 0.25 mg / mL (for example, at least 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, with a maximum of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, exactly 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL, or between any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL (inclusive) DSPC at concentrations of 0.3-0.45 mg / mL or approximately 0.3-0.45 mg / mL (for example, at least 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, and at most 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL) A small amount of cholesterol encapsulated in LNPs having a lipid composition of cholesterol at a concentration exactly between any two of the following (inclusive or exclusive): 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL, or 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL. At most 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, at most 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL (inclusive or exclusive), preferably 0.01 to 0.09 mg / mL or about 0.01 to 0.The present invention comprises RNA polynucleotides encoding the RSV polypeptide disclosed herein at a concentration of 0.9 mg / mL, and is present in concentrations of 0.01 to 0.15 mg / mL or approximately 0.01 to 0.15 mg / mL (e.g., at least 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, with a maximum of 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, exactly 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL, or 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg Tromethamine in concentrations between any two of the following (inclusive or exclusive) (0.5–0.65 mg / mL) and 0.5–0.65 mg / mL or approximately 0.5–0.65 mg / mL (e.g., at least 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, with a maximum of 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0. 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, exactly 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL, or 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.Tris (concentration between any two of the following 65 mg / mL values ​​(inclusive or exclusive)) HCl, 35-50 mg / mL or approximately 35-50 mg / mL (for example, at least 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, at most 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, exactly 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL, or any two of 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL) The Tris buffering composition further comprises sucrose in a concentration between two (inclusive or exclusive) and a sodium chloride (NaCl) diluent in a concentration between 5 and 15 mg / mL or approximately 5 and 15 mg / mL (for example, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, exactly 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL, or between any two of the above (inclusive or exclusive)). In a specific embodiment, the freeze-dried composition contains 0.6 to 0.75 mL or about 0.6 to 0.75 mL of sodium chloride (for example, at least 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL, and up to 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.6 8, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL, exactly 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL, or 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.The RNA-LNP composition is restored in any two of the following volumes (inclusive or exclusive): 72, 0.73, 0.74, or 0.75 mL. The concentration in the lyophilized RNA-LNP composition is determined after restoration. In some embodiments, one, two, three, four, five, or more of the above elements may be excluded from the lyophilized RNA-LNP composition. In some embodiments, one, two, three, four, five, or more of the above element concentrations may be excluded from the lyophilized RNA-LNP composition.

[0039] This disclosure provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered to a target in doses per dose of at least 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, 90 μg, 100 μg or higher, up to 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, 90 μg, 100 μg or higher, exactly 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, 90 μg, 100 μg or higher, or between (inclusive or exclusive) any two of the following per doses of RSV RNA encapsulated in LNPs. In some embodiments, concentrations of 1, 2, 3, 4, 5, or more of the RSV RNA encapsulated in the above LNPs may be excluded.

[0040] This disclosure provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered in single doses. This disclosure provides two doses (for example, day 0 and day 7 or about day 7, day 0 and day 14 or about day 14, day 0 and day 21 or about day 21, day 0 and day 28 or about day 28, day 0 and day 60 or about day 60, day 0 and day 90 or about day 90, day 0 and day 120 or about day 120, day 0 and day 150 or about day 150, day 0 and day 180 or about day 180, day 0 and one month later or about one month later, day 0) The disclosure further provides RNA molecules, RNA-LNPs, and immunogenic compositions that may be administered on day 0 and 2 months or approximately 2 months later, day 0 and 3 months or approximately 3 months later, day 0 and 6 months or approximately 6 months later, day 0 and 9 months or approximately 9 months later, day 0 and 12 months or approximately 12 months later, day 0 and 18 months or approximately 18 months later, day 0 and 2 years or approximately 2 years later, day 0 and 5 years or approximately 5 years later, or day 0 and 10 years or approximately 10 years later. The disclosure further provides RNA molecules, RNA-LNPs, and immunogenic compositions that may be administered twice on day 0 and 2 months or approximately 2 months later. The disclosure further provides RNA molecules, RNA-LNPs, and immunogenic compositions that may be administered twice on day 0 and 6 months or approximately 6 months later. This disclosure further provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more times. In some embodiments, periodic boosters at intervals of 1 to 5 years may be desired to maintain protective levels of the antibody. This disclosure further provides administration of at least one booster dose. In some embodiments, 1, 2, 3, 4, 5, or more of the above dosing regimens may be excluded.

[0041] This disclosure provides a method for inducing an immune response to RSV in a subject, comprising administering to the subject an effective amount of an RNA molecule, RNA-LNP, and / or immunogenic composition described herein. This disclosure further provides the use of the RNA molecule, RNA-LNP, and / or immunogenic composition described herein in the production of a pharmaceutical for use in inducing an immune response to RSV in a subject.

[0042] This disclosure provides a method for inducing an immune response to RSV in a subject, comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or immunogenic composition containing at least one open reading frame encoding the RSV polypeptide described herein. This disclosure further provides the use of an RNA molecule and / or RNA-LNP or immunogenic composition containing at least one open reading frame encoding the RSV polypeptide described herein in the production of a pharmaceutical for use in inducing an immune response to RSV in a subject.

[0043] This disclosure provides a method for inducing an immune response to RSV in a subject, comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or composition containing at least one open reading frame encoding a polypeptide of a gene of interest described herein. This disclosure further provides the use of an RNA molecule and / or RNA-LNP or composition containing at least one open reading frame encoding a polypeptide of a gene of interest described herein in the production of a pharmaceutical for use in inducing an immune response to RSV in a subject.

[0044] This disclosure provides a method for preventing, treating, and / or alleviating an infection, disease, or condition in a subject, comprising administering to the subject an effective amount of the RNA molecule, RNA-LNP, and / or immunogenic composition described herein. This disclosure further provides the use of the RNA molecule, RNA-LNP, and / or immunogenic composition described herein in the production of a medicament for use in the prevention, treatment, and / or alleviation of an infection, disease, or condition in a subject. In some embodiments, the infection, disease, or condition is associated with RSV. In some embodiments, the infection, disease, or condition is an acute lower respiratory infection (ALRI), including pneumonia and bronchitis. In some embodiments, the infection, disease, or condition is an acute lower respiratory infection (ALRI), including pneumonia and bronchitis.

[0045] This disclosure provides a method for preventing, treating, and / or alleviating an infection, disease, or condition in a subject, comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or immunogenic composition containing at least one open reading frame encoding the RSV polypeptide described herein. This disclosure further provides the use of an RNA molecule and / or RNA-LNP or immunogenic composition containing at least one open reading frame encoding the RSV polypeptide described herein in the production of a medicament for use in the prevention, treatment, and / or alleviation of an infection, disease, or condition in a subject. In some embodiments, the infection, disease, or condition is associated with RSV. In some embodiments, the infection, disease, or condition is an acute lower respiratory infection (ALRI), including pneumonia and bronchitis.

[0046] This disclosure further provides a method for preventing, treating, and / or alleviating an infection, disease, or condition in a subject, comprising administering to the subject an RNA molecule and / or RNA-LNP or immunogenic composition containing at least one open reading frame encoding a polypeptide of a gene of interest described herein in an effective amount. This disclosure further provides the use of an RNA molecule and / or RNA-LNP or immunogenic composition containing at least one open reading frame encoding a polypeptide of a gene of interest described herein in the production of a medicament for use in the prevention, treatment, and / or alleviation of an infection, disease, or condition in a subject. In some embodiments, the infection, disease, or condition is associated with the gene of interest.

[0047] In some embodiments, the subjects are at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months of age, or 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or older, up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months of age, or 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or older, exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months of age, or 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or older, or between (inclusive or exclusive) any two of the following ages: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months of age, or 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or older.In some cases, the target group is under 1 year old, 1 year old or older, 5 years old or older, 10 years old or older, 20 years old or older, 30 years old or older, 40 years old or older, 50 years old or older, 60 years old or older, 70 years old or older, or older, or at least under 1 year old, 1 year old or older, 5 years old or older, 10 years old or older, 20 years old or older, 30 years old or older, 40 years old or older, 50 years old or older, 60 years old or older, 70 years old or older, or older. The ages are, or up to less than 1 year old, 1 year or older, 5 years or older, 10 years or older, 20 years or older, 30 years or older, 40 years or older, 50 years or older, 60 years or older, 70 years or older, or older, or about less than 1 year old, 1 year or older, 5 years or older, 10 years or older, 20 years or older, 30 years or older, 40 years or older, 50 years or older, 60 years or older, 70 years or older, or younger. In some embodiments, the subjects are 50 years old or about 50 years or older. In some embodiments, 1, 2, 3, 4, 5, or more of the above age groups do not receive RNA molecules and / or RNA-LNPs.

[0048] In some aspects, the subjects are immunocompetent. In other aspects, the subjects are immunocompromised.

[0049] This disclosure provides methods or uses described herein in which RNA molecules, RNA-LNPs and / or immunogenic compositions are administered as vaccines. This disclosure also provides methods or uses described herein in which RNA molecules, RNA-LNPs and / or immunogenic compositions are administered by intradermal, intramuscular, or intranasal injection.

[0050] Any aspect discussed herein may be carried out with respect to any method or composition of the Disclosure, and vice versa. Furthermore, any composition of the Disclosure may be used to achieve any method of the Disclosure.

[0051] Any method in the context of therapeutic, diagnostic, or physiological purposes or effects may also be described in the form of a “use” claim, such as “use” of any compound, composition, or agent discussed herein, for achieving or performing the described therapeutic, diagnostic, or physiological purpose or effect. The use of one or more compositions may be performed based on any of the methods described herein.

[0052] Other purposes, features, and advantages of this disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, while pointing to specific aspects of this disclosure, are given only as examples, and various modifications and alterations within the spirit and scope of this disclosure will become apparent to those skilled in the art from this detailed description. [Brief explanation of the drawing]

[0053] [Figure 1A]Figure 1A shows the immunogenicity of modRNA-LNP formulations of RSV 847 in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either the bivalent protein subunit (RSV 847A+B) or one of the RSV 847 constructs as either a monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulation. On day 35 (two weeks after dose 2, PD2), serum was collected for the RSV neutralization assay and spleen was collected for the T cell assay (ELISpot and intracellular cytokine staining, ICS assay). Figure 1A shows the neutralization assay results for RSV A, expressed as 50% neutralization titer (each symbol represents the titer from an individual animal; bars represent geometric mean titer (GMT)). [Figure 1B] Figure 1B shows the immunogenicity of modRNA-LNP formulations of RSV 847 in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either the bivalent protein subunit (RSV 847A+B) or one of the RSV 847 constructs as either a monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulation. On day 35 (two weeks after dose 2, PD2), serum was collected for the RSV neutralization assay and spleen was collected for the T cell assay (ELISpot and intracellular cytokine staining, ICS assay). Figure 1B shows the neutralization assay results for RSV B, expressed as 50% neutralization titer (each symbol represents the titer from an individual animal; the bar represents the geometric mean titer (GMT)). [Figure 1C]Figure 1C shows the immunogenicity of modRNA-LNP formulations of RSV 847 in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either the bivalent protein subunit (RSV 847A+B) or any of the RSV 847 constructs as either monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (two weeks after dose 2, PD2), serum was collected for the RSV neutralization assay and spleen was collected for the T cell assay (ELISpot and intracellular cytokine staining, ICS assay). Figure 1C shows the ELISpot assay results, measuring the number of IFN-γ-secreting RSV A+BF-specific cells, expressed as spot-forming cells (SFCs) per million cells. Bars and error bars depict the median and interquartile range. NA: Not analyzed. [Figure 1D] Figure 1D shows the immunogenicity of modRNA-LNP formulations of RSV 847 in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either the bivalent protein subunit (RSV 847A+B) or any of the RSV 847 constructs as either monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (two weeks after dose 2, PD2), serum was collected for the RSV neutralization assay and spleen was collected for the T cell assay (ELISpot and intracellular cytokine staining, ICS assay). Figure 1D shows the ICS assay results, measuring RSV A+BF-specific IFN-γ-expressing cells in CD4+ T cells, expressed as the percentage of IFN-γ+ cells. Bars and error bars depict the median and interquartile range. NA: Not analyzed. [Figure 1E]Figure 1E shows the immunogenicity of modRNA-LNP formulations of RSV 847 in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either the bivalent protein subunit (RSV 847A+B) or any of the RSV 847 constructs as either monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (two weeks after dose 2, PD2), serum was collected for the RSV neutralization assay and spleen was collected for the T cell assay (ELISpot and intracellular cytokine staining, ICS assay). Figure 1E shows the ICS assay results, measuring RSV A+BF-specific IFN-γ-expressing cells in CD8+ T cells, expressed as the percentage of IFN-γ+ cells. Bars and error bars depict the median and interquartile range. NA: Not analyzed. [Figure 2] Figure 2 shows the immunogenicity of modRNA-LNP formulations encoding different RSV A pre-F (preF) designs in mice. Female BALB / c mice (10 mice / group) were intramuscularly immunized at days 0 and 21 with 0.5 μg doses of modRNA-LNP formulations encoding the RSV A pre-F (preF) designs as expressed herein. On day 35 (2W PD2), serum was analyzed for the RSV A neutralization response, expressed as 50% neutralization titer. Each symbol represents the titer from an individual animal. Bars represent geometric mean titer (GMT). [Figure 3A]Figure 3A shows the immunogenicity of modRNA-LNP and saRNA-LNP preparations of pre-F (preF) RSV in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of the bivalent protein subunit (RSV preF A+B), or either a bivalent modRNA-LNP preparation or a bivalent saRNA-LNP preparation of the RSV preF construct. Serum was collected for RSV neutralization assays on day 21 (3W PD1) and day 35 (2W PD2), and spleen was collected for T-cell assays (intracellular cytokine staining, ICS assay) on day 35. Neutralization assay results are shown for RSV A and B, expressed as 50% neutralization titers in either 3W PD1 (Figures 3A and 3B) or 2W PD2 (Figures 3C and 3D). Each symbol represents the titer from an individual animal. The bars represent geometric mean titer (GMT). [Figure 3B] Figure 3B shows the immunogenicity of modRNA-LNP and saRNA-LNP preparations of pre-F (preF) RSV in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of bivalent protein subunits (RSV preF A+B), or either a bivalent modRNA-LNP preparation or a bivalent saRNA-LNP preparation of the RSV preF construct. Serum was collected for RSV neutralization assays on day 21 (3W PD1) and day 35 (2W PD2), and spleen was collected for T-cell assays (intracellular cytokine staining, ICS assay) on day 35. Neutralization assay results are shown for RSV A and B, expressed as 50% neutralization titers in either 3W PD1 (Figures 3A and 3B) or 2W PD2 (Figures 3C and 3D). Each symbol represents the titer from an individual animal. The bars represent geometric mean titer (GMT). [Figure 3C]Figure 3C shows the immunogenicity of modRNA-LNP and saRNA-LNP preparations of pre-F (preF) RSV in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of bivalent protein subunits (RSV preF A+B), or either a bivalent modRNA-LNP preparation or a bivalent saRNA-LNP preparation of the RSV preF construct. Serum was collected for RSV neutralization assays on day 21 (3W PD1) and day 35 (2W PD2), and spleen was collected for T-cell assays (intracellular cytokine staining, ICS assay) on day 35. Neutralization assay results are shown for RSV A and B as 50% neutralization titers in either 3W PD1 (Figures 3A and 3B) or 2W PD2 (Figures 3C and 3D). Each symbol represents the titer from an individual animal. The bars represent geometric mean titer (GMT). [Figure 3D] Figure 3D shows the immunogenicity of modRNA-LNP and saRNA-LNP preparations of pre-F (preF) RSV in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of bivalent protein subunits (RSV preF A+B), or either a bivalent modRNA-LNP preparation or a bivalent saRNA-LNP preparation of the RSV preF construct. Serum was collected for RSV neutralization assays on day 21 (3W PD1) and day 35 (2W PD2), and spleen was collected for T-cell assays (intracellular cytokine staining, ICS assay) on day 35. Neutralization assay results are shown for RSV A and B, expressed as 50% neutralization titers in either 3W PD1 (Figures 3A and 3B) or 2W PD2 (Figures 3C and 3D). Each symbol represents the titer from an individual animal. The bars represent geometric mean titer (GMT). [Figure 3E]Figure 3E shows the immunogenicity of modRNA-LNP and saRNA-LNP preparations of pre-F (preF) RSV in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of the bivalent protein subunit (RSV preF A+B), or either a bivalent modRNA-LNP preparation or a bivalent saRNA-LNP preparation of the RSV preF construct. Serum was collected for RSV neutralization assays on day 21 (3W PD1) and day 35 (2W PD2), and spleen was collected on day 35 for a T cell assay (intracellular cytokine staining, ICS assay). Figure 3E shows the ICS assay results measuring RSV preF A+BF-specific IFN-γ expressing cells in CD4+ T cells. Bars and error bars depict the median and interquartile range. NT: Not tested. [Figure 3F] Figure 3F shows the immunogenicity of modRNA-LNP and saRNA-LNP preparations of pre-F (preF) RSV in mice. Female BALB / c mice (10 mice / group) were immunized intramuscularly on days 0 and 21 with the indicated doses of bivalent protein subunits (RSV preF A+B), or either a bivalent modRNA-LNP preparation or a bivalent saRNA-LNP preparation of the RSV preF construct. Serum was collected for RSV neutralization assays on day 21 (3W PD1) and day 35 (2W PD2), and spleen was collected on day 35 for a T cell assay (intracellular cytokine staining, ICS assay). Figure 3F shows the ICS assay results measuring RSV preF A+BF-specific IFN-γ expressing cells in CD8+ T cells. Bars and error bars depict the median and interquartile range. NT: Not tested. [Figure 4]Figure 4 schematically shows the wild-type (WT) RSV F protein (RSV WT) and variant RSV F protein constructs, where "SP" refers to the signal peptide sequence (amino acid residues 1-25 of each construct), "TM" refers to the transmembrane peptide sequence corresponding to the portion of the protein that extends into the cell membrane, "CT" refers to the cytoplasmic tail peptide sequence corresponding to the portion of the protein that extends into the cytoplasm, and "ectodomain" refers to the peptide sequence corresponding to the portion of the protein that extends into the extracellular space, where the ectodomain contains amino acid residues 1-513 (without TM and CT, represented by "ΔTM & CT"). The amino acid positions of mutants for each portion (i.e., SP, F2, pep27, F1) or each construct are indicated therein; for example, the SP of each construct extends from amino acid residues 1-25 of each construct. [Modes for carrying out the invention]

[0054] Detailed explanation This disclosure provides RNA molecules (e.g., RNA polynucleotides) comprising at least one open reading frame (ORF) encoding a respiratory syncytial virus (RSV) antigen. In some embodiments, the RSV antigen is an RSV polypeptide. In some embodiments, the RSV polypeptide is an RSV F polypeptide. In some embodiments, the RSV polypeptide comprises an amino acid sequence listed in Table 1. In some embodiments, the RNA molecule comprises an ORF transcribed from at least one DNA nucleic acid sequence in Table 2. In some embodiments, the RNA molecule comprises an ORF comprising an RNA nucleic acid sequence in Table 3. In some embodiments, the RNA molecule comprises at least one of a 5' cap, 5' UTR, 3' UTR, and poly-A tail. In other embodiments, the RNA molecule comprises at least one of a 5' cap, 3' UTR, and poly-A tail. This disclosure provides RNA molecules comprising modified nucleotides (e.g., modified RNA; modRNA).

[0055] This disclosure provides an immunogenic composition comprising any one RNA molecule encoding an RSV polypeptide as described herein, which is complexed with one or more lipids, encapsulated within one or more lipids, or formulated using one or more lipids and forms lipid nanoparticles (RNA-LNPs). This disclosure further provides an immunogenic composition comprising any one RNA molecule comprising at least one RNA nucleic acid as described herein, which is complexed with one or more lipids, encapsulated within one or more lipids, or formulated using one or more lipids and forms RNA-LNPs. This disclosure further provides a method for preventing, treating, or alleviating an infection, disease, or condition in a subject (e.g., respiratory illnesses associated with RSV infection, including pneumonia and bronchitis) by administering an effective amount of the RNA molecule, RNA-LNP, or immunogenic composition described herein to the subject. This disclosure further provides the use of the RNA molecule, RNA-LNP, and / or immunogenic composition described herein as a vaccine.

[0056] The present invention can be more readily understood by referring to the following detailed description of embodiments of the invention and the examples included herein. It should be understood that the present invention is not limited to specific manufacturing methods, which may, of course, be modified. It should also be understood that the technical terms used herein are for the sole purpose of describing specific embodiments and are not intended to be limiting.

[0057] Section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described herein.

[0058] All references made herein, including patent applications, patent publications, and UniProtKB accession numbers, are incorporated herein by reference in the same way as each individual reference is specifically and individually indicated to be incorporated in whole by reference.

[0059] I. Examples of Definitions Unless otherwise defined herein, scientific and technical terms used in connection with the present invention have meanings that are generally understood by those skilled in the art.

[0060] Throughout this application, the terms “about,” “approximately,” and “substantially” are used in accordance with their plain and common meanings in the field of cell and molecular biology, indicating a deviation of ±10% from the value in which it is set. Accordingly, in any optionally disclosed embodiment, this term may be replaced with “within [percentage]” as defined. In one non-limiting embodiment, the percentages include 0.1, 0.5, 1, 5, and 10 percent.

[0061] The descriptions of value ranges in this specification are merely intended to serve as a simplified way of referring individually to each separate value that falls within that range. Unless otherwise indicated herein, each individual value is incorporated herein in the same way as if it were individually listed herein.

[0062] The use of the words "a" or "an," when used in combination with the term "contains," can mean "one," but also coincides with the meanings of "one or more," "at least one," and "one or more."

[0063] The phrase "and / or" means "and" or "or." For example, A, B, and / or C includes A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C. In other words, "and / or" functions as an inclusive "or."

[0064] The phrase “essentially all” is defined as “at least 95%”; if essentially all members of a group possess a certain characteristic, then at least 95% of the members of the group possess that characteristic. In some embodiments, “essentially all” means that the members of the group possess the characteristic if they are equal to or at least one of 95, 96, 97, 98, 99, or 100%, or if they are between two of 95, 96, 97, 98, 99, or 100%.

[0065] Compositions and methods of use thereof may “contain,” “essentially consist of,” or “consist of” any of the components or steps disclosed throughout this Spec. Throughout this Spec. unless the context otherwise requires, the words “comprising” (and any form of “comprising,” e.g., “comprise” and “comprises”), “having” (and any form of “having,” e.g., “have” and “has”), “including” (and any form of “including,” e.g., “includes” and “include”), or “containing” (and any form of “containing,” e.g., “contains” and “contain”) are understood to be inclusive or open-ended, implying that they include the steps or elements or groups of steps or elements described, but not exclude any other steps or elements or groups of steps or elements. The embodiments described herein in the context of the term “contains” are also expected to be implemented in the context of the terms “consisting of” or “essentially consisting of.” Compositions and methods “essentially consisting of” any of the disclosed components or steps limit the scope of the claims to identified materials or steps that do not substantially affect the basic and novel features of the claimed disclosure. The word “consisting of” (and any form of “consisting of,” e.g., “consist of” and “consists of”) means including and being limited to everything that precedes the phrase “consisting of.” Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and that other elements cannot be present.

[0066] Any reference throughout this Specification to “one aspect,” “aspect,” “a particular aspect,” “related aspect,” “a certain aspect,” “additional aspect,” or “further aspects,” or any combination thereof, means that the particular features, structures, or characteristics described in connection with such aspects are included in at least one aspect of this disclosure. Therefore, the occurrence of these terms in various places throughout this Specification does not necessarily mean that all of them refer to the same aspect. Furthermore, particular features, structures, or characteristics may be combined in any preferred manner in one or more aspects.

[0067] The terms “inhibit,” “reduce,” or “mitigate,” or any variation thereof, include any measurable reduction (e.g., a reduction of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) or complete inhibition to achieve the desired outcome. The terms “enhance,” “promote,” or “increase,” or any variation thereof, include any measurable increase (e.g., an increase of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) to achieve the desired result or production of a protein or molecule.

[0068] Where used herein, the terms “reference,” “standard,” or “control” refer to a value against which a comparison is made. For example, an agent, subject, population, sample, or value of interest is compared to a reference, standard, or control of the agent, subject, population, sample, or value of interest. The reference, standard, or control may be tested and / or determined substantially simultaneously with and / or together with the test or determination of the agent, subject, population, sample, or value of interest, and / or determined or characterized under conditions or circumstances equivalent to those of the agent, subject, population, sample, or value of interest being evaluated.

[0069] The term “isolated” can refer to a nucleic acid or polypeptide that is substantially free from the source cellular material, bacterial material, viral material, or culture medium (if produced by recombinant DNA technology), or chemical precursors or other chemicals (if chemically synthesized). Furthermore, an isolated compound refers to a compound that can be administered to a subject as an isolated compound; in other words, a compound may not be simply considered “isolated” if it is attached to a column or embedded in an agarose gel. Furthermore, an “isolated nucleic acid fragment” or “isolated peptide” is a nucleic acid or protein fragment that does not exist naturally as a fragment and / or is not typically in a functional state and / or has been modified or extracted from its natural state through human intervention. For example, DNA that exists naturally in a living animal is not “isolated,” but synthetic DNA, or DNA that is partially or completely separated from the material that coexists with it in its natural state, is “isolated.” Isolated nucleic acids may exist in a substantially purified form or in a non-native environment, such as in the cell to which the nucleic acid is delivered.

[0070] When used herein, “nucleic acid” refers to a molecule containing nucleic acid components, and means a DNA or RNA molecule. It may be used interchangeably with the term “polynucleotide.” A nucleic acid molecule is a polymer containing or consisting of nucleotide monomers covalently linked to one another by phosphodiester bonds of a sugar / phosphate backbone. Nucleic acids may also include modified nucleic acid molecules, such as DNA or RNA molecules that have been modified by base modification, sugar modification, or backbone modification. Nucleic acids may exist in various forms, e.g., polypeptides, isolated segments and incorporated sequences encoding one or both chains of an antigen or antibody, or fragments thereof, derivatives, mutaines, or variants, or recombinant vectors of recombinant polynucleotides, hybridization probes for identification, analysis, mutation or amplification of polynucleotides encoding polypeptides, polynucleotides sufficient for use as PCR primers or sequencing primers, polynucleotides beyond those described herein, mRNA, saRNA, modRNA, and antisense nucleic acids for inhibiting the expression of complementary sequences. Nucleic acids may encode epitopes to which antibodies can bind.

[0071] The term “epitope” refers to a portion of an antigen that is specifically recognized by an immunoglobulin (e.g., antibody or receptor) binding component. In some embodiments, an epitope consists of multiple chemical atoms or groups on an antigen. In some embodiments, such chemical atoms or groups are exposed on the surface when the antigen adopts a relevant three-dimensional conformation. In some embodiments, such chemical atoms or groups are physically close to each other in space when the antigen adopts such a conformation. In some embodiments, at least some of such chemical atoms are physically separated from each other when the antigen adopts an alternative conformation (e.g., linearized).

[0072] Nucleic acids may be single-stranded or double-stranded and may include RNA and / or DNA nucleotides as well as their artificial variants (e.g., peptide nucleic acids). In some cases, the nucleic acid sequence may encode the polypeptide sequence together with additional heterologous coding sequences to enable, for example, the purification, transport, secretion, post-translational modification of the polypeptide, or therapeutic benefits such as targeting or efficacy. Tags or other heterologous polypeptides may be appended to the modified polypeptide coding sequence, and “heterologous” refers to a polypeptide that is not the same as the modified polypeptide.

[0073] The term "polynucleotide" refers to nucleic acid molecules that may be recombinant or isolated from whole-genome nucleic acids. Recombinant vectors, including oligonucleotides (nucleic acids with a length of 100 residues or fewer), such as plasmids, cosmids, phages, and viruses, are included in the term "polynucleotide." Polynucleotides, in certain embodiments, contain regulatory sequences substantially isolated from their naturally occurring gene or protein-coding sequences. Polynucleotides may be single-stranded (coding or antisense) or double-stranded, and may be RNA, DNA (genomic, cDNA, or synthetic), their analogues, or a combination thereof. Additional coding or non-coding sequences may, but are not required, be present within the polynucleotide.

[0074] In a particular embodiment, a polynucleotide variant having substantial identity with respect to the sequence disclosed herein; equal to any one of 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher in sequence identity when compared to the polynucleotide sequence provided herein using the methods described herein (e.g., BLAST analysis using standard parameters), or at least 70%, 75%, 80%, 85%, 90%. There are polynucleotide variants that have sequence identity of any one of %, 95%, 96%, 97%, 98%, or 99% or higher, or up to any one of 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher, or sequence identity among any two of 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher. In a particular embodiment, the isolated polynucleotide comprises a nucleotide sequence encoding a polypeptide having at least 90% identity with the amino acid sequences described herein across the entire length of the sequence; or a nucleotide sequence complementary to the isolated polynucleotide. In some embodiments, the isolated polynucleotide comprises a nucleotide sequence encoding a polypeptide having at least 95% identity with the amino acid sequence described herein over the entire length of the sequence; or a nucleotide sequence complementary to the isolated polynucleotide.

[0075] Nucleic acid segments, regardless of the length of the coding sequence itself, may be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, and other coding segments, and as a result, their overall length may vary considerably. Nucleic acids may be of any length. They may be equal to one of the lengths of, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides, or at least 5, 10, 15, 2 The nucleotide length can be any one of the following: 0, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more, or up to 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 7 Any of the following nucleotide lengths: 5, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more, or 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250 , 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotide lengths may be between any two of these lengths and / or may include one or more additional sequences, e.g., regulatory sequences, and / or may be larger nucleic acids, e.g., portions of a vector.Therefore, nucleic acid fragments of almost any length may be used, and the full length is expected to be limited by ease of preparation and use in the intended recombinant nucleic acid protocol.

[0076] In this regard, the term “gene” is used to refer to nucleic acids (including any sequences required for proper transcription, post-translational modification, or localization) that encode proteins, polypeptides, or peptides. As will be understood by those skilled in the art, this term encompasses genomic sequences, expression cassettes, cDNA sequences, and smaller, manipulated nucleic acid segments that express or can be adapted to express proteins, polypeptides, domains, peptides, fusion proteins, and mutants. A nucleic acid encoding all or part of a polypeptide may contain a contiguous nucleic acid sequence encoding all or part of such polypeptide. A particular polypeptide may be encoded by nucleic acids containing variations having slightly different nucleic acid sequences, but nevertheless, it is also conceivable that they encode the same or substantially similar polypeptides.

[0077] As used herein, the term “expression” of a nucleic acid sequence refers to the production of any gene product from a nucleic acid sequence. In some embodiments, the gene product may be a transcript. In some embodiments, the gene product may be a polypeptide. In some embodiments, the expression of a nucleic acid sequence involves one or more of the following: (1) the production of an RNA template from a DNA sequence (e.g., by transcription); (2) the processing of the RNA transcript (e.g., by splicing, editing, etc.); (3) the translation of the RNA into a polypeptide or protein; and / or (4) post-translational modifications of the polypeptide or protein.

[0078] Generally, the term "manipulated" refers to a state in which something has been manipulated by human hands. For example, a polynucleotide can be considered "manipulated" if it is manipulated by human hands so that two or more sequences that are not linked in their natural order are directly linked to each other in the manipulated polynucleotide, and / or if a particular residue in the polynucleotide is linked to an entity or part that does not exist in nature and / or is not linked in nature, through the action of human hands.

[0079] As used herein, the term "DNA" refers to nucleic acid molecules comprising nucleotides, such as deoxy-adenosine monophosphate, deoxy-thymidine monophosphate, deoxy-guanosine monophosphate, and deoxy-cytidine monophosphate monomers, which are composed of a sugar moiety (deoxyribose), a base moiety, and a phosphate moiety, and which polymerize by a characteristic skeletal structure. The skeletal structure is typically formed by a phosphodiester bond between the sugar moiety of a nucleotide of a first monomer, e.g., deoxyribose, and the phosphate moiety of a second adjacent monomer. The characteristic order of monomers, e.g., the order of bases linked to the sugar / phosphate backbone, is called the DNA sequence. DNA may be single-stranded or double-stranded. In the double-stranded form, nucleotides of the first strand typically hybridize with nucleotides of the second strand, e.g., by A / T base pairing and G / C base pairing. DNA may contain all or most deoxyribonucleotide residues. As used herein, the term “deoxyribonucleotide” means a nucleotide lacking a hydroxyl group at the 2' position of the β-D-ribofuranosyl group. Without limitation, DNA may include double-stranded DNA, antisense DNA, single-stranded DNA, isolated DNA, synthetic DNA, recombinant DNA, and modified DNA.

[0080] The term "RNA," as used herein, means a nucleic acid molecule comprising nucleotide monomers, such as adenosine-monophosphate, uridine-monophosphate, guanosine-monophosphate, and cytidine-monophosphate, linked together along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar of a first monomer, such as ribose, and the phosphate moiety of a second adjacent monomer. RNA may be obtained, for example, by the transcription of a DNA sequence inside a cell. In eukaryotic cells, transcription typically occurs inside the nucleus or mitochondria. In vivo, the transcription of DNA may result in immature RNA that is processed into messenger RNA (mRNA). Processing of immature RNA, for example in eukaryotes, includes various post-transcriptional modifications, such as splicing, 5' capping, polyadenylation, and export from the nucleus or mitochondria. Mature messenger RNA provides a nucleotide sequence that can be processed and translated into the amino acid sequence of a peptide or protein. Mature mRNA may include a 5' cap, 5' UTR, open reading frame, 3' UTR, and poly-A tail sequence. RNA may contain all or most ribonucleotide residues. As used herein, the term “ribonucleotide” means a nucleotide having a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. In one embodiment, RNA may be messenger RNA (mRNA) relating to an RNA transcript encoding a peptide or protein. As is known to those skilled in the art, mRNA generally contains a 5' untranslated region (5' UTR), a polypeptide coding region, and a 3' untranslated region (3' UTR). Without limitation, RNA may include double-stranded RNA, antisense RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinant RNA, and modified RNA (modRNA).

[0081] "Isolated RNA" is defined as an RNA molecule that may be recombinant or isolated from whole-genome nucleic acids. Isolated RNA molecules or proteins may exist in a substantially purified form or in a non-native environment, such as in a host cell.

[0082] "Modified RNA" or "modRNA" refers to an RNA molecule having at least one addition, deletion, substitution, and / or modification of one or more nucleotides compared to naturally occurring RNA. Such modification may refer to the addition of non-nucleotide material to internal RNA nucleotides or to the 5' and / or 3' ends of the RNA. In one embodiment, such modRNA contains at least one modified nucleotide, e.g., a modification to the base of a nucleotide. For example, the modified nucleotide may replace one or more uridine and / or cytidine nucleotides. For example, these substitutions may occur for any case of uridine and / or cytidine in the RNA sequence, or only for selected uridine and / or cytidine nucleotides. Such modifications to standard nucleotides in RNA may include non-standard nucleotides, e.g., chemically synthesized nucleotides or deoxynucleotides. For example, at least one uridine nucleotide may be replaced with N1-methylpseudridine in the RNA sequence. Other such modified nucleotides are known to those skilled in the art. Such modified RNA molecules are considered analogs of naturally occurring RNA. In some embodiments, RNA is produced by in vitro transcription using a DNA template, where DNA refers to nucleic acids containing deoxyribonucleotides. In some embodiments, RNA may be replicon RNA (replicon), in particular self-replicating RNA, or self-amplifying RNA (saRNA).

[0083] Without limitation, as assumed herein, RNA may be used as a therapeutic modality to treat and / or prevent a number of conditions in mammals, including humans. The methods described herein include the administration of the RNA described herein to a mammal, e.g., a human. For example, in one embodiment, the method of use of such RNA includes an antigen-coding RNA vaccine to achieve protective immunization by inducing robust neutralizing antibodies and a concomitant / associated T cell response. In some embodiments, a minimum vaccine dose is administered to achieve protective immunization by inducing robust neutralizing antibodies and a concomitant / associated T cell response. In one embodiment, the RNA administered is RNA transcribed in vitro. For example, such RNA may be used to encode at least one antigen intended to produce an immune response in the mammal. The pathogenic antigen is a peptide or protein antigen derived from a pathogen associated with an infectious disease. In a specific embodiment, the pathogenic antigen is a peptide or protein antigen derived from RSV. Conditions and / or diseases that can be treated with RNA disclosed herein include, but are not limited to, those caused and / or affected by viral infections. Such viruses include, but are not limited to, RSV.

[0084] When used herein in connection with the onset of a disease, disorder, and / or condition, “prevent” or “prevention” means reducing the risk of developing a disease, disorder, and / or condition, and / or delaying the onset of one or more characteristics or symptoms of a disease, disorder, or condition. Prevention may be considered complete if the onset of the disease, disorder, or condition is delayed over a predetermined period of time.

[0085] As understood from the context, the “risk” of a disease, disorder, and / or condition refers to the likelihood that a particular individual will develop the disease, disorder, and / or condition. In some embodiments, the risk is expressed as a percentage. In some embodiments, the risk is from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 to 100%, or at least these percentages, or at most these percentages. In some embodiments, the risk is expressed as a risk compared to a risk associated with a reference sample or group of reference samples. In some embodiments, the reference sample or group of reference samples has a known risk of the disease, disorder, condition, and / or event. In some embodiments, the reference sample or group of reference samples is from individuals comparable to a particular individual. In some embodiments, the risk may reflect one or more genetic attributes, e.g., one or more genetic attributes that may give an individual a predisposition to developing (or not developing) a particular disease, disorder, and / or condition. In some embodiments, risk may reflect one or more epigenetic events or attributes and / or one or more lifestyle or environmental events or attributes. Susceptibility: Individuals "susceptible to" a disease, disorder, and / or condition are individuals who have a higher risk of developing a disease, disorder, and / or condition than members of the general population. In some embodiments, individuals susceptible to a disease, disorder, and / or condition do not have to be diagnosed with the disease, disorder, and / or condition. In some embodiments, individuals susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, individuals susceptible to a disease, disorder, and / or condition do not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, individuals susceptible to a disease, disorder, and / or condition develop the disease, disorder, and / or condition. In some embodiments, individuals susceptible to a disease, disorder, and / or condition do not develop the disease, disorder, and / or condition.

[0086] The terms “protein,” “polypeptide,” or “peptide” are used herein as synonyms and refer to polymers of amino acid monomers, for example, molecules containing at least two amino acid residues. Polypeptides may include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologues, paralogs, fragments, and other equivalents, variants, and analogs thereof. Polypeptides may be single molecules or multimolecular complexes, such as dimers, trimers, or tetramers. Proteins may comprise one or more peptides or polypeptides and may be folded into a three-dimensional form that may be required for the protein to perform its biological function.

[0087] As used herein, the terms “wild-type,” “WT,” or “native” refer to the endogenous version of a molecule that occurs naturally in an organism. In some embodiments, the wild-type version of a protein or polypeptide is used, while in other embodiments of this disclosure, a modified protein or polypeptide is used to generate an immune response. The terms described above may be used interchangeably.

[0088] "Modified protein" or "modified polypeptide" or "variant" refers to a protein or polypeptide whose chemical structure, in particular its amino acid sequence, is altered relative to a wild-type protein or polypeptide. In some embodiments, a modified / variant protein or polypeptide has at least one modified activity or function (recognizing that a protein or polypeptide may have multiple activities or functions). It is particularly assumed that a modified / variant protein or polypeptide may be modified with respect to one activity or function, but may retain wild-type activity or function in other respects, such as immunogenicity. Where a protein is specifically referred to herein, it is generally a reference to a native (wild-type) or recombinant (modified) protein. A protein may be isolated directly from an organism native to it, or may be produced by recombinant DNA / exogenous expression methods, solid-phase peptide synthesis (SPPS), or other in vitro methods. In certain embodiments, there are isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences encoding polypeptides (e.g., antigens or fragments thereof). The term “recombinant” is sometimes used in combination with the name of a polypeptide or a specific polypeptide, and generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro, or a polypeptide produced from a replica product of such a molecule.

[0089] The term "fragment" refers to a portion of an amino acid sequence (peptide or protein), for example, a sequence representing a shortened amino acid sequence at the N-terminus and / or C-terminus. A C-terminus shortened fragment (N-terminal fragment) can be obtained, for example, by translation of a truncated open reading frame lacking the 3' end of the open reading frame. An N-terminus shortened fragment (C-terminal fragment) can also be obtained, for example, by translation of a truncated open reading frame lacking the 5' end of the open reading frame, insofar as the truncated open reading frame contains a start codon that helps initiate translation. A fragment of an amino acid sequence can contain, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% of the amino acid residues from the amino acid sequence. In this disclosure, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence is defined as a fragment of which at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, and up to 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, This refers to sequences that have sequence identity between any two of the following percentages: 96%, 97%, 98%, or 99%, exactly 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0090] In one embodiment, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 70% sequence identity with the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 80% sequence identity with the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 85% sequence identity with the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 90% sequence identity with the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 95% sequence identity with the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 97% sequence identity with the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 99% sequence identity with the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived.

[0091] When used herein in the context of molecules, e.g., nucleic acids, proteins, or small molecules, the term “variant” refers to a molecule that exhibits significant structural identity with a reference molecule but is structurally different from the reference molecule, for example, in the presence or absence of one or more chemical parts compared to the reference entity, or at a certain level. In some embodiments, a variant may also be functionally different from its reference molecule. Generally, whether a particular molecule is considered appropriate to be a “variant” of a reference molecule depends on the degree of structural identity with the reference molecule. As will be understood by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements. A variant is, by definition, a distinct molecule that shares one or more such characteristic structural elements but is different from the reference molecule in at least one embodiment. In some embodiments, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequences and / or one or more differences in chemical parts (e.g., carbohydrates, lipids, phosphate groups) that are covalently components of the polypeptide or nucleic acid (e.g., attached to the polypeptide or nucleic acid backbone). In some embodiments, the variant polypeptide or nucleic acid is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, and at most 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, exactly 85%. The variant polypeptide or nucleic acid exhibits overall sequence identity with the reference polypeptide or nucleic acid, which is between any two of the following percentages: 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some embodiments, the variant polypeptide or nucleic acid does not share at least one characteristic sequence element with the reference polypeptide or nucleic acid. In some embodiments, the reference polypeptide or nucleic acid has one or more biological activities.In some embodiments, a variant polypeptide or nucleic acid shares one or more of the biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid lacks one or more of the biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid exhibits a reduction in the level of one or more biological activities compared to a reference polypeptide or nucleic acid. In some embodiments, a polypeptide or nucleic acid of interest is considered a "variant" of a reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence identical to that of the reference amino acid or nucleotide sequence, except for a small number of sequence changes at specific positions. Preferably, a variant polypeptide or nucleic acid sequence has at least one modification, e.g., 1 to about 20 modifications, compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 10 modifications compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 5 modifications compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 4 modifications compared to a reference polypeptide or nucleic acid sequence. Typically, approximately 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, or less than 2% of the residues in the variant are substituted, inserted, or deleted compared to the reference. In many cases, the variant polypeptide or nucleic acid contains a very small number of substitutions, insertions, or deletions of functional residues (e.g., residues that participate in specific biological activities) compared to the reference (e.g., approximately 5, 4, 3, 2, or less than 1). In some embodiments, the variant polypeptide or nucleic acid contains approximately 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 residue substitutions compared to the reference. In some embodiments, the variant polypeptide or nucleic acid contains fewer than approximately 25, 20, 19, 18, 17, 16, 15, 14, 13, 10, 9, 8, 7, or 6 additions or deletions compared to the reference, and generally fewer than approximately 5, 4, 3, or 2 additions or deletions.In some embodiments, the variant polypeptide or nucleic acid contains about 5, about 4, about 3, about 2, or less than 1 addition or deletion compared to the reference, and in some embodiments, it contains neither addition nor deletion.

[0092] In some embodiments, the reference polypeptide or nucleic acid is a naturally occurring “wild-type” or “WT” or “native” sequence, including allele variations. A wild-type polypeptide or nucleic acid sequence has a sequence that has not been intentionally modified. For the purposes of this disclosure, “variant” of an amino acid sequence (peptide, protein, or polypeptide) includes amino acid insertion variants, amino acid addition variants, amino acid deletion variants, and / or amino acid substitution variants. “Variant” of a nucleotide sequence includes nucleotide insertion variants, nucleotide addition variants, nucleotide deletion variants, and / or nucleotide substitution variants. The term “variant” includes all mutants, splice variants, post-translational modification variants, conformations, isoforms, allele variants, species variants, and species homologs, in particular those occurring in nature. The term “variant” includes, in particular, fragments of amino acid or nucleic acid sequences.

[0093] The changes may be introduced into nucleic acids by mutation, which may lead to changes in the amino acid sequence of the polypeptide encoded by the nucleic acid (e.g., an antigen or antibody or antibody derivative). Mutations may be introduced using any technique known in the art. In one embodiment, one or more specific amino acid residues are altered, for example, using a site-directed mutagenesis protocol. In another embodiment, one or more randomly selected residues are altered, for example, using a random mutagenesis protocol. In some embodiments, the mutant polypeptide, however it is made, may be screened for expressed and desired properties.

[0094] Mutations can be introduced into nucleic acids without significantly altering the biological activity of the polypeptide encoded by the nucleic acid. For example, nucleotide substitutions leading to amino acid substitutions at non-essential amino acid residues may be introduced. Alternatively, one or more mutations that selectively alter the biological activity of the polypeptide encoded by the nucleic acid may be introduced into the nucleic acid. For example, the mutation may alter the biological activity quantitatively or qualitatively. Examples of quantitative changes include increasing, decreasing, or eliminating activity. Examples of qualitative changes include altering the antigen specificity of an antibody.

[0095] "Sequence similarity" refers to the percentage of amino acids that are identical or represent a conserved amino acid substitution. "Sequence identity" between two amino acid sequences refers to the percentage of amino acids that are identical between the sequences. "Sequence identity" between two nucleic acid sequences refers to the percentage of nucleotides that are identical between the sequences.

[0096] The terms “% identical,” “% identity,” or similar terms are intended to specifically refer to the percentage of nucleotides or amino acids that are identical in optimal alignment between the sequences being compared. The percentage is purely statistical, and the differences between the two sequences may, but do not need to be, randomly distributed across the entire length of the sequences being compared. Comparison of two sequences is typically performed by comparing the sequences after optimal alignment with respect to a segment or “comparison window” to identify local regions of the corresponding sequences. Optimal alignment for comparison may be performed manually, or with the assistance of a local homology algorithm by Smith and Waterman, 1981, Ads App.Math.2, 482, by Neddleman and Wunsch, 1970, J.Mol.Biol.48, 443, by Pearson and Lipman, 1988, Proc.Natl Acad.Sci.USA 88, 2444, or with the assistance of a computer program using such algorithms (Wisconsin Genetics Software Package, GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA from the Genetics Computer Group). In some embodiments, the percentage of identity between two sequences is determined using the BLASTN or BLASTP algorithm available on the United States National Center for Biotechnology Information (NCBI) website.

[0097] The identity percentage is obtained by determining the number of corresponding identical positions in the sequences being compared, dividing this number by the number of positions being compared (e.g., the number of positions in the reference sequence), and multiplying the result by 100.

[0098] In some embodiments, the degree of similarity or identity is given for regions that are at least about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the total length of the reference sequence, at most about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, exactly about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, or about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. For example, if a reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is given for at least about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, at most about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, exactly about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, or a number of nucleotides between any two of about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, in some embodiments, for consecutive nucleotides. In some embodiments, the degree of similarity or identity is given for the entire length of the reference sequence.

[0099] Homologous amino acid sequences may exhibit identity in at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% of amino acid residues, up to a maximum of 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99%, exactly 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99%, or any two of the following percentages: 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99%. In one embodiment, homologous amino acid sequences exhibit identity in at least 95% of amino acid residues. In one embodiment, homologous amino acid sequences exhibit identity in at least 98% of amino acid residues. In one embodiment, homologous amino acid sequences exhibit identity in at least 99% of amino acid residues.

[0100] A fragment or variant of an amino acid sequence (peptide or protein) may be called a “functional fragment” or “functional variant.” The terms “functional fragment” or “functional variant” in relation to an amino acid sequence relate to any fragment or variant that exhibits one or more functional properties identical or similar to one or more functional properties of an amino acid sequence from which it is derived, for example, functionally equivalent. With respect to an antigen or antigen sequence, one particular function is one or more immunogenic activities demonstrated by the amino acid sequence from which the fragment or variant is derived. When used herein, the terms “functional fragment” or “functional variant” specifically refer to a variant molecule or sequence that includes an amino acid sequence modified by one or more amino acids compared to the amino acid sequence of the parent molecule or sequence, and which still possesses one or more of the functions of the parent molecule or sequence, for example, the ability to induce an immune response. In one embodiment, the modification of the amino acid sequence of the parent molecule or sequence does not substantially affect or substantially alter the characteristics of the molecule or sequence. The terms "mutant" of wild-type RSV F protein, "mutant" of RSV F protein, "RSV F protein mutant," or "modified RSV F protein" refer to polypeptides that exhibit mutations compared to wild-type F protein and are immunogenic to wild-type F protein.

[0101] The amino acid sequence (peptide, protein, or polypeptide) “derived” from a specified amino acid sequence (peptide, protein, or polypeptide) refers to the origin of the first amino acid sequence. Preferably, an amino acid sequence derived from a particular amino acid sequence is identical, essentially identical, or homologous to that particular sequence or fragment. An amino acid sequence derived from a particular amino acid sequence may be a variant of that particular sequence or fragment. For example, it will be understood by those skilled in the art that antigens suitable for use herein may be modified so that their sequences vary from the naturally occurring or native sequences from which they are derived, while retaining the desired activity of the native sequences.

[0102] In this disclosure, "vector" refers to a nucleic acid molecule, such as an artificial nucleic acid molecule. A vector may be used to incorporate a nucleic acid sequence, such as a nucleic acid sequence including an open reading frame. A vector includes, but is not limited to, storage vectors, expression vectors, cloning vectors, and transfer vectors. A vector may be an RNA vector or a DNA vector. In some embodiments, the vector is a DNA molecule. In some embodiments, the vector is a plasmid vector. In some embodiments, the vector is a viral vector. Typically, an expression vector contains a desired coding sequence and other appropriate sequences necessary for the expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plants, insects, or mammals) or in vitro expression system. Cloning vectors are commonly used to manipulate and amplify a particular desired fragment (typically a DNA fragment) and may lack the functional sequences required for the expression of the desired fragment.

[0103] As used herein, the term “pharmaceutical composition” refers to an activator formulated with one or more pharmaceutically acceptable carriers. The pharmaceutical composition may be an immunogenic composition. In some embodiments, the activator is present in an appropriate unit dose for administration in a therapeutic regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to the relevant population. In some embodiments, the pharmaceutical composition may be specifically formulated for parenteral administration, for example, as a sterile solution or suspension, or as a sustained-release formulation, for example, by subcutaneous, intramuscular, intravenous, or epidural injection.

[0104] As used herein, the term “vaccination” refers to the administration of an immunogenic composition intended to produce an immune response to, for example, a disease-related (e.g., disease-inducing) factor (e.g., a virus). In some embodiments, vaccination may be administered before, during, and / or after exposure to a disease-related factor, and in certain embodiments, before, during, and / or immediately after exposure to said factor. In some embodiments, vaccination comprises multiple doses of the vaccine composition, appropriately time-intervened. In some embodiments, vaccination produces an immune response to an infectious factor. In some embodiments, vaccination produces an immune response to a tumor; and in some such embodiments, vaccination is “personalized” in that it is directed, in part or whole, to an epitope (e.g., one or more neoepitopes, or a combination thereof) that has been determined to be present in the tumor of a particular individual.

[0105] The immune response refers to a humoral response, a cellular response, or both humoral and cellular responses in an organism. The immune response may be measured by assays that measure the presence or amount of antibodies that specifically recognize proteins or cell surface proteins, assays that measure T cell activation or proliferation, and / or assays that measure modulation in terms of the activity or expression of one or more cytokines.

[0106] As used herein, the term “combination therapy” refers to a situation in which a subject is simultaneously exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents). In some embodiments, the two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all “doses” of the first regimen are administered prior to any dose of the second regimen); in some embodiments, such agents are administered in overlapping drug regimens. In some embodiments, the “administration” of combination therapy may involve the administration of one or more agents or modalities to a subject receiving other agents or modalities in combination. For clarity, combination therapy does not require that the individual agents be administered together (or necessarily simultaneously) in a single composition; however, in some embodiments, two or more agents, or their active portions, may be administered together in a combination composition, or even in a combination compound (e.g., as a single chemical complex or as part of a covalent entity).

[0107] Those skilled in the art will understand that the term “medication regimen” may be used to refer to a set of unit doses (typically more than one) administered individually to a subject, typically separated by a period of time. In some embodiments, a given therapeutic agent has a recommended medication regimen, which may consist of one or more doses. In some embodiments, a medication regimen comprises multiple doses, each separated in time from the other doses. In some embodiments, the individual doses are separated from each other by periods of the same length; in some embodiments, a medication regimen comprises multiple doses and at least two different periods of time separating the individual doses. In some embodiments, all doses within a medication regimen are in the same unit dose amount. In some embodiments, the different doses within a medication regimen are different amounts. In some embodiments, a medication regimen comprises a first dose in the amount of a first dose, followed by one or more additional doses in the amount of a second dose different from the amount of the first dose. In some embodiments, the drug regimen comprises a first dose in the amount of the first dose, followed by one or more additional doses in the amount of the second dose, which is the same as the amount of the first dose. In some embodiments, the drug regimen correlates with a desired or beneficial outcome when administered across a relevant population (e.g., a therapeutic drug regimen).

[0108] II. Respiratory Syncytial Virus (RSV) This disclosure provides an RNA molecule (e.g., RNA polynucleotide) comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) polypeptide. This disclosure further provides an immunogenic composition comprising at least one RNA molecule encoding an RSV polypeptide, which is complexed with one or more lipids, encapsulated within one or more lipids, or formulated using one or more lipids and forming lipid nanoparticles (LNPs). The RSV polypeptides contained in the immunogenic compositions disclosed herein may be any RSV F protein of pre-fusion conformation.

[0109] The term “pre-fusion conformation” refers to the structural conformation adopted by the RSV F protein or its mutant that can specifically bind to (i) antibody D25 or AM22 when the RSV F protein or mutant is in monomeric or trimeric form, or (ii) antibody AM14 when the RSV F protein mutant is in trimeric form. The pre-fusion trimer conformation is a subset of the pre-fusion conformation. As used herein, the RSV F protein or polypeptide or its mutant in the pre-fusion conformation may be denoted as “RSV preF”.

[0110] The term "post-fusion conformation" refers to the structural conformation adopted by RSV F proteins that do not specifically bind to D25, AM22, or AM14. Native F proteins adopt a post-fusion conformation after the fusion of the viral envelope with the host cell membrane. RSV F proteins may also be considered to be in a post-fusion conformation outside the context of the fusion event, for example, when extracted from the membrane under stress conditions such as heat and hypotonicity, when expressed as an ectodomain, or during storage. The term "AM14" refers to the antibody described in International Publication No. 2008 / 147196A2, which is incorporated entirely herein by reference. The term "AM22" refers to the antibody described in International Publication No. 2011 / 043643A1, which is incorporated entirely herein by reference. The term "D25" refers to the antibody described in International Publication No. 2008 / 147196A2, which is incorporated entirely herein by reference.

[0111] In some embodiments, the RSV F protein is subtype A of the RSV F protein. In some embodiments, the RSV F protein is subtype B of the RSV F protein. As used herein, the terms “subtype” and “subgroup” are interchangeable. As used herein, the term “strain” refers to a specific isolate within each subtype or subgroup. In some embodiments, the RSV F protein is a mutant of the wild-type RSV F protein. In some embodiments, the RSV F protein is a mutant of subtype A of the wild-type RSV F protein. In some embodiments, the RSV F protein is a mutant of subtype B of the wild-type RSV F protein. In some embodiments, the mutant exhibits the introduction of amino acid sequence mutations compared to the amino acid sequence of the corresponding wild-type RSV F protein and is immunogenic to the wild-type RSV F protein in its pre-fusion conformation or to viruses containing the wild-type F protein. Amino acid mutations in the mutant include amino acid substitutions, deletions, or additions compared to the wild-type RSV F protein.

[0112] In some embodiments, the RSV F protein is an RSV protein mutant described in International Publication No. 2017 / 109629, which is incorporated in whole herein by reference.

[0113] In some embodiments, the RSV F protein is a mutant of the wild-type RSV F protein, where the introduced amino acid mutation is a mutation of a pair of amino acid residues in the wild-type RSV F protein to a pair of cysteine ​​residues ("engineered disulfide mutation"). The introduction of a pair of cysteine ​​residues allows for the formation of a disulfide bond between the cysteine ​​residues, which stabilizes the conformation or oligomeric state of the protein, e.g., the pre-fusion conformation. Examples of specific pairs of such mutations include 55C and 188C; 155C and 290C; 103C and 148C; and 142C and 371C, e.g., S55C and L188C; S155C and S290C; A103C and I148C; and L142C and N371C.

[0114] In yet another embodiment, the RSV F protein mutant includes an amino acid mutation that is a mutation filling one or more cavities. Examples of target and replaceable amino acids that fill cavities include small aliphatic amino acids (e.g., Gly, Ala, and Val) or small polar amino acids (e.g., Ser and Thr), and amino acids that are exposed to the solvent in the post-fusion conformation but embedded in the pre-fusion conformation. Examples of replaceable amino acids include large aliphatic amino acids (Ile, Leu, and Met) or large aromatic amino acids (His, Phe, Tyr, and Trp). In some specific embodiments, the RSV F protein mutant includes (1) Substitution of S at position 55, 62, 155, 190, or 290 with I, Y, L, H, or M; (2) Substitution of I, Y, L, H, or M for T at position 54, 58, 189, 219, or 397; (3) Substitution of G at position 151 with A or H; (4) Substitution of A at position 147 or 298 with I, L, H, or M; (5) Substitution of V at positions 164, 187, 192, 207, 220, 296, 300, or 495 with I, Y, H; and (6) Substitution of R at position 106 with W Includes mutations that fill cavities, selected from a group consisting of the following:

[0115] In some specific embodiments, the RSV F protein mutant includes a mutation that fills at least one cavity selected from the group consisting of T54H, S190I, and V296I.

[0116] In further embodiments, the RSV F protein mutant includes electrostatic mutations that reduce ionic repulsion or increase ionic attraction between protein residues that are in close proximity to each other in the folded structure. In some embodiments, the RSV F protein mutant includes electrostatic substitutions that reduce repulsive ionic interactions or increase attractive ionic interactions with acidic residues Glu487 and Asp489 derived from another protomer of the RSV F trimer. In some specific embodiments, the RSV F protein mutant includes (1) Substitution of E at position 82, 92, or 487 by D, F, Q, T, S, L, or H; (2) Substitution of K at position 315, 394, or 399 with F, M, R, S, L, I, Q, or T; (3) Substitution of D at position 392, 486, or 489 with H, S, N, T, or P; and (4) Substitution of R at position 106 or 339 with F, Q, N, or W This includes electrostatic mutations selected from the group consisting of the following.

[0117] In further embodiments, the RSV F protein mutant comprises a combination of two or more different types of mutations selected from manipulated disulfide mutations, cavity-filling mutations, and electrostatic mutations. In some specific embodiments, the RSV F protein mutant comprises a combination of mutations compared to the corresponding wild-type RSV F protein, where the combination of mutations is: (1) A combination of A103C, I148C, S190I, and D486S; (2) A combination of T54H, S55C, L188C, and D486S; (3) A combination of T54H, A103C, I148C, S190I, V296I, and D486S; (4) Combinations of T54H, S55C, L142C, L188C, V296I, and N371C; (5) A combination of S55C, L188C, and D486S; (6) A combination of T54H, S55C, L188C, and S190I; (7) A combination of S55C, L188C, S190I, and D486S; (8) Combinations of T54H, S55C, L188C, S190I, and D486S; (9) A combination of S155C, S190I, S290C, and D486S; (10) Combinations of T54H, S55C, L142C, L188C, V296I, N371C, D486S, E487Q, and D489S; (11) combinations of T54H, S155C, S190I, S290C, and V296I, and (12) Combinations of S155C, S190F, S290C, and V207L It is selected from the group consisting of the following.

[0118] In some embodiments, the RSV F protein is of subtype A and includes mutations S155C, S190F, S290C, and V207L.

[0119] In some embodiments, the RSV F protein is of subtype B and includes mutations S155C, S190F, S290C, and V207L.

[0120] In some embodiments, the RSV F protein is of subtype A and includes mutations S155C, S190F, and S290C.

[0121] In some embodiments, the RSV F protein is of subtype B and includes mutations S155C, S190F, and S290C.

[0122] In some embodiments, the RSV F protein is of subtype A and includes mutations A103C, I148C, S190I, and D486S.

[0123] In some embodiments, the RSV F protein is of subtype B and includes mutations A103C, I148C, S190I, and D486S.

[0124] In some embodiments, the RSV F protein is of subtype A and includes the mutants T54H, A103C, I148C, S190I, and D486S.

[0125] In some embodiments, the RSV F protein is of subtype B and includes mutants T54H, A103C, I148C, S190I, and D486S.

[0126] In some embodiments, the RSV F protein is of subtype A and includes mutants T54H, S55C, L188C, and D486S.

[0127] In some embodiments, the RSV F protein is of subtype B and includes mutants T54H, S55C, L188C, and D486S.

[0128] Given the substantial conservation of RSV F sequences, those skilled in the art can easily compare amino acid positions between different native RSV F sequences to identify corresponding RSV F amino acid positions between different RSV strains and subtypes. For example, across almost all identified native RSV F0 precursor proteins, the furin cleavage sites are located at the same amino acid positions. Thus, the conservation of native RSV F protein sequences across strains and subtypes allows for the use of reference RSV F sequences for comparing amino acids at specific positions in RSV F proteins. For the purposes of this disclosure (unless the context otherwise indicates), the amino acid positions of RSV F proteins are given with respect to the amino acid sequence of the full-length native F precursor polypeptide of the RSV A2 strain corresponding to GenInfo Identifier GI 138251 and Swiss Prot identifier P03420 (SEQ ID NO: 1).

[0129] In some embodiments, the RSV F protein is the mature form of the RSV F protein, comprising two separate polypeptide chains, namely the F1 polypeptide and the F2 polypeptide. In some other embodiments, the F2 polypeptide is linked to the F1 polypeptide by one or two disulfide bonds to form an F2 / F1 heterodimer. In yet another embodiment, the RSV F mutant is in the form of a single-stranded protein, where the F2 polypeptide is linked to the F1 polypeptide by a peptide bond or a peptide linker. Any suitable peptide linker may be used to join the two polypeptide chains together. Examples of such linkers include the G, GG, GGG, GS, and SAIG ​​linker sequences. The linker may also be the full-length pep27 sequence or a fragment thereof, the full-length pep27 sequence corresponding to amino acids 110-136 of SEQ ID NO: 1.

[0130] The mutant F1 polypeptide chain may be the same length as the full-length F1 polypeptide of the corresponding wild-type RSV F protein, but may also have deletions, such as a deletion of 1 to up to 60 amino acid residues from the C-terminus of the full-length F1 polypeptide. The full-length F1 polypeptide of the RSV F mutant corresponds to amino acid positions 137-574 of the native RSV F0 precursor (SEQ ID NO: 1) and includes an extracellular domain (residues 137-524), a transmembrane domain ("TM") (residues 525-550), and a cytoplasmic domain ("CT") (residues 551-574) (from N-terminus to C-terminus). It should be noted that the forward amino acid residue 514 in the native F1 polypeptide sequence is an optional sequence in the F1 polypeptide of the RSV F protein contained in the immunogenic composition provided herein, and therefore may not be present in the mutant F1 polypeptide.

[0131] In some embodiments, the F1 polypeptide of the RSV F mutant lacks the entire cytoplasmic domain. In other embodiments, the F1 polypeptide lacks the cytoplasmic domain and part or all of the transmembrane domain. In some specific embodiments, the mutant contains an F1 polypeptide that lacks amino acid residues at positions 510, 511, 512, 513, 514, 515, 520, 525, or 530–574. Typically, for mutants linked to a trimerizing domain, such as Foldon, amino acids 514–574 may be absent. Therefore, in some specific embodiments, amino acid residues 514–574 are absent from the mutant's F1 polypeptide. In yet another specific embodiment, the F1 polypeptide of the RSV F mutant comprises or consists of amino acid residues 137-513 of either the native F0 polypeptide sequence (SEQ ID NO: 1), for example, the RSV 847A-Foldon polypeptide (SEQ ID NO: 74), or an alternative F0 precursor sequence, for example, those disclosed in SEQ ID NOs: 1, 2, 4, 6, and 81-270 of International Publication No. 2017109629, which is incorporated herein in its entirety by reference.

[0132] The F1 and F2 polypeptides of an RSV F protein mutant in which one or more mutations have been introduced may be derived from any wild-type RSV F protein known or hereafter discovered in the art, including, but not limited to, the F protein amino acid sequences of RSV subtype A and subtype B strains, including A2 Ontario and Buenos Aires, or any other subtype. In some embodiments, the RSV F mutant includes an F1 and / or F2 polypeptide derived from an RSV A virus in which one or more mutations have been introduced, for example, an F1 and / or F2 polypeptide derived from an RSV F0 precursor protein described in any one of Sequence IDs 1, 2, 4, 6, and 81-270 of International Publication No. 2017109629, the sequence of which is incorporated herein by reference in whole. In some other embodiments, the RSV F mutant comprises an F1 and / or F2 polypeptide derived from RSV B virus, in which one or more mutations are introduced, e.g., an F1 and / or F2 polypeptide derived from the RSV F0 precursor protein described in any one of Sequence IDs 2 and 211-263 of International Publication No. 2017 / 109629, the sequence of which is incorporated herein by reference in whole. In yet another embodiment, the RSV F mutant comprises an F1 and / or F2 polypeptide derived from RSV bovine virus, in which one or more mutations are introduced, e.g., an F1 and / or F2 polypeptide derived from the RSV F0 precursor protein described in any one of Sequence IDs 264-270 of International Publication No. 2017 / 109629, the sequence of which is incorporated herein by reference in whole.

[0133] The term "F0 polypeptide" (F0) refers to the precursor polypeptide of the RSV F protein, which consists of the signal polypeptide sequence, the F1 polypeptide sequence, the pep27 polypeptide sequence, and the F2 polypeptide sequence. With rare exceptions, the F0 polypeptide of known RSV strains consists of 574 amino acids.

[0134] The term “F1 polypeptide” (F1) refers to the polypeptide chain of the mature RSV F protein. Native F1 comprises approximately 137–574 residues of the RSV F0 precursor and consists of an extracellular domain (approximately 137–524 residues) (N-terminus to C-terminus), a transmembrane domain ("TM") (approximately 525–550 residues), and a cytoplasmic tail ("CT") (approximately 551–574 residues). As used herein, the term encompasses both native F1 polypeptides and F1 polypeptides that include modifications from the native sequence (e.g., amino acid substitutions, insertions, or deletions), such as modifications designed to stabilize or enhance the immunogenicity of RSV F protein mutants.

[0135] The term “F2 polypeptide” (F2) refers to the polypeptide chain of the mature RSV F protein. Native F2 contains approximately 26–109 residues of the RSV F0 precursor. As used herein, the term encompasses both the native F2 polypeptide and F2 polypeptides that include modifications from the native sequence (e.g., amino acid substitutions, insertions, or deletions), such as modifications designed to stabilize or enhance the immunogenicity of RSV F protein mutants in the pre-fusion conformation. In the native RSV F protein, the F2 polypeptide is linked to the F1 polypeptide by two disulfide bonds to form an F2-F1 heterodimer. The term “Foldon” or “Foldon domain” refers to an amino acid sequence capable of forming a trimer. One example of such a Foldon domain is the peptide sequence derived from bacteriophage T4 fibrin having the sequence GYIPEAPRDGQAYVRKDGEWVLLSTFL (SEQ ID NO: 45).

[0136] In some embodiments, the RNA molecule encodes the RSV F protein mutant disclosed in International Publication No. 2009 / 079796, International Publication No. 2010 / 149745, International Publication No. 2011 / 008974, International Publication No. 2014 / 160463, International Publication No. 2014 / 174018, International Publication No. 2014 / 202570, International Publication No. 2015 / 013551, International Publication No. 2015 / 177312, International Publication No. 2017 / 005848, International Publication No. 2017 / 174564, International Publication No. 2017 / 005844, and International Publication No. 2018 / 109220. The RSV F protein disclosed in these references is incorporated herein by reference in its entirety.

[0137] Antibodies against the RSV F protein are widely distributed after natural infection and vaccination and have been shown to neutralize viral activity in vitro. As used herein, the terms “respiratory syncytial virus” or “RSV” are not limited to any particular strain or variant.

[0138] In some embodiments, the RNA molecule contains an open reading frame encoding the RSV antigen. In some embodiments, the RSV antigen is an RSV polypeptide. In some embodiments, the RSV polypeptide is an RSV glycoprotein, or a fragment or variant thereof. In some embodiments, the RNA molecule encodes the RSV F protein.

[0139] In some aspects, the RSV polypeptide is a full-length RSV polypeptide. In some aspects, the RSV polypeptide is a cleaved RSV polypeptide. In some aspects, the RSV polypeptide is a variant of the RSV polypeptide. In some aspects, the RSV polypeptide is a fragment of the RSV polypeptide.

[0140] In some aspects, the RSV polypeptide is the full-length RSV F protein. In some aspects, the RSV polypeptide is the cleaved RSV F protein. In some aspects, the RSV polypeptide is a variant of the RSV F protein. In some aspects, the RSV polypeptide is a fragment of the RSV F protein.

[0141] In some embodiments, the RSV F protein contains at least one mutation. In some embodiments, the RSV F protein contains at least two mutations. In some embodiments, the RSV F protein contains at least three mutations. In some embodiments, the RSV F protein contains at least four mutations. In some embodiments, the RSV F protein contains four mutations. In some embodiments, the RSV F protein contains at least five mutations.

[0142] In some embodiments, the RNA molecule encodes the RSV F protein listed in Table 1 (see Example 6). In some embodiments, the RNA molecule encodes the RSV F protein, or a fragment or variant thereof, containing any of the amino acid sequences of SEQ ID NOs. 1-6 and 71-74. In some embodiments, the RSV F polypeptide contains at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, of any of the amino acid sequences in Table 1, e.g., SEQ ID NOs. 1-6 and 71-74. 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, up to 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% Identity of %, 98%, or 99%, exactly 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, Alternatively, the protein may have identity between any two of the following percentages: 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the RSV F protein consists of any of the amino acid sequences in Table 1, for example, any of SEQ ID NOs. 1-6 and 71-74.

[0143] In some embodiments, the RNA molecule sequence is transcribed from the DNA nucleic acid sequences (DNA polynucleotides) in Table 2 (see Example 6). In some embodiments, the RNA molecule contains an ORF, or a fragment or variant thereof, transcribed from any of the nucleic acid sequences SEQ ID NOs. 7-10 and 59-62. In some embodiments, the RNA molecule contains at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, and 92% of any of the nucleic acid sequences in Table 2, e.g., SEQ ID NOs. 7-10 and 59-62. 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, up to 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , or 99% identity, exactly 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, or 70%, 71%, The RNA molecule contains an ORF transcribed from a nucleic acid sequence that may have identity between any two of the following percentages: 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the RNA molecule contains an ORF transcribed from any of the nucleic acid sequences in Table 2, for example, any of the sequence numbers 7-10 and 59-62.

[0144] In some embodiments, the RNA molecule comprises an ORF containing the RNA nucleic acid sequence (RNA polynucleotide) of Table 3 (see Example 6). In some embodiments, the RNA molecule comprises an ORF, or a fragment or variant thereof, containing any of the nucleic acid sequences of SEQ ID NOs. 11-16 and 63-70. In some embodiments, the RNA molecule comprises at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, and 91% of any of the RNA nucleic acid sequences of Table 3, e.g., any of SEQ ID NOs. 11-16 and 63-70. 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, up to 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98%, or 99% identity, exactly 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, or 70%, The ORF includes a nucleic acid sequence which may have identity between any two of the following percentages: 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the RNA molecule includes an ORF which includes a nucleic acid sequence which consists of any of the RNA nucleic acid sequences in Table 3, for example, any of the sequence numbers 11-16 and 63-70.

[0145] In some embodiments, the RNA molecule comprises stabilized RNA. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by N1-methylpseudridine. In some embodiments, the RNA molecule comprises a sequence in which all uridines are replaced by N1-methylpseudridine (referred to as "Ψ"). In some embodiments, the RNA molecule comprises an ORF containing any of the nucleic acid sequences of SEQ ID NOs. 11-16 and 63-70, in which all uridines are replaced by N1-methylpseudridine (referred to as "Ψ").

[0146] In some embodiments, the RNA molecule is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of any of the RSV F protein sequences of SEQ ID NOs. 1-6 and 71-74 (Table 1) or other RSV pre-fusion F proteins described herein, and up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, accurately The RNA molecule includes an open reading frame encoding an RSV F protein amino acid sequence which may be identical among any two of the following percentages: 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the RNA molecule includes an open reading frame encoding an RSV F protein amino acid sequence which consists of any of the RSV F protein sequences of SEQ ID NOs.1-6 and 71-74 (Table 1) or other RSV pre-fusion F proteins described herein.

[0147] In some embodiments, RNA molecules are at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of any of the nucleic acid sequences of SEQ ID NOs. 7-10 and 59-62 (Table 2) or other nucleic acids described herein, up to a maximum of 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% The RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence that is identical to, or 99%, exactly 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or any two of the following percentages. In some embodiments, the RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence consisting of any of the nucleic acid sequences of SEQ ID NOs.7-10 and 59-62 (Table 2) or other nucleic acids described herein.

[0148] In some embodiments, RNA molecules are at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of any of the nucleic acid sequences of SEQ ID NOs. 11-16 and 63-70 (Table 3) or other nucleic acids described herein, and up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 9 The open reading frame includes an RNA nucleic acid sequence that is identical in any two of the following percentages: 8%, 99%, exactly 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the RNA molecule includes an open reading frame that includes an RNA nucleic acid sequence consisting of any of the nucleic acid sequences of SEQ ID NOs.11-16 and 63-70 (Table 3) or other nucleic acids described herein. In some embodiments, the RNA molecule contains an ORF comprising one of the nucleic acid sequences of SEQ ID NOs. 11-16 and 63-70 (Table 3), in which all uridines are replaced by N1-methylpseudridine (referred to as "Ψ").

[0149] III.RNA molecule In some embodiments, the RNA molecules described herein are coding RNA molecules. Coding RNA includes functional RNA molecules that can be translated into peptides or polypeptides. In some embodiments, the coding RNA molecule includes at least one open reading frame (ORF) encoding at least one peptide or polypeptide. The open reading frame includes a sequence of codons that can be translated into peptides or proteins. The coding RNA molecule may include 1 (monocistronic), 2 (dipistronic), or more (multicistronic) ORFs, which may be sequences of codons that can be translated into polypeptides or proteins of interest.

[0150] The coding RNA molecule may be a messenger RNA (mRNA) molecule, a viral RNA molecule, or a self-amplifying RNA molecule (saRNA, also referred to as a replicon). In some embodiments, the RNA molecule is mRNA. Preferably, the RNA molecule of this disclosure is mRNA. In some embodiments, the RNA molecule is modRNA. In some embodiments, the RNA molecule is saRNA. In some embodiments, the saRNA molecule may be a coding RNA molecule.

[0151] An RNA molecule may encode one or more polypeptides of interest, such as one or more antigens, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptides. Alternatively or additionally, a single RNA molecule may also encode one or more polypeptides of interest, such as antigens, and may be a 2-cistronic or 3-cistronic RNA molecule encoding different or identical antigens.

[0152] The sequence of an RNA molecule may be codon-optimized or deoptimized for expression in a desired host, e.g., human cells. In some embodiments, the gene of interest (e.g., an antigen) described herein is codon-optimized and / or encoded by a coding sequence in which its guanosine / cytidine (G / C) content is increased compared to the wild-type coding sequence. In some embodiments, one or more sequence regions of the coding sequence are codon-optimized and / or have an increased G / C content compared to the corresponding sequence region of the wild-type coding sequence. In some embodiments, codon optimization and / or increased G / C content do not alter the sequence of the encoded amino acid sequence.

[0153] Those skilled in the art will understand that the term “codon optimized” refers to modifying codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism without altering the amino acid sequence encoded by the nucleic acid molecule. In the context of this disclosure, in some embodiments, the coding region is codon optimized for optimal expression in the subject treated with the RNA polynucleotides described herein. Codon optimization is based on the finding that translation efficiency is also determined by the different frequencies of tRNA molecules present in a cell. Thus, the RNA sequence may be modified so that codons where frequently present tRNA molecules are available are inserted in place of “rare codons.”

[0154] In some embodiments, the G / C content of the coding region of an RNA (e.g., the sequence of the gene of interest; the open reading frame (ORF)) is increased compared to the G / C content of the corresponding coding sequence of the wild-type RNA encoding the gene of interest, and in some embodiments, the amino acid sequence encoded by the RNA is not modified compared to the amino acid sequence encoded by the wild-type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region being translated is important for the efficient translation of its mRNA. Sequences with increased G (guanosine) / C (cytidine) content are more stable than sequences with increased A (adenosine) / U (uridine) content. With respect to the fact that several codons encode one identical amino acid (so-called degeneracy of the genetic code), the most favorable codon for stability may be determined (so-called selective codon usage). Depending on the amino acids encoded by the RNA, there are various possibilities for modification of the RNA sequence compared to its wild-type sequence. In particular, codons containing A and / or U nucleosides may be modified by substituting these codons with other codons that encode the same amino acids but do not contain A and / or U, or that contain lower amounts of A and / or U nucleosides. Thus, in some embodiments, the G / C content of the coding region of the RNA described herein is increased by at least 10%, 20%, 30%, 40%, 50%, 55%, up to 10%, 20%, 30%, 40%, 50%, 55%, exactly 10%, 20%, 30%, 40%, 50%, 55%, or any two of 10%, 20%, 30%, 40%, 50%, 55%, or even higher percentages compared to the G / C content of the coding region of wild-type RNA. In some embodiments, the coding region of the RSV RNA described herein contains a G / C content of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or about 80%.In some embodiments, the coding region of the RSV RNA described herein contains a G / C content of approximately 50% to 75%, approximately 55% to 70%, approximately 50% to 60%, approximately 60% to 70%, approximately 70% to 80%, approximately 50% to 55%, approximately 55% to 60%, approximately 60% to 65%, approximately 65% ​​to 70%, approximately 70% to 75%, or approximately 75% to 80%. In some embodiments, the coding region of the RSV RNA described herein contains a G / C content of approximately 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%. In some embodiments, the coding region of the RSV RNA described herein contains a G / C content of approximately 58%, 66%, or 62%.

[0155] In some aspects, RNA molecules have approximately 20 to approximately 100,000 nucleotides (e.g., 30-50, 30-100, 30-250, 30-500, 30-1,000, 30-1,500, 30-3,000, 30-5,000, 30-7,000, 30-10,000, 30-25,000, 30-50,000, 30-70,000, 100-250, 100-500, 100-1,000, 100- 1,500, 100-3,000, 100-5,000, 100-7,000, 100-10,000, 100-25,000, 100-50,000, 100-70,000, 100-100,000, 500-1,000, 500-1,500, 500-2,000, 500-3,000, 500-5,000, 500-7,000, 500-10,000, 500-25,000, 500-50,000 , 500~70,000, 500~100,000, 1,000~1,500, 1,000~2,000, 1,000~3,000, 1,000~5,000, 1,000~7,000, 1,000~10,000, 1,000~25,000, 1,000~50,000, 1,000~70,000, 1,000~100,000, 1,500~3,000, 1,500~5,000, 1,500~7,000 (Containing 0, 1,500-10,000, 1,500-25,000, 1,500-50,000, 1,500-70,000, 1,500-100,000, 2,000-3,000, 2,000-5,000, 2,000-7,000, 2,000-10,000, 2,000-25,000, 2,000-50,000, 2,000-70,000, and 2,000-100,000 nucleotides).

[0156] In some embodiments, RNA molecules are at least 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2 400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7 400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 3 0000, 32000, 34000, 36000, 38000, 40000, 42000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72,000, 74,000, 76,000, 78,000, 80,000, 82,000, 84,000, 86,000, 88,000, 90,000, 92,000, 94,000, 96,000, 98,000, or 100,000 pieces, with a maximum of 20, 40, 60, 80, 100, 120, 140, 16 0, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780 , 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000,4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000 ,9200,9400,9600,9800,10000,10000,12000,14000,16000,18000,20000,22000,24000,26000,28000,30000,32000,34000,36000,38000,40000,42 000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000, exactly 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 34 0, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 96 0, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400 , 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, 10000, 10000, 1 2000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 36000, 38000, 40000, 42000, 44000, 46000, 48000, 50000, 52000,54000, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000 pieces, or approximately 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600 ,4800,5000,5200,5400,5600,5800,6000,6200,6400,6600,6800,7000,7200,7400,7600,7800,8000,8200,8400,8600,8800,9000,9200,9400,9600,9800,10000,10000,12000,14000,16000,18000,20000,22000,24000,26000,28000,30000,32000,34000,36000,3 It has a number of nucleotides between any two of the following: 8000, 40000, 42000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000.

[0157] In some embodiments, an RNA molecule contains at least 100 nucleotides. For example, in some embodiments, RNA has lengths of 100 to 15,000 nucleotides; 7,000 to 16,000 nucleotides; 8,000 to 15,000 nucleotides; 9,000 to 12,500 nucleotides; 11,000 to 15,000 nucleotides; 13,000 to 16,000 nucleotides; and 7,000 to 25,000 nucleotides. In some embodiments, RNA molecules are present in at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, and 200 0, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, ​​3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700, 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 59 50, 6000, 6050, 6100, 6150, 6200, 6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450, 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900,7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700, 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950, 10000, 10050, 10100, 10150, 10200, 10250, 10300, 103 50, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 11000, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11 400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 1 2450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500 , 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 pieces, with a maximum of 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050,2100、2150、2200、2250、2300、2350、2400、2450、2500、2550、2600、2650、2700、2750、2800、2850、2900、2950、3000、3050、3100、3150、3200、3250、3300、3350、3400、3450、3500、3550、3600、3650、3700、3750、3800、3850、3900、3950、4000、4050、4100、4150、4200、4250、4300、4350、4400、4450、4500、4550、4600、4650、4700、4750、4800、4850、4900、4950、5000、5050、5100、5150、5200、5250、5300、5350、5400、5450、5500、5550、5600、5650、5700、5750、5800、5850、5900、5950、6000、6050、6100、6150、6200、6250、6300、6350、6400、6450、6500、6550、6600、6650、6700、6750、6800、6850、6900、6950、7000、7050、7100、7150、7200、7250、7300、7350、7400、7450、7500、7550、7600、7650、7700、7750、7800、7850、7900、7950、8000、8050、8100、8150、8200、8250、8300、8350、8400、8450、8500、8550、8600、8650、8700、8750、8800、8850、8900、8950、9000、9050、9100、9150、9200、9250、9300、9350、9400、9450、9500、9550、9600、9650、9700、9750、9800、9850、9900、9950、10000、10050、10100、10150、10200、10250、10300、10350、10400、10450、10500、10550、10600、10650、10700、10750、10800、10850、10900、10950、11000、11050、11100、11150、11200、11250、11300、11350、11400、11450、11500、11550、11600、11650、11700、11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750 , 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 1380 0, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 148 50, 14900, 14950, or 15000 pieces, exactly 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200 , 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450 , 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, ​​3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700 ,3750,3800,3850,3900,3950,4000,4050,4100,4150,4200,4250,4300,4350,4400,4450,4500,4550,4600,4650,4700,4750,4800,4850,4900,4950 , 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, 6000, 6050, 6100, 6150, 6200,6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450 , 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900, 7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700 ,8750,8800,8850,8900,8950,9000,9050,9100,9150,9200,9250,9300,9350,9400,9450,9500,9550,9600,9650,9700,9750,9800,9850,9900,9950 , 10000, 10050, 10100, 10150, 10200, 10250, 10300, 10350, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 1100 0, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12 050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 1 3100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 pieces, or approximately 100, 150,200、250、300、350、400、450、500、550、600、650、700、750、800、850、900、950、1000、1050、1100、1150、1200、1250、1300、1350、1400、1450、1500、155、 0、1600、1650、1700、1750、1800、1850、1900、1950、2000、2050、2100、2150、2200、2250、2300、2350、2400、2450、2500、2550、2600、2650、2700、2750、2800、2850、2900、2950、3000、3050、3100、3150、3200、3250、3300、3350、3400、3450、3500、3550、3600、3650、3700、3750、3800、3850、3900、3950、4000、4050、4100、4150、4200、4250、4300、4350、4400、4450、4500、4550、4600、4650、4700、4750、4800、4850、4900、4950、5000、5050、5100、5150、5200、5250、5300、5350、5400、5450、5500、5550、5600、5650、5700、5750、5800、5850、5900、5950、6000、6050、6100、6150、6200、6250、6300、6350、6400、6450、6500、6550、6600、6650、6700、6750、6800、6850、6900、6950、7000、7050、7100、7150、7200、7250、7300、7350、7400、7450、7500、7550、7600、7650、7700、7750、7800、7850、7900、7950、8000、8050、8100、8150、8200、8250、8300、8350、8400、8450、8500、8550、8600、8650、8700、8750、8800、8850、8900、8950、9000、9050、9100、9150、9200、9250、9300、9350、9400、9450、9500、9550、9600、9650、9700、9750、9800、9850、9900、9950、10000、10050、10100、10150、10200、10250、10300、10350、10400、10450、10500、10550、10600、10650、10700、10750、10800、10850、10900、10950、11000、11050、11100、11150、11200、11250、11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, It has a number of nucleotides between any two of the following: 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000.

[0158] The RNA molecules of this disclosure may be prepared by any method known in the art, including chemical synthesis and in vitro methods, such as RNA in vitro transcription. In some embodiments, the RNA of this disclosure is prepared using in vitro transcription.

[0159] In some embodiments, the RNA molecules of this disclosure may be purified by, for example, ultrafiltration, diafiltration, or filtration, for example, via tangential flow ultrafiltration / diafiltration.

[0160] In some embodiments, the RNA molecules of this disclosure are freeze-dried to be temperature-stable.

[0161] In some aspects of this disclosure, RNA is or includes messenger RNA (mRNA) associated with an RNA transcript encoding a polypeptide. In some aspects, the RNA disclosed herein includes a 5' cap containing the 5' cap disclosed herein; a 5' untranslated region (5'UTR) containing a sequence proximal to the cap; a sequence encoding a protein (e.g., a polypeptide) (e.g., a pre-RSV fusion F protein); a 3' untranslated region (3'UTR); and / or a polyadenylated (polyA) sequence.

[0162] In some embodiments, the RNA disclosed herein comprises the following components in a 5'-to-3' orientation: a 5' cap containing the 5' cap disclosed herein; a 5' untranslated region (5'UTR) containing a sequence proximal to the cap, a sequence encoding a protein (e.g., a polypeptide) (e.g., a pre-RSV fusion F protein); a 3' untranslated region (3'UTR); and a polyA sequence.

[0163] In some embodiments, the RNA disclosed herein further comprises signal peptides. Non-limiting examples of signal peptides and amino acids, as well as nucleic acid sequences encoding such peptides, can be found, for example, in International Publication No. 2017 / 109629, which is incorporated herein by reference in its entirety.

[0164] In some embodiments, the RNAs disclosed herein encode antigenic fusion proteins. Thus, one or more antigens encoded may comprise two or more proteins (e.g., a protein and / or protein fragments) fused to each other. Alternatively, the proteins to which the protein antigen is fused do not promote a strong immune response to themselves rather than to the antigen. In some embodiments, the antigenic fusion proteins retain functional properties from each of the original proteins. In some embodiments, the RNAs disclosed herein encode fusion proteins containing antigens ligated to a scaffold portion. In some embodiments, the RNA further encodes linkers located between at least one or each of the domains of the fusion protein. Non-limiting examples of such scaffold portions and linkers can be found, for example, in International Publication No. 2022 / 067010, which is incorporated herein by reference in its entirety.

[0165] A. Modified nucleic acid bases In some embodiments of this disclosure, the RNA molecule is chemically unmodified and contains a standard ribonucleotide consisting of adenosine, guanosine, cytosine, and uridine. In some embodiments, the nucleotides and nucleosides of this disclosure contain standard nucleoside residues, e.g., those present in transcribed RNA (e.g., A, G, C, and / or U). In some embodiments, the nucleotides and nucleosides of this disclosure contain standard deoxyribonucleosides, e.g., those present in DNA (e.g., dA, dG, dC, and / or dT).

[0166] In other embodiments of this disclosure, the RNA molecule may contain modified nucleosides and modified nucleic acid bases that can be incorporated into nucleotides. In some embodiments, the RNA molecule may contain one or more modified nucleotides. Naturally occurring nucleotide modifications are known in the art. In some embodiments, the RNA molecule may contain modified nucleotides. Non-exclusive examples of modified nucleotides that may be contained in RNA molecules include pseudouridine, N1-methylpseudridine, 5-methyluridine, 3-methyluridine, 5-methoxyuridine, 5-azauridine, 6-azauridine, 2-thio-5-azauridine, 2-thiouridine, 4-thiouridine, 4-thiopseudridine, 2-thiopseudridine, 5-hydroxyuridine, 5-aminoallyluridine, 5-halouridine (e.g., 5-iodouridine or 5-bromouridine), uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyluridine, 1-carboxymethylpseudridine, 5-carboxyhydroxymethyluridine, 5-carboxyhydroxymethyluridine methyl ester, 5-methoxycarbonylmethyluridine, 5-methoxycarbonylmethyl-2-thiouridine, and 5-aminomethyl-2 -Thio-uridine, 5-methylaminomethyl-uridine, 1-ethyl-pseuduridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseuduridine, 5-taurinomethyl-uridine, 1-taurinomethyl Chil-pseuduridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-pseuduridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseuduridine, 4-thio-1-methyl-pseuduridine, 3-methyl-1-pseuduridine, 2-thio-1-methyl-pseuduridine, 1-methyl-1-deaza-pseuduridine, 2-thio-1-methyl-1-deaza-pseuduridine, dihydrouridine,Dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O-methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5-carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl-uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine, and any other modified uridine known in the art, or combinations thereof. In some embodiments, 1, 2, 3, 4, 5, or more of the above modified nucleotides can be excluded from the RNA molecules disclosed herein.,

[0167] Possible modifications present in RNA molecules include, for example: ms2io6A(2-methylthio-(N6-(cis-hydroxyisopentenyl)adenosine); ms2m6A(2-methylthio-N6-methyladenosine); ms2t6A 2-methylthio-N6-threonylcarbamoyladenosine; g6A(N6-glycinylcarbamoyladenosine); i6A(N6-isopentenyladenosine); m6A(N6-methyladenosine); t6A(N6-threonylcarbamoyladenosine); m'Am(1,2'-O-dimethyladenosine); m1A(1-methyladenosine); 2'-O-methyladenosine; A r(p)(2'-O-ribosyladenosine (phosphate));2-methyladenosine;2-methylthio-N6 isopentenyladenosine;ms2hn6A(2-methylthio-N6-hydroxynorvalylcarbamoyladenosine);2-O-methyladenosine;Am(2-1-O-methyladenosine);2'-O-ribosyladenosine (phosphate);isopentenyladenosine;io6A N6-(cis-hydroxyisopentenyl)adenosine; m6Am(N6,2'-O-dimethyladenosine); m62Am(N6,N6,2'-O-trimethyladenosine); m62A(N6,N6-dimethyladenosine); ac6A(N6-acetyladenosine); hn6A(N6-hydroxynorvalylcarbamoyladenosine); m6t6A(N6-methyl-N6-threonylcarbamoyladenosine); m2A(2-methyladenosine); ms2i6A(2-methylthio-N6-isopentenyladenosine); 7-deaza-adenosine; N1-methyl-adenosine; N6,N6(dimethyl)adenine; N6 -Cis-hydroxy-isopentenyl-adenosine; α-thio-adenosine; 2(amino)adenine; 2(aminopropyl)adenine; 2(methylthio)N6(isopentenyl)adenine; 2-(alkyl)adenine; 2-(aminoalkyl)adenine; 2-(aminopropyl)adenine; 2-(halo)adenine; 2-(propyl)adenine; 2'-amino-2'-deoxy-ATP; 2'-azido-2'-deoxy-ATP; 2'-deoxy-2'-α-aminoadenosine TP; 2'-deoxy-2'-α-azideadodenosine TP; 6(alkyl)adenine; 6(methyl)adenine; 6-(alkyl)adenine;6-(methyl)adenine; 7(deaza)adenine; 8(alkenyl)adenine; 8(alkynyl)adenine; 8(amino)adenine; 8(thioalkyl)adenine; 8-(alkenyl)adenine; 8-(alkyl)adenine; 8-(alkynyl)adenine; 8-(amino)adenine; 8-(halo)adenine; 8-(hydroxyl)adenine; 8-(thioalkyl)adenine; 8-(thiol)adenine; 8-azido-adenosine; 8-oxo-adenine; azaadenine; deazaadenine; N6(methyl)adenine; N6-(isopentyl)adenine; 7-Deaza-8-Aza-adenosine; 7-Methyladenine; 1-Deazaadenosine TP; 2'Fluoro-N6-Bz-Deoxyadenosine TP; 2'-OMe-2-Amino-ATP; 2'O-Methyl-N6-Bz-Deoxyadenosine TP; 2'-α-Ethynyladenosine TP; 2-Aminoadenine; 2-Aminoadenosine TP; 2-Amino-ATP; 2'-α-Trifluoromethyladenosine TP; 2-Azidoadenosine TP; 2'-β-Ethynyladenosine TP; 2-Bromodenosine TP; 2'-β-Trifluoromethyladenosine TP; 2- Chloroadenosine TP; 2'-deoxy-2',2'-difluoroadenosine TP; 2'-deoxy-2'-α-mercaptoadenosine TP; 2'-deoxy-2'-α-thiomethoxyadenosine TP; 2'-deoxy-2'-β-aminoadenosine TP; 2'-deoxy-2'-β-azidoadenosine TP; 2'-deoxy-2'-β-bromoadenosine TP; 2'-deoxy-2'-β-chloroadenosine TP; 2'-deoxy-2'-β-fluoroadenosine TP; 2'-deoxy-2'-β-iodoadenosine TP; 2'-deoxy-2'- β-mercaptoadenosine TP; 2'-deoxy-2'-β-thiomethoxyadenosine TP; 2-fluoroadenosine TP; 2-iodoadenosine TP; 2-mercaptoadenosine TP; 2-methoxyadenine; 2-methylthioadenine; 2-trifluoromethyladenosine TP; 3-deaza-3-bromoadenosine TP; 3-deaza-3-chloroadenosine TP; 3-deaza-3-fluoroadenosine TP; 3-deaza-3-iodoadenosine TP; 3-deazaadenosine TP; 4'-azidoadenosine TP; 4'-carbocyclic adenosine TP;4'-Ethinyladenosine TP; 5'-Homo-adenosine TP; 8-Aza-ATP; 8-Bromo-adenosine TP; 8-Trifluoromethyladenosine TP; 9-Deazaadenosine TP; 2-Aminopurine; Substituting 7-Deazapurine; 7-Deaza-7-Substituting Purine; 7-Deaza-8-Substituting Purine; 7-Deaza-2,6-Diaminopurine; 7-Deaza-8-Aza-2,6-Diaminopurine; 7-Deaza-8-Aza-2-Aminopurine; 2,4-Diaminopurine; 2,6-Diaminopurine; 7-Deaza-8-Aza-Adenine; 7-Deaza-2-Aminopurine; 8 -Azapurine; s2C(2-thiocytidine); m3C(3-methylcytidine); f5C(5-formylcytidine); hm5C(5-hydroxymethylcytidine); m5C(5-methylcytidine); ac4C(N4-acetylcytidine); Cm(2'-O-methylcytidine); m5Cm(5,2'-O-dimethylcytidine); f5Cm(5-formyl-2'-O-methylcytidine); k2C(lysidine); m4Cm(N4,2'-O-dimethylcytidine); ac4Cm(N4-acetyl-2'-O-methylcytidine); m4C(N4-methylcytidine); N 4,N4-dimethyl-2'-OMe-cytidine TP; 4-methylcytidine; 5-aza-cytidine; pseudo-isocytidine; pyrrolo-cytidine; α-thiocytidine; 2-(thio)cytosine; 2'-amino-2'-deoxy-CTP; 2'-azido-2'-deoxy-CTP; 2'-deoxy-2'-α-aminocytidine TP; 2'-deoxy-2'-α-azidocytidine TP; 3(deaza)5(aza)cytosine; 3(methyl)cytosine; 3-(alkyl)cytosine; 3-(deaza)5(aza)cytosine; 3-(methyl)cytidine; 4,2'-O-dimethyl Chilcytidine; 5(halo)cytosine; 5(methyl)cytosine; 5(propynyl)cytosine; 5(trifluoromethyl)cytosine; 5-chlorocytosine; 5-fluorocytosine; 5-bromocytosine; 5-hydroxycytosine; 5-methylcytosine; 5-(alkyl)cytosine; 5-(alkenyl)cytosine; 5-(alkynyl)cytosine; 5-(halo)cytosine; 5-(propynyl)cytosine; 5-(trifluoromethyl)cytosine; 5-bromocytidine; 5-iodocytidine; 5-propynylcytosine; 6-(azo)cytosine; 6-azacytidine;Azacytosine; Deazacytosine; N4(acetyl)cytosine; 1-methyl-1-deaza-pseudoisocytidine; 1-methyl-pseudoisocytidine; 2-methoxy-5-methylcytidine; 2-methoxycytidine; 2-thio-5-methylcytidine; 4-methoxy-1-methyl-pseudoisocytidine; 4-methoxy-pseudoisocytidine; 4-thio-1-methyl-1-deaza-pseudoisocytidine; 4-thio-1-methyl-pseudoisocytidine; 4-thio-pseudoisocytidine; 5-aza-zebralin; 5-methyl-zebralin; pyrrolo- Pseudoisocytidine; Zebralin; (E)-5-(2-bromo-vinyl)cytidine TP; 2,2'-anhydrocytidine TP hydrochloride; 2'fluoro-N4-Bz-cytidine TP; 2'fluoro-N4-acetylcytidine TP; 2'-O-methyl-N4-acetylcytidine TP; 2'O-methyl-N4-Bz-cytidine TP; 2'-α-ethynylcytidine TP; 2'α-trifluoromethylcytidine TP; 2'-β-ethynylcytidine TP; 2'β-trifluoromethylcytidine TP; 2'-deoxy-2',2'-difluorocytidine 2'-Deoxy-2'-α-Mercaptocytidine; 2'-Deoxy-2'-α-Thiomethoxycytidine; 2'-Deoxy-2'-β-Aminocytidine; 2'-Deoxy-2'-β-Azidocytidine; 2'-Deoxy-2'-β-Bromocytidine; 2'-Deoxy-2'-β-Chlorocytidine; 2'-Deoxy-2'-β-Fluorocytidine; 2'-Deoxy-2'-β-Iodocytidine; 2'-Deoxy-2'-β-Mercaptocytidine; 2'-Deoxy-2'-β-Thiomethoxycytidine; 2'-O -Methyl-5-(1-propynyl)cytidine TP; 3'-ethynylcytidine TP; 4'-azidocytidine TP; 4'-carbocyclic cytidine TP; 4'-ethynylcytidine TP; 5-(1-propynyl)alacytidine TP; 5-(2-chlorophenyl)-2-thiocytidine TP; 5-(4-aminophenyl)-2-thiocytidine TP; 5-aminoallyl-CTP; 5-cyanocytidine TP; 5-ethynylalacytidine TP; 5-ethynylcytidine TP; 5'-homocytidine TP; 5-methoxycytidine TP; 5-trifluoromethylcytidine TP;N4-amino-cytidine TP; N4-benzoyl-cytidine TP; pseudoisocytidine; mimG (methylguanosine); m7G (7-methylguanosine); m2Gm (N2,2'-O-dimethylguanosine); m2G (N2-methylguanosine); imG (viosine); m1Gm (1,2'-O-dimethylguanosine); m1G (1-methylguanosine); 2'-O-methylguanosine; 2'-O-ribosylguanosine (phosphate); Gm (2'-O-methylguanosine); Gr(p) (2'-O-ribosylguanosine (phosphate)); preQi (7-aminomethyl-7-deazaguanosine); preQo (7-cyano-7-deazaguanosine); G; *(Alkaeosin); Methyl yosin; m2'7G(N2,7-dimethylguanosine); m22Gm(N2,N2,2'-O-trimethylguanosine); m2'2'7G(N2,N2,7-trimethylguanosine); m22G(N2,N2-dimethylguanosine); N2,7,2'-O-trimethylguanosine; 6-thioguanosine; 7-deazaguanosine; 8-oxoguanosine; N1-methylguanosine; α-thioguanosine; 2(propyl)guani N; 2-(alkyl)guanine; 2'-amino-2'-deoxy-GTP; 2'-azido-2'-deoxy-GTP; 2'-deoxy-2'-α-aminoguanosine TP; 2'-deoxy-2'-α-azidoguanosine TP; N2-dimethylguanine; 6-(methyl)guanine; 6-(alkyl)guanine; 6-(methyl)guanine; 6-methyl-guanosine; 6-thioguanine; 7(alkyl)guanine; 7-deaza-7-substituted guanine; 7-deaza-7-(C2~C 6) Alkynyl guanine; 7-deaza-8-substituted guanine; 7(methyl)guanine; 7-(alkyl)guanine; 7-(deaza)guanine; 7-(methyl)guanine; 8-azaguanine; 8-hydroxyguanine; 8-oxoguanine; 8(alkyl)guanine; 8(alkynyl)guanine; 8(halo)guanine; 8(thioalkyl)guanine; 8-(alkenyl)guanine; 8-(alkyl)guanine; 8-(alkynyl)guanine; 8-(amino)guanine; 8- (Halo)guanine; 8-(hydroxyl)guanine; 8-(thioalkyl)guanine; 8-(thiol)guanine; azaguanine; deazaguanine; N(methyl)guanine; N-(methyl)guanine; 1-methyl-6-thio-guanosine; 6-methoxy-guanosine; 6-thio-7-deaza-8-aza-guanosine; 6-thio-7-deaza-guanosine; 6-thio-7-methyl-guanosine; 7-deaza-8-aza-guanosine; 7-methyl-8-oxo-guanosine; N2,N2-dimethyl-6-thio-guanosine; N2-methyl-6-thio-guanosine; 1-me-GTP; 2'-fluoro-N2-isobutyl-guanosine TP; 2'-0-methyl-N2-isobutyl-guanosine TP; 2'-α-ethynylguanosine TP; 2'-α-trifluoromethylguanosine TP; 2'-β-ethynylguanosine TP; 2'-β-trifluoromethylguanosine TP; 2'-deoxy-2',2'-difluoroguanosine TP; 2'-deoxy-2'-α-mercaptoguanosine TP; 2'-deoxy-2'-α-thiomethoxyguanosine Nosine TP; 2'-Deoxy-2'-β-Aminoguanosine TP; 2'-Deoxy-2'-β-Azidoguanosine TP; 2'-Deoxy-2'-β-Bromoguanosine TP; 2'-Deoxy-2'-β-Chloroguanosine TP; 2'-Deoxy-2'-β-Fluoroguanosine TP; 2'-Deoxy-2'-β-Iodoguanosine TP; 2'-Deoxy-2'-β-Mercaptoguanosine TP; 2'-Deoxy-2'-β-Thiomethoxyguanosine TP; 4'-Azidoguanosine TP; 4'-Carbocyclic Guanosine TP; 4'-Ethinylguanosine TP; 5' -Homo-guanosine TP; 8-bromo-guanosine TP; 9-deazaguanosine TP; N2-isobutyl-guanosine TP; miI(1-methylinosine); I(inosine); m'lm(1,2'-O-dimethylinosine); 2'-O-methylinosine; 7-methylinosine; Tm(2'-O-methylinosine); oQ(epoxyquosin); galQ(galactosylquosin); manQ(mannosylquosin); Q(quosin); allylaminothymidine; azathymidine; deazathymidine; deoxythymidine; Um(2'-O-methylinosine) Thiuridine); s2U (2-thiouridine); m3U (3-methyluridine); cm5U (5-carboxymethyluridine); ho5U (5-hydroxyuridine); m5U (5-methyluridine); tm5s2U (5-taurinomethyl-2-thiouridine); 5-taurinomethyluridine; D (dihydrouridine); pseudouridine; acp3U (3-(3-amino-3-carboxypropyl)uridine); 1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine; 1-methylpseudouridine; 1-ethyl-pseudouridine;2'-O-methyluridine; 2'-O-methylpsuduridine; 2'-O-methyluridine; s2Um(2-thio-2'-O-methyluridine); 3-(3-amino-3-carboxypropyl)uridine; m3Um(3,2'-O-dimethyluridine); 3-methylpsuduridineTP; s4U(4-thiouridine); chm5U(5-(carboxyhydroxymethyl)uridine); mchm5U(5-(carboxyhydroxymethyl)uridine methyl ester); m5Um(5,2'-O-dimethyluridine); 5,6-dihydrouridine n;nm5s2U(5-aminomethyl-2-thiouridine);ncm5Um(5-carbamoylmethyl-2'-O-methyluridine);ncm5U(5-carbamoylmethyluridine);5-carboxyhydroxymethyluridine;5-carboxyhydroxymethyluridine methyl ester;cnmm5Um(5-carboxymethylaminomethyl-2'-O-methyluridine);cmnm5s2U(5-carboxymethylaminomethyl-2-thiouridine);5-carboxymethylaminomethyluridine;cmnm5U(5-carboxymethylamino Methyluridine; 5-Carbamoylmethyluridine TP; mcm5Um(5-Methoxycarbonylmethyl-2'-O-methyluridine); mcm5s2U(5-Methoxycarbonylmethyl-2-thiouridine); mcm5U(5-Methoxycarbonylmethyluridine); mo5U(5-Methoxyuridine); m5s2U(5-Methyl-2-thiouridine); mnm5se2U(5-Methylaminomethyl-2-selenouridine); mnm5s2U(5-Methylaminomethyl-2-thiouridine); mnm5U(5-Methylaminomethyluridine); m 5D(5-methyldihydrouridine); 5-oxyacetic acid-uridine TP; 5-oxyacetic acid-methyl ester-uridine TP; dihydrouracil; pseudouracil; N1-methyl-pseudouracil; N1-ethyl-pseudouracil; cmo5U(uridine 5-oxyacetic acid); mcmo5U(uridine 5-oxyacetic acid methyl ester); 3-(3-amino-3-carboxypropyl)-uridine TP; 5-(iso-pentenylaminomethyl)-2-thiouridine TP; 5-(iso-pentenylaminomethyl)-2'-O-methyluridine TP;5-(iso-pentenylaminomethyl)uridine TP; 5-propynyluracil; α-thio-uridine; 1(aminoalkylamino-carbonylethylenyl)-2(thio)-pseudracil; 1(aminoalkylamino-carbonylethylenyl)-2,4-(dithio)pseudracil; 1(aminoalkylamino-carbonylethylenyl)-4(thio)pseudracil; 1(aminoalkylamino-carbonylethylenyl)-pseudracil; 1(aminocarbonylethylenyl)-2(thio)-pseudracil; 1(aminocarbonylethylenyl (Nyl)-2,4-(dithio)pseudracil; 1(aminocarbonylethylenel)-4(thio)pseudracil; 1(aminocarbonylethylenel)-pseudracil; 1-substituted 2(thio)-pseudracil; 1-substituted 2,4-(dithio)pseudracil; 1-substituted 4(thio)pseudracil; 1-substituted pseudouracil; 1-(aminoalkylamino-carbonylethylenel)-2-(thio)-pseudracil; 1-methyl-3-(3-amino-3-carboxypropyl)pseudraidine TP; 1-methyl-3-(3-amino-3-carboxypropyl) Propyl) Pseudo-UTP; 1-Methyl-Pseudo-UTP; 1-Ethyl-Pseudo-UTP; 2(thio) Pseudouracil; 2' Deoxyuridine; 2' Fluorouridine; 2-(thio)uracil; 2,4-(dithio) Pseudouracil; 2' Methyl, 2' Amino, 2' Azide, 2' Fluoro-Guanosine; 2' Amino-2'- Deoxy-UTP; 2' Azide-2'- Deoxy-UTP; 2' Azide-Deoxyuridine TP; 2'-O-Methyl Pseudouracil; 2' Deoxyuridine; 2' Fluorouridine; 2'- Deoxy-2'-α- Minouridine TP; 2'-Deoxy-2'-α-azidouridine TP; 2-Methylpsudouridine; 3(3-amino-3 carboxypropyl)uracil; 4(thio)psudouracil; 4-(thio)psudouracil; 4-(thio)uracil; 4-thiouracil; 5-aminouracil; 5(1,3-diazole-1-alkyl)uracil; 5(2-aminopropyl)uracil; 5(aminoalkyl)uracil; 5(dimethylaminoalkyl)uracil; 5(guanidinium alkyl)uracil; 5(methoxycarbonylmethyl)-2-(thio)uracil;5(methoxycarbonyl-methyl)uracil; 5(methyl)2(thio)uracil; 5(methyl)2,4(dithio)uracil; 5(methyl)4(thio)uracil; 5(methylaminomethyl)-2(thio)uracil; 5(methylaminomethyl)-2,4(dithio)uracil; 5(methylaminomethyl)-4(thio)uracil; 5(propynyl)uracil; 5(trifluoromethyl)uracil; 5-(2-aminopropyl)uracil; 5-(alkyl)-2-(thio)pseudracil; 5-(alkyl)-2,4(dithio)pseudracil; 5-(alkyl 5-(alkyl)pseudracil; 5-(alkyl)uracil; 5-(alkenyl)uracil; 5-(alkynyl)uracil; 5-(allylamino)uracil; 5-(cyanoalkyl)uracil; 5-(dialkylaminoalkyl)uracil; 5-(dimethylaminoalkyl)uracil; 5-(guanidiniumalkyl)uracil; 5-(halo)uracil; 5-(1,3-diazole-1-alkyl)uracil; 5-(methoxy)uracil; 5-(methoxycarbonylmethyl)-2-(thio)uracil; 5-(meth) Xycarbonyl-methyl)uracil; 5-(methyl)2(thio)uracil; 5-(methyl)2,4(dithio)uracil; 5-(methyl)4(thio)uracil; 5-(methyl)-2-(thio)pseudracil; 5-(methyl)-2,4(dithio)pseudracil; 5-(methyl)-4(thio)pseudracil; 5-(methyl)pseudracil; 5-(methylaminomethyl)-2(thio)uracil; 5-(methylaminomethyl)-2,4(dithio)uracil; 5-(methylaminomethyl)-4-(thio)uracil; 5-(propynyl)uracil; 5 -(trifluoromethyl)uracil; 5-aminoallyl-uridine; 5-bromo-uridine; 5-iodo-uridine; 5-uracil; 6(azo)uracil; 6-(azo)uracil; 6-aza-uridine; allylamino-uracil; azauracil; deazauracil; 5-methyluracil; 5-(hydroxymethyl)uracil; 5-chlorouracil; 5-fluorouracil; 5-bromouracil; N3(methyl)uracil; pseudo-UTP-1-2-ethaneic acid; pseudouracil; 4-thio-pseudo-UTP; 1-carboxymethyl-pseudouridine;1-methyl-1-deaza-pseuduridine; 1-propynyl-uridine; 1-taurinomethyl-1-methyl-uridine; 1-taurinomethyl-4-thio-uridine; 1-taurinomethyl-pseuduridine; 2-methoxy-4-thio-pseuduridine; 2-thio-1-methyl-1-deaza-pseuduridine; 2-thio-1-methyl-pseuduridine; 2-thio-5-aza-uridine; 2-thio-dihydropseuduridine; 2-thio-dihydrouridine; 2-thio-pseuduridine; 4-methoxy-2-thio-pseuduridine; 4-methoxy C-pseudridine; 4-thio-1-methylpseudridine; 4-thiopseudridine; 5-aza-uridine; dihydropseudridine; (±)1-(2-hydroxypropyl)pseudridine TP; (2R)-1-(2-hydroxypropyl)pseudridine TP; (2S)-1-(2-hydroxypropyl)pseudridine TP; (E)-5-(2-bromo-vinyl)ala-uridine TP; (E)-5-(2-bromo-vinyl)uridine TP; (Z)-5-(2-bromo-vinyl)ala-uridine TP; (Z)-5-(2-bromo-vinyl)ala-uridine TP; Mo-vinyl)uridine TP; 1-(2,2,2-trifluoroethyl)-pseudo-UTP; 1-(2,2,3,3,3-pentafluoropropyl)pseudouridine TP; 1-(2,2-diethoxyethyl)pseudouridine TP; 1-(2,4,6-trimethylbenzyl)pseudouridine TP; 1-(2,4,6-trimethyl-benzyl)pseudo-UTP; 1-(2,4,6-trimethyl-phenyl)pseudo-UTP; 1-(2-amino-2-carboxyethyl)pseudo-UTP; 1-(2 -Hydroxyethyl)pseudridine TP; 1-(2-methoxyethyl)pseudridine TP; 1-(3,4-bis-trifluoromethoxybenzyl)pseudridine TP; 1-(3,4-dimethoxybenzyl)pseudridine TP; 1-(3-amino-3-carboxypropyl)pseudridine-UTP; 1-(3-amino-propyl)pseudridine-UTP; 1-(3-cyclopropyl-propa-2-inyl)pseudridine TP; 1-(4-amino-4-carboxybutyl)pseudridine-UTP; 1-(4-amino-benzyl)pseudridine-UTP;1-(4-amino-butyl)pseudo-UTP; 11(4-amino-phenyl)pseudo-UTP; 1-(4-azidobenzyl)pseudouridine TP; 1-(4-bromobenzyl)pseudouridine TP; 1-(4-chlorobenzyl)pseudouridine TP; 1-(4-fluorobenzyl)pseudouridine TP; 1-(4-iodobenzyl; Pseudouridine TP; 1-(4-methanesulfonylbenzyl)pseuduridine TP; 1-(4-methoxybenzyl)pseuduridine TP; 1-(4-methoxy-benzyl)pseud-UTP; 1-(4-methoxy-phenyl)pseud-UTP; 1-(4-methylbenzyl)pseuduridine TP; 1-(4-methylbenzyl)pseud-UTP; 1-(4-nitrobenzyl)pseuduridine TP; 1-(4-nitro-benzyl)pseud-UTP; 1-(4-nitro-phenyl)pseud-UTP; 1-(4-thiomethoxybenzyl Pseudouridine TP; 1-(4-trifluoromethoxybenzyl)pseudolidine TP; 1-(4-trifluoromethylbenzyl)pseudolidine TP; 1-(5-amino-pentyl)pseudol-UTP; 1-(6-amino-hexyl)pseudol-UTP; 1,6-dimethyl-pseudol-UTP; 1-[3-(2-{2-[2-(2-aminoethoxy)-ethoxy]-ethoxy}-ethoxy)-propionyl]pseudolidine TP; 1-{3-[2-(2-aminoethoxy)-ethoxy]-propionyl}pseudolidine TP; 1 -Acetylpsuduridine TP; 1-alkyl-6-(1-propynyl)-psud-UTP; 1-alkyl-6-(2-propynyl)-psud-UTP; 1-alkyl-6-allyl-psud-UTP; 1-alkyl-6-ethynyl-psud-UTP; 1-alkyl-6-homoallyl-psud-UTP; 1-alkyl-6-vinyl-psud-UTP; 1-allylpsuduridine TP; 1-aminomethyl-psud-UTP; 1-benzoylpsuduridine TP; 1-benzyloxymethylpsuduridine TP; 1-benzyl- Pseudo-UTP; 1-biotinyl-PEG2-pseuduridine TP; 1-biotinyl-pseuduridine TP; 1-butyl-pseud-UTP; 1-cyanomethylpseuduridine TP; 1-cyclobutylmethyl-pseud-UTP; 1-cyclobutyl-pseud-UTP; 1-cycloheptylmethyl-pseud-UTP; 1-cycloheptyl-pseud-UTP; 1-cyclohexylmethyl-pseud-UTP; 1-cyclohexyl-pseud-UTP; 1-cyclooctylmethyl-pseud-UTP; 1-cyclooctyl-pseud-UTP;1-Cyclopentylmethyl-pseudo-UTP; 1-Cyclopentyl-pseudo-UTP; 1-Cyclopropylmethyl-pseudo-UTP; 1-Cyclopropyl-pseudo-UTP; 1-Ethyl-pseudo-UTP; 1-Hexyl-pseudo-UTP; 1-HomoallylpseudouridineTP; 1-HydroxymethylpseudouridineTP; 1-Iso-propyl-pseudo-UTP; 1-me-2-thio-pseudo-UTP; 1-me-4-thio-pseudo-UTP; 1-me-alpha-thio-pseudo-UTP; 1-Methanesulfonylmethylpseudo Uridine TP; 1-Methoxymethylpseudruridine TP; 1-Methyl-6-(2,2,2-trifluoroethyl)pseudo-UTP; 1-Methyl-6-(4-morpholino)pseudo-UTP; 1-Methyl-6-(4-thiomorpholino)pseudo-UTP; 1-Methyl-6-(substituted phenyl)pseudo-UTP; 1-Methyl-6-aminopseudo-UTP; 1-Methyl-6-azidepseudo-UTP; 1-Methyl-6-bromopseudo-UTP; 1-Methyl-6-butylpseudo-UTP; 1-Methyl-6-chloropseudo-UTP; 1- Methyl-6-cyano-pseudo-UTP; 1-methyl-6-dimethylamino-pseudo-UTP; 1-methyl-6-ethoxy-pseudo-UTP; 1-methyl-6-ethylcarboxylate-pseudo-UTP; 1-methyl-6-ethyl-pseudo-UTP; 1-methyl-6-fluoro-pseudo-UTP; 1-methyl-6-formyl-pseudo-UTP; 1-methyl-6-hydroxyamino-pseudo-UTP; 1-methyl-6-hydroxy-pseudo-UTP; 1-methyl-6-iodo-pseudo-UTP; 1-methyl-6-iso-propyl-pseudo-UTP Do-UTP; 1-methyl-6-methoxy-pseudo-UTP; 1-methyl-6-methylamino-pseudo-UTP; 1-methyl-6-phenyl-pseudo-UTP; 1-methyl-6-propyl-pseudo-UTP; 1-methyl-6-tert-butyl-pseudo-UTP; 1-methyl-6-trifluoromethoxy-pseudo-UTP; 1-methyl-6-trifluoromethyl-pseudo-UTP; 1-morpholinomethylpseudouridine TP; 1-pentyl-pseudo-UTP; 1-phenyl-pseudo-UTP; 1-pivaloylpseudouridine TP;1-Propargyl Pseudouridine TP; 1-Propyl Pseudo-UTP; 1-Propynyl Pseudouridine; 1-p-Tolyl Pseudo-UTP; 1-Tert-Butyl Pseudo-UTP; 1-Thiomethoxymethyl Pseudouridine TP; 1-Thiomemorpholinomethyl Pseudouridine TP; 1-Trifluoroacetyl Pseudouridine TP; 1-Trifluoromethyl Pseudo-UTP; 1-Vinyl Pseudouridine TP; 2,2'-Anhydrouridine TP; 2'-Bromo-Deoxyuridine TP; 2'-F-5-Methyl-2'-Deoxy -UTP;2'-OMe-5-me-UTP;2'-OMe-pseudo-UTP;2'-a-ethynyluridineTP;2'-a-trifluoromethyluridineTP;2'-b-ethynyluridineTP;2'-b-trifluoromethyluridineTP;2'-deoxy-2',2'-difluorouridineTP;2'-deoxy-2'-a-mercaptouridineTP;2'-deoxy-2'-a-thiomethoxyuridineTP;2'-deoxy-2'-b-aminouridineTP;2'-deoxy-2'-b-azidouridineTP;2'-deoxy-2'-b-b Romoruridine TP; 2'-Deoxy-2'-β-Chlorouridine TP; 2'-Deoxy-2'-β-Fluorouridine TP; 2'-Deoxy-2'-β-Iodouridine TP; 2'-Deoxy-2'-β-Mercaptouridine TP; 2'-Deoxy-2'-β-Thiomethoxyuridine TP; 2-Methoxy-4-Thio-uridine; 2-Methoxyuridine; 2'-O-Methyl-5-(1-Propynnyl)uridine TP; 3-Alkyl-Pseudo-UTP; 4'-Azidouridine TP; 4'-Carbocyclic Uridine TP; 4'-Ethynyluridine TP; 5-(1-P Ropinyl)ara-uridine TP; 5-(2-furanyl)uridine TP; 5-cyanouridine TP; 5-dimethylaminouridine TP; 5'-homo-uridine TP; 5-iodo-2'-fluorodeoxyuridine TP; 5-phenylethynyluridine TP; 5-triduteromethyl-6-duterouridine TP; 5-trifluoromethyluridine TP; 5-vinylalauridine TP; 6-(2,2,2-trifluoroethyl)-pseudo-UTP; 6-(4-morpholino)-pseudo-UTP; 6-(4-thiomorpholino)-pseudo-UTP;6-(substituted-phenyl)-pseudo-UTP; 6-amino-pseudo-UTP; 6-azido-pseudo-UTP; 6-bromo-pseudo-UTP; 6-butyl-pseudo-UTP; 6-chloro-pseudo-UTP; 6-cyano-pseudo-UTP; 6-dimethylamino-pseudo-UTP; 6-ethoxy-pseudo-UTP; 6-ethylcarboxylate-pseudo-UTP; 6-ethyl-pseudo-UTP; 6-fluoro-pseudo-UTP; 6-formyl-pseudo-UTP; 6-hydroxyamino-pseudo-UTP; 6-hydroxy-pseudo-UTP; 6-iodo-pseudo -UTP; 6-isopropyl-pseudo-UTP; 6-methoxy-pseudo-UTP; 6-methylamino-pseudo-UTP; 6-methyl-pseudo-UTP; 6-phenyl-pseudo-UTP; 6-phenyl-pseudo-UTP; 6-propyl-pseudo-UTP; 6-tert-butyl-pseudo-UTP; 6-trifluoromethoxy-pseudo-UTP; 6-trifluoromethyl-pseudo-UTP; alpha-thio-pseudo-UTP; pseudouridine 1-(4-methylbenzenesulfonic acid)TP; pseudouridine 1-(4-methylbenzoic acid)TP; pseudouridine TP 1-[3-(2-ethoxy)]propionic acid; pseudouridine TP 1-[3-{2-(2-[2-(2-ethoxy)-ethoxy]-ethoxy)-ethoxy}]propionic acid; pseudouridine TP 1-[3-{2-(2-[2-{2(2-ethoxy)-ethoxy}-ethoxy]-ethoxy)-ethoxy}]propionic acid; pseudouridine TP 1-[3-{2-(2-[2-ethoxy]-ethoxy)-ethoxy}]propionic acid; pseudouridine TP 1-[3-{2-(2-ethoxy)-ethoxy}]propionic acid; pseudouridine TP 1-methylphosphonic acid; pseudouridine TP 1-Diethyl methylphosphonate; Pseudo-UTP-N1-3-propionic acid; Pseudo-UTP-N1-4-butanoic acid; Pseudo-UTP-N1-5-pentanoic acid; Pseudo-UTP-N1-6-hexanoic acid; Pseudo-UTP-N1-7-heptanoic acid; Pseudo-UTP-N1-methyl-p-benzoic acid; Pseudo-UTP-N1-p-benzoic acid; yW (wibutosin); OHyW (hydroxywibutosin);imG2 (isowiosin); o2yW (peroxywibutosin); OHaW; *(Unmodified hydroxywibutosin); imG-14(4-demethylwiosin); 2,6-(diamino)purine; 1-(aza)-2-(thio)-3-(aza)-phenoxazine-1-yl: 1,3-(diaza)-2-(oxo)-phenthiadin-1-yl; 1,3,5-(triza)-2,6-(dioxa)-naphthalene; 2(amino)purine; 2,4,5-(trimethyl)phenyl; 2'methyl, 2'amino, 2'azide, 2'fluorocytidine; 2'methyl, 2 'Amino, 2'azide, 2'fluoroadenine; 2'methyl, 2'amino, 2'azide, 2'fluorouridine; 2'-amino-2'-deoxyribose; 2-amino-6-chloropurine; 2-azainosinyl; 2'-azide-2'-deoxyribose; 2'fluoro-2'-deoxyribose; 2'-fluoro-modified base; 2'-O-methylribose; 2-oxo-7-aminopyridopyrimidine-3-yl; 2-oxo-pyridopyrimidine-3-yl; 2-pyridinone; 3-nitropyrrole; 3-(methyl)-7-(propynyl) Socarbostyrillyl; 3-(methyl)isocarbostyrillyl; 4-(fluoro)-6-(methyl)benzimidazole; 4-(methyl)benzimidazole; 4-(methyl)indolyl; 4,6-(dimethyl)indolyl; 5-nitroindole; 5-substituted pyrimidine; 5-(methyl)isocarbostyrillyl; 5-nitroindole; 6-(aza)pyrimidine; 6-(azo)thymine; 6-(methyl)-7-(aza)indolyl; 6-chloropurine; 6-phenylpyrrolopyrimidine-2-on-3-yl; 7-(aminoalkylhydroxy )-1-(aza)-2-(thio)-3-(aza)-phenthiadin-1-yl;7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxadin-1-yl;7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxadin-1-yl;7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenthiadin-1-yl;7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxadin-1-yl;7-(aza)indolyl;7-(guanidinium alkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazine-1-yl; 7-(guanidinium alkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiadin-1-yl; 7-(guanidinium alkylhydroxy)-1-(aza)-2-(thio)-3-(aza; )-phenoxazine-1-yl;7-(guanidinium alkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazine-1-yl;7-(guanidinium alkyl-hydroxy)-1,3-(diaza)-2-(oxo)-phenthiadin-1-yl;7-(guanidinium alkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazine-1-yl;7-(propynyl)isocarbostyrillyl;7-(propynyl)isocarbostyrillyl;propynyl-7-(aza)indolyl;7-deaza-inosinyl;7-substituted 1-(a (Za)-2-(thio)-3-(aza)-phenoxazine-1-yl; 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazine-1-yl; 9-(methyl)-imidizopyridinyl; aminoindolyl; anthracenyl; bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidine-2-on-3-yl; bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidine-2-on-3-yl; difluorotolyl; hypoxanthine; imidizopyridinyl; inosinyl; isocarbostyrillyl; isoguanisine; N2-substituted purine; N6- Methyl-2-amino-purine; N6-substituted purine; N-alkylated derivative; Naphthalenyl; Nitrobenzimidazolyl; Nitroimidazolyl; Nitroindazolyl; Nitropyrazolyl; Nubularin; O6-substituted purine; O-alkylated derivative; Ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidine-2-on-3-yl; Ortho-substituted-6-phenyl-pyrrolo-pyrimidine-2-on-3-yl; Oxoformycin TP; Para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidine-2-on-3-yl; Para- Substitutions: 6-phenyl-pyrrolopyrimidine-2-on-3-yl; pentacenyl; phenanthrasenyl; phenyl; propynyl-7-(aza)indolyl; pyrenyl; pyridopyrimidine-3-yl; pyridopyrimidine-3-yl; 2-oxo-7-aminopyridopyrimidine-3-yl; pyrrolopyrimidine-2-on-3-yl; pyrrolopyrimidinyl; pyrrolopyrimidinyl; stilbenzyl; substitutions: 1,2,4-triazole; tetracenyl; tubercidine; xanthine; xanthosin-5'-TP; 2-thio-zebralin; 5-aza-2-thio-zebralin;7-deaza-2-amino-purine; pyridin-4-one ribonucleoside; 2-amino-riboside-TP; formycin A TP; formycin B TP; pyrosin TP; 2'-OH-ara-adenosine TP; 2'-OH-ara-cytidine TP; 2'-OH-ara-uridine TP; 2'-OH-ara-guanosine TP; 5-(2-carbomethoxyvinyl)uridine TP; N6-(19-amino-pentaoxanonadecyl)adenosine TP; hydrogen (non-basic residue); and 2'-O-methyl-U, and the like. In some embodiments, the RNA molecule comprises a combination of at least two (e.g., 2, 3, 4, or more) of the aforementioned modified nucleobases. In some embodiments, 1, 2, 3, 4, 5, or more of the above modifications can be excluded from the RNA molecules disclosed herein.;

[0168] In some embodiments, modified nucleic acid bases in RNA molecules include pseudouridine (ψ), 2-thiouridine (s2U), 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseuduridine, 2-thio-1-methyl-pseuduridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuduridine, 2-thio-dihydropseuduridine, 2-thio-pseuduridine, 4-methoxy-2-thiopseuduridine, 4-methoxypseuduridine, 4-thio-1-methylpseuduridine, 4-thiopseuduridine, 5-aza-uridine, dihydropseuduridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine, 1-methylpseuduridine (m1ψ), 1-ethylpseuduridine (e1ψ), 5-methoxyuridine (mo5U), and 5-methyl Lucytidine (m5C), α-thio-guanosine, α-thio-adenosine, 5-cyanouridine, 4'-thiouridine, 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenosine (m2A), N6-methyl-adenosine (m6A), 2,6-diaminopurine, inosine (I), 1-methyl-inosine (m1I), vyosine (imG), methylvyosine (mimG), 7-deaza-guanosine N, 7-cyano-7-deaza-guanosine (preQO), 7-aminomethyl-7-deaza-guanosine (preQl), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 2,8-dimethyladenosine, 2-geranylthiouridine, 2-lysidine, 2-selenouridine, 3-(3-amino-3-carboxypropyl)-5,6-Dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudridine, 3-methylpseudridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5-aminomethyl-2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2-thiouridine, 5-carboxymethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-geranylthiouridine, 5-carboxymethylaminomethyl-2-selenouridine, 5-cyanomethyluridine, 5-hydroxycytidine, 5-methylaminomethyl-2-geranylthiouridine This includes 7-aminocarboxypropyl-demethylwiosin, 7-aminocarboxypropylwiosin, 7-aminocarboxypropylwiosin methyl ester, 8-methyladenosine, N4,N4-dimethylcytidine, N6-formyladenosine, N6-hydroxymethyladenosine, agmatidine, cyclic N6-threonylcarbamoyladenosine, glutamyl-queusin, methylated unmodified hydroxywibutosine, N4,N4,2'-O-trimethylcytidine, geranylated 5-methylaminomethyl-2-thiouridine, geranylated 5-carboxymethylaminomethyl-2-thiouridine, Qbase, preQObase, preQlbase, and two or more combinations thereof. In some embodiments, the RNA molecule includes a combination of at least two (e.g., 2, 3, 4, or more) of the aforementioned modified nucleic acid bases, including but not limited to chemical modifications. In some embodiments, one, two, three, four, five, or more of the above modified nucleic acid bases may be excluded from the RNA molecules disclosed herein.

[0169] Exemplary nucleic acid bases and nucleosides having modified cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methylcytidine (m3C), N4-acetylcytidine (ac4C), 5-formylcytidine (f5C), N4-methylcytidine (m4C), 5-methylcytidine (m5C), 5-halocytidine (e.g., 5-iodocytidine), and 5-Hy Droxymethylcytidine (hm5C), 1-methyl-pseudoisocytidine, pyrrolocytidine, pyrrolo-pseudoisocytidine, 2-thiocytidine (s2C), 2-thio-5-methylcytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine Zin, Zebralin, 5-Aza-Zebralin, 5-Methyl-Zebralin, 5-Aza-2-Thio-Zebralin, 2-Thio-Zebralin, 2-Methoxycytidine, 2-Methoxy-5-Methylcytidine, 4-Methoxy-Pseudoisocytidine, 4-Methoxy-1-Methyl-Pseudoisocytidine, Lysidine (k2C), α-Thiocytidine, 2'-O-Methylcytidine (Cm), 5,2'-O-Di This includes methylcytidine (m5Cm), N4-acetyl-2'-O-methylcytidine (ac4Cm), N4,2'-O-dimethylcytidine (m4Cm), 5-formyl-2'-O-methylcytidine (f5Cm), N4,N4,2'-O-trimethylcytidine (m42Cm), 1-thiocytidine, 2'-F-alacytidine, 2'-F-cytidine, and 2'-OH-alacytidine. In some embodiments, 1, 2, 3, 4, 5, or more of the above modified cytosines may be excluded from the RNA molecules disclosed herein.

[0170] In some embodiments, the modified nucleic acid base is modified uridine. Exemplary nucleic acid bases and nucleosides having modified uracil include pseudouridine (ψ), pyridine-4-onyribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudridine, 2-thio-pseudridine, 5-hydroxyuridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 5-cyanouridine, 3 -methyluridine (m3U), 5-methoxyuridine (mo5U), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyluridine (cm5U), 1-carboxymethyl-pseudridine, 5-carboxyhydroxymethyluridine (chm5U), 5-carboxyhydroxymethyluridine methyl ester (mchm5U), 5-methoxycarbonylmethyluridine (mcm5U), 5-methoxycarbonylmethyl-2-thiouridine (mc m5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnmVU), 5-propynyl-uridine, 1-propynyl-pseudouridine Zin, 5-taurinomethyluridine (xm5U), 1-taurinomethylpseudridine, 5-taurinomethyl-2-thiouridine (xmVu), 1-taurinomethyl-4-thiopseudridine, 5-methyluridine (m5U, e.g., having the nucleic acid base deoxythymine), 1-methylpseudridine (m1Ψ), 1-ethylpseudridine (e1ψ), 5-methyl-2-thiouridine (m5s2U), 1-methyl-4-thiopseudridine (m1s4Ψ), 4-thio-1-methylpseudridine,3-methyl-pseuduridine (m3Ψ), 2-thio-1-methyl-pseuduridine, 1-methyl-1-deaza-pseuduridine, 2-thio-1-methyl-1-deaza-pseuduridine, dihydrouridine (D), dihydropseuduridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseuduridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseuduridine, 4-methoxy-2-thio-pseuduridine, N1-methyl-pseuduridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseuduridine (acp3 ψ), 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), α-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudridine (Ψm), 2-thio-2'-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl- This includes uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm5Um), 3,2'-O-dimethyluridine (m3Um), and 5-(isopentenylaminomethyl)-2'-O-methyluridine (inm5Um), 1-thiouridine, deoxythymidine, 2'-F-ala-uridine, 2'-F-uridine, 2'-OH-ala-uridine, 5-(2-carbomethoxyvinyl)uridine, and 5-[3-(lE-propenylamino)]uridine. In some embodiments, 1, 2, 3, 4, 5, or more of the above modified uridines may be excluded from the RNA molecules disclosed herein.

[0171] In some aspects of this disclosure, the modified nucleotide comprises either N1-methylpseudridine and / or pseudouridine.

[0172] In some embodiments, the RNA molecule contains nucleotides modified with N1-methylpseudridine. In some embodiments, the RNA molecule contains nucleotides modified with pseudouridine.

[0173] In some embodiments, the RNA comprises a modified nucleoside in place of at least one uridine. In some embodiments, the RNA comprises a modified nucleoside in place of each uridine. In some embodiments, the RNA molecule comprises a sequence in which at least one uridine is replaced by N1-methylpseudruridine. In some embodiments, the RNA molecule comprises a sequence in which all uridines are replaced by N1-methylpseudruridine. N1-methylpseudruridine is referred to as "Ψ" in the sequence. The term "uracil," as used herein, describes one of the nucleic acid bases that may be present in the nucleic acid of RNA. The term "uridine," as used herein, describes one of the nucleosides that may be present in RNA. "Pseudouridine" is an example of a modified nucleoside that is an isomer of uridine, where uracil is attached to a pentose ring via a carbon-carbon bond instead of a nitrogen-carbon glycosidic bond.

[0174] In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by N1-methylpseudridine and / or pseudouridine. In some cases, RNA molecules make up at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 5 5%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, up to 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 1 4%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71% , 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, exactly 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%,31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77% , 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72% The RNA molecule contains nucleic acid sequences in which uridines between any two of the following percentages (inclusive or exclusive): 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% are replaced by N1-methylpseudridine and / or pseudouridine. In some embodiments, the RNA molecule contains nucleic acid sequences in which all uridines are replaced by N1-methylpseudridine and / or pseudouridine.

[0175] In some embodiments, the modified nucleic acid base is a modified adenine.Exemplary nucleic acid bases and nucleosides having modified adenine include 2-aminopurine, 2,6-diaminopurine, 2-amino-6-halopurine (e.g., 2-amino-6-chloropurine), 6-halopurine (e.g., 6-chloropurine), 2-amino-6-methylpurine, 8-azidoadenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, and 7-deaza-8-aza-2,6-diaminopurine. 1-Methyl-adenosine (m1A), 2-Methyl-adenine (m2A), N6-Methyl-adenosine (m6A), 2-Methylthio-N6-methyl-adenosine (ms2m6A), N6-Isopentenyl-adenosine (i6A), 2-Methylthio-N6-Isopentenyl-adenosine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-Methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io6A), N6-Glycinylcarbamoyl-adenosine (g6A), N6-Threonylcarbamoyl-adenosine Bamoyl-adenosine (t6A), N6-methyl-N6-threonylcarbamoyl-adenosine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenosine (ms2g6A), N6,N6-dimethyl-adenosine (m62A), N6-hydroxynorvalylcarbamoyl-adenosine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine (ms2hn6A), N6-acetyl-adenosine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio- It contains adenosine, 2'-O-methyl-adenosine (Am), N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2'-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2'-F-ala-adenosine, 2'-F-adenosine, 2'-OH-ala-adenosine, and N6-(19-amino-pentaoxanonadecyl)-adenosine.In some embodiments, one, two, three, four, five, or more of the above modified adenines may be excluded from the RNA molecules disclosed herein.

[0176] In some embodiments, the modified nucleic acid base is modified guanine. Exemplary nucleic acid bases and nucleosides having modified guanine include inosine (I), 1-methyl-inosine (m1I), vyosine (imG), methylvyosine (mimG), 4-demethylvyosine (imG-14), isowiosine (imG2), wibutosine (yW), peroxywibutosine (o2yW), hydroxywibutosine (OhyW), and unmodified hydroxywibutosine (OhyW) *), 7-deaza-guanosine, quosin (Q), epoxyquosin (oQ), galactosylquosin (galQ), mannosylquosin (manQ), 7-cyano-7-deaza-guanosine (preQo), 7-aminomethyl-7-deaza-guanosine (preQ1), alkaeosin (G+), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine Anosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine (m7G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m1G), N2-methyl-guanosine (m2G), N2,N2-dimethyl-guanosine (m22G), N2,7-dimethyl-guanosine (m2'7G), N2,N2,7-dimethyl-guanosine N2(m2'2'7G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2'-O-methyl-guanosine(Gm), N2-methyl-2'-O-methyl-guanosine(m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine(m This includes 22Gm), 1-methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine (m2'7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 2'-O-ribosylguanosine (phosphate) (Gr(p)), 1-thio-guanosine, O6-methyl-guanosine, 2'-F-ala-guanosine, and 2'-F-guanosine. In some embodiments, 1, 2, 3, 4, 5, or more of the above modified guanines may be excluded from the RNA molecules disclosed herein.

[0177] In some embodiments, RNA molecules are uniformly modified with respect to a particular modification (e.g., completely modified, modified throughout the entire sequence). In some embodiments, RNA molecules may be partially or completely (e.g., uniformly) modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purines and / or pyrimidines, or one or more or all of A, G, U, and C) may be uniformly modified in the polynucleotide of the Disclosure or in a given predetermined sequence region thereof. In some embodiments, all nucleotides X in the polynucleotide of the Disclosure (or in a given sequence region thereof) are modified nucleotides, where X may be one of nucleotides A, G, U, and C, and / or one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, and / or A+G+C. For example, a polynucleotide can be uniformly modified with pseudouridine, meaning that all uridine residues in the RNA sequence are replaced with pseudouridine. Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with modified residues, such as those described above. The modified nucleotide can be replaced by a single compound having a unique structure, or by multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0178] RNA molecules contain 1% to 100% or approximately 1% to 100% (for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 , 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, with a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 3 2, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 ,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,5 7, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,99, or 100%, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or any percentage between any two of 100% (inclusive or exclusive), or any intervening percentage. (For example, 1%~20%, 1%~25%, 1%~50%, 1%~60%, 1%~70%, 1%~80%, 1%~90%, 1%~95%, 10%~20%, 10%~25%, 10%~50%, 10%~60%, 10%~70%, 10%~80%, 10%~90%, 10%~95%, 10%~100%, 20%~25%, 20%~50%, 20%~60%, 20%~70%, 20%~80%, 20%~ It may contain modified nucleotides in the following percentages: 90%, 20%-95%, 20%-100%, 50%-60%, 50%-70%, 50%-80%, 50%-90%, 50%-95%, 50%-100%, 70%-80%, 70%-90%, 70%-95%, 70%-100%, 80%-90%, 80%-95%, 80%-100%, 90%-95%, 90%-100%, and 95%-100%. Any remaining percentage is understood to be due to the presence of unmodified A, G, U, and / or C.

[0179] In some embodiments, the RNA molecule may include phosphoramidate, phosphorothioate, and / or methylphosphonate linkages.

[0180] In some embodiments, RNA molecules may include one or more structural and / or chemical modifications and / or alterations that confer useful properties to polynucleotides, including reduced degradation in cells or organisms and / or the absence of substantial induction of the innate immune response of cells into which the RNA molecule is introduced. As used herein, “structural” features or modifications are those in which two or more linked nucleotides are inserted, deleted, duplicated, inverted, and / or randomized in an RNA molecule without significant chemical modification to the nucleotides themselves. Structural modifications are of a chemical nature and therefore chemical modifications, since chemical bonds are inevitably broken and reformed, affecting structural modifications. However, structural modifications result in different sequences of nucleotides. For example, the polynucleotide “ATCG” may be chemically modified to “AT-5meC-G”. The same polynucleotide may be structurally modified from “ATCG” to “ATCCCG”, where the dinucleotide “CC” is inserted, resulting in a structural modification to the polynucleotide.

[0181] In some embodiments, modified RNA molecules introduced into cells or organisms exhibit reduced degradation in the cell or organism compared to unmodified nucleic acids containing standard nucleotides and nucleosides, respectively. In some embodiments, modified RNA molecules introduced into cells or organisms may exhibit reduced immunogenicity (e.g., reduced spontaneous response) in the cell or organism compared to unmodified nucleic acids containing standard nucleotides and nucleosides, respectively.

[0182] In some embodiments, the RNA molecule may contain one or more modified nucleotides in addition to any 5' cap structure. In some embodiments, the RNA molecule may not contain modified nucleotides, for example, modified nucleic acid bases, and all nucleotides in the RNA molecule are conventional standard ribonucleotides A, U, G, and C, with the exception of an optional 5' cap which may contain, for example, 7-methylguanosine, as further described below. In some embodiments, the RNA may contain a 5' cap containing 7'-methylguanosine, and the first one, two, or three 5' ribonucleotides may be methylated at the 2' position of ribose.

[0183] B.5'CAP In some embodiments, the RNA molecules described herein generally include a 5' cap that "caps" the 5' end of the RNA and stabilizes the RNA molecule.

[0184] In some embodiments, the 5' cap portion is a natural 5' cap. A “natural 5' cap” is defined as a cap containing 7-methylguanosine attached to the 5' end of the mRNA molecule via a 5'-5' triphosphate ligation. In some embodiments, the guanosine nucleoside contained in the 5' cap may be modified, for example, by methylation at one or more positions on the base (guanine) (e.g., position 7) and / or by methylation at one or more positions on the ribose. In some embodiments, the guanosine nucleoside contained in the 5' cap contains a 3'O methylation at the ribose (3'OMeG). In some embodiments, the guanosine nucleoside contained in the 5' cap contains methylation at position 7 of the guanine (m7G). In some embodiments, the guanosine nucleoside contained in the 5' cap contains methylation at position 7 of the guanine and a 3'O methylation at the ribose (m7(3'OMeG)). The 5' cap may be incorporated during RNA synthesis (e.g., co-transcriptional capping) or enzymatically manipulated after RNA transcription (e.g., post-transcriptional capping). In some embodiments, co-transcriptional capping with the caps disclosed herein improves the capping efficiency of RNA compared to co-transcriptional capping with a suitable reference comparator. In some embodiments, improving capping efficiency may increase the translation efficiency and / or translation rate of RNA and / or increase the expression of the encoded polypeptide. In some embodiments, capping is performed after the purification of the RNA molecule, for example, after tangential flow filtration.

[0185] In some embodiments, the RNA described herein includes a 5' cap or 5' cap analog, such as cap 0, cap 1, or cap 2. In some embodiments, the provided RNA does not have an uncapped 5'-triphosphate. In some embodiments, the 5' end of the RNA is capped with a modified ribonucleotide. In some embodiments, the 5' cap moiety is a 5' cap analog. In some embodiments, the RNA may be capped with a 5' cap analog. The cap structure is 7 mG(5’)ppp(5’)N1pN2p (cap 0), 7 mG(5’)ppp(5’)N1 m pNp (cap 1), and 7 mG(5’)ppp(5’)N1 m pN2 m p (cap 2), including but not limited to. In some embodiments, 1, 2, 3, 4, 5, or more of the above cap structures may be excluded from the RNA molecules disclosed herein.

[0186] In some embodiments, the RNA described herein includes cap 0. In some embodiments, cap 0 is N7-methylguanosine, and the cap 0 structure includes guanosine nucleoside (m7G) methylated at the 7-position of guanine. In some embodiments, the cap 0 structure is connected to the RNA via a 5'-5'-triphosphate linkage and is also referred to herein as m7G, m7Gppp, and / or m7G(5’)ppp(5’). The 5' cap is the structure 7The capped mRNA may be methylated with mG(5')ppp(5')N1pN2p(cap 0) or a derivative thereof, where N is the 5' cap, typically the terminal 5' nucleotide of the nucleic acid having the 5' end of mRNA. Exemplary enzymatic reactions for capping may involve the use of vaccinia virus capping enzymes (VCE), including mRNA triphosphatase, guanylyltransferase, and guanine-7-methyltransferase, which catalyze the construction of the N7-monomethylated capped mRNA structure. The capped mRNA structure plays a crucial role in maintaining the stability and translational efficiency of the RNA molecule. In cells, the capped mRNA structure is essential for the efficient translation of capped mRNA.

[0187] In some embodiments, the RNA described herein includes cap 1, for example, as described herein. The 5' cap of the RNA molecule may be further modified at the 2'O position by a 2'-O-methyltransferase, which results in the formation of a cap 1 structure (m7Gppp[m2'-O]N) that can further increase translation efficiency. In some embodiments, the cap 1 structure includes a guanosine nucleoside (m7G) methylated at the 7th position of guanine, and the first nucleotide in the RNA that is 2'O-methylated (2'OMeN1). In some embodiments, the cap 1 structure is attached to the RNA via a 5'-5'-triphosphate linkage, as described herein, m7GpppN m (Here, N m (represents any nucleotide having 2'O methylation), 7 mG(5')ppp(5')N1 mAlso referred to as pNp, m7Gppp(2'OMeN1), and / or m7G(5')ppp(5')(2'OMeN1). In some embodiments, N1 is selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, the m7G(5')ppp(5')(2'OMeN1) cap 1 structure includes a second nucleotide N2, which is the nucleotide proximal to the cap at position 2 and is selected from A, G, C, or U (m7G(5')ppp(5')(2'OMeN1)N2). In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0188] In some embodiments, the cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G), and one or more additional modifications, such as methylation at the ribose, and a 2'O-methylated first nucleotide in the RNA. In some embodiments, the cap 1 structure includes a guanosine nucleoside methylated at the 7-position of guanine, 3'O-methylation at the ribose (m7(3’OMeG)), and a 2'O-methylated first nucleotide (2’OMeN1) in the RNA. In some embodiments, the cap 1 structure is connected to the RNA via a 5’-5’-triphosphate linkage, also referred to herein as m7(3’OMeG)ppp(2’OMeN1) and / or m7(3’OMeG)(5’)ppp(5’)(2’OMeN1). In some embodiments, N1 is selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, the m7(3’OMeG)(5’)ppp(5’)(2’OMeN1) cap 1 structure includes a second nucleotide N2, which is the cap-proximal nucleotide at the 2-position and is selected from A, G, C, or U (m7(3’OMeG)(5’)ppp(5’)(2’OmeN1)N2). In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U. In some embodiments, one, two, three, four, five, or more of the above cap 1 structures can be excluded from the RNA molecules disclosed herein.

[0189] In some embodiments, the second nucleotide in the cap 1 structure may include one or more modifications, such as methylation. In some embodiments, the RNA described herein includes a cap 2. In some embodiments, a cap 1 structure that includes a second nucleotide that includes 2’O-methylation is a cap 2 structure.

[0190] In some embodiments, RNA molecules may be enzymatically capped at the 5' end using vaxinia-guanylyl transferase, guanosine triphosphate, and S-adenosyl-L-methionine to yield a cap 0 structure. An inverted 7-methylguanosine cap is added via a 5'-5' triphosphate crosslink. Alternatively, the use of 2'O-methyltransferase and vaxinia-guanylyl transferase yields a cap 1 structure, where, in addition to the cap 0 structure, the 2'OH group is methylated at the second to last nucleotide. S-adenosyl-L-methionine (SAM) is a cofactor used as a methyl transfer agent. Non-limiting examples of 5' cap structures, among others, have enhanced binding of the cap-binding polypeptide, an increased half-life, reduced sensitivity to 5'-endonucleases, and / or reduced 5' decapping compared to synthetic 5' cap structures (or wild-type, natural, or physiological 5' cap structures) known in the art.

[0191] For example, recombinant vaccinia virus capping enzymes and recombinant 2'O-methyltransferase enzymes can create a canonical 5'-5'-triphosphate linkage between the 5' terminal nucleotides of mRNA and guanine cap nucleotides, where the cap guanine contains N7 methylation and the 5' terminal nucleotide of mRNA contains 2'-O-methylation. Such a structure is referred to as a cap 1 structure. This cap results in higher translational qualification and cellular stability, as well as reduced activation of pro-inflammatory cytokines, compared, for example, other 5' cap analog structures known in the art.

[0192] The cap species may comprise one or more modified nucleosides and / or linker moieties. For example, the cap may comprise a guanine nucleotide and a 7-methylated guanine (G) nucleotide joined by a triphosphate linkage at its 5' position, such as m7G(5')ppp(5')G, commonly written as m7GpppG. The cap species may also be an anti-reverse cap analog. A non-limiting list of possible cap species includes m7GpppG, m7Gpppm7G, m73'dGpppG, m27,O3'GpppG, m27,O3'GppppG, m27,O2'GppppG, m7Gpppm7G, m73'dGpppG, m27,O3'GpppG, m27,O3'GppppG, and m27,O2'GppppG. In some embodiments, one, two, three, four, five, or more of the above cap types may be excluded from the RNA molecules disclosed herein.

[0193] In some embodiments, the 5'-terminated cap may contain a cap analog, for example, a guanine analog. Exemplary guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine. In some embodiments, one, two, three, four, five, or more of the above guanine analogs may be excluded from the cap structures disclosed herein.

[0194] In some embodiments, the capping region may include a single cap or a series of nucleotide-forming caps. In this embodiment, the capping region may have a length of 1 to 10 nucleotides, for example, 2 to 9, 3 to 8, 4 to 7, 1 to 5, 5 to 10, or at least 2 or 10, or fewer. In this embodiment, the capping region has a length of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, and at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or between (inclusive or exclusive) any two of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, no caps are present. In some embodiments, the first and second operable regions may be in the range of 3 to 40 nucleotide lengths, for example, 5 to 30, 10 to 20, 15, or at least 4, 30, or fewer nucleotide lengths, and may include one or more signal sequences and / or restriction sequences in addition to a start codon and / or stop codon.In some embodiments, the first and second operable regions are at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, Large: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, exactly 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 The length of a nucleotide is the length between (inclusive or exclusive) any two of the following: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, or the length between (inclusive or exclusive) any two of the following: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, and may include one or more signal sequences and / or restriction sequences in addition to the start codon and / or stop codon.

[0195] Further examples of 5' cap structures include glyceryl, inverted deoxy-nonbasic residues (partial), 4',5' methylene nucleotide, 1-(beta-D-erythrofuranosyl) nucleotide, 4'-thionucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotide, alpha-nucleotide, modified base nucleotide, threopentofuranosyl nucleotide, acyclic 3',4'-seconucleotide, and acyclic 3,4-dihydroxybutyl nucleotide. This includes, but is not limited to, acyclic 3,5-dihydroxypentyl nucleotides, 3'-3'-inverted nucleotide moieties, 3'-3'-inverted nonbasic moieties, 3'-2'-inverted nucleotide moieties, 3'-2'-inverted nonbasic moieties, 1,4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, and / or crosslinked or uncrosslinked methylphosphonate moieties. In some embodiments, 1, 2, 3, 4, 5, or more of the above 5' cap structures may be excluded from the RNA molecules disclosed herein.

[0196] In some embodiments, the RNA molecule of the Disclosure includes at least one 5' cap structure. In some embodiments, the RNA molecule of the Disclosure does not include a 5' cap structure.

[0197] Numerous synthetic 5' cap analogs have been developed and are known in the art to enhance mRNA stability and translatability (see, for example, Grudzien-Nogalska, E., Kowalska, J., Su, W., Kuhn, AN, Slepenkov, SV, Darynkiewicz, E., Sahin, U., Jemielity, J., and Rhoads, RE, Synthetic mRNAs with superior translation and stability properties in Synthetic Messenger RNA and Cell Metabolism Modulation in Methods in Molecular Biology 69 (Rabinovich, PH. ed.), 2013). In one embodiment, the 5' capping structure is a modified 5' cap 1 structure (m 7 G + It includes m3'-5'-ppp-5'-Am). In one embodiment, the 5' capping structure is (3'OMe)-m2 7, 3' -O Gppp(m1 2’-O This includes ApG (TRiLink BioTechnologies). This molecule is identical to the natural RNA cap structure in that it starts with guanosine methylated at N7 and is linked to the first encoding nucleotide (adenosine in this case) of the transcribed RNA by a 5'-5' triphosphate linkage. This guanosine is also methylated at the 3' hydroxyl of ribose to mitigate possible reverse integration of the cap molecule. The 2' hydroxyl of ribose at adenosine is methylated to confer the cap 1 structure.

[0198] C. Untranslated region (UTR) The 5'UTR is a regulatory region located at the 5' end of a protein open reading frame that is transcribed into mRNA but not translated into an amino acid sequence, and / or a corresponding region in an RNA polynucleotide, such as an mRNA molecule. Untranslated regions (UTRs) may be present at the 5' (upstream) (5'UTR) and / or the 3' (downstream) (3'UTR) of the open reading frame.

[0199] In some embodiments, UTRs are derived from naturally abundant mRNA in specific tissues (e.g., lymphoid tissues) where mRNA expression is targeted. In some embodiments, UTRs increase protein synthesis. Although not bound by mechanism or theory, UTRs may increase protein synthesis by increasing the time mRNA remains in the translation polysome (message stability) and / or the rate at which ribosomes initiate translation on the message (message translation efficiency). Thus, UTR sequences may prolong protein synthesis in a tissue-specific manner.

[0200] In some embodiments, regulatory features of UTRs may be incorporated into the RNA of this disclosure to enhance molecular stability among others. Specific features may also be incorporated to ensure controlled downregulation of transcripts in cases where they are mistakenly directed to undesirable organ sites. Various 5'UTR and 3'UTR sequences are known and available in the art.

[0201] It should be understood that any UTR derived from any gene may be incorporated into the RNA region of this disclosure. Furthermore, multiple wild-type UTRs of any known gene may be utilized. Providing artificial UTRs that are not variants of wild-type regions is also within the scope of this disclosure. These UTRs or portions thereof may be placed in the same orientation as those in the transcript, which may be selected or have their orientation and / or location altered. Thus, the 5' and / or 3' UTRs may be inverted, shortened, lengthened, and / or made up of one or more other 5' UTRs or 3' UTRs. As used herein, the term “modified” means that the UTR is altered in any way relative to the reference sequence, when it relates to a UTR sequence. For example, the 5' UTR and / or 3' UTR may be modified compared to the wild-type or native UTR by changes in orientation and / or location as taught above, as well as by the inclusion of additional nucleotides, deletion of nucleotides, swapping, and / or transposition of nucleotides. Any of these changes will produce a "modified" UTR (whether 5' and / or 3') that includes a variant UTR.

[0202] In some embodiments, double, triple, or quadruple UTRs, e.g., 5' and / or 3' UTRs, may be used. As used herein, a “double” UTR is one in which two copies of the same UTR are coded in series or substantially in series. For example, a double beta-globin 3' UTR may be used. Having patterned UTRs is also within the scope of this disclosure. As used herein, a “patterned UTR” is a UTR that reflects a repeating or alternating pattern, e.g., AB AB AB or AABBAABBAABB or ABCABCABC, or a variant thereof that is repeated one, two, or three times or more. In these patterns, each letter A, B, or C represents a different UTR at the nucleotide level.

[0203] The RNA may encode a polypeptide of interest belonging to a family of proteins expressed in specific cells, tissues, and / or at some point during development. In some embodiments, the UTR from any of these genes may be swapped for any other UTR of the same or different protein families to create a new RNA molecule. As used herein, “protein family” is used in its broadest sense to refer to a group of polypeptides of interest that share at least one function, structure, feature, localization, origin, and / or expression pattern.

[0204] In some embodiments, the 5'UTR and 3'UTR sequences are derived by computer. In some embodiments, the 5'UTR and 3'UTR are derived from mRNA that is naturally abundant in the tissue. The tissue may be, for example, the liver, stem cells, and / or lymphoid tissue. The lymphoid tissue may include, for example, lymphocytes (e.g., B lymphocytes, helper T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, and / or natural killer cells), macrophages, monocytes, dendritic cells, neutrophils, eosinophils, and reticulocytes. In some embodiments, the 5'UTR and 3'UTR are derived from alphavirus. In some embodiments, the 5'UTR and 3'UTR are from wild-type alphavirus.

[0205] In some embodiments, the untranslated region may also include translation enhancer elements (TEEs). Non-limiting examples include those described in U.S. Patent Application No. 20090226470, which is incorporated herein in its entirety by reference, and those known in the art.

[0206] i.5'UTR In some embodiments, the RNA disclosed herein includes a 5'UTR. The 5'UTR, if present, is located at the 5' end and begins with the transcription start site upstream of the start codon of the protein coding region. The 5'UTR is downstream of the 5' cap (if present) and, for example, directly adjacent to the 5' cap. The 5'UTR may contain various regulatory elements, such as the 5' cap structure, stem-loop structure, and an internal ribosome entry site (IRES) that may play a role in regulating translation initiation. The 5'UTR may harbor a signature, such as a Kozak sequence, which is also involved in the process by which ribosomes initiate translation of many genes. The 5'UTR may also form secondary structures involved in elongation factor binding.

[0207] In some embodiments, the 5'UTR disclosed herein includes, for example, a cap proximal sequence, as disclosed herein. In some embodiments, the cap proximal sequence includes a sequence adjacent to the 5' cap. In some embodiments, the cap proximal sequence includes nucleotides at the +1, +2, +3, +4, and / or +5 positions of the RNA polynucleotide.

[0208] In some embodiments, the cap structure comprises one or more polynucleotides of the cap proximal sequence. In some embodiments, the cap structure comprises the m7 guanosine cap and nucleotide +1 (N1) of the RNA polynucleotide. In some embodiments, the cap structure comprises the m7 guanosine cap and nucleotide +2 (N2) of the RNA polynucleotide. In some embodiments, the cap structure comprises the m7 guanosine cap of the RNA polynucleotide, as well as nucleotides +1 and +2 (N1 and N2).

[0209] Those skilled in the art who read this disclosure will understand that in some embodiments, one or more residues of the cap proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in the RNA for the reason that they are included in the cap entity (e.g., the cap 1 structure), and alternatively, in some embodiments, at least a portion of the residues in the cap proximal sequence may be enzymatically added (e.g., by a polymerase, e.g., T7 polymerase). For example, (m2 7,3’-O )Gppp(m 2’-O In a particular exemplary embodiment in which the ApG cap is used, the +1 and +2 residues are (m2 7,3’-O These are A and G residues, and the +3, +4, and +5 residues are added by polymerase (e.g., T7 polymerase).

[0210] In some embodiments, the cap proximal sequence comprises N1 and / or N2 of the cap structure, where N1 and N2 are any nucleotides, e.g., A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U. In some embodiments, the cap proximal sequence comprises N1 and N2 of the cap structure, as well as N3, N4, and N5, where N1-N5 correspond to RNA polynucleotides at positions +1, +2, +3, +4, and / or +5. In some embodiments, N1, N2, N3, N4, or N5 are any nucleotides, e.g., A, C, G, or U. In some embodiments, N1N2 includes one of the following: AA, AC, AG, AU, CA, CC, CG, CU, GA, GC, GG, GU, UA, UC, UG, or UU. In some embodiments, N1N2 includes AG, and N3N4N5 includes any one of the following: AAA, ACA, AGA, AUA, AAG, AGG, ACG, AUG, AAC, ACC, AGC, AUC, AAU, ACU, AGU, AUU, CAA, CCA, CGA, CUA, CAG, CGG, CCG, CUG, CAC, CCC, CGC, CUC, CAU, CCU, CGU, CUU, GAA, GCA, GGA, GUA, GAG, GGG, GCG, GUG, GAC, GCC, GGC, GUC, GAU, GCU, GGU, GUU, UAA, UCA, UGA, UUA, UAG, UGG, UCG, UUG, UAC, UCC, UGC, UUC, UAU, UCU, UGU, or UUU.

[0211] In some embodiments, the cap proximal sequence includes N1 and N2 of the cap structure, and a sequence comprising A3A4X5 (sequence number 46; where X5 is A, G, C, or U), where N1 and N2 are independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0212] In some embodiments, the cap proximal sequence includes N1 and N2 of the cap structure, and a sequence containing C3A4X5 (sequence number 47; where X5 is A, G, C, or U), where N1 and N2 are independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0213] In some embodiments, the cap proximal sequence includes N1 and N2 of the cap structure, as well as a sequence containing X3Y4X5 (sequence number 48; where X3 or X5 is independently selected from A, G, C, or U; Y4 is not C). In some embodiments, N1 and N2 are independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 are independently selected from A, C, G, or U. In some embodiments, X3 and / or X5 are A. In some embodiments, X3 and / or X5 are C. In some embodiments, X3 and / or X5 are G. In some embodiments, X3 and / or X5 are U. In some embodiments, Y4 is C. In other embodiments, Y4 is not C. In some embodiments, Y4 is A. In some embodiments, Y4 is G. In other embodiments, Y4 is not G. In some embodiments, Y4 is U.

[0214] In some embodiments, the cap proximal sequence includes N1 and N2 of the cap structure, as well as a sequence containing A3C4A5 (sequence number 49). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0215] In some embodiments, the cap proximal sequence includes N1 and N2 of the cap structure, as well as a sequence containing A3U4G5 (SEQ ID NO: 50). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0216] In some embodiments, 1, 2, 3, 4, 5, or more of the above cap proximal sequences may be excluded from the 5'UTR of the RNA molecule disclosed herein.

[0217] In some embodiments of this disclosure, the 5'UTR is a heterologous UTR, for example, a naturally occurring UTR associated with a different ORF. In other embodiments, the 5'UTR is a synthetic UTR, for example, one that does not exist in nature. Synthetic UTRs include mutated or synthetic UTRs to improve their properties, for example, to increase gene expression. In some embodiments, the 5'UTR is functionally linked to an ORF, for example, associated with an ORF, so that it may exhibit a function, for example, to increase, enhance, stabilize, and / or extend protein production from an RNA molecule, and / or increase protein expression and / or total protein production from an RNA molecule, compared to a reference RNA molecule containing a reference 5'UTR or RNA molecule lacking a 5'UTR. In some embodiments, one, two, three, four, five, or more of the above 5'UTR functions may be excluded.

[0218] Exemplary 5'UTRs include 5'UTRs derived from Xenopus or human alpha-globin or beta-globin, human cytochrome b-245a, hydroxysteroid (17b) dehydrogenase, tobacco etch virus, CMV early 1 (IE1) gene, TEV, HSP705', c-Jun, or homologs, fragments, or variants of any of the above. In some embodiments, the 5'UTR is a 5'UTR (oligopyrimidine tract) of the TOP gene lacking the 5'TOP motif, a 5'UTR derived from the ribosomal protein large 32 (L32) gene, a 5'UTR derived from the hydroxysteroid (17p) dehydrogenase 4 gene (HSD17B4), or a fragment, homolog, or variant of the 5'UTR derived from the ATP5A1 5'UTR. In some embodiments, the 5'UTR is derived from a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the sequences above, such as Sequence IDs 1-1363, Sequence ID 1395, Sequence ID 1421, and Sequence ID 1422, or any of the sequences above, whose disclosure is incorporated herein in its entirety by reference; up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity; exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity; or identity (inclusive or exclusive) between any two of the 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. The sequence GGGAUCCUACC may also be used. In some embodiments, 1, 2, 3, 4, 5, or more of the above 5'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0219] In some aspects, 5'UTR is RPSA, RPS2, RPS3, RPS3A, RPS4, RPS5, RPS6, RPS7, RPS8, RPS9, RPS10, RPS11, RPS12, RPS13, RPS14, RPS15, RPS15A, RPS16, RPS17, RPS18, RPS19, RPS20, RPS21, RPS23, RPS24, RPS25, RPS26, RPS27, RPS27A, RPS28, RPS29, RPS30, RPL3, RPL4, RPL5, RPL6, RPL7, RPL7 A, RPL8, RPL9, RPL10, RPL10A, RPL11, RPL12, RPL13, RPL13A, RPL14, RPL15, RPL17, RPL18, RPL18A, RPL19, RPL21, RPL22, RPL23, RPL23A, RPL2 4, RPL26, RPL27, RPL27A, RPL28, RPL29, RPL30, RPL31, RPL32, RPL34, RPL35, RPL35A, RPL36, RPL36A, RPL37, RPL37A, RPL38, RPL39, RPL40, RP The 5'UTR region of the genes encoding L41, RPLPO, RPLP1, RPLP2, RPLP3, RPLPO, RPLP1, RPLP2, EEF1A1, EEF1B2, EEF1D, EEF1G, EEF2, EIF3E, EIF3F, EIF3H, EIF2S3, EIF3C, EIF3K, EIF3EIP, EIF4A2, PABPC1, HNRNPA1, TPT1, TUBB1, UBA52, NPM1, ATP5G2, GNB2L1, NME2, UQCRB, or their homologs, fragments, or variants. Alternatively, the sequence includes a sequence derived from a gene sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the above gene sequences, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity (inclusive or exclusive) between any two of the above 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In some embodiments, one, two, three, four, five, or more of the above 5'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0220] In one embodiment, the DNA encoding the 5'UTR disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with SEQ ID NO: 17, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity between any two of the following (inclusive or exclusive): 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity. In one embodiment, the DNA encoding the 5'UTR comprises the sequence of SEQ ID NO: 17. In one embodiment, the RNA disclosed herein includes a 5'UTR having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the 5'UTR provided in either SEQ ID NO: 18 or 19, with the transcribed 5' cap structure underlined; up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity; exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity; or identity between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In one embodiment, the 5'UTR includes the sequence of either SEQ ID NO: 18 or 19, with the transcribed 5' cap structure underlined. Sequence ID 17 (DNA) AG AATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCC Sequence ID 18 (RNA) AG AAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCC Sequence ID 19 (RNA) AG AAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCC

[0221] In one embodiment, the DNA encoding the 5'UTR disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with SEQ ID NO: 51, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity between any two of the following (inclusive or exclusive): 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity. In one embodiment, the DNA encoding the 5'UTR comprises the sequence of SEQ ID NO: 51. In one embodiment, the RNA disclosed herein includes a 5'UTR containing a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the 5'UTR provided in either SEQ ID NO: 52 or 53, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In one embodiment, the 5'UTR contains the sequence of either SEQ ID NO: 52 or 53, with the transcribed 5' cap structure underlined. Sequence ID 51 (DNA) G ATAGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA Sequence ID 52 (RNA) G AUAGGCGGCGCAUGAGAGAAGCCCAGACCAAUUACCUACCCAAA Sequence ID 53 (RNA) G AΨAGGCGGCGCAΨGAGAGAAGCCCAGACCAAΨΨACCΨACCCAAA

[0222] In some embodiments, one, two, three, or more of the above 5'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0223] ii. 3'UTR In some embodiments, the RNA disclosed herein includes a 3'UTR. If present, the 3'UTR is located downstream of the proteincoding sequence open reading frame, for example, downstream of the stop codon in the proteincoding region. Typically, the 3'UTR is a portion of mRNA located between the proteincoding sequence and the poly-A tail. Therefore, in some embodiments, the 3'UTR is upstream of the poly-A sequence (if present), for example, directly adjacent to the poly-A sequence. The 3'UTR may be involved in regulatory processes including transcript cleavage, stability, and polyadenylation, translation, and mRNA localization.

[0224] Natural or wild-type 3'UTRs contain adenosine and uridine stretches. These AU-rich signatures are particularly widespread in genes with high turnover rates. Based on their sequence features and functional properties, AU-rich elements (AREs) can be divided into three classes. Class I AREs contain several dispersed copies of the AUUUA motif within the AU-rich region. Class II AREs have two or more overlapping UUAUUUA(U / A)(U / A) notamers. Class III AREs do not contain the AUUUA motif. Most proteins that bind to AREs are known to destabilize the molecule. Therefore, the introduction, removal, and / or modification of 3'UTR AREs can be used to modulate the stability of nucleic acids (e.g., RNA) of this disclosure. When manipulating specific nucleic acids, in some embodiments, one or more copies of AREs can be introduced to create unstable RNA, thereby suppressing the translation and reducing the production of the resulting protein. Similarly, in some embodiments, AREs can be identified, removed, and / or mutated to increase intracellular stability, and thus increase the resulting protein translation and production. Transfection experiments can be performed in relevant cell lines using the nucleic acids of this disclosure, and protein production can be assayed at various time points after transfection. For example, cells can be transfected using different ARE manipulation molecules with ELISA kits for the relevant proteins, and by assaying the proteins produced 6, 12, 24, 48, and 7 days after transfection. In some embodiments, the 3'UTR may have one or more AU-rich sequences that are removed. Alternatively, the AU-rich sequences may remain in the 3'UTR.

[0225] The 3'UTR may also include elements that are not encoded in the template from which the RNA is transcribed but are added during post-transcriptional maturation, such as a poly-A tail. The 3'UTR of mRNA is not translated into an amino acid sequence. In some embodiments, the RNA disclosed herein includes a 3'UTR containing an F element and / or an I element. In some embodiments, the 3'UTR or a proximal sequence thereto includes a restriction site. In some embodiments, the restriction site is a BamHI site. In some embodiments, the restriction site is an Xhol site.

[0226] In some embodiments of this disclosure, the 3'UTR is a heterologous UTR, for example, a naturally occurring UTR associated with a different ORF. In other embodiments, the 3'UTR is a synthetic UTR, for example, one that does not exist in nature. In some embodiments, the 3'UTR is functionally linked to an ORF, for example, associated with an ORF, so that it may exhibit a function, for example, increasing, enhancing, stabilizing, and / or extending protein production from an RNA molecule, and / or increasing protein expression and / or total protein production from an RNA molecule, compared to a reference RNA molecule containing a reference 3'UTR or RNA molecule lacking the 3'UTR. In some embodiments, one, two, three, four, five, or more of the above 3'UTR functions may be excluded.

[0227] An exemplary 3'UTR is described in Sequence IDs 1369-1390 of International Publication Brochure No. 2013 / 143700 of the patent application whose disclosure is incorporated herein in its entirety by reference, and includes the albumin gene, α-globin gene, β-globin gene, ribosomal protein gene, tyrosine hydroxylase gene, lipoxygenase gene, and collagen alpha gene, e.g., collagen alpha 1(1) gene, or albumin gene, α-globin gene, β-globin gene, ribosomal protein gene, tyrosine hydroxylase gene, lipoxygenase gene, and / or collagen alpha gene The 3'UTR is derived from a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the above sequences, such as a homolog, fragment, or variant of the 3'UTR of a gene containing the collagen alpha 1(1) gene, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or (inclusive or exclusive) identity between any two of the following: 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity. In some embodiments, the sequence UUUGAAUU is used. In some embodiments, 1, 2, 3, 4, 5, or more of the above 3'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0228] In some embodiments, the 3’UTR is NM_000661.4, NM_001024921.2, NM_000967.3, NM_001033853.1, NMJD00968.3, NM_000969.3, NM_001024662.1, NM_000970.3, NM_000971.3, NMJD00972.2, NM_000975.3, NM_001199802.1, NM_000976.3, NM__000977.3, NM_033251.2, NMJ01243130.1, NM_001243131, NM_000978.3, NM_000979.3, NM_001270490.1, NMJD00980.3, NM_000981.3, NM_000982.3, NM_000983.3, NM_000984.5, NM_000985.4, NM_001035006.2, NM_001199340.1, NM_001199341.1, NMJD01199342.1, NM_001199343.1, NM_001199344.1, NM_001199345.1, NM_000986.3, NM_000987.3, NM_000988.3, NM_000989.3, NM_000990.4, NM_001136134.1, NMJD00991.4, NM_001136135.1, NM_001136136.1, NM_001136137.1, NM_000992.2, NM_000993.4, NM_001098577.2, NM_001099693.1, NM_000994.3, NM_001007073.1, NM_001007074.1, NM_000996.2, M_000997.4, NM_000998.4, NM_000999.3, NM_001035258.1, NM_001000.3, NM_001002.3, NM_053275.3, NM_001003.2, NM_213725.1, NM_001004.3, NM_001005.4, NM_001256802.1, NM_001260506.1, NM_001260507.1, NM_001006.4, NM_001267699.1, NM_001007.4, NM_001008.3, N_001009.3, NM_001010.2, NM_001011.3, NM_001012.1, NM_001013.3, NM_001203245.2、NM_001014.4、NM_001204091.1、NM_001015.4、NM_001016.3、NM_001017.2、NM_001018.3、NM_001030009.1、NM_001019.4、NM_001020.4、NM_001022.3、NM_001146227.1、NM_001023.3、NM_001024.3、NM_001025.4、NM_001028.2、NM_001029.3、NM_001030.4、NM_002954、NM_001135592.2、NM_001177 413.1, NM_001031.4, NM_001032.4, NM_001030001.2, NM_002948.3, NM_001253379.1, NM_001253380.1, NM_001253382.1, NM_001253383.1, NM_001253384.1, NM_002952.3, NM_001034996.2, NM_001025071.1, NM_001025070.1, NM_005617.3, NM_006013.3, NM_001256577.1, NM_001256580.1, NM_007 104.4, NM_007209.3, NM_012423.3, NM_001270491.1, NM_033643.2, NM_015414.3, NM_021029.5, NM_001199972.1, NM_021104.1, NM_022551.2, NM_033022.3, NM_001142284.1, NM_001026.4, NM_001142285.1, NM_001142283.1, NM_001142282.1, NM_000973.3, NM_033301.1, NM_000995.3, NM_033625 .2、NM_001021.3、NM_002295.4、NM_001012321.1、NM_001033930.1、NM_003333.3、NM_001997.4、NM_001099645.1、NM_001021.3、NM_052969.1、NM_08 0746.2、NM_001001.4、NM_005061.2、NM_015920.3、NM_016093.2、NM_198486.2、NG_011172.1、NG_011253.1、NG_000952.4、NR_002309.1、NG_010827.2. A sequence of a transcript containing NG_009952.2 or NG_009517.1, or a sequence of a transcript having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the above transcripts, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or (inclusive or exclusive) identity between any two of the above 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In some embodiments, 1, 2, 3, 4, 5, or more of the above 3'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0229] In some aspects, the 3'UTR is the boundary of ribosomal proteins, such as ribosomal protein L9 (RPL9), ribosomal protein L3 (RPL3), ribosomal protein L4 (RPL4), ribosomal protein L5 (RPL5), ribosomal protein L6 (RPL6), ribosomal protein L7 (RPL7), ribosomal protein L7a (RPL7A), ribosomal protein L11 (RPL11), ribosomal protein L12 (RPL12), ribosomal protein L13 (RPL13), and ribosomal protein L23 (RPL23). Ribosomal protein L18 (RPL18), ribosomal protein L18a (RPL18A), ribosomal protein L19 (RPL19), ribosomal protein L21 (RPL21), ribosomal protein L22 (RPL22), ribosomal protein L23a (RPL23A), ribosomal protein L17 (RPL17), ribosomal protein L24 (RPL24), ribosomal protein L26 (RPL26), ribosomal protein L27 (RPL27), ribosomal protein L30 (RPL30), ribosomal protein L27a (RPL27A), ribosomal protein L28 (RPL28), ribosomal protein L29 (RPL29), ribosomal protein L31 (RPL31), ribosomal protein L32 (RPL32), ribosomal protein L35a (RPL35A), ribosomal protein L37 (RPL37), ribosomal protein L37a (RPL37A), ribosomal protein L38 (RPL38), ribosomal protein L39 (RPL39), ribosomal protein large P0 (RPLP0), ribosomal protein large P1 (RPLP1), ribo Ribosomal protein large P2 (RPLP2), ribosomal protein S3 (RPS3), ribosomal protein S3A (RPS3A), ribosomal protein S4,X-linked (RPS4X), ribosomal protein S4,Y-linked 1 (RPS4Y1), ribosomal protein S5 (RPS5), ribosomal protein S6 (RPS6), ribosomal protein S7 (RPS7), ribosomal protein S8 (RPS8), ribosomal protein S9 (RPS9), ribosomal protein S10 (RPS10), ribosomal protein S11 (RPS11),Ribosomal protein S12 (RPS12), ribosomal protein S13 (RPS13), ribosomal protein S15 (RPS15), ribosomal protein S15a (RPS15A), ribosomal protein S16 (RPS16), ribosomal protein S19 (RPS19), ribosomal protein S20 (RPS20), ribosomal protein S21 (RPS21), ribosomal protein S23 (RPS23), ribosomal protein S25 (RPS25), ribosomal protein S26 (RPS26), ribosomal protein Ribosomal protein S27 (RPS27), ribosomal protein S27a (RPS27a), ribosomal protein S28 (RPS28), ribosomal protein S29 (RPS29), ribosomal protein L15 (RPL15), ribosomal protein S2 (RPS2), ribosomal protein L14 (RPL14), ribosomal protein S14 (RPS14), ribosomal protein L10 (RPL10), ribosomal protein L10a (RPL10A), ribosomal protein L35 (RPL35), ribosomal protein L13a (RPL13A) Sequences derived from the 3'UTR region of genes encoding ribosomal protein L36 (RPL36), ribosomal protein L36a (RPL36A), ribosomal protein L41 (RPL41), ribosomal protein S18 (RPS18), ribosomal protein S24 (RPS24), ribosomal protein L8 (RPL8), ribosomal protein L34 (RPL34), ribosomal protein S17 (RPS17), ribosomal protein SA (RPSA), or ribosomal protein S17 (RPS17), or the above riboso The sequence of a gene encoding a ribosomal protein having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the ribosomal gene protein sequences, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity (inclusive or exclusive) between any two of the above 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In some embodiments, one of the above 3'UTR sequences,2, 3, 4, 5, or more may be excluded from the RNA molecules disclosed herein.

[0230] In some embodiments, the 3'UTR is a sequence derived from the 3'UTR region of a gene encoding a ribosomal protein, or a ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), ubiquitously expressed Finkel-Biskis-Reilly mouse sarcoma virus (FBR-MuSV) (FAU), ribosomal protein L22-like 1 (RPL22L1), ribosomal protein L39-like (RPL39L), ribosomal protein L Ribosomal protein L36a-like (RPL10L), ribosomal protein L3a-like (RPL36AL), ribosomal protein L3-like (RPL3L), ribosomal protein S27-like (RPS27L), ribosomal protein L26-like 1 (RPL26L1), ribosomal protein L7-like 1 (RPL7L1), ribosomal protein L13a pseudogene (RPL13AP), ribosomal protein L37a pseudogene 8 (RPL37AP8), ribosomal protein S Sequences derived from genes including pseudogene 10 (RPS10P5), pseudogene 11 (RPS26P11), pseudogene 5 (RPL39P5), pseudogene 6 (RPLP0P6), and pseudogene 14 (RPL36P14) of ribosomal protein, and / or any of the above gene protein sequences, with at least 99%, 98%, 97%, 96%, and 9%. The sequence includes a gene encoding a protein having 5%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity between any two of the following (inclusive or exclusive): 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In some embodiments, one, two, three, four, five, or more of the above 3'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0231] Those skilled in the art will understand that heterologous and / or synthetic 5'UTRs may be used with any desired 3'UTR sequence, and vice versa. For example, a heterologous 5'UTR may be used with a synthetic and / or heterologous 3'UTR.

[0232] In one embodiment, the DNA encoding the 3'UTR disclosed herein includes a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with respect to SEQ ID NO: 20, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity between any two of the following (inclusive or exclusive): 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity. In one embodiment, the DNA encoding the 3'UTR includes the sequence of SEQ ID NO: 20. In some embodiments, the RNA disclosed herein includes a 3'UTR containing a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with respect to the 3'UTR provided in either SEQ ID NO: 21 or 22, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity between any two of the following (inclusive or exclusive): 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity. In one embodiment, the 3'UTR contains the sequence of either SEQ ID NO: 21 or 22. Sequence ID 20 (DNA) CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC SEQ ID NO: 21 (RNA) CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCUGGAGCUAGC SEQ ID NO: 22 (RNA) CΨCGAGCΨGGΨACΨGCAΨGCACGCAAΨGCΨAGCΨGCCCCΨΨΨCCCGΨCCΨGGGΨACCCCGAGΨCΨCCCCCGACCΨCGGGΨCCCAGGΨAΨGCΨCCCACCΨCCACCΨGCCCCACΨCACCACCΨCΨGCΨAGΨΨCCAGACACCΨCCCAAGCACGCAGCAAΨGCAGCΨCAAAACGCΨΨAGCCΨAGCCACACCCCCACGGGAAACAGCAGΨGAΨΨAACCΨΨΨAGCAAΨAAACGAAAGΨΨΨAACΨAAGCΨAΨACΨAACCCCAGGGΨΨGGΨCAAΨΨΨCGΨGCCAGCCACACCCΨGGAGCΨAGC

[0233] In one embodiment, the DNA encoding the 3'UTR disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with respect to sequence number 23, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity between any two of the following (inclusive or exclusive): 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity. In one embodiment, the DNA encoding the 3'UTR comprises the sequence of sequence number 23. In one embodiment, the RNA disclosed herein includes a 3'UTR containing a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with respect to the 3'UTR provided in either SEQ ID NO: 24 or 25, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80%. In one embodiment, the 3'UTR contains the sequence of either SEQ ID NO: 24 or 25. Sequence ID 23 (DNA) ATACAGCAGCAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTATTTTATTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC Sequence ID 24 (RNA) AUACAGCAGCAAUUGGCAAGCUGCUUACAUAGAACUCGCGGCGAUUGGCAUGCCGCCUUAAAAUUUUUUAUUUUUUUUUUCUUUUUUUUCCGAAUCGGAUUUUGUUUUUAAUAUUUC Sequence ID 25 (RNA) AΨACAGCAGCAAΨΨGGCAAGCΨGCΨΨACAΨAGAACΨCGCGGCGAΨΨGGCAΨGCCGCCΨ ΨAAAAΨΨΨΨΨAΨΨΨΨAΨΨΨΨΨCΨΨΨΨCΨΨΨΨΨCCGAAΨCGGAΨΨΨΨGΨΨΨΨΨAAΨAΨΨΨC

[0234] In some embodiments, 1, 2, 3, 4, 5, or more of the above 3'UTR sequences may be excluded from the RNA molecules disclosed herein.

[0235] D. Open Reading Frame (ORF) The 5' and 3' UTRs may be operably ligated to an open reading frame (ORF), which may be a sequence of codons capable of being translated into a polypeptide of interest. The open reading frame may be a sequence of several DNA or RNA nucleotide triplets that can be translated into a peptide or protein. The ORF may begin with a start codon at its 5' end, for example, a combination of three subsequent nucleotides (ATG or AUG) that typically codes for the amino acid methionine, as well as a subsequent region that typically exhibits a length of several three nucleotides. The open reading frame may end with at least one stop codon, including but not limited to TAA, TAG, TGA or UAA, UAG or UGA, or any combination thereof. In some embodiments, the open reading frame may end with 1, 2, 3, 4 or more stop codons, including but not limited to TAATAA (SEQ ID NO: 27), TAATAG (SEQ ID NO: 28), TAATGA (SEQ ID NO: 29), TAGTGA (SEQ ID NO: 30), TAGTAA (SEQ ID NO: 31), TAGTAG (SEQ ID NO: 32), TGATGA (SEQ ID NO: 33), TGATAG (SEQ ID NO: 34), TGATAA (SEQ ID NO: 35), or UAAUAA (SEQ ID NO: 36), UAAUAG (SEQ ID NO: 37), UAAUGA (SEQ ID NO: 38), UAGUGA (SEQ ID NO: 39), UAGUAA (SEQ ID NO: 40), UAGUAG (SEQ ID NO: 41), UGAUGA (SEQ ID NO: 42), UGAUAG (SEQ ID NO: 43), UGAUAA (SEQ ID NO: 44), or any combination thereof. The open reading frame may be isolated or incorporated into a longer nucleic acid sequence, such as a vector or mRNA. Open reading frames may also be referred to as "(protein) coding regions" or "coding sequences."

[0236] As described herein, RNA molecules may contain one (monocistronic), two (dicistronic), or more (multicistronic) open reading frames.

[0237] In some embodiments, the ORF encodes a non-structural viral gene. In some embodiments, the ORF further comprises one or more subgenome promoters. In some embodiments, the RNA molecule comprises a subgenome promoter operably linked to the ORF. In some embodiments, the first RNA molecule does not contain an ORF encoding any polypeptide of interest, but the second RNA molecule contains an ORF encoding a polypeptide of interest. In some embodiments, the first RNA molecule does not contain a subgenome promoter.

[0238] This disclosure provides an RNA molecule comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) polypeptide. In some embodiments, the RNA molecule comprises at least one open reading frame encoding an RSV F protein. In preferred embodiments, the RNA molecule comprises at least one open reading frame encoding a respiratory syncytial virus (RSV) pre-fusion F protein (preF) polypeptide.

[0239] E. Genes of interest The RNA molecules described herein may include genes of interest. Genes of interest encode polypeptides of interest. Non-limiting examples of polypeptides of interest include, for example, biologics, antibodies, vaccines, therapeutic polypeptides or peptides, cell-permeable peptides, secreted polypeptides, plasma membrane polypeptides, cytoplasmic or cytoskeletal polypeptides, intracellular membrane-bound polypeptides, nuclear polypeptides, polypeptides associated with human diseases, targeted moieties, polypeptides encoded by the human genome that have no identified therapeutic indicators but are nevertheless useful in the fields of research and drug discovery, or combinations thereof. In some embodiments, one, two, three, four, five, or more of the above polypeptides of interest may be excluded. Sequences of specific genes of interest are readily identified by those skilled in the art using public and private databases, e.g., GENBANK®.

[0240] In some embodiments, the RNA molecule includes a coding region for a gene of interest. In some embodiments, the gene of interest is or includes an antigen polypeptide, an immunogenic variant thereof, or an immunogenic fragment thereof. In some embodiments, the antigen polypeptide includes one epitope from an antigen. In some embodiments, the antigen polypeptide includes multiple distinct epitopes from an antigen. In some embodiments, an antigen polypeptide including multiple distinct epitopes from an antigen is a polyepitope. In some embodiments, the antigen polypeptide includes an antigen polypeptide from an allergen, a viral antigen polypeptide, a bacterial antigen polypeptide, a fungal antigen polypeptide, a parasitic antigen polypeptide, an antigen polypeptide from an infectious agent, an antigen polypeptide from a pathogen, a tumor antigen polypeptide, or an autoantigen polypeptide. In some embodiments, one, two, three, four, five, or more of the above antigen polypeptides may be excluded.

[0241] The term “antigen” may refer to a substance that has the ability to be recognized by the immune system, such as the adaptive immune system, and that has the ability to induce an antigen-specific immune response, for example, by the formation of antibodies and / or antigen-specific T cells as part of the adaptive immune response. An antigen may be, or may contain, a peptide or protein that can be presented to T cells by MHC. An antigen may also be the translation product of a nucleic acid molecule provided, for example, an RNA molecule containing at least one coding sequence described herein. Additionally, fragments, variants, and derivatives of an antigen, such as peptides or proteins, containing at least one epitope are understood as antigens.

[0242] In some embodiments, the RNA encoding the gene of the object of interest, e.g., the antigen, is expressed in the target cells being treated in order to provide the gene of the object of interest, e.g., the antigen. In some embodiments, the RNA is transiently expressed in the target cells. In some embodiments, the expression of the gene of the object of interest, e.g., the antigen, occurs on the cell surface. In some embodiments, the gene of the object of interest, e.g., the antigen, is expressed and presented in the context of the MHC. In some embodiments, the expression of the gene of the object of interest, e.g., the antigen, occurs in the extracellular space, e.g., the antigen is secreted.

[0243] In some embodiments, the RNA molecule includes a coding region for a gene of interest, e.g., an antigen. In some embodiments, the RNA molecule includes a coding region for a gene of interest, e.g., an antigen derived from a pathogen associated with an infectious disease. In some embodiments, the RNA molecule includes a coding region for a gene of interest, e.g., an antigen derived from RSV.

[0244] In some embodiments, the RNA molecule encodes the RSV preF protein, or a fragment or variant thereof.

[0245] In some embodiments, the RNA polynucleotides described herein or compositions or pharmaceutical preparations containing them contain the nucleotide sequences disclosed herein. In some embodiments, the RNA polynucleotides contain sequences having at least 80% identity to the nucleotide sequences disclosed herein. In some embodiments, the RNA polynucleotides contain sequences encoding polypeptides having at least 80% identity to the polypeptide sequences disclosed herein. In some embodiments, the RNA polynucleotides described herein or compositions or pharmaceutical preparations containing them are transcribed using a DNA template. In some embodiments, the DNA template used to transcribe the RNA polynucleotides described herein contains sequences complementary to the RNA polynucleotides. In some embodiments, the gene of interest described herein is encoded by the RNA polynucleotides described herein, which contain the nucleotide sequences disclosed herein. In some embodiments, the RNA polynucleotides encode polypeptides having at least 80% identity to the polypeptide sequences disclosed herein. In some embodiments, the polypeptides described herein are encoded by RNA polynucleotides transcribed using a DNA template containing sequences complementary to the RNA polynucleotides.

[0246] In some embodiments, the RNA molecule encodes an RSV preF protein, or a fragment or variant thereof, containing one of the sequences 1-6 and 71-74.

[0247] In some embodiments, the RNA molecule encodes an RSV preF protein, or a fragment or variant thereof, synthesized from a nucleic acid sequence containing any one of sequence numbers 7-10 and 59-62.

[0248] F. Poly-A Tail In some embodiments, the RNA molecules disclosed herein include, for example, a polyadenylate (poly-A) sequence as described herein. In some embodiments, the poly-A sequence is located downstream of the 3'UTR, for example, adjacent to the 3'UTR. "Poly-A tail" or "poly-A sequence" refers to a stretch of consecutive adenine residues, for example, up to 400 or up to about 400 adenosine nucleotides, for example, 20 to 400 or about 20 to about 400, preferably 50 to 400 or about 50 to about 400, more preferably 50 to 300 or about 50 to about 300, even more preferably 50 to 250 or about 50 to about 250, most preferably 60 to 250 or about 60 to about 250 adenosine nucleotides, which may be attached to the 3' end of the RNA molecule. The poly-A sequence is known to those skilled in the art and may follow the 3'UTR in the RNA molecules described herein. Poly-A tails may increase the stability, half-life, and / or translation efficiency of RNA molecules.

[0249] After cleavage, most pre-mRNAs acquire a polyadenylated tail, except that they contain a replication-dependent histone transcript that terminates in a histone stem-loop instead of a polyA sequence. In this context, 3' end processing is a nuclear cotranscription process that facilitates the transport of mRNA from the nucleus to the cytoplasm and affects mRNA stability and translation. This 3' end formation occurs in a two-step reaction directed by a cleavage / polyadenylation mechanism and depends on the presence of two sequence elements in the mRNA precursor (pre-mRNA): a hexanucleotide polyadenylation signal and a downstream G / U-rich sequence. In the first step, the pre-mRNA is cleaved into a free 3' hydroxyl between these two elements. In the second step, the newly formed 3' end is extended by polyadenylation or the addition of a polyA sequence.

[0250] Polyadenylation refers to the addition of a poly(A) sequence to an RNA molecule, for example, to immature mRNA. Polyadenylation may be induced by a so-called polyadenylation signal. This signal may be located near the 3' end of the RNA molecule being polyadenylated or within a stretch of nucleotides therein. The polyadenylation signal may also be contained in the 3'UTR of an artificial nucleic acid molecule. The polyadenylation signal typically contains a hexamer consisting of adenine and uracil / thymine nucleotides, preferably the hexamer sequence AAUAAA, but other sequences, preferably hexamer sequences, are also conceivable. Polyadenylation typically occurs during the processing of pre-mRNA (also called immature mRNA). Typically, RNA maturation (from pre-mRNA to mature mRNA) includes the polyadenylation step. Poly(A) tailing of transcribed mRNA in vitro can be achieved using a variety of approaches, including, but not limited to, cloning of a poly(T) tract into a DNA template or post-transcriptional addition using poly(A) polymerase. This term may also relate to the polyadenylation of RNA as a cellular process, or to polyadenylation carried out by an in vitro enzymatic reaction with a suitable enzyme, such as Escherichia coli (E. coli) poly-A polymerase, or by chemosynthesis.

[0251] The RNA molecules disclosed herein may have a polyA sequence attached to the free 3' end of the RNA by a template-independent RNA polymerase after transcription, or a polyA sequence encoded by DNA and transcribed by a template-dependent RNA polymerase. In some embodiments, the polyA sequence is attached during RNA transcription, for example, during the preparation of in vitro transcribed RNA, based on a DNA template containing repeating dT nucleotides (deoxythymidilates) in a strand complementary to the coding strand.

[0252] The DNA sequence encoding the polyA sequence (coding strand) is referred to as the polyA cassette. In some embodiments, the polyA cassette present in the coding strand of DNA consists essentially of dA nucleotides, but is interrupted by a random sequence of four nucleotides (dA, dC, dG, and dT). Such a random sequence consists of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. Length, up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides, exactly 5, 6, 7 , lengths of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides, or lengths of 5, 6, 7, 8, 9, 10, 11, The nucleotide lengths may be between (inclusive or exclusive) any two of the following: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50. Such cassettes are disclosed, for example, in International Publication No. 2016 / 005324A1, which is incorporated herein by reference. Any poly-A cassette disclosed in International Publication No. 2016 / 005324A1 may be used in this disclosure.A poly-A cassette, essentially composed of dA nucleotides but having an equal distribution of four nucleotides (dA, dC, dG, dT) and interrupted by a random sequence having, for example, a length of 5 to 50 nucleotides, exhibits consistent proliferation of plasmid DNA in Escherichia coli (E. coli) at the DNA level and is further associated with beneficial properties related to the support of RNA stability and translation efficiency at the RNA level. In some embodiments, the poly-A sequence contained in the RNA polynucleotide described herein is essentially composed of adenosine nucleotides but interrupted by a random sequence of four nucleotides (A, C, G, U). Such random sequences contain at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. Length, up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides, exactly 5, 6, 7 , lengths of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides, or lengths of 5, 6, 7, 8, 9, 10, 11, The length of the nucleotide may be the length between any two of the following nucleotides (inclusive or exclusive): 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

[0253] The polyA sequence may be located at any position within the 3'UTR. In some embodiments, nucleotides other than adenosine nucleotides do not adjoin the polyA sequence at their 3' ends; for example, the polyA sequence is neither masked by nor followed by any nucleotides other than adenosine at its 3' end. In some embodiments, the polyA sequence may be located at the 3' end of the 3'UTR; for example, the 3'UTR does not contain more than 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides located at the 3' end of the polyA sequence; more preferably, the 3'UTR does not contain any further elements located at the 3' end of the polyA sequence. In some embodiments, the polyA sequence is located at the 3' end of the RNA molecule; for example, the artificial nucleic acid molecule does not contain more than 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides located at the 3' end of the polyA sequence. Alternatively, the polyA sequence may be located at the 5' end of the 3'UTR, for example, immediately 3' of the ORF of an artificial nucleic acid molecule, or within the 3'UTR, for example, adjacent to the 5' and 3' sides of other 3'UTR elements. In some embodiments, the polyA sequence is adjacent to the 3' side of a polyC sequence and / or a histone stem-loop sequence. In addition or alternatively, the polyA sequence may be adjacent to the 5' side of a 3'UTR element, for example, derived from a human albumin or globin gene.

[0254] In some embodiments, the RNA molecule may further include an endonuclease recognition site sequence immediately downstream of the poly(A) tail sequence. The RNA molecule may further include a poly(A) polymerase recognition sequence (e.g., a polyadenylation signal) (e.g., AAUAAA) near its 3' end. In some embodiments, the polyadenylation signal is located 3' of the poly(A) sequence contained in the 3'UTR. In some embodiments, the poly(A) sequence consists of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides, up to 1, 2, 3, 4, 5, 6, 7, 8 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides, exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 , 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120 The nucleotide sequence contains (inclusive or exclusive) any two of nucleotides among 125, 130, 135, 140, 145, or 150, or is separated from the polyadenylation signal by a nucleotide sequence consisting of such nucleotides, where the nucleotide sequence preferably does not contain more than 10, 9, 8, 7, 6, 5, 4, 3, or 2 consecutive adenine nucleotides.In some embodiments, the nucleotide sequence separating the polyA sequence and the polyadenylation signal comprises 1 to 200 or about 1 to about 200 nucleotides, for example, 10 to 90, 20 to 85, 30 to 80, 40 to 80, 50 to 75 or 55 to 85 nucleotides, more preferably 55 to 80 nucleotides, and the nucleotide sequence does not contain more than 10, 9, 8, 7, 6, 5, 4, 3, or 2 consecutive adenine nucleotides.

[0255] In some embodiments, the polyadenylation signal includes a consensus sequence NN(U / T)ANA (N=A or U), preferably AA(U / T)AAA or A(U / T)(U / T)AAA. Such consensus sequences can be recognized by most animal and bacterial cell lines, for example, by cleavage / polyadenylation-specific factors (CPSFs) that cooperate with polyadenylation factors, such as CstF, PAP, PAB2, CFI and / or CFII. In some embodiments, the polyadenylation signal (e.g., consensus sequence NNUANA) is located on fewer than 50 or about 50 nucleotides downstream of the 3' end of the 3' UTR element as defined herein, e.g., at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides, at most 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides, exactly 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides, or between (inclusive or exclusive) any two of 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides, such that the transcription of the RNA molecule results in immature RNA containing the polyadenylation signal downstream of its 3' UTR, and the subsequent attachment of the polyA sequence to the immature RNA. Therefore, the obtained RNA may contain a 3'UTR containing at least one polyA sequence, where the 3'UTR is followed by an additional polyA sequence.

[0256] The poly-A sequence may be of any length. In some embodiments, the poly-A tail may be 5 to 300 nucleotides long. In some embodiments, the RNA molecule includes a poly-A tail containing, essentially, or consisting of, a sequence of 25 to 400 or about 25 to about 400 adenosine nucleotides, a sequence of 50 to 400 or about 50 to about 400 adenosine nucleotides, a sequence of 50 to 300 or about 50 to about 300 adenosine nucleotides, a sequence of 50 to 250 or about 50 to about 250 adenosine nucleotides, a sequence of 60 to 250 or about 60 to about 250 adenosine nucleotides, or a sequence of 40 to 100 or about 40 to about 100 adenosine nucleotides. In some embodiments, the poly A tail is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725, 730, 735, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 815, 820, 825,830, 835, 840, 845, 850, 855, 860, 865, 870, 875, 880, 885, 890, 895, 900, 905, 910, 915, 920, 925, 930, 935, 940, 945, 950, 955, 960, 965, 970, 975, 980, 985, 990, 995, or 1000 adenosine nucleotides, up to 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 11 0, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265 ,270,275,280,285,290,295,300,305,310,315,320,325,330,335,340,345,350,355,360,365,370,375,380,385,390,395,400,405,410,415,420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 5 80, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725, 730, 73 5, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 815, 820, 825, 830, 835, 840, 845, 850, 855, 860, 865, 870, 875, 880, 885, 890, 895, 900, 905, 910, 915, 920, 925, 930, 935, 940, 945, 950, 955, 960, 965, 970, 975, 980, 985, 990, 995, or 1000 adenosine nucleotides, precisely 5, 10, 15, 20, 25, 30,35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 1 75, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 33 0, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485 ,490,495,500,505,510,515,520,525,530,535,540,545,550,555,560,565,570,575,580,585,590,595,600,605,610,615,620,625,630,635,640, 645, 650, 655, 660, 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725, 730, 735, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 815, 820, 825, 830, 835, 840, 845, 850, 855, 860, 865, 870, 875, 880, 885, 890, 895, 900, 905, 910, 915, 920, 925, 930, 935, 940, 945, 950, 9 55, 960, 965, 970, 975, 980, 985, 990, 995, or 1000 adenosine nucleotides, or 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235,240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 4 50, 455, 460, 465, 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660 ,665,670,675,680,685,690,695,700,705,710,715,720,725,730,735,740,745,750,755,760,765,770,775,780,785,790,795,800,805,810,815,820,825,830,835,840,845,850,855,860,865,870,8 It contains, is essentially, or consists of any two adenosine nucleotides between (inclusive or exclusive) any two of the following: 75, 880, 885, 890, 895, 900, 905, 910, 915, 920, 925, 930, 935, 940, 945, 950, 955, 960, 965, 970, 975, 980, 985, 990, 995, or 1000. In this context, "essentially consisting of" means that most of the nucleotides in the polyA sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides in the polyA sequence are adenosine nucleotides, but the remaining nucleotides may be other nucleotides, such as uridine, guanosine, and / or cytosine. In this context, "consisting of" means all nucleotides in the polyA sequence, i.e.,This means that 100% of the nucleotides in the poly(A) sequence are adenosine nucleotides.

[0257] In some embodiments, the RNA molecule includes a polyA tail containing a sequence of more than 30 adenosine nucleotides. In some embodiments, the RNA molecule includes a polyA tail containing 40 adenosine nucleotides or about 40 adenosine nucleotides. In some embodiments, the RNA molecule includes a polyA tail containing 80 adenosine nucleotides or about 80 adenosine nucleotides. In some embodiments, the 3' polyA tail has a stretch of at least 10 consecutive adenosine residues and up to 300 consecutive adenosine residues. In some specific embodiments, the RNA molecule includes 40 consecutive adenosine residues or about 40 consecutive adenosine residues. In some embodiments, the RNA molecule includes 80 consecutive adenosine residues or about 80 consecutive adenosine residues. The polyA tail can play a crucial regulatory role in enhancing translation efficiency, as well as in regulating the efficiency of mRNA quality control and degradation. Short sequences or hyperpolyadenylation may indicate RNA degradation.

[0258] In some embodiments, the poly-A tail may be located within an RNA molecule or other nucleic acid molecule, for example, in a vector, for example, in a vector that serves as a template for the transcriptional generation of RNA, for example, mRNA. In some embodiments, the RNA molecule may not contain a poly-A tail.

[0259] In some embodiments, the poly-A tail may be located within an RNA molecule or other nucleic acid molecule, for example, in a vector, for example, in a vector that serves as a template for the transcriptional generation of RNA, for example, mRNA. In some embodiments, the RNA molecule may not contain a poly-A tail.

[0260] In one embodiment, the DNA encoding the poly-A tail disclosed herein comprises a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with SEQ ID NO: 26, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity between any two of the following (inclusive or exclusive): 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity. In one embodiment, the DNA encoding the poly-A tail comprises the sequence of SEQ ID NO: 26. In one embodiment, the RNA disclosed herein includes a polyA tail containing a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with respect to SEQ ID NO: 26, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or identity between any two of the following (inclusive or exclusive): 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity. In one embodiment, the polyA tail contains the sequence of SEQ ID NO: 26. In one embodiment, the polyA tail contains the sequence of SEQ ID NO: 26+ / -2 adenosine (A) nucleotides. In one embodiment, the polyA tail contains the sequence of the adenosine (A) nucleotide of SEQ ID NO: 26+ / -1. In one embodiment, the polyA tail contains the sequence of SEQ ID NO: 26. In one embodiment, the polyA tail contains the sequence of the adenosine (A) nucleotide of SEQ ID NO: 26+ / -2. In one embodiment, the polyA tail contains the sequence of the adenosine (A) nucleotide of SEQ ID NO: 26+ / -1. In some embodiments, the polyA tail contains the sequence of SEQ ID NO: 26.

[0261] In some embodiments, 1, 2, 3, 4, 5, or more of the above polyA sequences may be excluded from the RNA molecules disclosed herein. Sequence ID 26 (DNA, RNA) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0262] G. Other elements In some aspects of this disclosure, RNA molecules additionally include strand-terminated nucleosides. For example, strand-terminated nucleosides may include nucleosides deoxylated at the 2' and / or 3' positions of their sugar groups. Such species may include 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, and 2',3'-dideoxynucleosides, e.g., 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, and 2',3'-dideoxythymine. In some aspects, 1, 2, 3, 4, 5, or more of the above strand-terminated nucleosides may be excluded from the RNA molecules disclosed herein. In some embodiments, the incorporation of a terminal nucleotide into mRNA, for example at the 3' end, can result in mRNA stabilization, as described, for example, in International Publication No. 2013 / 103659.

[0263] In some embodiments of this disclosure, the RNA molecule additionally includes a stem-loop, such as a histone stem-loop. The stem-loop may contain 2, 3, 4, 5, 6, 7, 8, or more nucleotide base pairs. For example, the stem-loop may contain 4, 5, 6, 7, or 8 nucleotide base pairs. The stem-loop may be located in any region of the mRNA. For example, the stem-loop may be located before or after an untranslated region (5'UTR or 3'UTR), a coding region, or a poly-A sequence or tail. In some embodiments, the stem-loop may affect one or more functions of the mRNA, such as translation initiation, translation efficiency, and / or transcription termination. Such a histone stem-loop sequence may be the histone stem-loop sequence disclosed in International Publication No. 2012 / 019780, which is incorporated herein by reference in its entirety. Other non-limiting examples of histone stem-loop structures and nucleic acid sequences encoding such structures can be found, for example, in International Publication No. 2016 / 091391, which is incorporated herein by reference in its entirety.

[0264] In some embodiments, a combination of a polyA sequence or polyadenylation signal and at least one histone stem-loop acts synergistically to increase protein expression beyond the levels observed with either of the individual elements, even if both represent innate and alternative mechanisms. In some embodiments, the synergistic effect of the combination of polyA and at least one histone stem-loop is independent of the order and / or length of the elements in the polyA sequence.

[0265] In some embodiments, the RNA does not contain a histone downstream element (HDE). The HDE is a naturally occurring stem-loop stretch of approximately 15-20 nucleotides in the 3' position that represents a binding site for U7 snRNA, and is involved in the processing of histone pre-mRNA into mature histone mRNA.

[0266] In some embodiments, the histone stem-loop comprises intramolecular base pairing of two neighboring partially or entirely reverse-complementary sequences separated by a spacer consisting of short sequences that typically originate from histone genes and form a loop in the structure. Unpaired loop regions typically cannot base pair with any of the stem-loop elements. The stability of the stem-loop structure generally depends on the length of the paired regions, the number of mismatches or bulges, and / or the base composition. In some embodiments, fluctuating base pairing (non-Watson-Crick base pairing) may result. In some embodiments, at least one histone stem-loop sequence contains a length of 15 to 45 nucleotides.

[0267] In some embodiments, the RNA molecule contains a poly(C) sequence (e.g., within the 3'UTR). In some embodiments, the poly(C) sequence contains at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 cytidines, and at most 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 cytidines, exactly 1 The sequence contains 0, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 cytidines, or cytidines between (inclusive or exclusive) any two of the following: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200. In some embodiments, the polyC sequence contains 30 cytidines or approximately 30 cytidines.

[0268] In some embodiments, RNA molecules contain an internal ribosome entry site (IRES) sequence or IRES motif. In some embodiments, for example, if the RNA encodes two or more peptides or proteins, the IRES sequence separates the ORF. Therefore, IRES sequences can be useful when the RNA molecule is a dicistronic or multicistronic nucleic acid molecule.

[0269] In some embodiments, the RNA does not contain introns. In some embodiments, the RNA includes, instead of or additionally, microRNA binding sites.

[0270] A representative RNA molecule containing the element combinations disclosed herein is shown below in the 5' to 3' direction: ORF-Poly-A sequence; ORF-IRES-ORF-PolyA sequence; ORF-3'UTR-PolyA sequence; ORF-PolyA sequence-3'UTR; ORF-3'UTR-PolyA sequence-Poly(C) sequence-Histone stem loop; ORF-3'UTR-PolyA sequence-Poly(C) sequence-PolyA sequence; ORF-3'UTR-PolyA sequence-Histone stem loop-PolyA sequence; 5'UTR-ORF-3'UTR; 5'UTR-ORF-PolyA sequence; 5'UTR-ORF-Poly(A) sequence-Poly(C) sequence-Histone stem loop; 5'UTR-ORF-PolyA sequence-Poly(C) sequence-PolyA sequence; 5'UTR-ORF-PolyA sequence-Histone stem loop-PolyA sequence; 5'UTR-ORF-3'UTR-PolyA sequence; 5'UTR-ORF-3'UTR-PolyA sequence-Poly(C) sequence 5'UTR-ORF-3'UTR-Poly(A) sequence-Poly(C) sequence-Histone stem loop; 5'-Cap-5'UTR-ORF-3'UTR; 5'-cap-5'UTR-ORF-polyA sequence; 5'-cap-5'UTR-ORF-3'UTR-polyA sequence; 5'-cap-5'UTR-ORF-3'UTR-poly(A) sequence-poly(C) sequence; or 5'-Cap-5'UTR-ORF-3'UTR-Poly(A) sequence-Poly(C) sequence-Histone stem loop This may include, but is not limited to, the following:

[0271] In some embodiments, one, two, three, four, five, or more of the above elements may be excluded from the RNA molecules disclosed herein.

[0272] H. Self-amplifying RNA (saRNA) In some embodiments, the RNA molecule may be saRNA. “Self-replicating RNA,” “saRNA,” and “replicon” refer to RNA that has the ability to replicate itself. Self-replicating RNA molecules may be produced, for example, by using replication elements derived from an alphavirus and substituting a structural viral polypeptide with a nucleotide sequence encoding the polypeptide of interest. Self-replicating RNA molecules are typically positive-chain molecules that can be directly translated after delivery to a cell, and this translation provides RNA-dependent RNA polymerase, which then produces both antisense and sense transcripts from the delivered RNA. The delivered RNA may lead to the production of multiple daughter RNA molecules. These daughter RNA molecules, and collinear subgenomic transcripts, may themselves be translated to provide in-situ expression of the gene of interest, e.g., a viral antigen, and / or transcribed to provide further transcripts of the same sense as the delivered RNA, which are translated to provide in-situ expression of the antigen. The overall result of this transcription sequence is an amplification of the number of introduced saRNA molecules, and as a res...

Claims

1. An RNA molecule containing at least one open reading frame encoding a respiratory syncytial virus (RSV) fusion protein F(F) polypeptide.

2. The RNA molecule according to claim 1, wherein the RSV polypeptide is its full length, cleaved form, fragment, or variant.

3. The RNA molecule according to claim 1, wherein the RSV polypeptide comprises at least one mutation.

4. The RNA molecule according to claim 1, wherein the RSV polypeptide has at least 90%, 95%, 96%, 97%, 98%, or 99% identity with an amino acid sequence selected from SEQ ID NOs: 1-6 and 71-74.

5. The RNA molecule according to claim 1, wherein the open reading frame is transcribed from a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity with any one of sequences 7-10 and 59-62.

6. The RNA molecule according to claim 1, wherein the open reading frame includes a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity with any one of sequences 11-16 and 63-70.

7. The RNA molecule according to claim 1, wherein the open reading frame comprises one nucleic acid sequence from sequence numbers 11-16 and 63-70.

8. The RNA molecule according to claim 1, further comprising a 5' untranslated region (5'UTR).

9. The RNA molecule according to claim 8, wherein the 5'UTR contains a sequence selected from any of SEQ ID NOs: 17 to 19.

10. The RNA molecule according to claim 1, further comprising a 3' untranslated region (3'UTR).

11. The RNA molecule according to claim 10, wherein the 3'UTR contains one of the sequences of sequence numbers 20 to 25.

12. The RNA molecule according to claim 1, further comprising a 5' cap portion or a 3' poly-A tail.

13. The RNA molecule according to claim 12, wherein the polyA tail contains a sequence having sequence number 26.

14. The RNA molecule according to claim 1, wherein the open reading frame contains at least 55%, 60%, 65%, 70%, or 75%, or 50% to 75%, or 55% to 70%, or about 50% to 75%, or 55% to 70% G / C content.

15. The RNA molecule according to claim 1, wherein the encoded RSV polypeptide is localized to the cell membrane, or to the Golgi apparatus, and / or secreted.

16. The RNA molecule according to claim 1, wherein the RNA comprises at least one modified nucleotide.

17. The RNA molecule according to claim 16, wherein the modified nucleotide is pseudouridine, N1-methylpseudridine, N1-ethylpseudridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudridine, 2-thio-1-methylpseudridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudridine, 2-thio-dihydrouridine, 2-thiopseudridine, 4-methoxy-2-thiopseudridine, 4-methoxypseudridine, 4-thio-1-methylpseudridine, 4-thiopseudridine, 5-aza-uridine, dihydropseudridine, 5-methoxyuridine, or 2'-O-methyluridine.

18. The RNA molecule according to claim 17, wherein the modified nucleotide is N1-methylpseuduridine (Ψ).

19. The RNA molecule according to claim 1, wherein the RNA is mRNA.

20. The RNA molecule according to claim 19, wherein the RNA is modRNA or saRNA.

21. A composition comprising the RNA molecule described in claim 1, wherein the RNA molecule is formulated in lipid nanoparticles (LNPs).

22. The composition according to claim 21, wherein the lipid nanoparticles comprise at least one of cationic lipids, PEG-modified lipids, neutral lipids, and steroids or steroid analogs.

23. The composition according to claim 22, wherein the cationic lipid is (4-hydroxybutyl)azandiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

24. PEG-modified lipids include glycol lipids containing PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxypolyethylene glycol)2000)carbamyl]-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA), and PEG-2000-DMG, PEG-modified diacylglycerol (PEG-DAG), e.g., 1-( The composition according to claim 22, wherein the composition is monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG), PEG-modified phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG), for example 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanediate (PEG-S-DMG), PEG-modified ceramide (PEG-cer), or PEG dialkoxypropyl carbamate, for example co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate.

25. The composition according to claim 24, wherein the PEGylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

26. The neutral lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), and dioleoyl-phosphatidylethanolamine 4-(N-maleimide). The composition according to claim 22, wherein the composition is methyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), or 1,2-dieridoyl-sn-glycero-3-phosphoethanolamine (transDOPE).

27. The composition according to claim 26, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

28. The composition according to claim 22, wherein the steroid or steroid analog is cholesterol.

29. A method for inducing an immune response to RSV in a subject, comprising administering an effective amount of the RNA molecule described in claim 1 to the subject.

30. A method for preventing, treating, or alleviating an infection, disease, or condition associated with RSV in a subject, comprising administering an effective amount of the RNA molecule described in claim 1 to the subject.

31. The method according to claim 30, wherein the infection, disease, or condition is an RSV infection-induced acute respiratory tract disease, including pneumonia and bronchitis.

32. The method according to claim 29 or 30, wherein the subject is under approximately 1 year old, approximately 1 year old or older, approximately 5 years old or older, approximately 10 years old or older, approximately 20 years old or older, approximately 30 years old or older, approximately 40 years old or older, approximately 50 years old or older, approximately 60 years old or older, approximately 70 years old or older, or older.

33. The method according to claim 29 or 30, wherein an RNA molecule is administered as a vaccine.

34. The method according to claim 29 or 30, wherein the subject is administered a single dose, two doses, three doses, or more doses of an RNA molecule, and optionally a booster dose.

35. A method for inducing an immune response to RSV in a subject, comprising administering to the subject an effective amount of the composition according to claim 22.

36. A method for preventing, treating, or alleviating an infection, disease, or condition associated with RSV in a subject, comprising administering to the subject an effective amount of the composition according to claim 22.