Compositions and methods for splicing modulation of UNC13A

Dual-target antisense oligonucleotides target UNC13A RNA to modulate splicing and restore UNC13A expression, effectively treating ALS and FTD by inhibiting cryptic exon inclusion and reducing off-target risks.

JP2026513754AActive Publication Date: 2026-05-01TAKEDA PHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025553808
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-05
Filing Date
2025-03-04
Publication Date
2026-05-01
Estimated Expiration
2045-03-04

AI Technical Summary

Technical Problem

Current treatments for amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are lacking, as single nucleotide polymorphisms in the UNC13A gene lead to cryptic splicing and reduced UNC13A protein expression due to abnormal RNA degradation, which is associated with TDP-43 dysfunction.

Method used

The use of dual-target antisense oligonucleotides targeting specific regions of the UNC13A RNA to modulate splicing and restore UNC13A expression, reducing off-target risks and inhibiting the inclusion of cryptic exons in mature UNC13A mRNA.

Benefits of technology

The antisense oligonucleotides effectively inhibit the inclusion of cryptic exons and restore UNC13A protein expression, potentially treating ALS and FTD by addressing the underlying genetic cause of these diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026513754000001
    Figure 2026513754000001
  • Figure 2026513754000002
    Figure 2026513754000002
  • Figure 2026513754000003
    Figure 2026513754000003
Patent Text Reader

Abstract

Antisense oligonucleotides for modulating UNC13A splicing (e.g., inhibiting the inclusion of UNC13A hidden exons in mature UNC13A mRNA), compositions comprising such antisense oligonucleotides, and methods of use are described. Also disclosed are pharmaceutical compositions comprising one or more antisense oligonucleotides, and methods for treating UNC13A-related diseases or diseases associated with TDP-43 dysfunction in a subject by administering the antisense oligonucleotides to that subject.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related applications This application asserts the interests under Section 119(e) of U.S. Patent Provisional Application No. 63 / 561,593, entitled "COMPOSITIONS AND METHODS FOR SPLICING MODULATION OF UNC13A," filed on 5 March 2024, the contents of which are incorporated herein by reference in their entirety.

[0002] The present invention relates to compositions (e.g., antisense oligonucleotides) for splicing modulation and / or gene expression modulation of UNC13A.

[0003] References to electronic sequence lists The contents of the electronic sequence listing (T083370053WO00-SEQ-CBD.xml; size: 3,049,175 bytes; and creation date: February 28, 2025) are incorporated herein by reference in their entirety. [Background technology]

[0004] Amyotrophic lateral sclerosis (ALS), also known as Lou Gehrig's disease, and frontotemporal dementia (FTD) are rare neurodegenerative diseases known as motor neuron diseases (MND). ALS is a terminal MND characterized by the loss of upper and lower motor neurons, leading to a rapid deterioration of muscle function and ultimately death due to respiratory failure. FTD is characterized by progressive neuronal loss, primarily involving the frontal and temporal lobes, and generally manifests as behavioral or speech disorders. Some patients with ALS also develop frontotemporal dementia (FTD). Currently, there are no known cures for either ALS or FTD.

[0005] UNC13A is an essential protein for synaptic transmission and neuromuscular junction (NMJ) transmission. Single nucleotide polymorphisms (SNPs) in UNC13A, such as intronic SNPs, have been shown to increase the risk of ALS and FTD. SNPs have been shown to increase cryptic splicing and alter the direct binding affinity of the RNA-binding protein TDP-43, thereby reducing TDP-43's ability to suppress the inclusion of cryptic exons in UNC13A during RNA splicing. TDP-43 dysfunction has been shown to result in the inclusion of cryptic exons in mature UNC13A mRNA. The inclusion of cryptic exons in mature UNC13A mRNA leads to reduced UNC13A protein expression due to abnormal RNA degradation or the presence of premature stop codons.

[0006] Additional neurodegenerative diseases involving TDP-43 pathology include Alzheimer's disease and limbic-dominant age-related TDP-43 encephalopathy (LATE). [Overview of the project]

[0007] Patients with ALS and FTD may benefit from inhibiting the inclusion of the UNC13A hidden exon in mature UNC13A mRNA. For example, there is a need for compositions and methods to treat ALS and FTD in target cells having ALS or FTD by inhibiting the inclusion of the UNC13A hidden exon in mature UNC13A mRNA and / or by restoring UNC13A expression.

[0008] This disclosure provides, in some embodiments, antisense oligonucleotides for splicing modulation and / or gene expression modulation of UNC13A. Dual-target antisense oligonucleotides comprising a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region enable effective splicing modulation of UNC13A hidden exons while reducing off-target risk. In some embodiments, the UNC13A RNA transcript may be present intracellularly, within cells of an object such as a human subject. Compositions comprising such antisense oligonucleotides and methods of using them (e.g., for treating UNC13A-related diseases such as ALS or FTD) are also provided.

[0009] Some aspects of the present disclosure provide an antisense oligonucleotide comprising a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region, wherein the first target region and / or the second target region each comprise a UNC13A sequence, and the antisense oligonucleotide modulates the splicing of the UNC13A hidden exon. In some embodiments, the first or second target region comprises a nucleotide sequence shown in SEQ ID NO: 313 or SEQ ID NO: 315. In some embodiments, the UNC13A hidden exon is located in intron 20 of the UNC13A premRNA.

[0010] In some embodiments, the first and second target regions are located in intron 20 of the UNC13A premRNA. In some embodiments, the first target region is adjacent to the second target region of the UNC13A premRNA. In some embodiments, the first target region is located downstream of the second target region in the UNC13A premRNA. In some embodiments, the first target region is located downstream of one or more nucleosides than the second target region. In some embodiments, the first target region is located downstream of a hidden exon, and the second target region is located in a hidden exon.

[0011] In some embodiments, the first target region comprises the nucleotide sequence shown in SEQ ID NO: 315, and / or the second target region comprises the nucleotide sequence shown in SEQ ID NO: 313. In some embodiments, the first target region comprises the nucleotide sequence of SEQ ID NO: 315, and the second target region comprises the nucleotide sequence of SEQ ID NO: 313.

[0012] In some embodiments, the first antisense sequence and / or the second antisense sequence are 6 to 15 nucleoside lengths. In some embodiments, the first antisense sequence and the second antisense sequence are 6 to 15 nucleoside lengths. In some embodiments, the first antisense sequence and / or the second antisense sequence are 8 to 15 nucleoside lengths. In some embodiments, the first antisense sequence is sequence numbers 191 to 247, 274, 288, 495 to 515, AGCCACGA, ACGAATC, CGAATCT, GAATCTA, AATCTAC, CAATCAT, GTTCAAT, TTCATC, TCAATCA, TTTTATC, CTTTTAT, TCACCCA, ACGAATCTA, GCCACGA, GAATCTAC, CGAATCTTA, CGAATCTAC, GAATCTACC, TCTACCC, ATCTAC The sequence comprises at least six consecutive nucleic acid bases of any one of C, GTCGCCG, GGGTGCG, GGGTCGC, and GGGCGCC, and / or the second antisense sequence comprises at least six consecutive nucleic acid bases of any one of Sequence IDs 194, 199, 212, 226, 227, 246-306, 516-535, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TGTACTC, and TCACCCA.In some embodiments, the first antisense sequence is sequence numbers 191-247, 274, 288, 495-515, AGCCACGA, ACGAATC, CGAATCT, GAATCTA, AATCTAC, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTATC, CTTTTAT, TCACCCA, ACGAATCTA, GCCACGA, GAATCTAC, CGAATCTTA, CGAATCTAC, GAATCTACC, TCTACCC, ATCTAC The sequence comprises at least seven consecutive nucleic acid bases of any one of C, GTCGCCG, GGGTGCG, GGGTCGC, and GGGCGCC, and / or the second antisense sequence comprises at least seven consecutive nucleic acid bases of any one of Sequence IDs 194, 199, 212, 226, 227, 246-306, 516-535, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TGTACTC, and TCACCCA. In some embodiments, the first antisense sequence is sequence numbers 191-247, 274, 288, 495-515, AGCCACGA, ACGAATC, CGAATCT, GAATCTA, AATCTAC, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTATC, CTTTTAT, TCACCCA, ACGAATCTA, GCCACGA, GAATCTAC, CGAATCTTA, CGAATCTAC, GAATCTACC, TCTACCC, ATCTAC The sequence comprises at least eight consecutive nucleic acid bases of any one of C, GTCGCCG, GGGTGCG, GGGTCGC, and GGGCGCC, and / or the second antisense sequence comprises at least eight consecutive nucleic acid bases of any one of SEQ ID NOs: 194, 199, 212, 226, 227, 246-306, 516-535, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TGTACTC, and TCACCCA.In some embodiments, the first antisense sequence comprises any one of the nucleic acid base sequences of SEQ ID NOs: 191-247, 274, 288, 495-515, AGCCACGA, ACGAATC, CGAATCT, GAATCTA, AATCTAC, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TCACCCA, ACGAATCTA, GCCACGA, GAATCTAC, CGAATCTA, CGAATCTAC, GAATCTACC, TCTACCC, ATCTACC, GTCGCCG, GGGGT CG, GGGTCGC, and GGTCGCC, and / or the second antisense sequence comprises any one of the nucleic acid base sequences of SEQ ID NOs: 194, 199, 212, 226, 227, 246-306, 516-535, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TGTACTC, and TCACCCA.

[0013] In some embodiments, the first antisense sequence and the second antisense sequence are directly adjacent to each other. In some embodiments, one or more nucleic acid bases are present between the first antisense sequence and the second antisense sequence. In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, or more) nucleic acid bases at the 3'-end of the first antisense sequence are complementary to one or more (e.g., 1, 2, 3, 4, 5, or more) nucleic acid bases at the 3'-end of the second target region, and / or one or more (e.g., 1, 2, 3, 4, 5, or more) nucleic acid bases at the 5'-end of the second antisense sequence are complementary to one or more (e.g., 1, 2, 3, 4, 5, or more) nucleic acid bases at the 5'-end of the first target region. In some embodiments, a spacer is present between the first antisense sequence and the second antisense sequence. In some embodiments, the spacer is a C3 spacer (e.g., the C3 spacer shown in Table 16). In some embodiments, the spacer is a C6 spacer (e.g., the C6 spacer shown in Table 16).

[0014] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid base sequence of SEQ ID NO: 194 and a second antisense sequence containing the nucleic acid base sequence of SEQ ID NO: 253, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0015] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence of SEQ ID NO: 194 and a second antisense sequence containing the nucleic acid sequence of SEQ ID NO: 253, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0016] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence comprising the nucleic acid base sequence of SEQ ID NO: 497 and a second antisense sequence comprising the nucleic acid base sequence of SEQ ID NO: 249, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0017] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence of SEQ ID NO: 506 and a second antisense sequence containing the nucleic acid sequence of SEQ ID NO: 259, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0018] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence of SEQ ID NO: 246, and a second antisense sequence containing the nucleic acid sequence of SEQ ID NO: 246, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0019] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 198 and a second antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 253, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0020] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence of GAATCTA and a second antisense sequence containing the nucleic acid sequence of Sequence ID No. 246, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0021] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence of GAATCTA and a second antisense sequence containing the nucleic acid sequence of Sequence ID No. 246, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0022] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence of GAATCTA and a second antisense sequence containing the nucleic acid sequence of Sequence ID No. 534, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0023] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence of GAATCTA and a second antisense sequence containing the nucleic acid sequence of Sequence ID No. 534, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0024] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence GAATCTACC and a second antisense sequence containing the nucleic acid sequence SEQ ID NO: 535, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0025] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence GAATCTACC and a second antisense sequence containing the nucleic acid sequence SEQ ID NO: 535, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0026] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence comprising the nucleic acid sequence GAATCTACC and a second antisense sequence comprising the nucleic acid sequence SEQ ID NO: 264, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0027] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence GAATCTACC and a second antisense sequence containing the nucleic acid sequence SEQ ID NO: 264, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0028] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence of GAATCTAC and a second antisense sequence containing the nucleic acid sequence of SEQ ID NO: 264, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0029] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence of GAATCTAC and a second antisense sequence containing the nucleic acid sequence of SEQ ID NO: 246, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0030] In some embodiments, the antisense oligonucleotides provided herein include a first antisense sequence containing the nucleic acid sequence of GAATCTAC and a second antisense sequence containing the nucleic acid sequence of SEQ ID NO: 246, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0031] In some embodiments, the antisense oligonucleotides provided herein include one nucleic acid sequence from SEQ ID NOs: 1-190 and 338-494. In some embodiments, the antisense oligonucleotides provided herein include one nucleic acid sequence from SEQ ID NOs: 1-182, 184-190, 338-434, and 442-494.

[0032] In some embodiments, the antisense oligonucleotides provided herein comprise one or more modified nucleosides. In some embodiments, the one or more modified nucleosides comprise non-bicyclic 2'-modified nucleosides, 2'-4'-bridged nucleosides, or a combination thereof. In some embodiments, each nucleoside of the antisense oligonucleotide is a modified nucleoside.

[0033] In some embodiments, the non-bicyclic 2'-modified nucleoside is a 2'-O-methoxyethyl (2'-MOE) modified nucleoside, a 2'-ON-methylacetamide (2'-O-NMA) modified nucleoside, a 2'-O-methyl (2'-O-Me) modified nucleoside, or a 2'-fluoro (2'-F) modified nucleoside, and / or the 2'-4' crosslinked nucleoside is a locked nucleic acid (LNA, 2'-4' methylene crosslinked), an ethylene crosslinked nucleic acid (ENA, 2'-4' ethylene crosslinked), a restricted ethyl nucleic acid (cEt, 2'-4' ethylene crosslinked), a 2'-O,4'-C-spirocyclopropylene crosslinked nucleic acid (scpBNA), an amide crosslinked nucleic acid (AmNA), or a 2'-O,4'-C-aminomethylene crosslinked nucleic acid (BNA(NC)). In some embodiments, the antisense oligonucleotide comprises one or more 2'-MOE modified nucleosides and one or more LNAs. In some embodiments, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside. In some embodiments, the antisense oligonucleotide comprises one or more modified nucleosides selected from ENA, scpBNA, 2'-O-NMA, AmNA, and BNA(NC). In some embodiments, each nucleoside of the antisense oligonucleotide is a modified nucleoside, and the antisense oligonucleotide comprises one or more modified nucleosides selected from ENA, scpBNA, 2'-O-NMA, AmNA, and BNA(NC), with the remaining modified nucleosides being 2'-MOE modified nucleosides, LNAs, or a mixture of 2'-MOE modified nucleosides and LNAs.

[0034] In some embodiments, the antisense oligonucleotides provided herein include one or more modified nucleoside linkages. In some embodiments, each nucleoside linkage of the oligonucleotide is a modified nucleoside linkage. In some embodiments, the modified nucleoside linkage is a phosphorothioate linkage. In some embodiments, each nucleoside linkage of the oligonucleotide is a phosphorothioate linkage. In some embodiments, the antisense oligonucleotide includes a mixture of phosphodiester linkages and phosphorothioate linkages.

[0035] In some embodiments, the antisense oligonucleotide is a phosphorodiamidate oligomer (PMO).

[0036] In some embodiments, each cytosine in the oligonucleotide is not 5-methylcytosine. In some embodiments, each cytosine in the oligonucleotide is 5-methylcytosine. In some embodiments, one or more cytosines in the oligonucleotide are 5-methylcytosine.

[0037] In some embodiments, the antisense oligonucleotide is linked to a lipid. In some embodiments, the lipid is a C16 lipid. In some embodiments, the C16 lipid is linked to the 5' nucleoside of the antisense strand via a DNA linker. In some embodiments, the DNA linker is a phosphodiester d(TCA) linker, and the linkage between each nucleoside is a phosphodiester linkage.

[0038] In some embodiments, the antisense oligonucleotides provided herein include the structures provided in Table 5. In some embodiments, the antisense oligonucleotides provided herein include the structures provided in Table 11. In some embodiments, the antisense oligonucleotides provided herein include one of the structures of ASO1-331 or 350-814. In some embodiments, the antisense oligonucleotides provided herein include one of the structures of SEQ ID NOs. 569-925, 927-957, 960-970, 973-1039, 1042-1165, 1170-1350, and 1355-1362. In some embodiments, the antisense oligonucleotides provided herein include one of the structures of ASO407, 408, 420, 488, 613, 614, and 796-806. In some embodiments, the antisense oligonucleotides provided herein include any one of the structures of SEQ ID NOs: 569-880, 882-925, 927-957, 960-970, 973-1039, 1042-1155, 1165, 1170-1350, 1355-1362, and ASO407, 408, 420, 488, 613, 614, and 796-806. In some embodiments, the antisense oligonucleotide inhibits the inclusion of UNC13A hidden exons in mature UNC13A mRNA. In some embodiments, the antisense oligonucleotide induces a secondary structure between a first target region and a second target region of UNC13A premRNA.

[0039] In some embodiments, the antisense oligonucleotide has the following structure: [iTs][iGs][iTs][iTs][i 5 Cs][iAs][iAs][iTs][i 5 Cs][iAs][iTs][iTs][i 5 Cs][iGs][iGs][iGs][iAs][iTs][iAs][iAs][iG][iA][iG][iT][iTs][i 5 Includes C] (Sequence ID 569), iA, iG, i 5C, and iT are 2'-O-methoxyethyl (2'-MOE) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, s is a phosphorothioate internucleoside linkage, and the absence of s between two nucleosides indicates a phosphodiester internucleoside linkage.

[0040] In some embodiments, the antisense oligonucleotide has the following structure: [iTs][iGs][iTs][iTs][i 5 Cs][iAs][iAs][iTs][i 5 Cs][iAs][iTs][iTs][i 5 Cs][iGs][iGs][iGs][iAs][iTs][iAs][iAs][iGs][iA][iG][iT][iTs][i 5 C] (SEQ ID NO: 570), where iA, iG, i 5 C, and iT are 2'-O-methoxyethyl (2'-MOE) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, s is a phosphorothioate internucleoside linkage, and the absence of s between two nucleosides indicates a phosphodiester internucleoside linkage.

[0041] In some embodiments, the antisense oligonucleotide has the following structure: [i 5 Cs][iGs][iAs][iAs][iTs][i 5 Cs][iTs][iAs][i 5 Cs][i 5 Cs][i 5 Cs][iAs][i 5 Cs][iAs][iTs][i 5 Cs][iTs][iGs][iTs][iTs][i 5 Cs][iAs][iAs][iTs][i 5 Cs][iA] (SEQ ID NO: 571), where iA, iG, i 5C, and iT are 2'-O-methoxyethyl (2'-MOE) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively; s is a phosphorothioate nucleoside linkage.

[0042] In some embodiments, the antisense oligonucleotide has the following structure: [iTs][iG][iT][iTs][i 5 Cs][iAs][iAs][iTs][i 5 Cs][iAs][iTs][iTs][i 5 Cs][iGs][iGs][iGs][iAs][iTs][iAs][iAs][iGs][iAs][iG][iT][iTs][i 5 Includes C] (Sequence ID 572), iA, iG, i 5 C and iT are 2'-O-methoxyethyl (2'-MOE) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, s is a phosphorothioate nucleoside linkage, and the absence of s between two nucleosides indicates a phosphodiester nucleoside linkage.

[0043] In some embodiments, the antisense oligonucleotide has the following structure: [iTs][iG][iT][iT][i 5 Cs][iAs][iAs][iTs][i 5 Cs][iAs][iTs][iTs][i 5 Cs][iGs][iGs][iGs][iAs][iTs][iAs][iAs][iGs][iA][iG][iT][iTs][i 5 Includes C] (Sequence ID 573), iA, iG, i 5 C and iT are 2'-O-methoxyethyl (2'-MOE) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, s is a phosphorothioate nucleoside linkage, and the absence of s between two nucleosides indicates a phosphodiester nucleoside linkage.

[0044] In some embodiments, the antisense oligonucleotide has the following structure:

[0045] [ka] Including nmaA, nmaG, nma 5 C and nmaT are 2'O-NMA modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, s is a phosphorothioate nucleoside linkage, and the absence of s between two nucleosides indicates a phosphodiester nucleoside linkage.

[0046] In some embodiments, the antisense oligonucleotide has the following structure:

[0047] [ka] Including nmaA, nmaG, nma 5 C and nmaT are 2'O-NMA modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, and s is a phosphorothioate nucleoside linkage.

[0048] In some embodiments, the antisense oligonucleotide has the following structure:

[0049] [ka] Including nmaA, nmaG, nma 5 C and nmaT are 2'O-NMA modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, and s is a phosphorothioate nucleoside linkage.

[0050] In some embodiments, the antisense oligonucleotide has the following structure: [lGs][nmaAs][nmaAs][nmaTs][nma 5 Cs][nmaTs][nmaAs][nma 5Cs][nma 5 Cs][nmaAs][nmaTs][nma 5 Cs][nma 5 Cs][nmaAs][nmaTs][nmaGs][nmaTs][nmaAs][nma 5 Includes Cs][lT] (Sequence ID 1355), lA, lG, l 5 C and lT are 2'-4'-methylene cross-linked (LNA) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, nmaA, nmaG, nma 5 C and nmaT are 2'O-NMA modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, and s is a phosphorothioate nucleoside linkage.

[0051] In some embodiments, the antisense oligonucleotide has the following structure: [lGs][nmaAs][nmaAs][nmaTs][nma 5 Cs][nmaTs][nmaAs][nma 5 Cs][nma 5 Cs][nma 5 Cs][nmaAs][nmaTs][nma 5 Cs][nma 5 Cs][nmaAs][nmaTs][nmaGs][nmaTs][nmaAs][nma 5 Includes Cs][lT] (Sequence ID 1356), lA, lG, l 5 C and lT are 2'-4'-methylene cross-linked (LNA) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, nmaA, nmaG, nma 5 C and nmaT are 2'O-NMA modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, and s is a phosphorothioate nucleoside linkage.

[0052] In some embodiments, the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt.

[0053] Some aspects of this disclosure provide compositions comprising antisense oligonucleotides provided herein. In some embodiments, the compositions provided herein further comprise a pharmaceutically acceptable carrier.

[0054] Some aspects of this disclosure provide a method for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in cells, the method comprising contacting cells with an antisense oligonucleotide or composition provided herein.

[0055] Some aspects of this disclosure provide a method for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in cells of interest, comprising administering an antisense oligonucleotide or composition provided herein to the subject. In some embodiments, the method comprises administering a therapeutically effective amount of the antisense oligonucleotide or composition provided herein to the subject. In some embodiments, the subject exhibits decreased expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject is human. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutations include rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0056] Some aspects of this disclosure provide a method for treating a disease associated with abnormal UNC13A expression in a subject, comprising administering an antisense oligonucleotide or composition provided herein to the subject. In some embodiments, the method comprises administering a therapeutically effective amount of an antisense oligonucleotide or composition provided herein to the subject. In some embodiments, the disease is a neurodegenerative disease. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the neurodegenerative disease is frontotemporal dementia (FTD). In some embodiments, the neurodegenerative disease is Alzheimer's disease. In some embodiments, the neurodegenerative disease is limbic-dominant age-related TDP-43 encephalopathy (LATE). In some embodiments, the subject is human. In some embodiments, the subject exhibits decreased expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have a SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0057] Some aspects of this disclosure provide a method for treating a disease associated with TDP-43 dysfunction in a subject, comprising administering an antisense oligonucleotide or composition provided herein to the subject. In some embodiments, the method comprises administering a therapeutically effective amount of an antisense oligonucleotide or composition provided herein to the subject. In some embodiments, the disease is a neurodegenerative disease. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the neurodegenerative disease is frontotemporal dementia (FTD). In some embodiments, the neurodegenerative disease is Alzheimer's disease. In some embodiments, the neurodegenerative disease is limbic-dominant age-related TDP-43 encephalopathy (LATE). In some embodiments, the subject is human. In some embodiments, the subject exhibits decreased expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have a SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0058] Some aspects of this disclosure provide pharmaceutical compositions for use in methods for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in target cells, comprising antisense oligonucleotides provided herein. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of antisense oligonucleotides provided herein. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the subject is human. In some embodiments, the subject exhibits decreased expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutations include rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0059] Some aspects of this disclosure provide pharmaceutical compositions for use in methods for treating diseases associated with abnormal UNC13A expression in subjects, comprising antisense oligonucleotides provided herein. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of antisense oligonucleotides provided herein. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the subject is human. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutations include rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0060] Some aspects of this disclosure provide pharmaceutical compositions for use in methods for treating diseases associated with TDP-43 dysfunction in subjects, comprising antisense oligonucleotides provided herein. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of antisense oligonucleotides provided herein. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the subject is human. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutations include rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0061] Some aspects of this disclosure provide antisense oligonucleotides for use in a method for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in cells of interest, the method comprising administering the antisense oligonucleotides provided herein to the subject. In some embodiments, the method comprises administering an effective amount of the antisense oligonucleotides provided herein to the subject. In some embodiments, the subject is human. In some embodiments, the subject exhibits decreased expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutations include rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0062] Some aspects of this disclosure provide antisense oligonucleotides for use as pharmaceuticals. In some embodiments, the pharmaceuticals are administered to a subject. In some embodiments, the subject is human. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0063] Some aspects of this disclosure provide antisense oligonucleotides for use in a method for treating a disease associated with abnormal UNC13A expression in a subject, the method comprising administering the antisense oligonucleotides provided herein to the subject. In some embodiments, the method comprises administering an effective amount of the antisense oligonucleotides provided herein to the subject. In some embodiments, the subject is human. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutations include rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0064] Some aspects of this disclosure provide antisense oligonucleotides for use in a method for treating a disease associated with TDP-43 dysfunction in a subject, the method comprising administering the antisense oligonucleotides provided herein to the subject. In some embodiments, the method comprises administering an effective amount of the antisense oligonucleotides provided herein to the subject. In some embodiments, the subject is human. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutations include rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0065] Some aspects of this disclosure provide the use of antisense oligonucleotides provided herein for the production of agents for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or for restoring UNC13A expression in target cells. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the subject is human. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutations include rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0066] Some aspects of this disclosure provide the use of antisense oligonucleotides provided herein for the manufacture of agents for treating diseases associated with abnormal UNC13A expression in subjects. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the subject is human. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0067] Some aspects of this disclosure provide the use of antisense oligonucleotides provided herein for the manufacture of agents for treating diseases associated with TDP-43 dysfunction in subjects. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the subject is human. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof. [Modes for carrying out the invention]

[0068] In general, the nomenclature used in relation to cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry, as well as hybridization, as described herein, is well known and commonly used in the art. Certain methods and techniques provided herein are generally carried out in accordance with methods well known in the art, and, unless otherwise indicated, as described in the various basic and more specific references cited and described throughout this specification. Enzyme reactions and purification techniques are carried out in accordance with the manufacturer's specifications, as commonly achieved in the art, or as otherwise described herein. The nomenclature, laboratory procedures, and techniques of analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are well known and commonly used in the art. Standard techniques are used in chemical synthesis, chemical analysis, drug preparation, formulation, delivery, and patient treatment.

[0069] Any gene therapies available in the art can be used in the methods provided herein. For a basic review of gene therapy, see Goldspiel et al. (1993) Clin. Pharmacy 12:488-505; Wu and Wu (1991) Biotherapy 3:87-95; Tolstoshev (1993) Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan (1993) Science 260:926-932; Morgan and Anderson (1993) Ann. Rev. Biochem. 62:191-217; and May (1993) TIBTECH 11(5):155-215. Methods that are generally known and usable in the field of recombinant DNA technology are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990). A detailed description of various gene therapy methods is disclosed in U.S. Patent Application Publication No. US20050042664.

[0070] definition To facilitate a more readily understandable understanding of this disclosure, certain terms are defined first. Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure have the meanings generally understood by those skilled in the art. The meaning and scope of terms should be clear, but in the event of any potential ambiguity, the definitions provided herein shall prevail over any dictionary or external definitions. Unless otherwise required by circumstances, singular terms include plurals, and plural terms include singulars. The use of “or” means “and / or” unless otherwise stated. The use of the term “including,” and other forms of this term, is not limited.

[0071] In addition, it should be noted that if parameter values ​​or ranges of values ​​are enumerated, intermediate values ​​and ranges of the enumerated values ​​are also intended to be part of this disclosure.

[0072] Where used herein, the singular forms “a,” “an,” and “the” include multiple referents unless the context clearly indicates otherwise. Where used herein, “and” is synonymous with “or” unless expressly otherwise stated. The terms “comprising,” “having,” “including,” and “containing” should be interpreted as open-ended terms (i.e., “including, but not limited to”) unless otherwise specified herein. Where used herein, the enumeration of value ranges is intended merely as a concise way of referring individually to each individual value enumerated or within its range, unless otherwise indicated herein, and each individual value is incorporated herein as if it were enumerated individually.

[0073] The terms “about” or “approximately” applied to one or more values ​​provided herein refer to values ​​similar to the reference values ​​described. In some embodiments, unless otherwise stated or evident from the context, the terms “about” or “approximately” refer to a range of values ​​that fall within or include 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) of the reference values ​​described. In some embodiments, “about” or “approximately” can be understood as about twice the standard deviation from the mean. In some embodiments, “about” or “approximately” means up to and including ±10% (e.g., ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, ±1%, or less). In some embodiments, “about” or “approximately” means ±5%. When "about" or "approximately" precedes a series of numbers or a range, it is understood that it can modify each of the numbers in that series or range.

[0074] The terms “administer” or “administer of” mean, as used herein, to provide an agonist, such as an antisense oligonucleotide, to a target. In some embodiments, “administer” or “administer of” means to provide an antisense oligonucleotide to a target in a physiologically and / or pharmacologically useful manner (e.g., to treat a condition of a target). Non-limiting examples of routes of administration include intravenous, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-articular, synovial, intrathecal, or intraventricular routes. In some embodiments, the route of administration is an intrathecal or intraventricular route. In some embodiments, the route of administration is intrathecal. In some embodiments, the route of administration is intraventricular. In some embodiments, the route of administration is subcutaneous.

[0075] The term “antisense oligonucleotide (ASO)” as used herein refers to a single-stranded oligonucleotide, each comprising at least a portion of a target sequence (e.g., a gene sequence, a premRNA sequence, or an mRNA sequence), such as a target region, and comprising one or more (e.g., 1, 2, or more) complementary regions capable of hybridizing with the target region, and capable of modulating the processing of the transcript of the target gene and / or the expression of the target gene (e.g., at the mRNA and / or protein level). In some embodiments, the target region of the target nucleotide sequence may have at least 8 nucleoside lengths, such as 8, 9, 10, 11, 12, 13, 14, 15, or longer.

[0076] In some embodiments, the antisense oligonucleotides disclosed herein modulate the splicing of UNC13A premRNA. In some embodiments, the antisense oligonucleotides disclosed herein modulate the splicing of a UNC13A hidden exon present in UNC13A premRNA (e.g., a hidden exon in intron 20 of UNC13A premRNA). In some embodiments, splicing modulation of UNC13A premRNA and / or a UNC13A hidden exon present in UNC13A premRNA results in modulation of UNC13A gene expression (e.g., at the mRNA and / or protein level).

[0077] In some embodiments, the antisense oligonucleotides disclosed herein target two target regions of a target sequence (e.g., a gene sequence, a premRNA sequence, or an mRNA sequence). In some embodiments, the antisense oligonucleotides disclosed herein target two target regions of a UNC13A sequence (e.g., a gene sequence or a premRNA sequence). In some embodiments, two target regions of a UNC13A sequence (e.g., a gene sequence or premRNA sequence) have 0 to 200 nucleic acid bases between them (e.g., 0 to 200, 0 to 150, 0 to 100, 0 to 50, 0 to 20, 0 to 10, 0 to 5, 5 to 200, 5 to 150, 5 to 100, 5 to 50, 5 to 20, 5 to 10, 10 to 200, 10 to 150, 10 to 100, 10 to 50, 10 to 20, 20 to 200, 20 to 150, 20 to 100, 20 to 50, 50 to 200, 50 to 150, 50 to 100, 100 to 200, 100 to 150, or 150 to 200 nucleic acid bases).

[0078] In some embodiments, the antisense oligonucleotide comprises a first antisense sequence and a second antisense sequence, each targeting one of two target regions of a target sequence (e.g., a gene sequence, a pre-mRNA sequence, or an mRNA sequence). In some embodiments, the antisense oligonucleotide comprises a first antisense sequence and a second antisense sequence, each targeting one of two target regions of a UNC13A sequence (e.g., a gene sequence or a pre-mRNA sequence). In some embodiments, the first antisense sequence is directly adjacent to the second antisense sequence (i.e., there are no nucleic acid bases between them). In some embodiments, one or more nucleic acid bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) are present between the first antisense sequence and the second antisense sequence.

[0079] For the purposes of this disclosure, in the antisense oligonucleotides disclosed herein, the first antisense sequence is located at the 5' end of the antisense oligonucleotide, and the second antisense sequence is located at the 3' end of the antisense oligonucleotide. Furthermore, in the antisense oligonucleotides disclosed herein, the first antisense sequence targets a first target region of a target sequence (e.g., UNC13A premRNA), and the second antisense sequence targets a second target region of the target sequence (e.g., UNC13A premRNA). Therefore, the first target region is 3' to the second target region of the target sequence (e.g., UNC13A premRNA), and the second target region is 5' to the first target region of the target sequence (e.g., UNC13A premRNA).

[0080] The term “at least” preceding a number or range of numbers is understood to include the number adjacent to the term “at least,” and all subsequent numbers or integers that may logically be included as is evident from the context. For example, the number of nucleotides or nucleosides in a nucleic acid molecule must be an integer. For example, “at least 19 nucleosides in a nucleic acid molecule with 21 nucleotides” means that 19, 20, or 21 nucleosides have the characteristic of the notation. When “at least” is present before a range of numbers, it is understood that “at least” can modify each of the numbers in the range of numbers.

[0081] The term "amyotrophic lateral sclerosis (ALS)" or "ALS," as used herein, refers to a neurodegenerative disease characterized by progressive upper and lower motor neuron loss. Two types of this disease have been reported: sporadic ALS (sALS) and familial ALS (fALS). sALS is the most common form of ALS, accounting for approximately 90% of all ALS cases, while fALS is rarer and is hereditary, occurring within families over several generations. Both forms of ALS show rapid clinical deterioration after the onset of the disease, often leading to death within a few years due to respiratory failure. The exact cause of ALS is unknown, and there is no known cure.

[0082] The term “frontotemporal dementia” or “FTD,” as used herein, refers to a progressive neurodegenerative disease in humans that has been found to overlap significantly with ALS at clinical, genetic, and pathological levels. (Burrell JR, Halliday GM, Kril JJ, et al. The frontotemporal dementia-motor neuron disease continuum. Lancet. 2016;388(10047):919-931.) FTD is characterized by damage to neurons in the frontal and temporal lobes of the brain. Three types of the disease have been reported: behavioral variant frontotemporal dementia (bvFTD), primary progressive aphasia (PPA), and motor impairment, with bvFTD being the most common and involving changes in personality, behavior, and judgment. Some patients suffer from both frontotemporal dementia and ALS. Thus, these diseases lie on a single molecular and clinical spectrum. The exact cause of FTD is unknown, and there is no known cure.

[0083] While the causes of ALS and FTD are generally known, single nucleotide polymorphisms (SNPs) in UNC13A, such as intronic SNPs, have been shown to increase the risk of ALS and FTD. In some cases, SNPs increase cryptic splicing and alter the direct binding affinity of the RNA-binding protein TDP-43, thereby reducing TDP-43's ability to suppress the inclusion of hidden exons in UNC13A during RNA splicing. TDP-43 dysfunction has been shown to result in the inclusion of hidden exons in UNC13A mRNA. The inclusion of hidden exons in mature UNC13A mRNA leads to reduced UNC13A protein expression due to abnormal RNA degradation or the presence of premature stop codons. In some embodiments, the antisense oligonucleotides disclosed herein inhibit the inclusion of UNC13A hidden exons in mature UNC13A mRNA and / or restore UNC13A expression in target cells having ALS or FTD.

[0084] As used herein, the term “Alzheimer’s disease” refers to a progressive degenerative brain disease and the most common form of dementia. Alzheimer’s disease is associated with the abnormal accumulation of amyloid-beta (Aβ) plaques and neurofibrillary tangles of tau protein aggregates. Alzheimer’s disease is characterized by a progressive pattern of cognitive and functional impairment. TDP-43 pathology also plays a role in the progression of Alzheimer’s disease. Meneses et al., TDP-43 Pathology in Alzheimer’s Disease. Mol Neurodegener. 2021 Dec 20;16(1):84. Currently, there is no known cure for Alzheimer’s disease.

[0085] The term “Limbic-predominant age-related TDP-43 encephalopathy” or “LATE,” as used herein, refers to a late-onset neurodegenerative disorder characterized by amnesic dementia similar to Alzheimer’s disease. LATE typically affects individuals aged 80 years or older. LATE is characterized by TDP-43 inclusions prominently present in the limbic regions of the brain, including the amygdala and hippocampus. (Nelson et al., Limbic-predominant age-related TDP-43 encephalopathy (LATE): consensus working group report, Brain, Volume 142, Issue 6, June 2019, Pages 1503-1527). Currently, there is no known cure for LATE.

[0086] The term "biological activity" refers to any biological properties of a molecule, whether naturally occurring in vivo or provided or made possible by recombinant means. Examples of biological activity include, but are not limited to, receptor binding, induction of cell proliferation, inhibition of cell growth, induction of other cytokines, induction of apoptosis, and enzymatic activity.

[0087] In the context of oligonucleotides, the term "consecutive" refers to nucleosides, nucleic acid bases, sugar moieties, or nucleoside linkages that are directly adjacent to each other. For example, "consecutive nucleic acid bases" means nucleic acid bases that are directly adjacent to each other in sequence.

[0088] The term “complementary,” as used herein, refers to the ability of two nucleic acid bases or two nucleic acid sequences to pair. In particular, complementarity is a term that characterizes the degree of hydrogen bond pairing that results in binding between two nucleic acid bases or two nucleic acid sequences. For example, if a base at one position in a nucleic acid sequence (e.g., an antisense oligonucleotide as described herein) can hydrogen bond with a base at a corresponding position in another nucleic acid sequence (e.g., a target gene sequence, pre-mRNA sequence, or mRNA sequence), then the bases are considered complementary at that position. A nucleic acid molecule whose nucleic acid sequences are complementary (e.g., an antisense oligonucleotide) may contain one or more modified nucleosides and modified nucleoside linkages. A nucleic acid molecule whose nucleic acid sequences are complementary (e.g., an antisense oligonucleotide and a target sequence) may also contain nucleic acid base analogs that result in a non-complementary base at a particular position, but the nucleic acid sequences of the two molecules must be sufficiently complementary over their entire length to produce the desired biological activity (e.g., modulation of gene expression).

[0089] Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs (e.g., fluctuation base pairs (e.g., GU / T, AG) and Hoogsteen base pairs), and may include natural or modified nucleosides or nucleoside mimetic compounds. For example, in some embodiments, in the case of complementary base pairing, an adenosine base (A) is complementary to a thymidine base (T) or a uracil base (U), a cytosine base (C) is complementary to a guanosine base (G), and a universal base such as 3-nitropyrrole or 5-nitroindole can hybridize with any of A, C, U, or T and is considered complementary. Inosine (I) is also considered a universal base in the art and is considered complementary to any of A, C, U, or T.

[0090] Complementarity is independent of sugar modifications to the nucleoside. For example, 2'-modification A, as defined herein, is complementary to U (or T) and identical to A for the purpose of determining identity or complementarity.

[0091] The terms "perfectly complementary" or "completely complementary" mean that all (100%) of the nucleic acid bases, nucleosides, or nucleotides in the contiguous sequence of the first nucleotide sequence (e.g., an antisense oligonucleotide) will hybridize with the same number of nucleic acid bases, nucleosides, or nucleotides in the contiguous sequence of the second nucleotide sequence (e.g., a target sequence such as UNC13A premRNA). The contiguous sequence may contain all or part of the first or second nucleotide sequence. The terms "partially complementary" mean that in a hybridize pair of nucleic acid bases, nucleosides, or nucleotide sequences, at least 70% (but not all) of the bases in the contiguous sequence of the first nucleotide sequence (e.g., an antisense oligonucleotide) will hybridize with the same number of bases in the contiguous sequence of the second nucleotide sequence (e.g., a target sequence such as UNC13A premRNA). The terms “sufficiently complementary” or “substantially complementary” mean that in a hybridize pair of nucleic acid bases, nucleosides, or nucleotide sequences, at least 85% of, though not all, of the bases in the contiguous sequence of the first nucleotide sequence (e.g., an antisense oligonucleotide) will hybridize with the same number of bases in the contiguous sequence of the second nucleotide sequence (e.g., a target sequence such as UNC13A premRNA). The terms “complementary,” “fully complementary,” “partially complementary,” and “sufficiently / substantially complementary” are used herein in reference to the matching of nucleic acid bases, nucleosides, or nucleotides between an antisense oligonucleotide and a target sequence (e.g., UNC13A premRNA).

[0092] When referring to a substance, the terms “control” or “reference” mean a composition used as a baseline or point of comparison when measuring other test results. In some embodiments, the “control” or “reference” is a composition known to not contain the analyte (“negative control”) or a composition known to contain the analyte (“positive control”). The positive control may contain a known concentration of the analyte. The terms “control” and “positive control” can be used to refer to a composition containing a known concentration of the analyte. The “positive control” can be used to establish assay performance characteristics and is a useful indicator of the integrity of the reagent (e.g., the analyte). In some embodiments, a suitable “control” or “reference” is one in which only one element is modified to determine the effect of that element. In some embodiments, the control is the level of the target gene (e.g., intracellular or intrasubject) before treatment (e.g., by antisense oligonucleotides as described herein).

[0093] The terms “control” or “reference” also mean a baseline level of measurement, depending on the context in which the terms are used. A baseline level of measurement is a reference or point of comparison for comparing measurements. In some embodiments, “control” or “reference” refers to a level of measured value of a particular biological activity or substance in a cell, tissue, organ, or subject without treating the cell, tissue, organ, or subject with an agonist (e.g., an antisense oligonucleotide), e.g., gene expression level, copy number of mRNA of such gene, or level of protein encoded by such gene. In some embodiments, “control” or “reference” refers to a level of mean measured value of a particular biological activity or substance in a cell, tissue, organ, or subject (e.g., a particular enzyme activity in the liver) in a group of healthy subjects (e.g., within a general population within certain geographical or demographic limitations, or within any other limitations that may be appropriate for the study of a particular disease or disorder) that does not have a particular disease or disorder (e.g., liver disease).

[0094] The term "reference" may also be used in the context of "reference sequence." The term "reference sequence" refers to a sequence used as a criterion for sequence comparison, such as a nucleic acid sequence or an amino acid sequence. In certain embodiments, the reference sequence is an RNA sequence that forms the basis for the design of an antisense oligonucleotide, such as a human UNC13A premRNA sequence.

[0095] The term "cross-reactivity" refers to the ability of a binding molecule (e.g., an antisense oligonucleotide) to bind to a target molecule (e.g., a gene sequence, premRNA sequence, or mRNA sequence) other than the one it was designed or produced for. For example, a binding molecule may be able to specifically bind to more target molecules of a similar type or class (e.g., mRNA variants or mRNA homologs from closely related species) with similar affinity. Generally, a binding molecule will bind to its target molecule with sufficiently high affinity, but may also bind to the same target molecule in a different species, or exhibit low affinity to non-target molecules. In some embodiments, an antisense oligonucleotide that is cross-reactive to human and non-human primate UNC13A contains a complementary region to the human and non-human primate UNC13A gene sequence, premRNA sequence, or mRNA sequence. Individual binding molecules are generally selected to meet two criteria: (1) tissue staining appropriate for known expression of the target, or (2) similar staining patterns between human tissue and toxicological species (mouse and cynomolgus monkey) tissue from the same organ. Methods for evaluating cross-reactivity, as well as other methods, are known to those skilled in the art.

[0096] The terms “effective dose” or “therapeutic effective dose,” as used herein, refer to the amount of antisense oligonucleotide that produces a molecular (e.g., reducing the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in the subject), biological, pharmacological, therapeutic (e.g., treatment of UNC13A-related disease or a disease associated with TDP-43 dysfunction in the subject), or prophylactic outcome. The dose administered will likely depend on variables such as the patient’s overall health, the relative biological efficacy of the compound being delivered, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. It should also be understood that the initial dose administered may, in some cases, be increased beyond the upper limit levels above to rapidly achieve the desired blood or tissue concentration, or the initial dose may, in some cases, be less than the optimal value.

[0097] The terms "hybridize" and "hybridization" refer to the pairing of complementary compounds (e.g., antisense oligonucleotides and their target nucleic acids). While not limited to specific mechanisms, the most common pairing mechanisms involve hydrogen bonding between complementary nucleic acid bases, which may include Watson-Crick hydrogen bonds, fluctuating hydrogen bonds, Hoogsteen hydrogen bonds, or reverse Hoogsteen hydrogen bonds.

[0098] As used herein, the term "nucleoside linkage" means a covalent linkage between adjacent nucleosides of an oligonucleotide (e.g., an antisense oligonucleotide as described herein). The nucleoside linkage may be a natural phosphodiester nucleoside linkage or a modified (non-natural) nucleoside linkage. Modified internucleoside linkages that can be used in antisense oligonucleotides disclosed herein include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, 3'-aminophosphoramides and aminoalkyl phosphoramides, mesylphosphoramides, phosphoramides including thionophosphoramides, thionoalkyl phosphonates, thionoalkyl phosphotriesters, and boranophosphates having the usual 3'-5' linkage, their 2'-5' linked analogues, and those having inverted polarity in which adjacent pairs of nucleoside units are linked from 3'-5' to 5'-3' or 2'-5' to 5'-2'. U.S. Patent No. 3,687,808; No. 4,469,863; No. 4,476,301; No. 5,023,243; No. 5,177,196; No. 5,188,897; No. 5,264,423; No. 5,276,019; No. 5,278,302; No. 5,286,717; No. 5,321,131; No. 5,399,676; No. 5,405,939 See specifications No. 5,453,496; No. 5,455,233; No. 5,466,677; No. 5,476,925; No. 5,519,126; No. 5,536,821; No. 5,541,306; No. 5,550,111; No. 5,563,253; No. 5,571,799; No. 5,587,361; and No. 5,625,050.In some embodiments, in any one of the antisense oligonucleotides disclosed herein, all nucleoside linkages are stereorandom.

[0099] As used herein, the term "nucleoside" refers to a compound comprising a nucleic acid base moiety and a sugar moiety. Examples of nucleosides, but not limited to these, include natural nucleosides (found in DNA and RNA) and modified nucleosides. Nucleosides may be ligated to a phosphate moiety. The term "nucleoside" encompasses both natural nucleosides and chemically modified nucleosides (e.g., those having modifications to the base and / or sugar moieties).

[0100] As used herein, the term "nucleotide" refers to a compound comprising a nucleoside linked to a phosphate group. As used herein, "linked nucleoside" may or may not be linked by phosphate linkage and therefore includes, but is not limited to, "linked nucleotides." As used herein, "linked nucleoside" is a nucleoside linked in a continuous sequence (i.e., there are no additional nucleosides between the linked nucleosides). The term "nucleotide" encompasses both natural nucleotides and chemically modified nucleotides (e.g., those having modifications to a base, sugar moiety, and / or phosphate group).

[0101] As used herein, the term “nucleic acid base” refers to a nitrogen-containing compound that can be linked to a sugar moiety to form a nucleoside that can be incorporated into an oligonucleotide, and which can be bound to a complementary native nucleic acid base of another oligonucleotide or nucleic acid. Nucleic acid bases may be native or modified. As used herein, “native nucleic acid bases” are adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). The term “nucleic acid base” also includes 5'-methylated bases (e.g., 5'-methylcytosine or 5'-methylguanine).

[0102] The term "modified nucleoside linkage" refers to linkages between two nucleosides that are not naturally occurring phosphodiester linkages (for example, in oligonucleotides). Non-exclusive examples of modified nucleoside linkages include phosphorothioates, phosphorodiamidates, phosphotriesters, methylphosphonates, short-chain alkyl or cycloalkyl sugar linkages, or short-chain heteroatom or heterocyclic sugar linkages.

[0103] The terms “nucleoside modification” or “modified nucleoside” mean a nucleoside having one or more modifications to the nucleoside, including modifications to the nucleic acid base moiety and / or sugar moiety. Any modifications of the chemical properties or forms of nucleosides described herein can be combined with each other. Non-limiting examples of modified nucleosides include 2'-fluoro(2'-F), 2'-O-methyl(2'-O-Me), 2'-O-methoxyethyl(2'-MOE), 2'-O-aminopropyl(2'-O-AP), 2'-O-dimethylaminoethyl(2'-O-DMAOE), 2'-O-dimethylaminopropyl(2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl(2'-O-DMAEOE), 2'- Examples include ON-methylacetamide (2'-O-NMA), locked nucleic acids (LNA, methylene-bridged nucleic acids), unlocked nucleic acids (UNA), ethylene-bridged nucleic acids (ENA), 2'-O,4'-C-spirocyclopropylene-bridged nucleic acids (scpBNA), amide-bridged nucleic acids (AmNA), or 2'-O,4'-C-aminomethylene-bridged nucleic acids (BNA(NC)), and (S)-restricted ethyl-bridged nucleic acid (cEt) modified nucleosides. Further non-restrictive examples of modified nucleosides include stereochemically restricted nucleosides, debasic nucleosides, 2'-amino modified nucleosides, morpholino nucleosides, phosphoramides, nucleosides containing unnatural bases, tetrahydropyran modified nucleosides, 1,5-anhydrous hexitol modified nucleosides (HNA), cyclohexenyl modified nucleosides (CeNA), nucleosides containing phosphorothioate groups, nucleosides containing methylphosphonate groups, nucleosides containing 5'-phosphates, nucleosides containing 5'-phosphate mimetic compounds, thermally destabilized nucleosides, and glycol modified nucleosides (GNA).

[0104] The term "2'-modified nucleoside" refers to a nucleoside having a modified sugar moiety at the 2' position, meaning the sugar moiety contains at least one 2'-substituent other than H or OH. Non-limiting examples of 2'-modified nucleosides include 2'-O-methoxyethyl (2'-MOE), 2'-O-methyl (2'-O-Me), 2'-fluoro (2'-F), LNA (2'-4' methylene crosslinked), ENA (2'-4' ethylene crosslinked), or cEt (2'-4' ethylene crosslinked), 2'-deoxy, 2'-O-aminopropyl (2'-O-AP), and 2'-O-dimethylaminoethyl (2'-O-DMAOE). Examples include 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamide (2'-O-NMA), 2'-O,4'-C-spirocyclopropylene-bridged nucleic acid (scpBNA), amide-bridged nucleic acid (AmNA), or 2'-O,4'-C-aminomethylene-bridged nucleic acid (BNA(NC)) modified nucleosides. In some embodiments, any one of the 2'-modified nucleosides described herein is a high-affinity modified nucleoside, and the modified antisense oligonucleotide exhibits increased affinity to the target sequence compared to the unmodified antisense oligonucleotide. In some embodiments, at least one modified nucleoside is a 2'-modified nucleoside. In some embodiments, the 2'-modified nucleoside is a 2'-MOE modified nucleoside or LNA or a combination thereof. In some embodiments, the 2'-modified nucleoside is a 2'-MOE-modified nucleoside.

[0105] The terms “modified oligonucleotide” or “modified antisense oligonucleotide” refer to an oligonucleotide or antisense oligonucleotide comprising one or more modified nucleosides and / or one or more modified nucleoside linkages. In some embodiments, the “modified oligonucleotide” or “modified antisense oligonucleotide” comprises a mixture of modified and unmodified nucleosides, and / or a mixture of modified and unmodified nucleoside linkages. In some embodiments, each nucleoside in the “modified oligonucleotide” or “modified antisense oligonucleotide” is a modified nucleoside, and / or each nucleoside linkage in the “modified oligonucleotide” or “modified antisense oligonucleotide” is a modified nucleoside linkage.

[0106] As used herein, the term "complementary region" refers to a nucleic acid sequence (e.g., the nucleic acid sequence of an antisense oligonucleotide) that is sufficiently complementary to, for example, the corresponding nucleic acid sequence of a target nucleic acid, so that the two nucleic acid sequences can anneal to each other under physiological conditions (e.g., intracellularly). In some embodiments, the complementary region is fully complementary (e.g., 100% complementary) to the corresponding nucleic acid sequence of the target nucleic acid. In some embodiments, the complementary region is partially complementary (e.g., at least 80%, 90%, 95%, or 99% complementary) to the corresponding nucleic acid sequence of the target nucleic acid. In some embodiments, the complementary region contains 1, 2, 3, 4, or 5 mismatches compared to the corresponding nucleic acid sequence of the target nucleic acid.

[0107] As used herein, the term "sequence identity" refers to the degree to which sequences are identical (independent of chemical modifications) on a per-nucleic acid base or per-amino acid basis over a comparison window. Therefore, the "percentage of sequence identity" can be calculated by comparing two optimally aligned sequences over a comparison window, determining the number of positions where identical nucleic acid bases (e.g., A, T, C, G, I) or identical amino acid residues (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys, and Met) occur in both sequences, calculating the number of matching positions, dividing the number of matching positions by the total number of positions within the comparison window (i.e., the window size), and multiplying the result by 100. The optimal sequence alignment for aligning the range to be compared can be achieved by a computer implementation of the algorithm (GAP, BESTFIT, FASTA, and TFASTA, Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA) or by the best alignment (i.e., the one that yields the highest homology percentage across the range to be compared) generated by any of the various methods investigated and selected. Alternatively, one can refer to the BLAST family program disclosed, for example, by Altschul et al., Nucl. Acids Res. 25:3389, 1997.

[0108] When referring to the expression of a given gene (e.g., UNC13A), the term “restore” means that, in the cells, groups of cells, tissues, organs, or subjects in which the gene is transcribed, the gene expression, as measured by the level of RNA transcribed from the gene or the level of polypeptides, proteins, or protein subunits translated from the mRNA, returns to a normal level (e.g., baseline level of gene expression in subjects without UNC13A-related disease and / or abnormal UNC13A expression) when those cells, groups of cells, tissues, organs, or subjects are treated with the antisense oligonucleotides disclosed herein. In some embodiments, treatment of cells, groups of cells, tissues, organs, or subjects with the antisense oligonucleotides disclosed herein results in a recovery of the expression (e.g., protein expression and / or mRNA expression) of a target gene (e.g., UNC13A) by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% compared to a baseline level of gene expression of a control, e.g., before treatment.

[0109] When referring to TDP-43 expression, the term “reduced” means that the expression of the gene, as measured by the level of RNA transcribed from the gene, or the level of polypeptides, proteins, or protein subunits translated from mRNA in the subject from which the gene is transcribed, is reduced compared to the expression of TDP-43 in a healthy subject or a subject without UNC13A-related disease (e.g., ALS, FTD, Alzheimer's disease, or LATE). For example, a subject described herein in which the expression of the TDP-43 gene or protein is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% shows reduced TDP-43 expression compared to the expression of TDP-43 in a subject without UNC13A-related disease (e.g., ALS, FTD, Alzheimer's disease, or LATE). The expression of the TDP-43 gene or protein can be measured by the level of RNA transcribed from the gene, or the level of polypeptides, proteins, or protein subunits translated from mRNA, in the target to which the gene is transcribed.

[0110] The term "single nucleotide polymorphism" or "SNP" refers to a genetic variation caused by a change in a single nucleic acid base. While not bound by any particular theory, SNPs in UNC13A (e.g., intronic SNPs) typically increase cryptic splicing and alter the direct binding affinity of the RNA-binding protein TDP-43, thereby reducing TDP-43's ability to suppress the inclusion of hidden exons in UNC13A during RNA splicing. SNPs can be associated with one or more diseases and can serve as genetic biomarkers for one or more diseases. For example, SNPs can be used to predict drug exposure or therapeutic efficacy in a subject. Non-limiting examples of SNPs associated with ALS include rs12608932, rs12973192, rs56041637, rs116169349, and rs62121687.

[0111] The term "subject" as used herein refers to a mammal. In some embodiments, the subject is a non-human primate or rodent. In some embodiments, the subject is a human. In some embodiments, the subject is a patient, e.g., a human patient who has or is suspected of having a disease. In some embodiments, the subject is a human patient who has or is suspected of having a UNC13A-related disease (e.g., a disease associated with abnormal UNC13A expression) and / or a disease associated with TDP-43 dysfunction in the subject. In some embodiments, the disease associated with UNC13A-related disease and / or TDP-43 dysfunction in the subject is a neurodegenerative disease (e.g., amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, or limbic-dominant age-related TDP-43 encephalopathy (LATE)). In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject does not have an SOD-1 gene mutation. SOD-1 gene mutations are described, for example, in Miller et al., N Engl J Med 2022;387:1099-110 and Ruffo et at., Genes 2022, 13, 537. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0112] The term "specificity" refers to the ability of a cell to inhibit a target RNA without apparent effects on other genes in the cell. The consequences of inhibition can be confirmed by examining the external characteristics of the cell or organism, or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring by microarrays, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence-activated cell analysis (FACS).

[0113] As used herein, the term “symptom” refers to any sign or indication of an underlying disease. A symptom may also be any biochemical, cellular, genetic, histological, and / or physiological observation, measurement, and / or test result in a subject that deviates from a control or reference. For example, a symptom may be an elevated level of a liver enzyme, such as aminotransferase, compared to a normal reference range.

[0114] The term “target sequence,” as used herein, refers to a nucleoside sequence whose expression or activity is modulated. In some embodiments, the target sequence is a nucleoside sequence of a gene, a nucleoside sequence of cDNA, a nucleoside sequence of premRNA, or a contiguous portion of a nucleoside sequence of an mRNA molecule formed during the transcription of a target gene (e.g., the UNC13A gene), such as a contiguous portion of a nucleoside sequence of an unprocessed UNC13A premRNA transcript. In some embodiments, the target sequence disclosed herein is present in UNC13A premRNA. In some embodiments, the target sequence disclosed herein is present in an intron of UNC13A premRNA. In some embodiments, the target sequence disclosed herein is present in intron 20 of UNC13A premRNA. In some embodiments, the target sequence disclosed herein is present in a hidden exon of intron 20 of UNC13A premRNA, or near it (e.g., within 100 nucleic acid bases upstream or downstream).

[0115] The terms “to treat” and “treatment,” as used herein, mean a method or step taken to provide reduction or mitigation of the number, severity, and / or frequency of one or more symptoms of a disease in a subject (e.g., a UNC13A-related disease (e.g., a disease associated with abnormal UNC13A expression) or a disease associated with TDP-43 dysfunction). As used herein, “to treat” and “treatment” may include prevention, management, prophylactic treatment, and / or inhibition of the number, severity, and / or frequency of one or more symptoms of a disease in a subject (e.g., a UNC13A-related disease (e.g., a disease associated with abnormal UNC13A expression) or a disease associated with TDP-43 dysfunction).

[0116] The term "variant" refers to a molecule (e.g., nucleic acid or polypeptide) that differs in sequence (e.g., nucleic acid or amino acids, respectively) from a given molecule (e.g., reference nucleic acid or polypeptide) due to the addition (e.g., insertion), deletion, or conservative substitution of nucleic acids or amino acids, respectively, but retains the biological activity of the given molecule. Changes in the reference nucleic acid sequence of a variant may be silent; that is, such changes may not alter the amino acid sequence encoded by the nucleic acid. Alternatively, changes in the nucleoside sequence of a variant may alter the amino acid sequence of the polypeptide encoded by the reference polynucleotide. Such nucleoside changes may result in amino acid substitutions, additions, deletions, fusions, and shortenings in the polypeptide encoded by the reference sequence. The term "variant" encompasses variant fragments unless otherwise defined. The variant may be 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, or 75% identical to the reference sequence. The degree of homology (identity percentage) between the natural sequence and the variant sequence can be determined by comparing the two sequences using, for example, a free computer program commonly used for this purpose on the World Wide Web (e.g., BLASTn with default settings).

[0117] The definitions of specific functional groups and chemical terms are explained in more detail below. Chemical elements are identified according to the periodic table of elements on the inside of the cover of the 75th edition of the CAS Handbook of Chemistry and Physics, and specific functional groups are generally defined as described therein. In addition, the fundamental principles of organic chemistry, as well as specific functional parts and reactivity, are described in *Organic Chemistry*, Thomas Sorrell, University Science Books, Sausalito, 1999; *Smith and March*, *March's Advanced Organic Chemistry*, 5th Edition, John Wiley & Sons, Inc., New York, 2001; *Larock*, *Comprehensive Organic Transformations*, VCH Publishers, Inc., New York, 1989; and *Carruthers*, *Some Modern Methods of Organic Synthesis*, 3rd Edition, Cambridge University Press, Cambridge, 1987.

[0118] It should be understood that compounds having the same molecular formula but differing in the nature or order of their atomic bonding, or in the spatial arrangement of those atoms, are also called "isomers." Isomers whose spatial arrangement of atoms differs are called "stereoisomers."

[0119] Stereoisomers that are not mirror images of each other are called "diastereomers," while stereoisomers that are mirror images of each other but cannot be superimposed are called "enantiomers." If a compound has a chiral center, for example, if it is bonded to four different groups, a pair of enantiomers is possible. Enantiomers can be characterized by the absolute configuration of their chiral center, described by the Kahn-Prelogue R- and S-ordering rules, or by the way the molecule rotates its plane of polarization, and are designated as dextrorotatory or levorotatory ((+) or (-) isomers, respectively). Chiral compounds can exist either as individual enantiomers or as mixtures thereof. A mixture containing equal proportions of enantiomers is called a "racemic mixture."

[0120] The term "TDP-43," as used herein, refers to the RNA-binding protein encoded by the TARDBP gene. TDP-43 plays a crucial role in RNA processing activity and splicing regulation as an inhibitor of hidden exon inclusion during RNA splicing. A key feature of neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease, and limbic-dominant age-related TDP-43 encephalopathy (LATE), is the mislocalization of TDP-43 from the nucleus and its aggregation in the cytoplasm of human brain, neuronal cell lines, motor neurons, and glial cells. TDP-43 dysfunction has been shown to result in the inclusion of hidden exons in UNC13A mRNA and reduced UNC13A protein expression. Diseases associated with TDP-43 dysfunction in cells include the neurodegenerative diseases ALS, FTD, Alzheimer's disease, and LATE.

[0121] The term "UNC-13 homolog A," used synonymously with "UNC13A," refers to the well-known gene and polypeptide, also known in this art as Munc13-1.

[0122] The term "UNC13A" includes human (Homo sapiens) UNC13A, whose amino acid and nucleotide sequences can be found, for example, in GenBank accession number Gene ID:23025 and NCBI accession numbers NG_052872.1:4991..92009 (SEQ ID NO: 318), NC_000019.10:17601336..17688354 complement (see GRCh38.p14 primary assembly) (SEQ ID NO: 318), NM_001080421.3 (SEQ ID NO: 307), and NP_001073890.2 (SEQ ID NO: 308). The term "UNC13A" also includes UNC13A from the cynomolgus monkey (Macaca fascicularis), whose amino acid and nucleotide sequences can be found, for example, in the GenBank accession number GI:102123626 and NCBI accession numbers NC_052273.1:17161646..17254007 complement (reference MFA1912RKSv2 primary assembly) (SEQ ID NO: 319), XM_045380772.1 (SEQ ID NO: 309), and XP_045236707.1 (SEQ ID NO: 310). Additional examples of UNC13A RNA sequences are readily available, for example, using GenBank, UniProt, OMIM, and the Macaca Genome Project website. Exemplary UNC13A nucleotide and amino acid sequences can also be found in Table 1, SEQ ID NOs: 307-310.

[0123] As used herein, the term "UNC13A" also refers to naturally occurring DNA sequence variations in the UNC13A gene. Numerous sequence variations within the UNC13A gene (e.g., SNPs rs12608932, rs12973192, rs56041637, rs116169349, rs62121687) have been identified and can be found, for example, in NCBI dbSNP and UniProt (see, for example, ncbi.nlm.nih.gov / snp).

[0124] Further information regarding UNC13A can be found, for example, at ncbi.nlm.nih.gov / gene / 23025. The contents of each of the accession numbers and gene database numbers mentioned above are incorporated herein by reference as of the filing date of this application.

[0125] Table 1 below summarizes exemplary amino acid sequences of the UNC13A protein, as well as the DNA sequences of the UNC13A gene in humans and cynomolgus monkeys.

[0126] [Table 1-1]

[0127] [Table 1-2]

[0128] [Table 1-3]

[0129] [Table 1-4]

[0130] [Table 1-5]

[0131] [Table 1-6]

[0132] [Table 1-7]

[0133] [Table 1-8]

[0134] Table 1-9

[0135] Table 1-10

[0136] Table 1-11

[0137] Table 1-12

[0138] As used herein, “intron 20” of UNC13A refers to the intron located between exons 20 and 21 of the UNC13A premRNA (see, for example, Brown et al., Nature. 2022 Mar;603(7899):131-137). Intron 20 of UNC13A is sometimes also known in the art as introns 20-21 (see, for example, Ma et al. TDP-43 represses cryptic exon inclusion in the FTD-ALS gene UNC13A. Nature 603, 124-130 (2022)). In some embodiments, intron 20 of UNC13A corresponds to positions 45511–46798 of the UNC13A gene sequence shown in the complement of accession numbers NC_000019.10:17601336..17688354 and NG_052872.1:4991..92009 (human UNC13A). In some embodiments, intron 20 of UNC13A includes the nucleotide sequence shown in SEQ ID NO: 311. Those skilled in the art will understand that in UNC13A premRNA, the intron 20 sequence is SEQ ID NO: 311, in which each thymine is replaced by uracil (see SEQ ID NO: 325).

[0139] [ka]

[0140] [ka]

[0141] The term “hidden exon,” as used herein, refers to an intron sequence that is mistakenly included in mature mRNA as a result of a splicing defect. Hidden exons may introduce frameshifts or stop codons, among other changes in the resulting mRNA, and may arise from single nucleotide polymorphisms (SNPs) at acceptor or donor splice sites, or from the activity of RNA-binding proteins such as spliceosomes or TDP-43. Hidden exons can be found in patient tissues from individuals affected by ALS, FTD, Alzheimer's disease, and LATE. In some embodiments, hidden exons may be found in patient tissue derived from individuals affected by frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial-onset sensorimotor neuropathy (FOSMN), age-related TDP-43 sclerosis (CARTS), Parkinson's disease, Guam-Parkinson's dementia complex (G-PDC), multiple system proteinosis (MSP), chronic traumatic encephalopathy (CTE), autism, hippocampal sclerosis (HS), hippocampal sclerotic dementia, Down syndrome, Huntington's disease, multiple sclerosis, Perry's disease, peripheral myopathy, polyglutamine diseases (e.g., spinocerebellar ataxia 3, myopathy, and chronic traumatic encephalopathy), Rasmussen's encephalitis, attention deficit hyperactivity disorder, autism, central pain syndrome, anxiety disorders, or depression. In some embodiments, the hidden exon disclosed herein has a length of 128 nucleosides. In some embodiments, the hidden exon disclosed herein has a length of 178 nucleosides. In some embodiments, the hidden exon disclosed herein has a length of 431 nucleosides.

[0142] In some embodiments, the hidden exons disclosed herein include the sequences shown in SEQ ID NOs. 312 and 326 (see also nucleosides 304-431 in SEQ ID NOs. 311 and 325; uppercase sequences):

[0143] [ka]

[0144] [ka]

[0145] In some embodiments, the hidden exons disclosed herein include the sequences shown in SEQ ID NOs. 334 and 335 (see also nucleosides 254-431 in SEQ ID NOs. 311 and 325; italicized sequences):

[0146] [ka]

[0147] [ka]

[0148] In some embodiments, the hidden exons disclosed herein include the sequences shown in SEQ ID NOs. 336 and 337 (see also nucleosides 1-431 in SEQ ID NOs. 311 and 325; underlined sequences):

[0149] [ka]

[0150] [ka]

[0151] As used herein, the term “UNC13A-related disease” is a disease or disorder caused by or associated with abnormal UNC13A expression and / or activity. The term “UNC13A-related disease” includes a disease, disorder, or condition in which a cell would benefit from inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression. In some embodiments, a subject having a UNC13A-related disease (e.g., a disease associated with abnormal UNC13A expression) would benefit from inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in the subject's cells. In some embodiments, a UNC13A-related disease is a motor neuron disease characterized by neuronal loss. A UNC13A-related disease may be a neurodegenerative disease. In some embodiments, a UNC13A-related disease is ALS. In some embodiments, a UNC13A-related disease is FTD. In some embodiments, the UNC13A-related disease is Alzheimer's disease. In some embodiments, the UNC13A-related disease is LATE (Late-Onset Alzheimer's Disease). In some embodiments, UNC13A-related disorders include frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial sensorimotor neuropathy (FOSMN), age-related TDP-43 sclerosis (CARTS), Parkinson's disease, Guam-Parkinson's dementia complex (G-PDC), multiple system proteinosis (MSP), chronic traumatic encephalopathy (CTE), autism, hippocampal sclerosis (HS), hippocampal sclerotic dementia, Down syndrome, Huntington's disease, multiple sclerosis, Perry's disease, peripheral myopathy, polyglutamine disorders (e.g., spinocerebellar ataxia 3, myopathy, and chronic traumatic encephalopathy), Rasmussen's encephalitis, attention deficit hyperactivity disorder, autism, central pain syndrome, anxiety disorder, or depression.

[0152] Further details regarding the signs and symptoms of various diseases or conditions are provided herein and are well known in the art.

[0153] composition UNC13A antisense oligonucleotide Some embodiments of this disclosure provide antisense oligonucleotides that target UNC13A and / or modulate UNC13A splicing and / or expression. In some embodiments, the antisense oligonucleotides disclosed herein include a sequence complementary to the UNC13A sequence (e.g., the UNC13A gene sequence or premRNA sequence). In some embodiments, the antisense oligonucleotides disclosed herein target more than one (e.g., two or more) target regions of UNC13A (e.g., the UNC13A gene or premRNA). In some embodiments, the antisense oligonucleotides disclosed herein are designed to modulate the splicing of UNC13A premRNA (e.g., to inhibit the inclusion of hidden exons present in UNC13A premRNA). In some embodiments, the antisense oligonucleotides disclosed herein are designed to modulate (e.g., restore) UNC13A gene expression (e.g., RNA expression and / or protein expression) and / or function.

[0154] In some embodiments, the antisense oligonucleotides disclosed herein include one or more complementary regions to one or more (e.g., one, two, or more) target regions in a human UNC13A sequence (e.g., shown in SEQ ID NO: 318). In some embodiments, the antisense oligonucleotides disclosed herein include one or more complementary regions to one or more (e.g., one, two, or more) target regions in an intron (e.g., intron 20, such as intron 20 shown in SEQ ID NO: 311) of a human UNC13A sequence (e.g., shown in SEQ ID NO: 318). In some embodiments, the antisense oligonucleotides disclosed herein include complementary regions to one or more (e.g., one, two, or more) target regions of intron 20 (e.g., the intron shown in SEQ ID NO: 311) of a UNC13A sequence (e.g., shown in SEQ ID NO: 318), each target region containing a UNC13A sequence that modulates the splicing of a UNC13A hidden exon (e.g., a UNC13A hidden exon located in intron 20, such as the hidden exon shown in SEQ ID NO: 312, SEQ ID NO: 334, or SEQ ID NO: 336). In some embodiments, the antisense oligonucleotides described herein inhibit the inclusion of a UNC13A hidden exon (e.g., a UNC13A hidden exon located in intron 20) in mature UNC13A mRNA.

[0155] In some embodiments, the antisense oligonucleotides disclosed herein target one or more (e.g., one, two, or more) target regions in or near a hidden exon (e.g., the hidden exon described in SEQ ID NO: 312, SEQ ID NO: 334, or SEQ ID NO: 336) in intron 20 of the UNC13A sequence (e.g., intron 20 shown in SEQ ID NO: 311). "Near" a location or sequence, as used herein, means within 125 nucleosides (e.g., 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) upstream (5' end) or downstream (3' end) of that location or sequence. As used herein, “upstream” of a position or arrangement means the 5' side of the position or arrangement. As used herein, “downstream” of a position or arrangement means the 3' side of the position or arrangement. For example, a target region "near" the hidden exon of intron 20 of the UNC13A sequence means that the target region is within 125 nucleosides (e.g., 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) of the hidden exon of intron 20 of the UNC13A sequence, either upstream (e.g., counting from the 5' terminal nucleotide of the hidden exon toward the 5' end) or downstream (e.g., counting from the 3' terminal nucleotide of the hidden exon toward the 3' end).

[0156] As used herein, a “target region” is represented by a nucleotide sequence in a reference sequence. For example, in the case of target regions 1 to 4 provided in Table 2, the reference sequences used are human UNC13A sequences (SEQ ID NO: 318; NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009). For the purposes of this disclosure, when referring to antisense oligonucleotides that target a target sequence in a reference sequence (e.g., NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009; in the human UNC13A sequence shown in SEQ ID NO: 318), such antisense oligonucleotides include antisense oligonucleotides that target a target region in the reference sequence (SEQ ID NO: 318; NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009), and antisense oligonucleotides that target a corresponding target region in another UNC13A sequence (e.g., a gene sequence, a premRNA sequence, or a variant or homolog of human UNC13A, e.g., derived from a closely related species such as a cynomolgus monkey).

[0157] To identify a target region in another UNC13A sequence that corresponds to a specific target region in a reference sequence (e.g., SEQ ID NO: 318;NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009), such other UNC13A sequences can be aligned with the reference sequence, and the corresponding target region can be determined. For example, in some embodiments, the target region in human UNC13A includes the nucleotide sequence shown in SEQ ID NO: 327 (CTGGGTATGTCTCTTCCAGCTGCCTGGGTTTCCTGGAAAGAACTCTTATCCCCAGGAACTAGTTTGTTGAATAAATGCTGGTGAATGAATGA). Target region 1 corresponds to the nucleoside at positions 45795-45886 of sequence number 318 (human UNC13A; NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009). The target region 1 of sequence number 318 (NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009; upper sequence) is aligned with the corresponding target region of the cynomolgus monkey UNC13A sequence (nucleoside at positions 50846-50936 of cynomolgus monkey UNC13A sequence number 319 (NC_052273.1:17161646..17254007 complement; lower sequence)) as follows.

[0158] [ka]

[0159] Therefore, positions 50846-50936 of the cynomolgus monkey UNC13A sequence, SEQ ID NO: 319 (NC_052273.1:17161646..17254007 complement) are the corresponding target region 1. When referring to antisense oligonucleotides targeting target region 1 of the UNC13A sequence, this disclosure includes antisense oligonucleotides targeting target region 1 of the NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009 (SEQ ID NO: 318), as well as antisense oligonucleotides targeting the corresponding target region 1 of the NC_052273.1:17161646..17254007 complement (SEQ ID NO: 319).

[0160] When determining the corresponding target region of another sequence related to a reference sequence, the other sequence and the reference sequence are optimally aligned over the range to be compared, containing a sufficient number of nucleosides for the alignment. Optimal sequence alignment for aligning the range to be compared can be achieved by a computer implementation of the algorithm (GAP, BESTFIT, FASTA, and TFASTA, Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA) or by the best alignment (i.e., the one that yields the highest homology percentage over the range to be compared) generated by any of the various methods investigated and selected. Alternatively, one can refer to, for example, the BLAST family program disclosed by Altschul et al., Nucl. Acids Res. 25:3389, 1997.

[0161] One or more insertions in another UNC13A sequence derived from a closely related species such as a cynomolgus monkey, relative to the human reference sequence (SEQ ID NO: 318; NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009), are represented as the "NM" position, where N represents the corresponding position immediately preceding the insertion in the reference sequence, and M represents the position of the nucleoside within the one or more insertions. For example, in the following alignment between the sequence region shown in sequence number 318 (NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009; upper sequence) and the sequence shown in sequence number 319 (NC_052273.1:17161646..17254007 complement; lower sequence),

[0162] [ka] The insertion TGGG in sequence number 319 (complementary element NC_052273.1:17161646..17254007) is located after position 46487 (bold A in the alignment above) of sequence number 318 (complementary element NC_000019.10:17601336..17688354 and NG_052872.1:4991..92009). Therefore, the positions of the insertion TGGG are designated as 46487-1, 46487-2, 46487-3, and 46487-4, respectively.

[0163] For the human reference sequence (sequence number 318; NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009), one or more deletions or mismatches in another UNC13A sequence from a closely related species such as a cynomolgus monkey may result in the absence of a "corresponding position." In such cases, as long as the deletion / mismatch (e.g., 5, 4, 3, 2, or 1 or fewer mismatches) is within a sufficiently long sequence (e.g., at least 20, 25, 30, 35, or 40 nucleosides) aligned between the two sequences, the mismatched position is represented as a position in the directly aligned reference sequence, even if the nucleosides in the reference are different. The deletion position in the other sequence is "skipped."

[0164] For example, the nucleoside at positions 46024-46036 of sequence number 318 of the human UNC13A sequence (NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009; upper sequence) is aligned to nucleosides 51070-51082 of sequence number 319 of the cynomolgus monkey UNC13A sequence (NC_052273.1:17161646..17254007 complement; lower sequence) as follows.

[0165] [ka]

[0166] The bold A at position 46029 of sequence number 318 (NC_000019.10:17601336..17688354 complement and NG_052872.1:4991..92009) is aligned with the bold G at position 51075 of sequence number 319 (NC_052273.1:17161646..17254007 complement). When referring to antisense oligonucleotides that target a target region containing the nucleoside at position 46029 of the UNC13A sequence, this disclosure includes antisense oligonucleotides that target the target region containing the nucleoside at position 46029 of the complements NC_000019.10:17601336..17688354 and NG_052872.1:4991..92009 (SEQ ID NO: 318), and antisense oligonucleotides that target the target region containing the nucleoside at position 51075 of the complement NC_052273.1:17161646..17254007 (SEQ ID NO: 319).

[0167] In some embodiments, an antisense oligonucleotide is provided herein, comprising a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region, wherein the first target region and / or the second target region each comprise a UNC13A sequence. In some embodiments, each of the first and second antisense sequences comprises a region complementary to the UNC13A sequence shown in Sequence ID No. 318. In some embodiments, the complementary region comprises at least 6 nucleotides (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or longer). In some embodiments, the complementary region comprises at least 7 nucleotides (e.g., at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or longer). In some embodiments, the complementary region consists of at least 8 nucleotides (for example, at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or longer).

[0168] In some embodiments, each of the first and second target regions is located in intron 20 of the UNC13A sequence (e.g., gene sequence or premRNA sequence). In some embodiments, each of the first and second antisense sequences includes a region complementary to intron 20 of the UNC13A sequence, as shown in SEQ ID NO: 311 or SEQ ID NO: 325. In some embodiments, the complementary region consists of at least 6 nucleotides (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or longer). In some embodiments, the complementary region consists of at least 7 nucleotides (e.g., at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or longer). In some embodiments, the complementary region consists of at least 8 nucleotides (for example, at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or longer).

[0169] In some embodiments, each of the first and second target regions is located near the hidden exon of intron 20 of the UNC13A sequence (e.g., a gene sequence or premRNA sequence). In some embodiments, each of the first and second target regions includes the UNC13A sequence, and targeting such a sequence modulates the splicing of the UNC13A hidden exon (e.g., the hidden exon of intron 20 of the UNC13A premRNA). In some embodiments, targeting the UNC13A sequence with the antisense oligonucleotide described herein that modulates the splicing of the UNC13A hidden exon inhibits the inclusion of the hidden exon (e.g., the hidden exon of intron 20 of the UNC13A premRNA) in mature UNC13A mRNA.

[0170] In some embodiments, the first and second target regions are adjacent to each other (e.g., within 300 nucleic acid bases). In some embodiments, the first target region is downstream of the second target region. In some embodiments, the first target region is more nucleotides downstream than one of the second target regions (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 nucleotides). In some embodiments, both the first and second target regions are located in a hidden exon (e.g., the hidden exon of intron 20 of UNC13A premRNA). In some embodiments, the first target region is located downstream of a hidden exon (e.g., the hidden exon of intron 20 of UNC13A premRNA), and the second target region is located in a hidden exon (e.g., the hidden exon of intron 20). In some embodiments, both the first and second target regions are located downstream of a hidden exon (e.g., the hidden exon of intron 20 of UNC13A premRNA). In some embodiments, the 5' end of the first target region and the 3' end of the second target region have 1 to 300 nucleic acid bases between them (e.g., 1 to 300, 3 to 300, 5 to 300, 7 to 300, 10 to 300, 1 to 250, 3 to 250, 5 to 250, 7 to 250, 10 to 250, 1 to 200, 3 to 200, 5 to 200, 7 to 200, 10 to 200, 1 to 150, 3 to 150, 5 to 150, 7 to 150, or 10 to 150 nucleic acid bases).

[0171] Non-limiting examples of target regions of UNC13A premRNA that can be targeted by the antisense oligonucleotides described herein are provided in Table 2. Such target regions are located near the hidden exon of intron 20 of the UNC13A sequence. Those skilled in the art will understand that the target regions overlap and are not separate regions. In some embodiments, antisense oligonucleotides disclosed herein, including antisense sequences targeting target regions 1 and 3, are particularly effective in skipping the hidden exon and inhibiting the inclusion of the UNC13A hidden exon in mature UNC13A mRNA.

[0172] [Table 2]

[0173] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region. In some embodiments, the first antisense sequence targets a first target region containing one of the nucleotide sequences of SEQ ID NOs. 313 to 316. In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NOs. 313 or 315. In some embodiments, the second antisense sequence targets a second target region containing one of the nucleotide sequences of SEQ ID NOs. 313 to 316. In some embodiments, the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NOs. 313 or 315.

[0174] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region. In some embodiments, the first antisense sequence targets a first target region including the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the first antisense sequence targets a first target region including the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the first antisense sequence targets a first target region including the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the first antisense sequence targets a first target region including the nucleotide sequence of SEQ ID NO: 316. In some embodiments, the second antisense sequence targets a second target region including the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the second antisense sequence targets a second target region including the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the second antisense sequence targets a second target region including the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 316. In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 316. In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 313.In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NO: 314, and the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NO: 314, and the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the first antisense sequence targets a first target region containing the nucleotide sequence of SEQ ID NO: 313, and the second antisense sequence targets a second target region containing the nucleotide sequence of SEQ ID NO: 313.

[0175] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region. In some embodiments, the first antisense sequence includes a complementary region with a nucleoside length of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) to the first target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the first antisense sequence includes a complementary region with a nucleoside length of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) to the first target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 316.In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 316. In some embodiments, the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 316.In some embodiments, the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 316.

[0176] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region. In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to the first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to the second target region containing the nucleotide sequence of SEQ ID NO: 316. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 316. In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 315.In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 316, and the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313.In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 315. In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 314.In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 314, and the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 314. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 314, and the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 314.In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 314, and the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 314, and the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313. In some embodiments, the first antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 313, and the second antisense sequence includes a complementary region of at least 6 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313.

[0177] In some embodiments, the first antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 313, and the second antisense sequence includes a complementary region of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or longer) nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313.

[0178] For the purposes of this disclosure, a complementary region does not need to be 100% complementary to the target region in order to be specifically hybridizable to or specific to the UNC13A sequence. In some embodiments, the complementary region is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target region of the target sequence. In some embodiments, the target region is a region of consecutive nucleosides of the target sequence. In some embodiments, the complementary region includes a nucleoside sequence containing 1, 2, 3, 4, or 5 or fewer mismatches compared to the complementary portion of the target sequence. In some embodiments, the complementary region includes a nucleoside sequence having up to 3 mismatches across 15 nucleosides, or up to 2 mismatches across 10 nucleosides.

[0179] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region. In some embodiments, the first antisense sequence has a nucleoside length of 6 to 15 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15). In some embodiments, the second antisense sequence has a nucleoside length of 6 to 15 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15). In some embodiments, the first antisense sequence has a nucleoside length of 8 to 15 (e.g., 8, 9, 10, 11, 12, 13, 14, or 15). In some embodiments, the second antisense sequence has a nucleoside length of 8 to 15 (e.g., 8, 9, 10, 11, 12, 13, 14, or 15). In some embodiments, the first antisense sequence has a nucleoside length of 10 to 14 (e.g., 10, 11, 12, 13, or 14), and the second antisense sequence has a nucleoside length of 10 to 14 (e.g., 10, 11, 12, 13, or 14). In some embodiments, the first and second antisense sequences are the same length. In some embodiments, the first and second antisense sequences are of different lengths. In some embodiments, the antisense oligonucleotide has a nucleoside length of 12–35 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35). In some embodiments, the antisense oligonucleotide has a nucleoside length of 16–30 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30). In some embodiments, the antisense oligonucleotide has a nucleoside length of 20–28 (e.g., 20, 21, 22, 23, 24, 25, 26, 27, or 28).

[0180] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region. In some embodiments, the first antisense sequence is 6 to 15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region to the first target region containing the nucleotide sequences of SEQ ID NOs. 313 to 316, the complementary region being at least 6 nucleoside lengths (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 nucleoside lengths). In some embodiments, the first antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region to the first target region containing the nucleotide sequences of SEQ ID NOs. 313–316, the complementary region being at least 8 nucleoside lengths (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 nucleoside lengths). In some embodiments, the first antisense sequence is 8 to 15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region to the first target region containing the nucleotide sequence of SEQ ID NO: 313 or 315, the complementary region being at least 8 nucleoside lengths (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 nucleoside lengths). In some embodiments, the second antisense sequence is 6–15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region to the second target region containing the nucleotide sequences of SEQ ID NOs. 313–316, the complementary region being at least 6 nucleoside lengths (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 nucleoside lengths).In some embodiments, the second antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region to the second target region containing the nucleotide sequences of SEQ ID NOs. 313–316, the complementary region being at least 8 nucleoside lengths (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 nucleoside lengths). In some embodiments, the complementary region contains one, two, three, or more mismatches. In some embodiments, the second antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region to the second target region containing the nucleotide sequence of SEQ ID NO: 313 or 315, the complementary region being at least 8 nucleoside lengths (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 nucleoside lengths). In some embodiments, the complementary region contains one, two, three, or more mismatches.

[0181] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence that targets a first target region and a second antisense sequence that targets a second target region. In some embodiments, the first antisense sequence is 6 to 15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a first target region containing the nucleotide sequences of SEQ ID NOs. 313 to 316, and the second antisense sequence of the antisense oligonucleotides disclosed herein is 6 to 15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a second target region containing the nucleotide sequences of SEQ ID NOs. 313 to 316. In some embodiments, the first antisense sequence is 8-15 nucleoside length (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a first target region containing the nucleotide sequences of SEQ ID NOs. 313-316, and the second antisense sequence of the antisense oligonucleotides disclosed herein is 8-15 nucleoside length (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a second target region containing the nucleotide sequences of SEQ ID NOs. 313-316.

[0182] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence that targets a first target region and a second antisense sequence that targets a second target region. In some embodiments, the first antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 315.

[0183] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence that targets a first target region and a second antisense sequence that targets a second target region. In some embodiments, the first antisense sequence of the antisense oligonucleotide disclosed herein is 8 to 15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence of the antisense oligonucleotide disclosed herein is 8 to 15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 314.

[0184] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence that targets a first target region and a second antisense sequence that targets a second target region. In some embodiments, the first antisense sequence of the antisense oligonucleotide disclosed herein is 8 to 15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 315, and the second antisense sequence of the antisense oligonucleotide disclosed herein is 8 to 15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313.

[0185] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence that targets a first target region and a second antisense sequence that targets a second target region. In some embodiments, the first antisense sequence of the antisense oligonucleotide disclosed herein is 8 to 15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a first target region containing the nucleotide sequence of SEQ ID NO: 313, and the second antisense sequence of the antisense oligonucleotide disclosed herein is 8 to 15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes a complementary region of 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths to a second target region containing the nucleotide sequence of SEQ ID NO: 313.

[0186] Nucleic acid sequences of the antisense oligonucleotides described herein, non-limiting examples of the first antisense sequence and / or second antisense sequence of the antisense oligonucleotides described herein are provided in Table 3. Nucleic acid sequences of the antisense oligonucleotides described herein, non-limiting examples of the first antisense sequence and / or second antisense sequence of the antisense oligonucleotides described herein are provided in Table 9.

[0187] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence and a second antisense sequence. In some embodiments, the first antisense sequence is 6 to 15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes at least six consecutive nucleic acid bases (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) of any one of SEQ ID NOs. In some embodiments, the first antisense sequence is 6–15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and contains at least six (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) consecutive nucleic acid bases from any one of sequence numbers 246, 247, 274, 288, and 495–515. In some embodiments, the first antisense sequence is 6-15 nucleoside length (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside length), and includes sequence numbers 246, 247, 274, 288, 495-515, AGCCACGA, ACGAATC, CGAATCT, GAATCTA, AATCTAC, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TCACCCA, ACG It comprises at least six (for example, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) consecutive nucleic acid bases from any one of the following: AATCTA, GCCACGA, GAATCTAC, CGAATCTA, CGAATCTAC, GAATCTACC, TCTACCC, ATCTACC, GTCGCCG, GGGTCCG, GGGTCGC, and GGGTCGCC.In some embodiments, the first antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and contains at least 8 consecutive nucleic acid bases (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) from any one of sequence numbers 191–245. In some embodiments, the first antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and contains at least 8 consecutive nucleic acid bases (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) from any one of sequence numbers 246, 247, 274, 288, and 495–515. In some embodiments, the first antisense sequence includes one nucleic acid sequence from sequence numbers 191 to 245. In some embodiments, the first antisense sequence includes one nucleic acid sequence from sequence numbers 246, 247, 274, 288, and 495 to 515. In some embodiments, the first antisense sequence includes one nucleic acid sequence from AGCCACGA, ACGAATC, CGAATCT, GAATCTA, AATCTAC, CAATCAT, GTTCAAT, TTCATC, TCAATCA, TTTTATC, CTTTTAT, TCACCCA, ACGAATCTA, GCCACGA, GAATCTAC, CGAATCTTA, GAATCTACC, TCTACCC, ATCTACC, GTCGCCG, GGGGTCG, GGGTCGC, and GGGCGCC. In some embodiments, the second antisense sequence is 6–15 nucleoside length (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside length) and contains at least six (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) consecutive nucleic acid bases from any one of sequence numbers 194, 199, 212, 226, 227, and 246–306.In some embodiments, the second antisense sequence is 6 to 15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and contains at least six consecutive nucleic acid bases (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) of any one of sequence numbers 516 to 535. In some embodiments, the second antisense sequence is 6 to 15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and contains at least six (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) consecutive nucleic acid bases from one of sequence numbers 516 to 535, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTATTC, CTTTTAT, TGTACTC, and TCACCCA. In some embodiments, the second antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes at least 8 consecutive nucleic acid bases (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) from any one of sequence numbers 194, 199, 212, 226, 227, and 246–306. In some embodiments, the second antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes at least 8 consecutive nucleic acid bases (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) from any one of sequence numbers 516–535. In some embodiments, the second antisense sequence includes one of the nucleic acid sequences of SEQ ID NOs: 194, 199, 212, 226, 227, and 246-306. In some embodiments, the second antisense sequence includes one of the nucleic acid sequences of SEQ ID NOs: 516-535.In some embodiments, the second antisense sequence includes one of the following nucleic acid base sequences: CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TGTACTC, and TCACCCA.

[0188] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence and a second antisense sequence. In some embodiments, the first antisense sequence is 6 to 15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes at least 6 consecutive nucleic acid bases (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) of any one of SEQ ID NOs: 191 to 245, and the second antisense sequence is The sense sequence is 6–15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and contains at least six consecutive nucleic acid bases (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) from one of sequence numbers 194, 199, 212, 226, 227, and 246–306. In some embodiments, the first antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes at least 8 consecutive nucleic acid bases (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) from any one of sequence numbers 191–245, and the second antisense sequence is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes at least 8 consecutive nucleic acid bases (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) from any one of sequence numbers 194, 199, 212, 226, 227, and 246–306. In some embodiments, the first antisense sequence comprises one nucleic acid sequence from sequence numbers 191 to 245, and the second antisense sequence comprises one nucleic acid sequence from sequence numbers 194, 199, 212, 226, 227, and 246 to 306.

[0189] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence and a second antisense sequence. In some embodiments, the first antisense sequence is 6 to 15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and includes at least six (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) consecutive nucleic acid bases from any one of sequence numbers 191 to 247, 274, 288, and 495 to 515. The antisense sequence of 2 is 6 to 15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and contains at least 6 consecutive nucleic acid bases (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) from any one of sequence numbers 194, 199, 212, 226, 227, 246 to 306, and 516 to 535. In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence and a second antisense sequence.In some embodiments, the first antisense sequence is 6-15 nucleoside length (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside length) and at least six of any one of sequence numbers 191-247, 274, 288, 495-515, AGCCACGA, ACGAATC, CGAATCT, GAATCTA, AATCTAC, CAATCAT, GTTCAAT, TTCATC, TCAATCA, TTTTATC, CTTTTAT, TCACCCA, ACGAATCTA, GCCACGA, GAATCTAC, CGAATCTTA, CGAATCTAC, GAATCTACC, TCTACCC, ATCTACC, GTCGCCG, GGGGTCG, GGGTCGC, and GGGCGCC (e.g., at least 6, at least 7, at least Each contains 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 consecutive nucleic acid bases, and the second antisense sequence is 6-15 nucleoside lengths (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and contains at least 6 (e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) consecutive nucleic acid bases from one of the following sequences: SEQ ID NOs: 194, 199, 212, 226, 227, 246-306, 516-535, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TGTACTC, and TCACCCA.In some embodiments, the first antisense sequence is 8-15 nucleoside length (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside length) and includes at least 8 (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) consecutive nucleic acid bases from one of sequence numbers 191-247, 274, 288, and 495-515. The antisense sequence of 2 is 8–15 nucleoside lengths (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 nucleoside lengths) and contains at least 8 consecutive nucleic acid bases (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14) from one of sequence numbers 194, 199, 212, 226, 227, 246–306, and 516–535. In some embodiments, the first antisense sequence is sequence numbers 191-247, 274, 288, 495-515, AGCCACGA, ACGAATC, CGAATCT, GAATCTA, AATCTAC, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TCACCCA, ACGAATCTA, GCCACGA, GAATCTAC, CGAATCTTA, CGAATCTAC, GAATCTACC, The second antisense sequence contains one of the following nucleic acid base sequences: TCTACCC, ATCTACC, GTCGCCG, GGGGTCG, GGGTCGC, and GGGCGCC, and the second antisense sequence contains one of the following nucleic acid base sequences: SEQ ID NOs: 194, 199, 212, 226, 227, 246-306, 516-535, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TGTACTC, and TCACCCA.

[0190] In some embodiments, in any one of the antisense oligonucleotides described herein, the first antisense sequence and the second antisense sequence are directly adjacent to each other (for example, there are no nucleic acid bases between the first antisense sequence and the second antisense sequence). In some embodiments, in any one of the antisense oligonucleotides described herein, there are one or more nucleic acid bases (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) between the first antisense sequence and the second antisense sequence. In some embodiments, the Disclosure provides antisense oligonucleotides in which one or more nucleic acid bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) at the 3' end of a first antisense sequence are complementary to one or more nucleic acid bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) at the 3' end of a second target region, and / or one or more nucleic acid bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) at the 5' end of a second antisense sequence are complementary to one or more nucleic acid bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) at the 5' end of a first target region.

[0191] In some embodiments, any one of the antisense oligonucleotides described herein includes a spacer between a first antisense sequence and a second antisense sequence. In some embodiments, the spacer includes one or more (1, 2, 3, 4, 5, 6, or more) debasement moieties. In some embodiments, the spacer is a C3 spacer (e.g., the C3 spacers shown in Table 16). In some embodiments, the spacer is a C6 spacer (e.g., the C5 spacers shown in Table 16).

[0192] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 194 and a second antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 253, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0193] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 194 and a second antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 253, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0194] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 497 and a second antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 249, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0195] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 506 and a second antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 259, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0196] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence containing the nucleic acid sequence of SEQ ID NO: 246, and a second antisense sequence containing the nucleic acid sequence of SEQ ID NO: 246, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0197] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 198 and a second antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 253, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0198] In some embodiments, the antisense oligonucleotides disclosed herein comprise a first antisense sequence comprising the nucleic acid sequence of GAATCTA and a second antisense sequence comprising the nucleic acid sequence of Sequence ID No. 246, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0199] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence containing the nucleic acid sequence of GAATCTA and a second antisense sequence containing the nucleic acid sequence of Sequence ID No. 246, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0200] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence containing the nucleic acid sequence of GAATCTA and a second antisense sequence containing the nucleic acid sequence of Sequence ID No. 534, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0201] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence containing the nucleic acid sequence of GAATCTA and a second antisense sequence containing the nucleic acid sequence of Sequence ID No. 534, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0202] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence containing the nucleic acid sequence GAATCTACC and a second antisense sequence containing the nucleic acid sequence SEQ ID NO: 535, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0203] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence containing the nucleic acid sequence GAATCTACC and a second antisense sequence containing the nucleic acid sequence SEQ ID NO: 535, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0204] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence containing the nucleic acid sequence GAATCTACC and a second antisense sequence containing the nucleic acid sequence SEQ ID NO: 264, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0205] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence containing the nucleic acid sequence GAATCTACC and a second antisense sequence containing the nucleic acid sequence SEQ ID NO: 264, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0206] In some embodiments, the antisense oligonucleotides disclosed herein comprise a first antisense sequence comprising the nucleic acid sequence of GAATCTAC and a second antisense sequence comprising the nucleic acid sequence of Sequence ID No. 264, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0207] In some embodiments, the antisense oligonucleotides disclosed herein comprise a first antisense sequence comprising the nucleic acid sequence of GAATCTAC and a second antisense sequence comprising the nucleic acid sequence of SEQ ID NO: 246, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C3 spacer (e.g., the C3 spacers shown in Table 16).

[0208] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence containing the nucleic acid sequence of GAATCTAC and a second antisense sequence containing the nucleic acid sequence of SEQ ID NO: 246, wherein the 3' end of the first antisense sequence is ligated to the 5' end of the second antisense sequence by a C6 spacer (e.g., the C6 spacers shown in Table 16).

[0209] In some embodiments, the antisense oligonucleotide has a nucleoside length of 12 to 35 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) and contains at least 16 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleic acid bases from any one of the sequence numbers 1 to 190. In some embodiments, the antisense oligonucleotide has a nucleoside length of 12 to 35 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) and contains at least 16 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleic acid bases of any one of the sequence numbers 338 to 494. In some embodiments, the antisense oligonucleotide has a nucleoside length of 16 to 30 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) and contains at least 16 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleic acid bases of any one of the sequence numbers 1 to 190. In some embodiments, the antisense oligonucleotide has a nucleoside length of 16 to 30 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) and contains at least 16 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleic acid bases of any one of the sequence numbers 338 to 494.In some embodiments, the antisense oligonucleotide has a nucleoside length of 12 to 35 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) and includes a nucleic acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 99%, or 100%) to any one of the nucleic acid sequences of SEQ ID NOs: 1 to 190. In some embodiments, the antisense oligonucleotide has a nucleoside length of 12 to 35 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) and includes a nucleic acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 99%, or 100%) to any one of the nucleic acid sequences of sequence numbers 338 to 494. In some embodiments, the antisense oligonucleotide has a nucleoside length of 12 to 35 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) and includes a nucleic acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 99%, or 100%) to one of the nucleic acid sequences of sequence numbers 1 to 182, 184 to 190, 338 to 434, or 442 to 494. In some embodiments, the antisense oligonucleotide has a nucleoside length of 16 to 30 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) and comprises a nucleic acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 99%, or 100%) to any one of the nucleic acid sequences of SEQ ID NOs: 1 to 190.In some embodiments, the antisense oligonucleotide has a nucleoside length of 16 to 30 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) and comprises a nucleic acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 99%, or 100%) to any one of the nucleic acid sequences of sequence numbers 338 to 494. In some embodiments, the antisense oligonucleotide has a nucleoside length of 16 to 30 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) and includes a nucleic acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 99%, or 100%) to one of the nucleic acid sequences of sequence numbers 1 to 182, 184 to 190, 338 to 434, or 442 to 494.

[0210] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence and a second antisense sequence, wherein the first antisense sequence is (5'->3'): (i) CACGAATCTACCC (Sequence ID 191) (ii) CGAATCTACCCAC (Sequence ID 192) (iii) CCATCCATCATCC (Sequence ID 198) (iv) GCATTTATTCAAC (Sequence ID 199) (v) CCACGAATCTACC (Sequence ID 193) (vi) TGTTCAATCATTC (Sequence ID 194) (vii) CGAATCTACCCA (Sequence ID 204) (viii) CGAATCTACC (Sequence ID 212) (ix) ACGAATCTACCCA (Sequence ID 196) (x) ACGAATCTACCC (Sequence ID 205) (xi)TCCATCCATCATC (Sequence ID 222), and (xii)CATCCATCTATCC(Sequence ID 233) It contains nucleic acid base sequences selected from the following.

[0211] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence and a second antisense sequence, the second antisense sequence being (5'->3'): (i) CCATCCATGTACT (Sequence ID 246) (ii) ATCTGTTCAATCA (Sequence ID 247) (iii) GGGATAAGAGTTC (Sequence ID 253) (iv) GGGGATAAGAGTT (Sequence No. 254) (v) GGATAAGAGTTCT (Sequence ID 252) (vi) ATCTGTTCAATC (Sequence ID 261) (vii) ATCCATGTAC(Sequence ID 271) (viii)CATCTGTTCAATC (Sequence ID 276), and (ix)CCATCCATGTAC(Sequence ID 262) It contains nucleic acid base sequences selected from the following.

[0212] In some embodiments, the antisense oligonucleotides disclosed herein include a first antisense sequence at the 5' end of the antisense oligonucleotide and a second antisense sequence at the 3' end of the antisense oligonucleotide, wherein the first antisense sequence is (5'->3'): (i) CACGAATCTACCC (Sequence ID 191) (ii) CGAATCTACCCAC (Sequence ID 192) (iii) CCATCCATCATCC (Sequence ID 198) (iv) GCATTTATTCAAC (Sequence ID 199) (v) CCACGAATCTACC (Sequence ID 193) (vi) TGTTCAATCATTC (Sequence ID 194) (vii) CGAATCTACCCA (Sequence ID 204) (viii) CGAATCTACC (Sequence ID 212) (ix) ACGAATCTACCCA (Sequence ID 196) (x) ACGAATCTACCC (Sequence ID 205) (xi)TCCATCCATCATC (Sequence ID 222), and (xii)CATCCATCTATCC(Sequence ID 233) Includes nucleic acid base sequences selected from, The second antisense array is as follows (5'->3'): (i) CCATCCATGTACT (Sequence ID 246) (ii) ATCTGTTCAATCA (Sequence ID 247) (iii) GGGATAAGAGTTC (Sequence ID 253) (iv) GGGGATAAGAGTT (Sequence No. 254) (v) GGATAAGAGTTCT (Sequence ID 252) (vi) ATCTGTTCAATC (Sequence ID 261) (vii) ATCCATGTAC(Sequence ID 271) (viii)CATCTGTTCAATC (Sequence ID 276), and (ix)CCATCCATGTAC(Sequence ID 262) It contains nucleic acid base sequences selected from the following.

[0213] In some embodiments, the antisense oligonucleotides disclosed herein are (5'->3'): (i) CACGAATCTACCCCCATCCATGTACT (Sequence ID 1) (ii) CGAATCTACCCACATCTGTTCAATCA (Sequence ID 2) (iii) CCATCCATCATCCGGGATAAGAGTTC (Sequence ID 16) (iv) GCATTTATTCAACGGGGATAAGAGTT (Sequence ID 17) (v) CCACGAATCTACCGGATAAGAGTTCT(Sequence ID 8) (vi) TGTTCAATCATTCGGGATAAGAGTTC (Sequence No. 9) (vii) CCACGAATCTACCGGGATAAGAGTTC (Sequence ID 14) (viii) CGAATCTACCCAATCTGTTCAATC (Sequence ID 36) (ix) CGAATCTACCATCCATGTAC (Sequence ID 82) (x) ACGAATCTACCCACATCTGTTCAATC (Sequence ID 93) (xi) ACGAATCTACCCCCATCCATGTAC (Sequence ID 37) (xii)TCCATCCATCATCGGGATAAGAGTTC (Sequence ID 121), and (xiii)CATCCATCTATCCGGGATAAGAGTTC (Sequence ID 159) It contains nucleic acid base sequences selected from the following.

[0214] For the purposes of this disclosure, an antisense oligonucleotide comprising the nucleic acid base sequences of the antisense oligonucleotides listed in Table 3 (e.g., the nucleic acid base sequences of the antisense oligonucleotide, the first antisense sequence, and the second antisense sequence) should be understood to encompass antisense oligonucleotides comprising such nucleic acid base sequences and without chemical modifications (e.g., modified nucleosides and / or modified nucleoside linkages), and antisense oligonucleotides comprising such nucleic acid base sequences and containing chemical modifications (e.g., one or more modified nucleosides and / or one or more modified nucleoside linkages, e.g., those provided in Table 5), and encompassing such modified or unmodified antisense oligonucleotides, where the target-directed moiety is either not conjugated or conjugated.

[0215] For the purposes of the present disclosure, antisense oligonucleotides comprising the nucleic acid base sequences of the antisense oligonucleotides listed in Table 9 (e.g., the nucleic acid base sequences of the antisense oligonucleotide, the first antisense sequence, and the second antisense sequence) include antisense oligonucleotides that contain such nucleic acid base sequences and do not include chemical modifications (e.g., modified nucleosides and / or modified internucleoside linkages), and antisense oligonucleotides that contain such nucleic acid base sequences and include chemical modifications (e.g., one or more modified nucleosides and / or one or more modified internucleoside linkages, such as those provided in Table 11), and such modified or unmodified antisense oligonucleotides, whether or not a targeting moiety is conjugated thereto, are to be understood to be included.

[0216]

Table 3-1

[0217]

Table 3-2

[0218]

Table 3-3

[0219]

Table 3-4

[0220]

Table 3-5

[0221]

Table 3-6

[0222] Table 3-7

[0223] Table 3-8

[0224] Table 3-9

[0225] Table 4-1

[0226] Table 4-2

[0227] Table 4-3

[0228] Table 4-4

[0229] Table 4-5

[0230] Table 4-6

[0231] Table 4-7

[0232] Table 4-8

[0233] [Table 4-9]

[0234] [Table 4-10]

[0235] [Table 4-11]

[0236] [Table 4-12]

[0237] Modified antisense oligonucleotides Some aspects of this disclosure provide modified (e.g., chemically modified) antisense oligonucleotides. For example, any one of the antisense oligonucleotides provided herein (e.g., Table 3 or Table 9) may include one or more chemical modifications, such as one or more modified nucleosides and / or linkages between one or more modified nucleosides.

[0238] In some embodiments, the antisense oligonucleotides disclosed herein comprise a first antisense sequence and a second antisense sequence, and comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 or more) modified nucleosides and / or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) linkages between modified nucleosides. In some embodiments, the modified nucleoside includes a modification at the 2' position of the sugar (referred to herein as a “2'-modified nucleoside”). In some embodiments, the 2'-modified nucleoside is not bicyclic (referred to herein as a “non-bicyclic 2'-modified nucleoside”). In some embodiments, the 2'-modified nucleoside includes modifications at the 2' and 4' positions of the sugar, creating a cross-linked structure (referred to herein as a “2'-4' cross-linked nucleoside”). In some embodiments, one or more modified nucleosides include a non-bicyclic 2'-modified nucleoside, a 2'-4' cross-linked nucleoside, or a combination thereof. In some embodiments, all modified nucleosides of antisense oligonucleotides are 2'-modified nucleosides. In some embodiments, the non-bicyclic 2'-modified nucleoside is a 2'-O-methoxyethyl (2'-MOE) modified nucleoside, a 2'-O-methyl (2'-O-Me) nucleoside, or a 2'-fluoro (2'-F) modified nucleoside, and / or the 2'-4' crosslinked nucleoside is a locked nucleic acid (LNA, 2'-4' methylene crosslinked), an ethylene crosslinked nucleic acid (ENA, 2'-4' ethylene crosslinked), or a restricted ethyl nucleic acid (cEt, 2'-4' ethylene crosslinked). In some embodiments, the 2'-modified nucleoside is a 2'-O,4'-C-spirocyclopropylene crosslinked nucleic acid (scpBNA). In some embodiments, the 2'-modified nucleoside is a 2'-ON-methylacetamide (2'-O-NMA) modified nucleoside. In some embodiments, the 2'-modified nucleoside is an amide-crosslinked nucleic acid (AmNA).In some embodiments, the 2'-modified nucleoside is a 2'-O,4'-C-aminomethylene-bridged nucleic acid (BNA(NC)). In some embodiments, the antisense oligonucleotide disclosed herein comprises one or more 2'-MOE-modified nucleosides. In some embodiments, the antisense oligonucleotide disclosed herein comprises one or more LNAs. In some embodiments, the antisense oligonucleotide disclosed herein comprises one or more 2'-MOE-modified nucleosides and one or more LNAs. In some embodiments, each nucleoside of the antisense oligonucleotide is a 2'-MOE-modified nucleoside.

[0239] In some embodiments, the antisense oligonucleotides disclosed herein include one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more) of the following 2'-modified nucleosides: 2'-O-Me, 2'-F, 2'-MOE, LNA, ENA, cEt, scpBNA, 2'-O-NMA, AmNA, and BNA(NC). In some embodiments, each nucleoside of the antisense oligonucleotide disclosed herein is a modified nucleoside (e.g., a 2'-modified nucleoside). In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are ENA. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are cEt. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are scpBNA. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are 2'-O-NMA modified nucleosides. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are AmNA. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are BNA(NC).In some embodiments, one or more modified nucleosides (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) are selected from the following 2'-modified nucleosides: 2'-O-Me, 2'-F, ENA, cEt, scpBNA, 2'-O-NMA, AmNA, and BNA(NC), and the remaining modified nucleosides are 2'-MOE modified nucleosides, LNA, or a mixture of 2'-MOE modified nucleosides and LNA. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are selected from the following 2'-modified nucleosides: ENA, scpBNA, 2'-O-NMA, AmNA, and BNA(NC), and the remaining modified nucleosides are 2'-MOE modified nucleosides, LNA, or a mixture of 2'-MOE modified nucleosides and LNA. In some embodiments, the remaining modified nucleosides are 2'-MOE modified nucleosides. In some embodiments, the remaining modified nucleosides are LNA. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are AmNA, and the remaining modified nucleosides are a mixture of 2'-MOE modified nucleosides and LNA. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are ENA, and the remaining modified nucleosides are 2'-MOE modified nucleosides. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are scpBNA, and the remaining modified nucleosides are 2'-MOE modified nucleosides. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are AmNA, and the remaining modified nucleosides are 2'-MOE modified nucleosides.In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are BNA(NC), and the remaining modified nucleosides are 2'-MOE modified nucleosides. In some embodiments, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the modified nucleosides are 2'-O-NMA modified nucleosides, and the remaining modified nucleosides are LNA.

[0240] In some embodiments, the antisense oligonucleotides disclosed herein comprise a first antisense sequence and a second antisense sequence, and include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified nucleoside linkages. In some embodiments, each nucleoside linkage of the antisense oligonucleotide is a modified nucleoside linkage. Non-limiting examples of nucleoside linkages include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-aminophosphoramides and aminoalkyl phosphoramidates, mesylphosphoramides, thionophosphoramides, thionoalkyl phosphonates, thionoalkyl phosphotriesters, and boranophosphates. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages. In any one of the antisense oligonucleotides disclosed herein, it should be understood that the remainder of the nucleoside linkages are all phosphodiester nucleoside linkages unless otherwise specified. In some embodiments, each nucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage. In some embodiments, the antisense oligonucleotide comprises a mixture of phosphodiester linkages and phosphorothioate linkages. In some embodiments, the antisense oligonucleotide comprises one or more phosphorodiamidate morpholino oligomers (PMOs).

[0241] In some embodiments, the antisense oligonucleotides disclosed herein comprise a first antisense sequence and a second antisense sequence, where each cytosine of the oligonucleotide is 5-methylcytosine. In some embodiments, each cytosine of the oligonucleotide is not 5-methylcytosine. In some embodiments, one or more cytosines of the oligonucleotide are 5-methylcytosine.

[0242] Table 4 lists various exemplary nucleosides having a 3'-phosphate or 3'-phosphorothioate and their structures.

[0243] [Table 5-1]

[0244] [Table 5-2]

[0245] [Table 5-3]

[0246] [Table 5-4]

[0247] [Table 5-5]

[0248] [Table 5-6]

[0249] [Table 6]

[0250] Table 7

[0251] In some embodiments, the antisense oligonucleotides disclosed herein comprise one or more modified nucleosides (e.g., one or more 2'-modified nucleosides). In some embodiments, the antisense oligonucleotides comprise non-bicyclic 2'-modified nucleosides, 2'-4'-bridged nucleosides, or combinations thereof (e.g., any combination of 2'-O-methoxyethyl (2'-MOE) modified nucleosides, 2'-O-methyl (2'-O-Me) modified nucleosides, 2'-fluoro (2'-F) modified nucleosides, LNA, ENA, and cEt). In some embodiments, the antisense oligonucleotides disclosed herein comprise one or more modified nucleosides (e.g., one or more 2'-modified nucleosides). In some embodiments, the antisense oligonucleotide includes a non-bicyclic 2'-modified nucleoside, a 2'-4'-bridged nucleoside, or a combination thereof (e.g., any combination of 2'-MOE-modified nucleoside, 2'-O-Me-modified nucleoside, 2'-F-modified nucleoside, LNA, ENA, cEt, AmNA, BNA(NC), scpBNA, and 2'-O-NMA). In some embodiments, the antisense oligonucleotide includes a combination of a 2'-MOE-modified nucleoside and LNA. In some embodiments, the antisense oligonucleotide includes a combination of a 2'-MOE-modified nucleoside and one or more (e.g., 1, 2, 3, or 4) ENAs. In some embodiments, the antisense oligonucleotide includes a combination of a 2'-MOE-modified nucleoside and one or more (e.g., 1, 2, 3, or 4) AmNAs. In some embodiments, the antisense oligonucleotide comprises a combination of a 2'-MOE modified nucleoside and one or more (e.g., 1, 2, 3, or 4) BNA(NC) molecules. In some embodiments, the antisense oligonucleotide comprises a combination of a 2'-MOE modified nucleoside and one or more (e.g., 1, 2, 3, or 4) scpBNA molecules. In some embodiments, the antisense oligonucleotide comprises a combination of a 2'-MOE modified nucleoside and one or more (e.g., 1, 2, 3, or 4) 2'-O-NMA modified nucleoside molecules.In some embodiments, the antisense oligonucleotide comprises a combination of LNA and one or more (e.g., 1, 2, 3, or 4) 2'-O-NMA modified nucleosides. In some embodiments, the antisense oligonucleotide comprises a combination of a 2'-MOE modified nucleoside, LNA, and one or more (e.g., 1, 2, 3, or 4) AmNAs. In some embodiments, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside. In some embodiments, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside. In some embodiments, the nucleosides at four or more positions (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) of the antisense oligonucleotide are nucleosides having the same 2' chemistry in the sugar moiety, selected from, for example, 2'-MOE modified nucleosides, 2'-O-methyl (2'-O-Me) modified nucleosides, 2'-fluoro (2'-F) modified nucleosides, LNA, ENA, and cEt, while the remaining nucleosides are nucleosides having different 2' chemistry in the sugar moiety, selected from, for example, 2'-MOE modified nucleosides, 2'-O-methyl (2'-O-Me) modified nucleosides, 2'-fluoro (2'-F) modified nucleosides, LNA, ENA, and cEt. In some embodiments, four or more (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12) nucleosides of the antisense oligonucleotide are LNA, and the remaining nucleosides are nucleosides having a different 2' chemistry in the sugar portion, e.g., 2'-MOE, 2'-O-methyl (2'-O-Me), 2'-fluoro (2'-F), ENA, or cEt. In some embodiments, four or more (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12) nucleosides of the antisense oligonucleotide are LNA, and all of the remaining nucleosides are 2'-MOE modified nucleosides.

[0252] In some embodiments, the antisense oligonucleotides disclosed herein comprise one or more (e.g., 1, 2, or 3) motifs of 2 to 6 (e.g., 2, 3, 4, 5, or 6) consecutive 2'-4' bridged nucleosides (e.g., LNA, ENA, or cEt). In some embodiments, the remaining nucleosides are non-bicyclic 2' modified nucleosides (e.g., 2'-MOE modified nucleosides, 2'-O-methyl (2'-O-Me) modified nucleosides, 2'-fluoro (2'-F) modified nucleosides). In some embodiments, at least one of the motifs is located at the 5' end of the antisense oligonucleotide. In some embodiments, at least one of the motifs is located at the 3' end of the antisense oligonucleotide. In some embodiments, at least one of the motifs is located within any of the 9-16 positions (counting from 5' to 3') of the antisense oligonucleotide.

[0253] In some embodiments, the antisense oligonucleotides disclosed herein have a nucleoside length of 20–28 (e.g., 20, 21, 22, 23, 24, 25, 26, 27, or 28) and contain one or more (e.g., 1, 2, or 3) motifs of 2–6 (e.g., 2, 3, 4, 5, or 6) consecutive LNAs within any of the 5' end, 3' end, and / or positions 9–16 (counting from 5'->3') (e.g., 9–10, 9–12, 10–11, 10–12, 10–13, 10–15, 10–16, 11–12, 11–14, 11–16, 12–13, 12–15, and 13–15), with all remaining nucleosides being 2'-MOE modified nucleosides.

[0254] In some embodiments, the antisense oligonucleotides disclosed herein have a nucleoside length of 20 to 28 (e.g., 20, 21, 22, 23, 24, 25, 26, 27, or 28), and each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside.

[0255] In some embodiments, the antisense oligonucleotides disclosed herein have a 20-28 (e.g., 20, 21, 22, 23, 24, 25, 26, 27, or 28) nucleoside length, where one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, or more) nucleosides of the antisense oligonucleotide are LNAs, and all of the remaining nucleosides are 2'-O-NMA modified nucleosides.

[0256] In some embodiments, the antisense oligonucleotides disclosed herein have a nucleoside length of 20 to 28 (e.g., 20, 21, 22, 23, 24, 25, 26, 27, or 28), and each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside.

[0257] In some embodiments, the antisense oligonucleotides disclosed herein have a nucleoside length of 20 to 28 (e.g., 20, 21, 22, 23, 24, 25, 26, 27, or 28), one or more nucleic acid bases at the 3' end of the first antisense sequence are complementary to one or more nucleic acid bases at the 3' end of the second target region, and / or one or more nucleic acid bases at the 5' end of the second antisense sequence are complementary to one or more nucleic acid bases at the 5' end of the first target region.

[0258] In some embodiments, the antisense oligonucleotides disclosed herein are 28 nucleoside long, and each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages. In some embodiments, the antisense oligonucleotide comprises a mixture of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphodiester nucleoside linkages.

[0259] In some embodiments, the antisense oligonucleotides disclosed herein are 28 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the inter-nucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0260] In some embodiments, the antisense oligonucleotides disclosed herein are 27 nucleoside long, and each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages. In some embodiments, the antisense oligonucleotide comprises a mixture of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphodiester nucleoside linkages.

[0261] In some embodiments, the antisense oligonucleotides disclosed herein are 27 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the inter-nucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0262] In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside long, and one or more nucleosides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) of the antisense oligonucleotide are LNAs, and all of the remaining nucleosides are 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside length and contain one or more (e.g., 1, 2, or 3) motifs of 2 to 6 (e.g., 2, 3, 4, 5, or 6) consecutive 2'-4' crosslinked nucleosides (e.g., LNA, ENA, or cEt) within positions 1 to 6, 10 to 17, and / or 22 to 26 (counting from 5'->3'). In some embodiments, the antisense oligonucleotides contain one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages and a mixture of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphodiester nucleoside linkages.

[0263] In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside long, the nucleosides at positions 11-16 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0264] In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside long, the nucleosides at positions 1-4 and 23-26 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0265] In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside long, the nucleosides at positions 1-4, 12-15, and 23-26 (counting 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0266] In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside long, the nucleosides at positions 1-3, 11-16, and 24-26 (counting 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0267] In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside long, the nucleosides at positions 1-4 and 11-16 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0268] In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside long, the nucleosides at positions 11-16 and 23-26 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0269] In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside long, and each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside. In some embodiments, the antisense oligonucleotide contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate internucleoside linkages. In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside long, and each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage.

[0270] In some embodiments, the antisense oligonucleotides disclosed herein are 26-nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more) phosphorothioate nucleoside linkages and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more) phosphodiester nucleoside linkages.

[0271] In some embodiments, the antisense oligonucleotides disclosed herein are 26-nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more) phosphorothioate nucleoside linkages and 2 or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more) phosphodiester nucleoside linkages. In some embodiments, the antisense oligonucleotide comprises two phosphodiester nucleoside linkages, and all of the remaining nucleoside linkages are phosphorothioate nucleoside linkages.

[0272] In some embodiments, the antisense oligonucleotides disclosed herein are 26-nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) phosphorothioate nucleoside linkages and 2 or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more) phosphodiester nucleoside linkages. In some embodiments, the antisense oligonucleotide comprises 5 phosphodiester nucleoside linkages, and all of the remaining nucleoside linkages are phosphorothioate nucleoside linkages.

[0273] In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the internucleoside links of the antisense oligonucleotide are phosphorothioate nucleoside links.

[0274] In some embodiments, the antisense oligonucleotides disclosed herein are 25 nucleoside long, and each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages. In some embodiments, the antisense oligonucleotide comprises a mixture of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphodiester nucleoside linkages.

[0275] In some embodiments, the antisense oligonucleotides disclosed herein are 25 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the inter-nucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0276] In some embodiments, the antisense oligonucleotides disclosed herein are 25 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) phosphorothioate nucleoside linkages and 2 or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more) phosphodiester nucleoside linkages.

[0277] In some embodiments, the antisense oligonucleotides disclosed herein are 25 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the internucleoside links of the antisense oligonucleotide are phosphorothioate nucleoside links.

[0278] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, and one or more nucleosides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) of the antisense oligonucleotide are LNAs, and all of the remaining nucleosides are 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, or 3) motifs of 2 to 6 (e.g., 2, 3, 4, 5, or 6) consecutive 2'-4' crosslinked nucleosides (e.g., LNA, ENA, or cEt) within positions 1 to 5, 10 to 16, and / or 20 to 24. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages and a mixture of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphodiester nucleoside linkages.

[0279] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 4, 8, 12, 16, 20, and 24 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0280] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 10-15 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0281] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 1-4, 11-14, and 21-24 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0282] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 1-4, 11-14, and 21-24 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, the antisense oligonucleotide contains two phosphodiester nucleoside linkages, and all of the remaining nucleoside linkages are phosphorothioate nucleoside linkages.

[0283] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 1, 4, 11-14, 21, and 24 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0284] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 1, 4, 12, 13, 21, and 24 (counting from 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0285] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 1, 2, 12, 13, 23, and 24 (counting 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0286] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 1, 2, 7, 8, 17, 18, 23, and 24 (counting from 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0287] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 13–15 and 22–24 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0288] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 1-3 and 10-12 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0289] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, the nucleosides at positions 1, 6, 12, 13, 19, and 24 (counting 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0290] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, and each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside. In some embodiments, the antisense oligonucleotide contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate internucleoside linkages. In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage.

[0291] In some embodiments, the antisense oligonucleotides disclosed herein are 24-nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more) phosphorothioate nucleoside linkages and 2 or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or more) phosphodiester nucleoside linkages.

[0292] In some embodiments, the antisense oligonucleotides disclosed herein are 24 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the internucleoside links of the antisense oligonucleotide are phosphorothioate nucleoside links.

[0293] In some embodiments, the antisense oligonucleotides disclosed herein are 22-nucleoside length, and four or more (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12) nucleosides of the antisense oligonucleotide are LNA, and all of the remaining nucleosides are 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotides disclosed herein are 22-nucleoside length and contain one or more (e.g., 1, 2, or 3) motifs of 2 to 6 (e.g., 2, 3, 4, 5, or 6) consecutive 2'-4' crosslinked nucleosides (e.g., LNA, ENA, or cEt) within positions 1-5, 9-14, and / or 20-22. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages. In some embodiments, the antisense oligonucleotide comprises a mixture of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphodiester nucleoside linkages.

[0294] In some embodiments, the antisense oligonucleotides disclosed herein are 22 nucleoside long, the nucleosides at positions 1, 2, 10-13, 21, and 22 (counting from 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0295] In some embodiments, the antisense oligonucleotides disclosed herein are 22-nucleoside long, the nucleosides at positions 1, 2, 10-13, 21, and 22 (counted 5'->3') of the antisense oligonucleotide are LNAs, and all of the remaining nucleosides are 2'-MOE modified nucleosides, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) phosphorothioate nucleoside linkages and 5 or more (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more) phosphodiester nucleoside linkages.

[0296] In some embodiments, the antisense oligonucleotides disclosed herein are 22-nucleoside long, the nucleosides at positions 1, 2, 10-13, 21, and 22 (counted 5'->3') of the antisense oligonucleotide are LNAs, and all of the remaining nucleosides are 2'-MOE modified nucleosides, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) phosphorothioate nucleoside linkages and 12 or fewer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) phosphodiester nucleoside linkages.

[0297] In some embodiments, the antisense oligonucleotides disclosed herein are 22 nucleoside long, and each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside. In some embodiments, the antisense oligonucleotide contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate internucleoside linkages. In some embodiments, the antisense oligonucleotides disclosed herein are 22 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage.

[0298] In some embodiments, the antisense oligonucleotides disclosed herein are 22-nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or more) phosphorothioate nucleoside linkages and 2 or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) phosphodiester nucleoside linkages.

[0299] In some embodiments, the antisense oligonucleotides disclosed herein have a length of 22 nucleosides, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and each nucleoside linkage of the antisense oligonucleotide is a phosphorothioate nucleoside linkage. In some embodiments, the antisense oligonucleotides disclosed herein have a length of 19 nucleosides, where two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) nucleosides of the antisense oligonucleotide are LNAs, and all of the remaining nucleosides are 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, with two or more nucleosides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) being LNAs and all remaining nucleosides being 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotides disclosed herein have a 21-nucleoside length, where two or more nucleosides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) are LNAs, and all remaining nucleosides are 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotides disclosed herein have a 22-nucleoside length, where two or more nucleosides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) are LNAs, and all remaining nucleosides are 2'-MOE modified nucleosides.In some embodiments, the antisense oligonucleotides disclosed herein have a 23-nucleoside length, where two or more nucleosides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) are LNAs, and all remaining nucleosides are 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotides disclosed herein have a 24-nucleoside length, where two or more nucleosides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) are LNAs, and all remaining nucleosides are 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotides disclosed herein have a 24-nucleoside length, where four or more nucleosides (e.g., 4, 5, 6, 7, 8, 9, 10, 11, or 12) are LNAs, and all remaining nucleosides are 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotides disclosed herein have a 25-nucleoside length, where two or more nucleosides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) are LNAs, and all remaining nucleosides are 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotides disclosed herein are 26 nucleoside length, and two or more nucleosides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) of the antisense oligonucleotide are LNA, and all of the remaining nucleosides are 2'-MOE modified nucleosides. In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside length, and within positions 1-5, 9-13, and / or 16-20, contain one or more (e.g., 1, 2, or 3) motifs of 2-6 (e.g., 2, 3, 4, 5, or 6) consecutive 2'-4' crosslinked nucleosides (e.g., LNA, ENA, or cEt).In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages. In some embodiments, the antisense oligonucleotide comprises a mixture of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate nucleoside linkages and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphodiester nucleoside linkages.

[0300] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, the nucleosides at positions 1, 2, 19, and 20 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0301] In some embodiments, the antisense oligonucleotides disclosed herein are 21-nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, or more) phosphorothioate nucleoside linkages and 2 or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphodiester nucleoside linkages.

[0302] In some embodiments, the antisense oligonucleotides disclosed herein are 21 nucleoside long, the nucleosides at positions 1 and 21 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-O-NMA modified nucleosides, and each nucleoside linkage of the antisense oligonucleotide is a phosphorothioate nucleoside linkage.

[0303] In some embodiments, the antisense oligonucleotides disclosed herein are 21 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the internucleoside links of the antisense oligonucleotide are phosphorothioate nucleoside links.

[0304] In some embodiments, the antisense oligonucleotide disclosed herein is 20 nucleoside long, the nucleosides at positions 1, 2, 19, and 20 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, the antisense oligonucleotide contains two phosphodiester nucleoside linkages, and all of the remaining nucleoside linkages are phosphorothioate nucleoside linkages.

[0305] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, the nucleosides at positions 1, 2, 9, and 10 (counted 5'->3') of the antisense oligonucleotide are LNAs, all the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0306] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, the nucleosides at positions 9-12 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0307] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, the nucleosides at positions 11, 12, 19, and 20 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0308] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, the nucleosides at positions 1, 2, 10, 11, 19, and 20 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0309] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, the nucleosides at positions 1, 2, 4, and 5 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0310] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, the nucleosides at positions 16, 17, 19, and 20 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-MOE modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0311] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, or more) phosphorothioate nucleoside linkages and 2 or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or more) phosphodiester nucleoside linkages.

[0312] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, the nucleosides at positions 1 and 20 (counted 5'->3') of the antisense oligonucleotide are LNAs, all of the remaining nucleosides are 2'-O-NMA modified nucleosides, and each nucleoside linkage of the antisense oligonucleotide is a phosphorothioate nucleoside linkage.

[0313] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the internucleoside links of the antisense oligonucleotide are phosphorothioate nucleoside links.

[0314] In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, and each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside. In some embodiments, the antisense oligonucleotide contains one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate internucleoside linkages. In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage. In some embodiments, the antisense oligonucleotides disclosed herein are 20 nucleoside long, each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, the internucleoside links of the antisense oligonucleotide are phosphorothioate links, one or more nucleic acid bases at the 3' end of the first antisense sequence are complementary to one or more nucleic acid bases at the 3' end of the second target region, and / or one or more nucleic acid bases at the 5' end of the second antisense sequence are complementary to one or more nucleic acid bases at the 5' end of the first target region.

[0315] In some embodiments, the antisense oligonucleotides disclosed herein comprise one of the nucleic acid base sequences described herein (e.g., those listed in Tables 3 and 9) in the following pattern (5'->3'): MMMMMMMMMMMMMMMMMMMMMMMMMM, MMMMMMMMMMMMMMMMMMMMMMMMM, MMMMMMMMMMMMMMMMMMMMMMMMMM Normal MMMMMMMMMMMMMMMMMMMMMMMMM, MMMMMMMMMMMMMMMMMMMMMMMM Normal MMMMMMMMMMMMMMMMMMMMMM Normal MMMMMMMMMMMMMMMMMMMM Normal MMMMMMMMMMLLLLLLMMMMMMMMMM MMMMMMMMMLLLLLLMMMMMMMMM, MMMMMMMMMMLLLLLLMMMMMMLLLL LLLLMMMMMMLLLLLLMMMMMMMMMM LLLLMMMMMMLLLLMMMMMMLLLL LLLMMMMMMMLLLLLLMMMMMMMLLL, LLLLMMMMMMMLLLLMMMMMMMLLLL, LLLLMMMMMMMMMMMMMMMMMMMMLLLL MMMLMMMLMMMLMMMLMMMLMMML LMMLMMMMMMLLLLMMMMMMLMML, LMMLMMMMMMMLLMMMMMMMLMML, LLMMMMMMMMMLLMMMMMMMMMLL, LLMMMMLLMMMMMMMMMMMMMMLL MMMMMMMMMMMMLLLMMMMMMLLL, LLLMMMMMMLLLMMMMMMMMMMMM, LMMMMLMMMMMLLMMMMMLMMMML, LLMMMMMMMLLLLMMMMMMMLL, LLMMMMMMMMMMMMMMMMLL, LLMMMMMMLLMMMMMMMMMM, MMMMMMMMLLLLMMMMMMMM, MMMMMMMMMMLLMMMMMMLL, LLMMMMMMMLLMMMMMMMLL, LLMLLMMMMMMMMMMMMMMM, and MMMMMMMMMMMMMMMLLMLL It further includes a modified nucleoside selected from one of the following: In the sequence, M is a 2'-O-methoxyethyl (2'-MOE) modified nucleoside, and L is LNA.

[0316] In some embodiments, the antisense oligonucleotides disclosed herein comprise one of the nucleic acid base sequences described herein (e.g., those listed in Tables 3 and 9) in the following pattern (5'->3'): MLLMMMMMMMMMMMMMMMMMMMMMLL MMLLMMMMMMLLMMMMMMMMMMMMMM MMMMMLLMMMMMMMMMMMMMMMMMMM normal MMMMMLLMMMMMMMMMMMLLMMMMMM MMMMMMMMMMMLLLLMMMMMMMMMMM MLLMMMMMMMMMMMMMMMMMMMMMMM normal LLMMMMMMMMMMLLMMMMMMMMLL LLMMMMMMMMLLLLMMMMMMLLLL LLLLMMMMMMLLLLMMMMMMMMLL LLLLMMMMMMMLLMMMMMMMLLLL, LLLMMMMMMMLLLLMMMMMMMLLL, LLLMMMMMMMMLLMMMMMMMMLLL, LLMLLMMMMMLLLLMMMMMMLLLL, LLMMMMMMMMMMMMMMMMMMMMMMMM MMLLMMMMMMMMMMMMMMMMMMMMMM MMMMLLMMMMMMMMMMMMMMMMMMMM MMMMMMLLMMMMMMMMMMMMMMMMMM MMMMMMMMLLMMMMMMMMMMMMMMMM MMMMMMMMMMLLMMMMMMMMMMMMMM MMMMMMMMMMMMLLMMMMMMMMMMMM MMMMMMMMMMMMMMMLLMMMMMMMMMMMM, MMMMMMMMMMMMMMMMMLLMMMMMMMMMM, MMMMMMMMMMMMMMMMMMMMLLMMMMMM, MMMMMMMMMMMMMMMMMMMMMMMLLMMMM, MMMMMMMMMMMMMMMMMMMMMMMMMLLMM, MMMMMMMMMMMMMMMMMMMMMMMMMMMMLL, MMLLMMMMMMMMMMMMMMMMMMMMMMLLMM, MMMMLLMMMMMMMMMMMMMMMMLLMMMM, MMMMMMMMLLMMMMMMLLMMMMMMMMMM, LMMMMMMMMMMMMMMMMMMML, LLMMMMMMMMMMMMMMMMMMMMMMMMMMLL, MMMMMMMMLLMMMMMMMMMMMMMM, LLMMMLLMMMMMMMMMMMMMMLL, LLMMMMMLLMMMMMMMMMMLL, LLMMMMLLMMMMMMMMMMMMLL, LLMMMMMMMMMLLMMMMMMLL, LMMMMMMMMMMMMMMMMMMMMML, LMMMMMLLMMMMMMMMMMMMML, LLMMMMMMMMMMMMMMMMMMLL, LMMMMMMLLMMMMMMMMMMML, LMMMMMMLMMLMMMMMMMMMMML, MMLMMMLMMMMMMMMMMMMMLMMM, LMMMLMMMMMMMMMLMMMML, MMLLMMMMMMMMMMMMMMLLMM, MMMMMMLLMMMMLLMMMMMM, LLMMMMMMMMMMMMMMMMMMMMM, MMLLMMMMMMMMMMMMMMMMMMMM, MMMLLMMMMMMMMMMMMMMMMMM, MMMMMMLLMMMMMMMMMMMMMM, MMMMMMMMMLLMMMMMMMMMMMM, MMMMMMMMMMMLLMMMMMMMM, MMMMMMMMMMMMLLMMMMMM, MMMMMMMMMMMMMMMLLMMMM, MMMMMMMMMMMMMMMMMLLMM, MMMMMMMMMMMMMMMMMMMMLL, LLMMMMMMMMMMMMMMMMMMMMMMMM, MMLLMMMMMMMMMMMMMMMMMMMMMM, MMMLLMMMMMMMMMMMMMMMMMMMM, MMMMMMLLMMMMMMMMMMMMMMMM, MMMMMMMMMMMLLMMMMMMMMMM, MMMMMMMMMMMMMLLMMMMMMMM, MMMMMMMMMMMMMMMLLMMMMMM, MMMMMMMMMMMMMMMMMLLMMMM, MMMMMMMMMMMMMMMMMMMMLLM, MMMMMMMMMMMMMMMMMMMMMLL, MLMMMMMMMMMMMMMMMMMMMLM, MMMLMMMMMMMMMMMMMMMMMMMMM, MMMMMLMMMMMMMMMMMLMMMMM, MMMMMMMLMMMMMMLMMMMMMM, MLMMMMMMMMMMMMMMMMMMMLM, MMMLMMMMMMMMMMMMMLMMM, MMMMMMLMMMMMMMMLMMMMMM, MMMMMMMMMMMMMMMMMMMMMMM, LMMMMMMMMMMMMMMMMMMMMMMLM, MLMMMMMMMMMMMMMMMMMMMML, LMMMMMMMMMMMMMMMMMMMMMMMM, MMMMMMMMMMMMMMMMMMMMML, LMMMMMMMMMMMMMMMMMMMMMMMM, MMMMMMMMMMMMMMMMMMMMMML, LMMMMMMMMMMMMMMMMMMMMMML, LMMMMMMMMMMMMMMMMMMMMMMML, LMMMMMMMMMMMMMMMMMMMMMMMMML, LMMMMMMLMMMMMMMMMMMMMMM, MMMMMMLMMMMMMMMMMMMMML, MMMMMMMLLMMMMMMMMMMMMMM, LMMMMMMLMMMMMMMMMMMMMMM, MMMMMMMLMMMMMMMMMMMML, LMMMMMMMLMMMMMMMMMMMMMM, LMMMMMMMMMMLMMMMMMMMMMM, MMMMMMMMMMLMMMMMMMMML, MMMMMMMMLMMMMMMMMMMML, LMMMMMLMMMMMMMMMMMMMMMMMM, MMMMMMMLMMMMMMMMMMMMMMML, MMMMMMMLLMMMMMMMMMMMMMMMM, LMMMMMMLMMMMMMMMMMMMMMM, MMMMMMMMLMMMMMMMMMMMMML, LMMMMMMMLMMMMMMMMMMMMMM, MMMMMMMMMMLMMMMMMMMMMML, MMMMMMMMLMMMMMMMMMMMML, LMMMMMMMMLMMMMMMMMMMMMMM, LMMMMMMMMMMLMMMMMMMMMMM, MMMMMMMMMMMLMMMMMMMMMMML, L-nice L-nice beautiful-beautiful xdddMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM, zzMMMMMMMMzzzzMMMMMMMMzL、 zzzzMMMMMMzzzzMMMMMMzzzL、 enaMMMMMMMMMMMMMMMMMMMena, bMMMMMMMMMMMMMMMMMMMMb、 enaMMMMMMMMMMMMMMMMMMMMMena, scpMMMMMMMMMMMMMMMMMMMMscp、 bMMMMMMMMMMMMMMMMMMMMMb, LMMMMMMMMMMMMMMMMMMMMLM, MzMMMMMMMMMMMMMMMMzM, enaMMMMMMMMMMMMMMMMMMMenaM、 MenaMMMMMMMMMMMMMMMenaM, MenaMMMMMMMMMMMMMMMMMena, MzMMMMMMMMMMMMMMMMMMzM, MscpMMMMMMMMMMMMMMMMMMMMscp、 enaMMMMMMMMMMMMMMMMMMMenaM、 MenaMMMMMMMMMMMMMMMMMenaM、 MenaMMMMMMMMMMMMMMMMMMMena, xdddLMMMMMMMMMMMMMMMMMMMML, xdddLMMMMMMMMMMMMMMMMMMMMMML, MMMMMMMMMMMMM[n]MMMMMMMMMMMMMM, LMMMMMM[n]MMMMMMMMMMMML, RegularMMMMMM[n]MMMMMMMMMMMMML, LMMMMMMMM[n]MMMMMMMMMML, RegularMMMMMMMM[n]MMMMMMMMMMML, LMMMMMMM[n]MMMMMMMMMMML, and LMMMMMMM[n]MMMMMMMMMMMMML It further includes a modified nucleoside selected from one of the following: In the sequence, M is a 2'-O-methoxyethyl (2'-MOE) modified nucleoside, L is LNA, x is a C16 lipid, 6-[(1-oxohexadecyl)amino]hexyl]phosphoryl, [n] is a C3 or C6 spacer (e.g., C3 or C6 spacers shown in Table 16), d is DNA, ena is ENA, b is BNA(NC), z is AmNA, nma is a 2'O-NMA modified nucleoside, and scp is scpBNA.

[0317] In some embodiments, the antisense oligonucleotides disclosed herein follow the pattern (5'->3'): sssssssssssssssssssss-ssssss, sssssssssssssssssssss-sssss, ssssssssssssssssssss-ssss, sssssssssssssssssssss-sss, sssssssssssssssssssss-ss, sssssssssssssssssssss s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-o-o-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-o-o-s、 s-o-o-o-o-o-s-s-s-s-s-o-o-o-s-s-s-s-s-o-o-o-o-o-s、 s-s-s-s-s-s-s-s-s-o-o-o-o-o-o-o-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-o-o-s、 s-o-o-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-o-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-o-s、 s-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-s、 s-o-s-o-s-o-s-o-s-o-s-o-s-o-s-o-s-o-s-o-s-o-s-o-s、 s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-o-s、 s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 ssssssssoosssssssss-ss, sssssssssssssoossssss-ss, sssssssssssssssssssso-fax, soooddssssssssssoooos, sssssssssssssssoooosuke, ssssssssssoossssoosuke, soddsssssoooooosssssoos, soadssssssssssssss, ssssssoosssssssss, ssssssssssoossssss, and ssssssssssssssssoos It includes a modified nucleoside linkage that contains one of the following: In the sequence, s represents a phosphorothioate nucleoside linkage, and o represents a phosphodiester nucleoside linkage.

[0318] In some embodiments, the antisense oligonucleotides disclosed herein follow the pattern (5'->3'): sssssssssssssooosssoo-ooos, ssssssssssoossoosssss-ssss, sofreesssssssssssssssss-soos, s-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-o-o-o-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-o-o-s、 s-s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-o-o-o-s-s-s-s-s-s-s-s-s-s-s、 s-o-o-o-s-s-s-s-s-s-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s、 s-o-o-o-s-s-s-s-s-s-s-s-s-s-o-o-o-s-s-s-s-s-s-s-s、 s-o-o-s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-o-o-s-s-s-s-s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-o-o-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-s、 s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s、 s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-o-o-s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-o-o-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-o-o-o-s-s-s-s-s-s-s-s-s-s-s-o-o-o-s、 s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-s、 s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-s-s、 s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-o-o-s-s-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-s-s-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-s-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-s-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-o-o-s、 s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-o-o-s、 o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s、 o-o-o-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-s-o-o-o-s、 sssssssssssssssssssss-so, and ssssssssssssssssssss It includes a modified nucleoside linkage that contains one of the following: In the sequence, s represents a phosphorothioate nucleoside linkage, and o represents a phosphodiester nucleoside linkage.

[0319] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 1 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and each nucleoside linkage of the antisense oligonucleotide is a phosphorothioate nucleoside linkage.

[0320] In some embodiments, the antisense oligonucleotides disclosed herein include the nucleic acid base sequence of SEQ ID NO: 2 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and each nucleoside linkage of the antisense oligonucleotide is a phosphorothioate nucleoside linkage.

[0321] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 2 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or more) phosphorothioate nucleoside linkages and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more) phosphodiester nucleoside linkages.

[0322] In some embodiments, the antisense oligonucleotides disclosed herein include the nucleic acid base sequence of SEQ ID NO: 16 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and each nucleoside linkage of the antisense oligonucleotide is a phosphorothioate nucleoside linkage.

[0323] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 17 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and each nucleoside linkage of the antisense oligonucleotide is a phosphorothioate nucleoside linkage.

[0324] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide comprises a mixture of 10 or more (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or more) phosphorothioate nucleoside linkages and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more) phosphodiester nucleoside linkages.

[0325] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide comprises a mixture of 22 phosphorothioate nucleoside linkages and 3 phosphodiester nucleoside linkages.

[0326] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide comprises a mixture of 21 phosphorothioate nucleoside linkages and 4 phosphodiester nucleoside linkages.

[0327] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide comprises a mixture of 19 phosphorothioate nucleoside linkages and 6 phosphodiester nucleoside linkages.

[0328] In some embodiments, the antisense oligonucleotides disclosed herein include the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide includes modified nucleoside linkages including the following pattern (5'->3'):ssssssssssssssssssssso-ooos.

[0329] In some embodiments, the antisense oligonucleotides disclosed herein include the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide includes modified nucleoside linkages including the following pattern (5'->3'):ssssssssssssssssssssss-ooos.

[0330] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide comprises modified nucleoside linkages including the following pattern (5'->3'): soosssssssssssssoosssss-ssss.

[0331] In some embodiments, the antisense oligonucleotides disclosed herein include the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide includes modified nucleoside linkages including the following pattern (5'->3'): soossssssssssssssssssss-soos.

[0332] In some embodiments, the antisense oligonucleotides disclosed herein include the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside, and the antisense oligonucleotide includes modified nucleoside linkages including the following pattern (5'->3'): sooosssssssssssssssss-ooos.

[0333] In some embodiments, the antisense oligonucleotides disclosed herein include the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the antisense oligonucleotide includes modified nucleoside linkages including the following pattern (5'->3'): sssssssssssssssssssoo-ooos.

[0334] In some embodiments, the antisense oligonucleotides disclosed herein include the nucleic acid base sequence of SEQ ID NO: 9 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and each nucleoside linkage of the antisense oligonucleotide is a phosphorothioate nucleoside linkage.

[0335] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 2 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the inter-nucleoside linkages of the antisense oligonucleotide are phosphorothioate linkages.

[0336] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 93 and include chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2'-O-NMA modified nucleoside, and the inter-nucleoside linkages of the antisense oligonucleotide are phosphorothioate linkages.

[0337] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 455 and include chemical modifications, wherein the nucleosides at positions 1 and 20 (counted 5'->3') of the antisense oligonucleotide are LNAs, all remaining nucleosides are 2'-O-NMA modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0338] In some embodiments, the antisense oligonucleotides disclosed herein comprise the nucleic acid base sequence of SEQ ID NO: 461 and include chemical modifications, wherein the nucleosides at positions 1 and 21 (counted 5'->3') of the antisense oligonucleotide are LNAs, all remaining nucleosides are 2'-O-NMA modified nucleosides, and the internucleoside links of the antisense oligonucleotide are phosphorothioate links.

[0339] In some embodiments, any one of the antisense oligonucleotides disclosed herein may be linked to a lipid (e.g., a C16 lipid). In some embodiments, the lipid (e.g., a C16 lipid) targets muscle. In some embodiments, the lipid (e.g., a C16 lipid) is linked to the 5' nucleoside of the antisense oligonucleotide via a DNA linker. In some embodiments, the DNA linker is a phosphodiester d(TCA) linker, and each nucleoside linkage is a phosphodiester linkage.

[0340] In some embodiments, the antisense oligonucleotide comprises a first antisense sequence and a second antisense sequence, and includes chemical modifications (e.g., one or more modified nucleosides and / or linkages between one or more modified nucleosides). In some embodiments, the antisense oligonucleotide includes the structures provided in Table 5.

[0341] In some embodiments, the antisense oligonucleotide comprises a first antisense sequence and a second antisense sequence, and includes chemical modifications (e.g., one or more modified nucleosides and / or linkages between one or more modified nucleosides). In some embodiments, the antisense oligonucleotide includes the structures provided in Table 11.

[0342] [Table 8-1]

[0343] [Table 8-2]

[0344] [Table 8-3]

[0345] Table 8-4

[0346] Table 8-5

[0347] Table 8-6

[0348] Table 8-7

[0349] Table 8-8

[0350] Table 8-9

[0351] Table 8-10

[0352] Table 8-11

[0353] Table 8-12

[0354] Table 8-13

[0355] Table 8-14

[0356] Table 8-15

[0357] Table 8-16

[0358] Table 8-17

[0359] Table 9-1

[0360] Table 9-2

[0361] Table 9-3

[0362] Table 9-4

[0363] Table 9-5

[0364] Table 9-6

[0365] Table 9-7

[0366] Table 9-8

[0367] Table 9-9

[0368] Table 9-10

[0369] Table 9-11

[0370] Table 9-12

[0371] Table 9-13

[0372] Table 9-14

[0373] Table 9-15

[0374] Table 9-16

[0375] Table 9-17

[0376] Table 9-18

[0377] Table 9-19

[0378] Table 9-20

[0379] Table 9-21

[0380] Table 9-22

[0381] Secondary structure The term “secondary structure,” as used herein, means according to its generally known meaning, i.e., a stem or loop. In some embodiments, pharmaceutically acceptable secondary structures include, but are not limited to, hairpins, bulges, helices, inner loops, outer loops, multibranched loops, and pseudoknots. In some embodiments, an antisense oligonucleotide can induce a secondary structure between a first target region and a second target region of UNC13A premRNA. In some embodiments, an antisense oligonucleotide can induce a secondary structure between a first target region and a second target region of UNC13A premRNA by simultaneously binding to the first and second target regions. In some embodiments, the secondary structure induced by the oligonucleotide can inhibit the inclusion of UNC13A hidden exons in mature UNC13A mRNA. In some embodiments, the secondary structure induced by the oligonucleotide can restore UNC13A expression.

[0382] salt The term "salt," as used herein, means an ionic aggregate of anions and cations, according to its generally known meaning. In some embodiments, antisense oligonucleotides may be in the form of pharmaceutically acceptable salts. In some embodiments, pharmaceutically acceptable salts include inorganic salts such as monovalent or divalent inorganic salts. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, magnesium, and ammonium salts. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, the pharmaceutically acceptable salt is a magnesium salt. In some embodiments, the pharmaceutically acceptable salt is an ammonium salt. In some embodiments, the ammonium salt is represented by the formula: N(R)3, where each R is H or an alkyl having 1 to 6 carbon atoms.

[0383] Pharmaceutical composition Pharmaceutical compositions are provided that include one or more antisense oligonucleotides alone or in combination with prophylactic agents, therapeutic agents, and / or pharmaceutically acceptable carriers. Pharmaceutical compositions comprising antisense oligonucleotides provided herein, but which are not limited to, are intended for use in the diagnosis, detection, or monitoring of diseases, in the prevention, treatment, management, or improvement of a disease or one or more symptoms, and / or in research. In some embodiments, the pharmaceutical composition may further include any other suitable therapeutic agents for treating a subject, e.g., a human subject having a UNC13A-related disease (e.g., ALS, FTD, Alzheimer's disease, or LATE). In some embodiments, the other therapeutic agents may enhance or complement the efficacy of the complex disclosed herein. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%. In some embodiments, the subjects exhibit TDP-43 protein dysfunction. In some embodiments, the subjects have cytoplasmic aggregation of TDP-43 protein. In some embodiments, the subjects have cytoplasmic mislocalization of TDP-43 protein. In some embodiments, the subjects do not have SOD-1 gene mutations.In some embodiments, SOD-1 gene mutations are intronic, p.Ala5Val, p.Ala5Thr, p.Leu39Val, p.Gly42Ser, p.His44Arg, p.Leu85Val, p.Gly94Ala, p.Leu107Val, p.Val149Gly, p.Ala141Gly, p.Ala146Thr, p.Ala5Ser, p.Ala5Thr, p.Ala5Val, p.Ala90Thr, p.Ala90Val, p.Arg116Gly, p.Asn87Ser, p.Asp102Gly, p.Asp125Val, p.Asp91Ala, p.Gln23Leu, p.Glu101Gly, p.Glu101Lys, p.Glu50L This includes ys, p.Gly13Arg, p.Gly148Ser, p.Gly38Arg, p.Gly42Asp, p.Gly42Ser, p.Gly94Ala, p.Gly94Arg, p.Gly94Asp, p.Gly94Cys, p.Gly94Ser, p.His121Gln, p.His44Arg, p.His47Arg, p.Ile113Thr, p.Ile114Thr, p.Ile150Thr, p.Leu127Ser, p.Leu145Phe, p.Leu145Ser, p.Leu39Val, p.Leu85Phe, p.Phe21Ile, p.Phe65Leu, p.Thr138Ile, p.Val149Gly, or any combination thereof. In some embodiments, SOD-1 gene mutations are intronic, p.Ala5Val, p.Ala5Thr, p.Leu39Val, p.Gly42Ser, p.His44Arg, p.Leu85Val, p.Gly94Ala, p.Leu107Val, p.Val149Gly, p.Ala146Thr, p.Ala5Ser, p.Ala5Thr, p.Ala5Val, p.A This includes la90Thr, p.Asn87Ser, p.Asp102Gly, p.Gly13Arg, p.Gly42Ser, p.Gly94Ala, p.Gly94Arg, p.His121Gln, p.His44Arg, p.Ile150Thr, p.Leu39Val, p.Leu85Phe, p.Thr138Ile, p.Val149Gly, or any combination thereof.In some embodiments, the SOD-1 gene mutations include p.Ala5Val, p.Ala5Thr, p.Leu39Val, p.Gly42Ser, p.His44Arg, p.Leu85Val, p.Gly94Ala, p.Leu107Val, p.Val149Gly, or any combination thereof. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutations include rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0384] One aspect of this disclosure comprises a pharmaceutical composition comprising one of the antisense oligonucleotides disclosed herein. In some embodiments, the pharmaceutical composition comprises one of the antisense oligonucleotides disclosed herein and a pharmaceutically acceptable carrier. The pharmaceutical compositions disclosed herein are formulated for administration to a subject. In some embodiments, the formulations disclosed herein include excipients. In some embodiments, the excipients impart to the composition improved stability of the active ingredient, improved absorption, improved solubility, and / or (e.g., and) therapeutic enhancement. In some embodiments, the excipients are pH adjusters (e.g., sodium citrate, sodium phosphate, Tris base, or sodium hydroxide), vehicles (e.g., buffer solutions, petrolatum, dimethyl sulfoxide, or mineral oil), isotonic agents (e.g., sodium chloride, calcium chloride, magnesium chloride, potassium chloride, dextrose or sucrose, or D-mannitol), solubilizers (e.g., polysorbate, cyclodextrin), binders, disintegrants, or lubricants. Any one of the antisense oligonucleotides of this disclosure may be packaged in kits, containers, packs, or dispensers when added to a pharmaceutically acceptable excipient. The pharmaceutical compositions disclosed herein may be packaged in filled syringes or vials. In some embodiments, such carriers make it possible to formulate the pharmaceutical compositions as, for example, tablets, pills, sugar-coated tablets, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral administration by a subject. In some embodiments, the pharmaceutically acceptable carrier or diluent may be sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0385] In some embodiments, the delivery medium can be used to deliver antisense oligonucleotides to cells or tissues. The delivery medium is a compound that enhances the delivery of antisense oligonucleotides to cells or tissues. The delivery medium may, but is not limited to, polymers, e.g., amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), anti-transferrin peptides, anti-transferrin antibodies, lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines. In some embodiments, any one of the antisense oligonucleotides or pharmaceutical compositions disclosed herein can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, peptides, antibodies, viral vectors (e.g., AAV vectors), or other delivery systems available in the art.

[0386] In some embodiments, the pharmaceutical composition is formulated to be compatible with its intended route of administration. Non-limiting examples of routes of administration include intravenous, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-articular, synovial, intrathecal, or intraventricular routes. In some embodiments, the route of administration is intrathecal or intraventricular. In some embodiments, the route of administration is subcutaneous.

[0387] kit One aspect of this disclosure comprises a kit comprising any one of the antisense oligonucleotides disclosed herein or a pharmaceutical composition disclosed herein. In some embodiments, the kit is for the treatment of UNC13A-related diseases disclosed herein (e.g., ALS, FTD, Alzheimer's disease, or LATE). In some embodiments, the kit further comprises additional activators disclosed herein.

[0388] method Some aspects of this disclosure provide methods for inhibiting the inclusion of UNC13A hidden exons in mature UNC13A mRNA in cells. In some embodiments, a method for inhibiting the inclusion of UNC13A hidden exons in mature UNC13A mRNA in cells includes contacting cells with any of the antisense oligonucleotides disclosed herein or any of the pharmaceutical compositions disclosed herein, thereby inhibiting the inclusion of UNC13A hidden exons in mature UNC13A mRNA in cells.

[0389] Some aspects of this disclosure provide methods for restoring UNC13A expression (e.g., at the mRNA level and / or protein level) in cells. In some embodiments, the method for restoring UNC13A expression includes contacting cells with any one of the antisense oligonucleotides disclosed herein or any one of the pharmaceutical compositions disclosed herein to thereby restore UNC13A expression (e.g., at the mRNA level and / or protein level) in the cells. In some embodiments, contacting cells with any one of the antisense oligonucleotides disclosed herein restores UNC13A expression levels (e.g., at the mRNA level and / or protein level) by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to UNC13A expression in cells that have not been contacted with the antisense oligonucleotide. In some embodiments, the cells are in vitro (e.g., in cell culture). In some embodiments, the cells are in vivo (e.g., within a subject).

[0390] This disclosure also provides methods for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA in target cells. In some embodiments, a method for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA in cells comprises administering to a target one of the antisense oligonucleotides disclosed herein or one of the pharmaceutical compositions disclosed herein, thereby inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA in cells.

[0391] This disclosure also provides methods for restoring UNC13A expression (e.g., mRNA and / or protein levels) in a subject compared to baseline pre-treatment levels. In some embodiments, the method involves administering one of the antisense oligonucleotides disclosed herein or one of the pharmaceutical compositions disclosed herein to a subject. The UNC13A expression level (e.g., mRNA and / or protein levels) in the subject is restored in the subject's cells, cell populations, tissues, blood, and / or other fluids. In some embodiments, the method further includes determining the UNC13A expression (e.g., mRNA and / or protein levels) in a sample derived from the subject (e.g., UNC13A levels in a blood or serum sample). The level of UNC13A in a sample can be measured by common methods known in the art.

[0392] In some embodiments, the subject in any one of the methods disclosed herein is a non-human primate or rodent. In some embodiments, the subject is human. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits a reduction in expression of the TDP-43 gene or protein of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% compared to TDP-43 expression in healthy subjects or subjects without UNC13A-related diseases (e.g., ALS, FTD, Alzheimer's disease, or LATE). In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation.In some embodiments, SOD-1 gene mutations are intronic, p.Ala5Val, p.Ala5Thr, p.Leu39Val, p.Gly42Ser, p.His44Arg, p.Leu85Val, p.Gly94Ala, p.Leu107Val, p.Val149Gly, p.Ala141Gly, p.Ala146Thr, p.Ala5Ser, p.Ala5Thr, p.Ala5Val, p.Ala90Thr, p.Ala90Val, p.Arg116Gly, p.Asn87Ser, p.Asp102Gly, p.Asp125Val, p.Asp91Ala, p.Gln23Leu, p.Glu101Gly, p.Glu101Lys, p.Glu50L This includes ys, p.Gly13Arg, p.Gly148Ser, p.Gly38Arg, p.Gly42Asp, p.Gly42Ser, p.Gly94Ala, p.Gly94Arg, p.Gly94Asp, p.Gly94Cys, p.Gly94Ser, p.His121Gln, p.His44Arg, p.His47Arg, p.Ile113Thr, p.Ile114Thr, p.Ile150Thr, p.Leu127Ser, p.Leu145Phe, p.Leu145Ser, p.Leu39Val, p.Leu85Phe, p.Phe21Ile, p.Phe65Leu, p.Thr138Ile, p.Val149Gly, or any combination thereof. In some embodiments, SOD-1 gene mutations are intronic, p.Ala5Val, p.Ala5Thr, p.Leu39Val, p.Gly42Ser, p.His44Arg, p.Leu85Val, p.Gly94Ala, p.Leu107Val, p.Val149Gly, p.Ala146Thr, p.Ala5Ser, p.Ala5Thr, p.Ala5Val, p.A This includes la90Thr, p.Asn87Ser, p.Asp102Gly, p.Gly13Arg, p.Gly42Ser, p.Gly94Ala, p.Gly94Arg, p.His121Gln, p.His44Arg, p.Ile150Thr, p.Leu39Val, p.Leu85Phe, p.Thr138Ile, p.Val149Gly, or any combination thereof.In some embodiments, the SOD-1 gene mutations include p.Ala5Val, p.Ala5Thr, p.Leu39Val, p.Gly42Ser, p.His44Arg, p.Leu85Val, p.Gly94Ala, p.Leu107Val, p.Val149Gly, or any combination thereof. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutations include rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof. In some embodiments, the subject is a patient, for example, a human patient who has or is suspected of having the disease. In some embodiments, the subjects are human patients who have or are suspected of having a disease associated with UNC13A-related disease and / or TDP-43 dysfunction in the subjects. In some embodiments, the disease associated with UNC13A-related disease and / or TDP-43 dysfunction in the subjects is a neurodegenerative disease. In some embodiments, the neurodegenerative disease is ALS or FTD. In some embodiments, the neurodegenerative disease is Alzheimer's disease. In some embodiments, the neurodegenerative disease is LATE. In some embodiments, neurodegenerative diseases include frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial sensorimotor neuropathy (FOSMN), age-related TDP-43 sclerosis (CARTS), Parkinson's disease, Guam-Parkinson's dementia complex (G-PDC), multiple system proteinosis (MSP), chronic traumatic encephalopathy (CTE), autism, hippocampal sclerosis (HS), hippocampal sclerotic dementia, Down syndrome, Huntington's disease, multiple sclerosis, Perry's disease, peripheral myopathy, polyglutamine disease (e.g., spinocerebellar ataxia 3, myopathy, and chronic traumatic encephalopathy), Rasmussen's encephalitis, attention deficit hyperactivity disorder, autism, central pain syndrome, anxiety disorder, or depression.

[0393] One aspect of this disclosure includes a method for treating a subject having a UNC13A-related disease (e.g., a disease associated with abnormal UNC13A expression). In some embodiments, the method includes administering one of the antisense oligonucleotides disclosed herein or a pharmaceutical composition disclosed herein to a subject. In some embodiments, the method results in treatment of a subject having a UNC13A-related disease (e.g., a disease associated with abnormal UNC13A expression). In some embodiments, the disease is a neurodegenerative disease. In some embodiments, the neurodegenerative disease is ALS. In some embodiments, the neurodegenerative disease is FTD. In some embodiments, the neurodegenerative disease is Alzheimer's disease. In some embodiments, the neurodegenerative disease is LATE. In some embodiments, neurodegenerative diseases include frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial sensorimotor neuropathy (FOSMN), age-related TDP-43 sclerosis (CARTS), Parkinson's disease, Guam-Parkinson's dementia complex (G-PDC), multiple system proteinosis (MSP), chronic traumatic encephalopathy (CTE), autism, hippocampal sclerosis (HS), hippocampal sclerotic dementia, Down syndrome, Huntington's disease, multiple sclerosis, Perry's disease, peripheral myopathy, polyglutamine disease (e.g., spinocerebellar ataxia 3, myopathy, and chronic traumatic encephalopathy), Rasmussen's encephalitis, attention deficit hyperactivity disorder, autism, central pain syndrome, anxiety disorder, or depression.

[0394] One aspect of this disclosure includes a method for treating subjects having a disease associated with TDP-43 dysfunction in the subject. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein. In some embodiments, the subject exhibits reduced expression of the TDP-43 gene or protein by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% compared to TDP-43 expression in a healthy subject. In some embodiments, the subject exhibits dysfunction of the TDP-43 protein. In some embodiments, the subject has cytoplasmic aggregation of the TDP-43 protein. In some embodiments, the subject has cytoplasmic mislocalization of the TDP-43 protein. In some embodiments, the subject does not have an SOD-1 gene mutation. In some embodiments, SOD-1 gene mutations are intronic, p.Ala5Val, p.Ala5Thr, p.Leu39Val, p.Gly42Ser, p.His44Arg, p.Leu85Val, p.Gly94Ala, p.Leu107Val, p.Val149Gly, p.Ala141Gly, p.Ala146Thr, p.Ala5Ser, p.Ala5Thr, p.Ala5Val, p.Ala90Thr, p.Ala90Val, p.Arg116Gly, p.Asn87Ser, p.Asp102Gly, p.Asp125Val, p.Asp91Ala, p.Gln23Leu, p.Glu101Gly, p.Glu101Lys, p.Glu50L This includes ys, p.Gly13Arg, p.Gly148Ser, p.Gly38Arg, p.Gly42Asp, p.Gly42Ser, p.Gly94Ala, p.Gly94Arg, p.Gly94Asp, p.Gly94Cys, p.Gly94Ser, p.His121Gln, p.His44Arg, p.His47Arg, p.Ile113Thr, p.Ile114Thr, p.Ile150Thr, p.Leu127Ser, p.Leu145Phe, p.Leu145Ser, p.Leu39Val, p.Leu85Phe, p.Phe21Ile, p.Phe65Leu, p.Thr138Ile, p.Val149Gly, or any combination thereof.In some embodiments, SOD-1 gene mutations are intronic, p.Ala5Val, p.Ala5Thr, p.Leu39Val, p.Gly42Ser, p.His44Arg, p.Leu85Val, p.Gly94Ala, p.Leu107Val, p.Val149Gly, p.Ala146Thr, p.Ala5Ser, p.Ala5Thr, p.Ala5Val, p.A The SOD-1 gene mutations include la90Thr, p.Asn87Ser, p.Asp102Gly, p.Gly13Arg, p.Gly42Ser, p.Gly94Ala, p.Gly94Arg, p.His121Gln, p.His44Arg, p.Ile150Thr, p.Leu39Val, p.Leu85Phe, p.Thr138Ile, p.Val149Gly, or any combination thereof. In some embodiments, the SOD-1 gene mutations include p.Ala5Val, p.Ala5Thr, p.Leu39Val, p.Gly42Ser, p.His44Arg, p.Leu85Val, p.Gly94Ala, p.Leu107Val, p.Val149Gly, or any combination thereof. In some embodiments, the subject has a UNC13A gene mutation in intron 20. In some embodiments, the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof. In some embodiments, the method involves administering one of the antisense oligonucleotides disclosed herein or a pharmaceutical composition disclosed herein to the subject. In some embodiments, the method results in the treatment of a subject having a disease associated with TDP-43 dysfunction. In some embodiments, the disease is a neurodegenerative disease. In some embodiments, the neurodegenerative disease is ALS. In some embodiments, the neurodegenerative disease is FTD. In some embodiments, the neurodegenerative disease is Alzheimer's disease. In some embodiments, the neurodegenerative disease is LATE.In some embodiments, neurodegenerative diseases include frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial sensorimotor neuropathy (FOSMN), age-related TDP-43 sclerosis (CARTS), Parkinson's disease, Guam-Parkinson's dementia complex (G-PDC), multiple system proteinosis (MSP), chronic traumatic encephalopathy (CTE), autism, hippocampal sclerosis (HS), hippocampal sclerotic dementia, Down syndrome, Huntington's disease, multiple sclerosis, Perry's disease, peripheral myopathy, polyglutamine disease (e.g., spinocerebellar ataxia 3, myopathy, and chronic traumatic encephalopathy), Rasmussen's encephalitis, attention deficit hyperactivity disorder, autism, central pain syndrome, anxiety disorder, or depression.

[0395] In some embodiments, the method described above further includes administering an additional agent to treat a UNC13A-related disorder (e.g., a disorder associated with abnormal UNC13A expression) and / or a disorder associated with TDP-43 dysfunction in the subject.

[0396] Although some embodiments have been described in detail above, the implementation of the present invention will be more fully understood from the following embodiments, which are provided herein for illustrative purposes only and should not be construed as limiting the invention in any way. [Examples]

[0397] [Example 1] Synthesis of oligonucleotides Automated solid-support synthesis of 331 oligonucleotides was performed using an nS8-II oligonucleotide synthesizer (GeneDesign). The antisense oligonucleotides correspond to ASO1-331 and 350-814 in Tables 3, 5, 9, and 11. All oligonucleotides were synthesized using low-support Unylinker® universal solid support (1 μmol scale, 42.6 μmol / g, ChemGenes, N-4000-10). The solid-support synthesis protocol is shown in Table 6 below.

[0398] Table 10

[0399] At the end of the solid-phase synthesis, the cyanoethyl protecting group was removed by treatment with 10% diethylamine in acetonitrile for 10 minutes. The solid support was dried by blowing argon gas and placed in a 2 mL microtube. 500 μL of concentrated aqueous ammonia was added to the tube, and the support was treated at 60°C for 8 hours. For AmNA(R=Me)-containing oligonucleotides, 500 μL of tert-butylamine-MeOH-water (1 / 1 / 2) solution was added to the tube, and the support was treated at 65°C for 7 hours. (Masaki Yamagami et. al., 1P-40 Synthesis and Properties of Antisense Oligonucleotides Containing AmNA and GuNA, The 46th International Symposium on Nucleic Acids Chemistry & The 3rd Annual Meeting of Japan Society of Nucleic Acids Chemistry on Oct 29th). Antisense oligonucleotides were isolated using a cartridge purification system (Glen-Pak® DNA purification cartridge, #60-5200, according to the provided manual) to obtain aqueous solutions containing the purified oligonucleotides. A Thermo Scientific SAVANT SPD2010 SpeedVac Concentrator was used for distillation of volatile components. Quantification of antisense oligonucleotides was performed based on UV absorbance measurements using an Unchained Labs LUNATIC. Oligonucleotides were analyzed for characterization using a Waters Xevo G2-XS Qtof UPLC-MS system (ESI-Qtof) with an ACQUITY UPLC OST C18 (1.7 μm, 2.1 × 50 mm) column. Elutions were 240 mM hexafluoroisopropanol / 7 mM triethylamine aqueous solution containing 5% MeOH and methanol solution (100% MeOH). The samples were lyophilized to obtain a white powder. The molecular weight of the antisense oligonucleotides was confirmed by molecular weight measurement by mass spectrometry. A subset of antisense oligonucleotides was selected for testing in Example 2.

[0400] Alternative methods for oligonucleotide synthesis Automated solid-support synthesis of oligonucleotides was performed using the nS8-II oligonucleotide synthesizer (GeneDesign). All oligonucleotides were synthesized using low-support Unylinker® universal solid support (1.5 μmol scale, 42.6 μmol / g, ChemGenes, N-4000-10). The detailed protocol for nS8-II is shown in Table 7 below.

[0401] [Table 11]

[0402] At the end of the solid-phase synthesis, the cyanoethyl protecting group was removed by treatment with 10% diethylamine in acetonitrile for 10 minutes. The synthesis was repeated three times on a 1.5 μmol scale, and these were combined to a total scale of 4.5 μmol. Subsequent experiments were then carried out using this combined volume. The solid support was dried by blowing argon gas and placed in a 2 mL microtube. 500 μL of concentrated aqueous ammonia was added to the tube, and the support was treated at 60°C for 8 hours. Oligonucleotides were isolated using a cartridge purification system (Glen-Pak® DNA purification cartridge, #60-5200, according to the provided manual) to obtain an aqueous solution containing purified oligonucleotides. A Thermo Scientific SAVANT SPD2010 SpeedVac Concentrator was used for distillation of volatile components. The obtained solution was filtered through a 0.20 μm filter (ADVANTEC, DISMIC:13CP020AS). The UV absorbance of the solution was measured, and the sample was then lyophilized to obtain a white powder. Oligonucleotides were analyzed for characterization using a Waters Xevo G2-XS Qtof UPLC-MS system (ESI-Qtof) with an ACQUITY UPLC OST C18 (1.7 μm, 2.1 × 50 mm) column. Elutions were 240 mM hexafluoroisopropanol / 7 mM triethylamine aqueous solution containing 5% MeOH and methanol solution (100% MeOH). Since the mass spectra were observed as polyvalent ions rather than molecular ion peaks, this data represents calculated values ​​obtained by deconvolution using a Waters MassLynx such as MaxEnt1. Oligonucleotide quantification was performed based on UV absorbance measurements at Unchained Labs LUNATIC. The molecular weight of antisense oligonucleotides was confirmed by molecular weight measurement by mass spectrometry.

[0403] Synthesis of 2'-O-NMA modified oligonucleotides Automated solid-support synthesis of 2'-O-NMA-modified oligonucleotides was performed using an nS8-II oligonucleotide synthesizer (GeneDesign). All oligonucleotides were synthesized using low-support Unylinker® universal solid support (1 μmol scale, 42.6 μmol / g, ChemGenes, N-4000-10). The solid-support synthesis protocol is shown in Table 17.

[0404] [Table 12]

[0405] At the end of the solid-phase synthesis, the cyanoethyl protecting group was removed from the solid support by treating it with 10% diethylamine in acetonitrile for 10 minutes. The solid support was dried by blowing argon gas and placed in a 2 mL microtube. Next, 500 μL of concentrated aqueous ammonia was added to the tube and the mixture was incubated at 65°C for 15 minutes. Then, 500 μL of 40% methylamine was added and the solution was incubated for a further 15 minutes in a 1:1 aqueous ammonia to methylamine ratio. Volatile components were removed using a Thermo Scientific SAVANT SPD2010 SpeedVac Concentrator. The resulting solution was filtered through a 0.20 μm filter (ADVANTEC, DISMIC:13CP020AS) and purified by HPLC using a C18 reverse-phase column (Xbridge @Oligonucleotide BEH C18, 10 mm × 50 mm, 130A, 2.5 μm) with a 10% to 70% mobile phase B gradient over 30 minutes. Mobile phase A consisted of 240 mM hexafluoroisopropanol and 7 mM triethylamine in an aqueous solution containing 5% methanol, while mobile phase B was 100% methanol. The purified DMT-ON fraction was collected and lyophilized. The resulting lyophilized powder was dissolved in 1 mL of distilled water and subjected to detritylation using a cartridge purification system (Glen-Pak® DNA purification cartridge, #60-5200) according to the manufacturer's instructions to obtain an aqueous solution containing purified oligonucleotide. Volatile components were removed again using a Thermo Scientific SAVANT SPD2010 SpeedVac Concentrator. The final solution was filtered through a 0.20 μm filter (ADVANTEC, DISMIC:13CP020AS) and its UV absorbance was measured. The purified sample was then lyophilized to obtain a white powder. Oligonucleotides were analyzed for characterization using a Waters Xevo G2-XS Qtof UPLC-MS system (ESI-Qtof) with an ACQUITY UPLC OST C18 (1.7 μm, 2.1 × 50 mm) column.The eluates were a 240 mM hexafluoroisopropanol / 7 mM triethylamine aqueous solution containing 5% MeOH and a methanol solution (100% MeOH).

[0406] Since the mass spectra were observed as multivalent ion fragment ions rather than molecular ion peaks, this data represents calculated values ​​obtained by deconvolution using Waters MassLynx, such as MaxEnt1. Oligonucleotide quantification was performed based on UV absorbance measurements at Unchained Labs LUNATIC. The molecular weight of antisense oligonucleotides was confirmed by molecular weight measurements measured by mass spectrometry.

[0407] Synthesis of C16 conjugate oligonucleotides Oligonucleotides were chemically synthesized using the deoxynucleoside phosphoramidite method with the AKTA oligopilot plus 10 system. (Solid support: UnyLinker® NittoPhase® 341 umol / g). 5'-TFA-amino modified C6 CE-phosphoamidite (Glen research, 10-1916-02) was used at the end of the coupling cycle. The solid support synthesis protocol is shown in Table 18.

[0408] [Table 13]

[0409] At the end of the solid-phase synthesis, the cyanoethyl protecting group was removed by treatment with 10% diethylamine in acetonitrile for 10 minutes. After transferring the solid-phase support from the column reactor to a 15 mL Falcon tube, 4 mL of aqueous ammonia was added to the tube, and the support was treated at 60°C for 8 hours. After filtering the reaction solution, nitrogen gas was blown into the filtrate to remove ammonia. The solution was then freeze-dried. The residue was dissolved in water (2 mL), and 300 μL of 3 M aqueous sodium acetate solution (pH=7.0) was added to the solution. EtOH was added to this solution, and the resulting white suspension was centrifuged. The supernatant was removed by decantation, and the residue was dissolved in water. Quantification of antisense oligonucleotides was performed based on UV absorbance measurements using Unchained Labs LUNATIC. Oligonucleotides were analyzed for characterization using a Waters Xevo G2-XS Qtof UPLC-MS system (ESI-Qtof) with an ACQUITY UPLC OST C18 (1.7 μm, 2.1 × 50 mm) column. Elutions were 240 mM hexafluoroisopropanol / 7 mM triethylamine aqueous solution containing 5% MeOH and methanol solution (100% MeOH). The samples were lyophilized to obtain C6 aminoconjugate oligonucleotides without further purification.

[0410] Crude C6 aminoconjugate oligonucleotides were dissolved in water. N,N-diisopropylethylamine (100 equivalents) and N-hydroxysuccinimide palmitate (10 equivalents), dissolved in DMSO, were added to the substrate solution. The reaction mixture was incubated at 45°C for 10 hours. 3M sodium acetate aqueous solution (pH=7.0) was added to this solution. EtOH was added to this solution, and the resulting white suspension was centrifuged. The supernatant was removed by decantation, and the residue was dissolved in water. The mixture was purified by HPLC (XBridge, OST C18 column, 2.5 μm, 10 × 50 mm, 0.1 M TEAA in DW / 0.1 M TEAA in MeCN, 10% to 60% in 30 minutes). The fraction containing the target product was evaporated, the residue was dissolved in water, and 3M NaOAc aqueous solution was added to the solution for anion exchange. EtOH was added to this solution, and the resulting white suspension was centrifuged. The supernatant was removed by decantation, and the residue was dissolved in water. The solution was then lyophilized to obtain C16 conjugated oligonucleotides. The oligonucleotides were analyzed for characterization using a Waters Xevo G2-XS Qtof UPLC-MS system (ESI-Qtof) with an ACQUITY UPLC OST C18 (1.7 μm, 2.1 × 50 mm) column. The eluates were a 240 mM hexafluoroisopropanol / 7 mM triethylamine aqueous solution containing 5% MeOH and a methanol solution (100% MeOH).

[0411] Since the mass spectra were observed as multivalent ion fragment ions rather than molecular ion peaks, this data represents calculated values ​​obtained by deconvolution using Waters MassLynx, such as MaxEnt1. Oligonucleotide quantification was performed based on UV absorbance measurements at Unchained Labs LUNATIC. The molecular weight of antisense oligonucleotides was confirmed by molecular weight measurements measured by mass spectrometry.

[0412] [Example 2] Activity of antisense oligonucleotides in vivo This example demonstrates that the antisense oligonucleotide disclosed herein inhibits the inclusion of hidden exons (CE) in UNC13A mRNA.

[0413] A single-stranded adeno-associated virus vector 9 (ssAAV9) (ssAAV9-SYN1-hUNC13A (SEQ ID NO: 328)) encoding the UNC13A exon 20-intron 20-exon 21 sequence and a portion of the intron 21 sequence, driven by the human synapsin I promoter and conjugated with alternative primer binding sites upstream and downstream of the UNC13A sequence, was generated by VectorBuilder. ssAAV9-SYN1-hUNC13A (2 μL of 1.0 × 10⁻⁶) 13Genome copies / mL were injected into the right dorsal hippocampus of 8-week-old mice. One week later, to knock down endogenous mouse Tardbp(TDP-43), mice were administered either an antisense oligonucleotide (2.5 mM, 2 μL) (5'-AAGGCttcatattgtACTTT-3' (SEQ ID NO: 317) (hereinafter referred to as "TardbpASO")) targeting mouse Tardbp(TDP-43), which has a phosphorothioate backbone, where lowercase letters indicate deoxyribonucleosides, uppercase letters indicate 2'-O-methoxyethyl modified nucleosides, and the base "C" or "c" indicates 5'-methylcytosine, or phosphate-buffered saline (PBS) (2 μL) (control, TardbpASO(-)) by intrahippocampal injection. The antisense oligonucleotide targeting mouse Tardbp was developed by Gene Design. Synthesized by Co., Ltd. (Osaka, Japan). One week after injection, test antisense oligonucleotides (10 μL at 1.0 mM) or PBS (10 μL) (control, test antisense oligonucleotide(-)) were injected into the cerebral ventricles. The test antisense oligonucleotides correspond to ASO1, 2, 8, 9, 14, 16, 17, 80, 144, 145, 149, 164, 193, 194, 214, 220, 222, 235, 238, 276, and 328 in Tables 3 and 5. Mice were euthanized 14 days after injection of the test antisense oligonucleotides, and the right dorsal hippocampus was isolated. Total RNA was extracted using QIAzol Lysis Reagent (Qiagen, 79306) and RNeasy Mini Kit (Qiagen, 74106), and SuperScript IV VILO Master according to the manufacturer's protocol. Reverse transcription was performed using Mix (Invitrogen, 11756050). RT-qPCR was performed using a QuantStudio 7 Flex real-time PCR system with TaqPath qPCR master mix and CG (Applied Biosystems, A15297).The expression levels of mouse Tardbp (TDP-43) and mouse Actb (Actb) were evaluated using Thermofisher TaqMan Gene Expression Assays: Tardbp (TDP-43) (ID: Mm01257504_g1) and Actb (ID: Mm00607939_s1). To detect splicing and normal splicing of the UNC13A hidden exon (CE), the following primer and probe sequences were synthesized by Integrated DNA Technologies (IDT) and used: UNC13A_CE FWD5'-3'CCCCGTACCATGTCCAGTACA (SEQ ID NO: 320), UNC13A_CE REV 5'-3'CATTCACCAGCATTTATTCAACAAA (SEQ ID NO: 321), UNC13A_CE probe 5'-3' / 56-FAM / CTGCATGAG / ZEN / CTGCCT / 3IABkFQ / ; UNC13A minigene_Normal FWD5'-3'CTCACTAAAGGGAACAAGCGA (SEQ ID NO: 322), UNC13A minigene_Normal REV5'-3'GTGGAACAGGTTCTCATGC (SEQ ID NO: 323), UNC13A minigene_Normal probe 5'-3' / 56-FAM / CAGTGTGGA / ZEN / GATCAAAGGCGAGGA / 3IABkFQ / (Sequence ID 324).

[0414] Each target expression level was calculated using absolute quantification. Mouse Tardbp expression levels were normalized by mouse Actb, and UNC13A hidden exon (CE) expression levels were normalized by the expression levels of normal UNC13A derived from minigenes (detected using UNC13A minigene_Normal primer and probe). To calculate the TDP-43 knockdown level in the Tardbp ASO-treated group, the mean expression values ​​of the control group (Tardbp ASO untreated group and test antisense oligonucleotide untreated group) were used for normalization (100%: Tardbp ASO(-), test antisense oligonucleotide(-) group). For UNC13A CE values ​​normalized by normal UNC13A derived from minigenes, the mean expression values ​​of the control group (Tardbp ASO-treated group and test antisense oligonucleotide untreated group) were used for normalization (100%: Tardbp ASO(+), test antisense oligonucleotide(-)). When multiple tests were performed, the average of those values ​​was calculated.

[0415] The results are shown in Table 8 below.

[0416] [Table 14]

[0417] The results show that all the antisense oligonucleotides tested in Table 8 inhibited the inclusion of CE in UNC13A mRNA.

[0418] The same experiment was performed using additional test antisense oligonucleotides corresponding to ASO81, 107, 324, 327, 369, 373, 396, 486, 494, 495, 514, 521, 532, 561, 603, 629, 631, 632, 633, 650, 660, 663, 692, 726, and 328 in Tables 3, 9, 5, and 11. The results are shown in Table 12 below.

[0419] [Table 15]

[0420] The results show that all antisense oligonucleotides tested in Table 12 inhibited the inclusion of CE in UNC13A mRNA.

[0421] [Example 3] In vivo activity of antisense oligonucleotides (hUNC13A BAC Tg mouse) This example demonstrates that the antisense oligonucleotides (ASOs) disclosed herein inhibited the inclusion of hidden exons (CEs) in UNC13A mRNA in a human UNC13A BAC transgenic (Tg) mouse model. This mouse model was prepared by Tokushu Immunology Laboratory Co., Ltd. as follows: Following an improved method of Abe et al. (Exp Anim. 2004 53(4):311-320. Establishment of an efficient BAC transgenesis protocol and its application to functional characterization of the mouse Brachyury locus), a human CH17-170L19 BAC clone (BACPAC GENOMICS,INC) containing the human UNC13A gene was purified using a plasmid extraction kit and linearized by reaction with PI-SceI. The linearized DNA was separated on an agarose gel, extracted using electroelution, and dialyzed with TE buffer prepared for microinjection. The purified DNA fragments were applied to a pulsed-field gel, and their high purity and lack of fragmentation were evaluated by measuring the DNA concentration using a NanoDrop spectrophotometer (Asahi Techno Glass Corporation). The DNA solution was diluted to 0.5 ng / μl and stored at 4°C until use for injection. PCR was performed using the following primers to verify the human UNC13A locus contained in the BAC clone: ​​PCR-A FWD 5'-3'GGTCTGCACAGGAGGAAACC (SEQ ID NO: 536), PCR-A REV 5'-3'CCACACGACCCCTCCAGCAG (SEQ ID NO: 537). To validate the purified BAC clones, PCR was performed using the following primers: PCR-B FWD 5'-3'CTACGAGCATGTCATGAAGTTGC (SEQ ID NO: 538), PCR-B REV 5'-3'AAGCCCATTCATTCCTAGTGCTG (SEQ ID NO: 539), PCR-C FWD 5'-3'ACATCCCTCAGAGTGTTGTGTCA (SEQ ID NO: 540), PCR-C REV5'-3'CCTGGGGAGGAGAATGAGGTAAA (Sequence ID 541). DNA was injected into the pronucleus of a C57BL / 6J mouse fertilized egg. After injection, the embryo was transferred into the unilateral fallopian tube of a female mouse. Genotyping and Southern blotting analysis of F0 mice were performed using the following primers and probes: PCR-1 FWD 5'-3'ACATCCCTCAGAGTGTTGTGTCA (SEQ ID NO: 540), PCR-1 REV 5'-3'CCTGGGGAGGAGAATGAGGTAAA (SEQ ID NO: 541), PCR-2 FWD 5'-3'TCCATTGAAGTGCATGTGTGTAG (SEQ ID NO: 542), PCR-2 REV 5'-3'GGGACCATAAGAGCTAAAGTTGG (SEQ ID NO: 543), PCR-3 FWD 5'-3'GCATTTGAAAGGTCTCAACTGTATT (SEQ ID NO: 544), PCR-3 REV 5'-3'TTGTTGCTGATGAATCTTGTGTG (SEQ ID NO: 545), PCR-4 FWD 5'-3'GGGAATTTATCTGAAGACCAAGC (SEQ ID NO: 546), PCR-4 REV 5'-3'TCAGCTTTTGAATGGAGAATGAA (SEQ ID NO: 547), PCR-5 FWD 5'-3'TACTCTCGCTGTCTCCTTGTGTC (SEQ ID NO: 548), PCR-5 REV 5'-3'ACTGAAAGAGGCTCAGGAACACT (SEQ ID NO: 549), PCR-6 FWD 5'-3'GACAGTGACTACCGCAGTGAAAC (SEQ ID NO: 550), PCR-6 REV 5'-3'CCACAAGAAAATGTGAATTCTGC (SEQ ID NO: 551), PCR-7 FWD 5'-3'AGTGGGCTTAATTTGCATTCATT (SEQ ID NO: 552), PCR-7 REV 5'-3'GCACAGGTATAATCAGACCCACA (SEQ ID NO: 553), PCR-8 FWD 5'-3'GGTTGGAAGAAGCACTGAGAGG (SEQ ID NO: 554), PCR-8 REV 5'-3'AGAAGAAGGGGAAAGTCAGAGGT (SEQ ID NO: 555), PCR-9 FWD 5'-3'AGTTACACCGTCGTCCCTATCAT (SEQ ID NO: 556), PCR-9 REV5'-3'ATGACCTTGAAGAAGTGGCTTTC (SEQ ID NO: 557), PCR-10 FWD 5'-3'CCTCACAGTTGTAGACCATGGAA (SEQ ID NO: 558), PCR-10 REV 5'-3'CACACCTCCTTCCAGATGTTGTA (SEQ ID NO: 559), PCR-11 FWD 5'-3'CTACGAGCATGTCATGAAGTTGC (SEQ ID NO: 538), PCR-11 REV 5'-3'AAGCCCATTCATTCCTAGTGCTG (SEQ ID NO: 539), PCR-12 FWD 5'-3'CCCTGTCTCGTGCTCCCTCAGA (SEQ ID NO: 560), PCR-12 REV 5'-3'CATGGGCAAGCAGTGTGTTCTA (SEQ ID NO: 561), PCR-Internal Control (Mouse Actb) FWD 5'-3'AGAGAGCTCACCATTCACCATCT (SEQ ID NO: 562), REV 5'-3'TCCTAGGCTCTCAAAACAAAACC (Sequence ID 563),

[0422] [ka] The F0 mice and subsequent generations were backcrossed with C57BL / 6J.

[0423] To knock down endogenous mouse Tardbp (TDP-43), 8-11 week old mice were given either a heteroduplex oligonucleotide targeting mouse Tardbp (TDP-43) (10 μL at 2.5 mM) (antisense strand: has a phosphorothioate backbone, lowercase letters are deoxyribonucleosides, underlined uppercase letters are ENA-modified nucleosides, the base of "C" or "c" is 5'-methylcytosine, 5'-ATATGcacgctgattCCTTT-3' (SEQ ID NO: 1363), complementary strand: has a phosphate backbone, lowercase letters are deoxyribonucleosides, the base of "c" is 5'-methylcytosine, 5'-aaaggaatcagcgtgcatat-3' (SEQ ID NO: 1364) (hereinafter referred to as "Tardbp HDO") or a vehicle control (Tardbp As HDO(-), 5% dextrose (5% Dex) (10 μL) was administered by intraventricular (ICV) injection on days 0 and 7. The antisense strand of Tardbp HDO was synthesized by KNC Laboratories Co., Ltd. (Kobe, Japan). The complementary strand of Tardbp HDO was synthesized by Gene Design. Synthesized by Co., Ltd. (Osaka, Japan). On days 1 and 21, test ASO (10 μL at 0.3 mM) or DPBS (10 μL) (test ASO(-)) as a vehicle control was injected via ICV. Test ASOs correspond to ASO211, 372, 391, 392, 393, 394, 395, 511, 564, 565, and 658 in Tables 3, 5, 9, and 11. Mice were euthanized 21 days after the last test ASO injection, and the cerebral cortex and spinal cord were isolated. Total RNA was extracted by DNase (QIAGEN, 79254) treatment using QIAzol lysis reagent (Qiagen, 79306) and QuickGene RNA tissue kit (Kurabo, RT-S2), and SuperPrep II Cell Lysis&RT Kit for Reverse transcription was performed using qPCR (Toyobo, SCQ-401) according to the manufacturer's protocol.

[0424] RT-qPCR was performed using the Viia7, QuantStudio 7 Flex, or QuantStudio 12K Flex real-time PCR system (Applied Biosystems) with THUNDERBIRD probe qPCR Mix (Toyobo, QPS-101). The expression level of mouse Tardbp (TDP-43) was evaluated using Thermofisher TaqMan Gene Expression Assays: Tardbp(TDP-43) (ID: Mm01257504_g1). To detect the splicing of UNC13A hidden exons (CE) and mouse Rbfox3, the following primer and probe sequences were synthesized using Integrated DNA Technologies (IDT) and used: UNC13A_CE FWD 5'-3'CCCCGTACCATGTCCAGTACA (SEQ ID NO: 320), UNC13A_CE REV 5'-3'CATTCACCAGCATTTATTCAACAAA (SEQ ID NO: 321), UNC13A_CE probe 5'-3' / 56-FAM / CTGCATGAG / ZEN / CTGCCT / 3IABkFQ / .Rbfox3 FWD 5'-3'CCGCTCGTTAAAAATGATCTCC (SEQ ID NO: 565), Rbfox3 REV 5'-3'CGACTACATGTCTCCAACATCC (SEQ ID NO: 566), Rbfox3 probe 5'-3' / 56-FAM / TTCCCGAAT / ZEN / TGCCCGAACATTTGC / 3IABkFQ / (SEQ ID NO: 567). The RT-qPCR protocol was performed as follows: 45 cycles of 60 seconds at 95°C, 15 seconds at 95°C, and 60 seconds at 60°C.

[0425] Each target expression level was calculated using absolute quantification. Expression levels of mouse Tardbp (TDP-43) and UNC13A hidden exon (CE) were normalized by mouse Rbfox3 expression levels. To calculate the TDP-43 knockdown level in the Tardbp HDO-treated group, the mean expression levels of the control group (Tardbp HDO(-) and experimental ASO(-) group (PBS only)) were used for normalization (100%: Tardbp HDO(-) and experimental ASO(-)). For UNC13A CE values ​​normalized by Rbfox3, the mean expression levels of the control group (Tardbp HDO(+) and experimental ASO(-) group) were used for normalization (100%: Tardbp HDO(+) and experimental ASO(-)).

[0426] In the statistical analysis, post-hoc analyses were performed on CE expression data in the cerebral cortex and spinal cord. Aspin-Welch tests were performed between the Tardbp HDO(-) and experimental ASO(-) group and the Tardbp HDO(+) and experimental ASO(-) group to confirm the success of TDP-43 knockdown. Subsequently, Dunnett's multiple comparison tests were performed between the Tardbp HDO(+) and experimental ASO(-) group and the Tardbp HDO(+) and experimental ASO(+) group. The experimental ASO group that showed a significant reduction in CE inclusion (p<0.05) is shown in Table 13 below.

[0427] [Table 16]

[0428] [Example 4] In vitro activity of antisense oligonucleotides (LNP TF to shTDP-SH-SY5Y cells) We established an SH-SY5Y cell line (parent SH-SY5Y cell line from ATCC; CRL-2266, lot: 58462094) that has doxycycline (dox)-inducible expression of TDP-43-specific shRNA for knockdown (Tet-on system) (hereinafter referred to as shTDP-SH-SY5Y). TurboRFP and microRNA30-compatible short hairpin RNA were expressed under the Tet operator and minimal CMV promoter, and rtTA3 was expressed under the UbC promoter. The microRNA30-compatible short hairpin RNA sequence is as follows.

[0429] [ka] shTDP-SH-SY5Y cells were grown at 37°C and 5% CO2 in 43.5% DMEM, high glucose, HEPES medium (Gibco, 12430054), 43.5% Ham F-12 nutrient mix medium (Gibco, 11765047), 10% fetal bovine serum (Gibco, A31606-01 or Clontech, 631105), 1×MEM NEAA solution (Gibco, 11140050), 2 mM sodium pyruvate (Gibco, 11360070), and 2 μg / mL blastosidine S HCl (Gibco, A1113903). To evaluate UNC13A splicing abnormalities and their correction by ASO, cells were treated with 4 μg / mL doxycycline (Clontech, 631311) for 14 days to induce approximately 60% TDP-43 knockdown.

[0430] Manufacturing method (1) A lipid mixture (cationic lipid: DPPC: cholesterol: GM-020 = 60:10.6:28:1.4, molar ratio) was dissolved in 90% EtOH / 10% RNase-free water to obtain a lipid solution of approximately 14.4 mg / mL. The cationic lipid was 3-{[4-(dimethylamino)butanoyl]oxy}-2,2-bis{[(9Z)-tetradeca-9-enoyloxy]methyl}propyl(9Z)-tetradeca-9-enoate, as described in International Publication No. 2019131839. The contents of this document pertain to cationic lipids and are incorporated herein by reference. A dispersion containing lipid particles was obtained by mixing the lipid solution with 10 mM citrate buffer, pH 3, using a NanoAssemblr (Precision Nanosystems) apparatus at room temperature with a flow rate ratio of 3 mL / min:9 mL / min. Using Slyde-A-Lyzer (molecular weight cutoff: 20k, Thermo Fisher Scientific), the resulting dispersion was dialyzed with water at 4°C for 1 hour and then with 10 mM MES / 0.9% NaCl buffer at pH 5 for 2 days. The mixture was then filtered through a 0.2 μm syringe filter (IWAKI CO., LTD.) to prepare a composition for nucleic acid introduction, which was then stored at 4°C. Lipid concentrations were analyzed using HPLC, and lipid sizes were measured using a Zetasizer Nano ZS (Malvern Instruments). The results are shown in Table 14.

[0431] (2) On day 11 of culture treated with doxycycline, shTDP-SH-SY5Y cells were seeded at 60,000 live cells / well in 96-well plates (Corning, 3598). A mixed composition was formed by gently mixing 0.853 μM of composition (1) diluted in physiological saline with an equal volume of 2 μM of the test compound, diluting it in 1 mM MES in physiological saline and / or DPBS(-), pH 5.5, and incubating at room temperature for 10 minutes. Within 30 minutes after mixing the lipid-based nanoparticles and the test compound, the mixed composition was added to the culture medium to a final concentration of 50 nM of the test compound. On day 14 after doxycycline treatment, cells were harvested using the FastLane Cell Multiplex kit (QIAGEN, 216513) according to the manufacturer's instructions.

[0432] [Table 17]

[0433] RT-qPCR was performed using the QuantStudio® 7 Flex Real-Time PCR System (Applied Biosystems) or the ViiA® 7 Real-Time PCR System (Applied Biosystems). Each experiment was performed twice in duplicate. The following PCR probe assays for UNC13A CE, synthesized by Integrated DNA Technologies (IDT), were used: UNC13A_CE FWD5'-3'CCCCGTACCATGTCCAGTACA (SEQ ID NO: 320), UNC13A_CE REV5'-3'CATTCACCAGCATTTATTCAACAAA (SEQ ID NO: 321), and UNC13A_CE probe 5'-3' / 56-FAM / CTGCATGAG / ZEN / CTGCCT / 3IABkFQ / . Housekeeping gene GAPDH expression analysis was performed using Thermofisher® TaqMan Gene Expression Assays Hs99999905_m1. The PCR protocol is as follows: 45 cycles of 30 minutes at 50°C, 15 minutes at 95°C, 15 seconds at 94°C, and 60 seconds at 60°C.

[0434] The relative expression of UNC13A CE was calculated by normalizing against GAPDH expression (deltaCt), and then the mean expression value of the control group (saline) without ASO treatment was used for normalization (100%: dox(+)ASO(-)). The tested ASOs correspond to ASO1-331 and 350-814 in Tables 3, 5, 9, and 11. The results are shown in Table 15 below.

[0435] [Table 18-1]

[0436] [Table 18-2]

[0437] [Table 18-3]

[0438] Table 18-4

[0439] Table 18-5

[0440] Table 18-6

[0441] Table 18-7

[0442] Table 18-8

[0443] Table 18-9

[0444] Table 18-10

[0445] Table 18-11

[0446] Table 18-12

[0447] Table 18-13

[0448] [Table 18-14]

[0449] Additional Embodiments 1. An antisense oligonucleotide comprising a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region, wherein the first target region and / or the second target region each contain a UNC13A sequence, and the antisense oligonucleotide modulates the splicing of the UNC13A hidden exon. 2. The UNC13A hidden exon is an antisense oligonucleotide as described in Embodiment 1, located in intron 20 of UNC13A premRNA. 3. The first and second target regions are antisense oligonucleotides according to Embodiment 1 or Embodiment 2, located in intron 20 of UNC13A premRNA. 4. An antisense oligonucleotide according to any one of Embodiments 1 to 3, wherein the first target region is adjacent to the second target region in the UNC13A premRNA. 5. The first target region is an antisense oligonucleotide according to any one of Embodiments 1 to 4, located downstream of the second target region in UNC13A premRNA. 6. An antisense oligonucleotide according to any one of Embodiments 1 to 5, wherein the first target region is downstream of the second target region by more than one nucleoside. 7. An antisense oligonucleotide according to any one of embodiments 1 to 6, wherein both the first target region and the second target region are located in a hidden exon. 8. An antisense oligonucleotide according to any one of embodiments 1 to 6, wherein the first target region is located downstream of the hidden exon and the second target region is located on the hidden exon. 9. An antisense oligonucleotide according to any one of embodiments 1 to 6, wherein both the first target region and the second target region are located downstream of a hidden exon. 10. An antisense oligonucleotide according to any one of Embodiments 1 to 8, wherein the first target region and / or the second target region comprises one nucleotide sequence of SEQ ID NOs. 313 to 316. 11. An antisense oligonucleotide according to any one of Embodiments 1 to 10, wherein the first target region comprises the nucleotide sequence of SEQ ID NO: 315, and the second target region comprises the nucleotide sequence of SEQ ID NO: 315. 12. An antisense oligonucleotide according to any one of Embodiments 1 to 10, wherein the first target region comprises the nucleotide sequence of SEQ ID NO: 315 and the second target region comprises the nucleotide sequence of SEQ ID NO: 314. 13. An antisense oligonucleotide according to any one of Embodiments 1 to 10, wherein the first target region comprises the nucleotide sequence of SEQ ID NO: 315 and the second target region comprises the nucleotide sequence of SEQ ID NO: 313. 14. An antisense oligonucleotide according to any one of Embodiments 1 to 10, wherein the first target region comprises the nucleotide sequence of SEQ ID NO: 313, and the second target region comprises the nucleotide sequence of SEQ ID NO: 313. 15. An antisense oligonucleotide according to any one of Embodiments 1 to 14, wherein the first antisense sequence and / or the second antisense sequence is 6 to 15 nucleoside lengths, and optionally, the first antisense sequence and / or the second antisense sequence is 8 to 15 nucleoside lengths. 16. An antisense oligonucleotide according to any one of Embodiments 1 to 15, wherein the first antisense sequence comprises at least eight consecutive nucleic acid bases of any one of Sequence IDs 191 to 245, and / or the second antisense sequence comprises at least eight consecutive nucleic acid bases of any one of Sequence IDs 194, 199, 212, 226, 227, and 246 to 306. 17. An antisense oligonucleotide according to any one of Embodiments 1 to 16, wherein the first antisense sequence comprises one nucleic acid base sequence of SEQ ID NOs: 191 to 245, and / or the second antisense sequence comprises one nucleic acid base sequence of SEQ ID NOs: 194, 199, 212, 226, 227, and 246 to 306. 18. An antisense oligonucleotide according to any one of embodiments 1 to 17, wherein the first antisense sequence and the second antisense sequence are directly adjacent to each other. 19. An antisense oligonucleotide according to any one of embodiments 1 to 18, wherein one or more nucleic acid bases are present between a first antisense sequence and a second antisense sequence. 20. An antisense oligonucleotide according to any one of Embodiments 1 to 17, wherein one or more nucleic acid bases at the 3' end of a first antisense sequence are complementary to one or more nucleic acid bases at the 3' end of a second target region, and / or one or more nucleic acid bases at the 5' end of a second antisense sequence are complementary to one or more nucleic acid bases at the 5' end of a first target region. 21. An antisense oligonucleotide according to any one of Embodiments 1 to 20, comprising one nucleic acid base sequence from Sequence ID No. 1 to 190. 22. An antisense oligonucleotide according to any one of Embodiments 1 to 21, comprising one or more modified nucleosides. 23. The antisense oligonucleotide according to Embodiment 22, wherein one or more modified nucleosides include a non-bicyclic 2'-modified nucleoside, a 2'-4'-bridged nucleoside, or a combination thereof. 24. The antisense oligonucleotide according to Embodiment 23, wherein the non-bicyclic 2'-modified nucleoside is a 2'-O-methoxyethyl (2'-MOE) modified nucleoside, a 2'-O-methyl (2'-O-Me) nucleoside, or a 2'-fluoro (2'-F) modified nucleoside, and / or the 2'-4' crosslinked nucleoside is a locked nucleic acid (LNA, 2'-4' methylene crosslinked), an ethylene crosslinked nucleic acid (ENA, 2'-4' ethylene crosslinked), or a restricted ethyl nucleic acid (cEt, 2'-4' ethylene crosslinked). 25. An antisense oligonucleotide according to any one of Embodiments 1 to 24, comprising one or more 2'-MOE modified nucleosides and one or more LNAs. 26. An antisense oligonucleotide according to any one of Embodiments 1 to 24, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside. 27. An antisense oligonucleotide according to any one of Embodiments 1 to 26, comprising one or more modified nucleoside linkages. 28. An antisense oligonucleotide according to any one of Embodiments 1 to 27, wherein each nucleoside linkage of the oligonucleotide is a modified nucleoside linkage. 29. The antisense oligonucleotide according to Embodiment 27 or Embodiment 28, wherein the modified nucleoside linkage is a phosphorothioate linkage. 30. An antisense oligonucleotide according to any one of Embodiments 1 to 29, wherein the internucleoside linkages of the oligonucleotide are phosphorothioate linkages. 31. An antisense oligonucleotide according to any one of Embodiments 1 to 29, comprising a mixture of phosphodiester-linked and phosphorothioate-linked structures. 32. An antisense oligonucleotide according to any one of Embodiments 1 to 22, which is a phosphorodiamidate oligomer (PMO). 33. An antisense oligonucleotide according to any one of Embodiments 1 to 32, wherein each cytosine in the oligonucleotide is not 5-methylcytosine. 34. An antisense oligonucleotide according to any one of Embodiments 1 to 32, wherein each cytosine in the oligonucleotide is 5-methylcytosine. 35. An antisense oligonucleotide according to any one of Embodiments 1 to 32, wherein one or more cytosines of the oligonucleotide are 5-methylcytosine. 36. An antisense oligonucleotide according to any one of Embodiments 1 to 35, comprising the structure provided in Table 5. 37. An antisense oligonucleotide according to any one of embodiments 1 to 36, which inhibits the inclusion of a UNC13A hidden exon in mature UNC13A mRNA. 38. An antisense oligonucleotide according to any one of Embodiments 1 to 37, in the form of a pharmaceutically acceptable salt. 39. A composition comprising an antisense oligonucleotide as described in any one of Embodiments 1 to 38. 40. The composition according to Embodiment 39, further comprising a pharmaceutically acceptable carrier. 41. A method for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in cells, comprising contacting cells with an antisense oligonucleotide according to any one of Embodiments 1 to 38, or a composition according to Embodiment 39 or Embodiment 40. 42. A method for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in target cells, comprising administering to the target an antisense oligonucleotide according to any one of Embodiments 1 to 38, or a composition according to Embodiment 39 or Embodiment 40. 43. A method for treating a disease associated with abnormal UNC13A expression in a subject, comprising administering an antisense oligonucleotide according to any one of claims 1 to 38, or a composition according to Embodiment 39 or Embodiment 40, to the subject. 44. A method for treating a disease associated with TDP-43 dysfunction in a subject, comprising administering an antisense oligonucleotide according to any one of claims 1 to 38, or a composition according to Embodiment 39 or Embodiment 40, to the subject. 45. The method according to Embodiment 43 or Embodiment 44, wherein the disease is a neurodegenerative disease. 46. ​​The method according to any one of embodiments 43 to 45, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS). 47. The method according to any one of embodiments 43 to 45, wherein the neurodegenerative disease is frontotemporal dementia (FTD). 48. The method according to any one of embodiments 42 to 47, wherein the subject is a human. 49. The method according to any one of embodiments 42 to 48, which shows a decrease in the expression of the TDP-43 gene or protein. 50. The subject is the method according to any one of embodiments 42 to 49, which does not have a SOD-1 gene mutation. 51. The method according to any one of embodiments 42 to 50, wherein the subject has a UNC13A gene mutation in intron 20. 52. The method according to Embodiment 51, wherein the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof. 53. A pharmaceutical composition for use in a method for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in a target cell, comprising an antisense oligonucleotide as described in any one of Embodiments 1 to 38. 54. A pharmaceutical composition for use in a method for treating a disease associated with abnormal UNC13A expression in a subject, comprising an antisense oligonucleotide as described in any one of Embodiments 1 to 38. 55. A pharmaceutical composition for use in a method for treating a disease associated with TDP-43 dysfunction in a subject, comprising an antisense oligonucleotide as described in any one of Embodiments 1 to 38. 56. A pharmaceutical composition according to any one of embodiments 53 to 55, further comprising a pharmaceutically acceptable carrier. 57. A pharmaceutical composition according to any one of embodiments 53 to 56, wherein the subject is a human. 58. The subject is a pharmaceutical composition according to any one of embodiments 55 to 57, which exhibits reduced expression of the TDP-43 gene or protein. 59. The subject is a pharmaceutical composition according to any one of embodiments 55 to 58, which does not have a SOD-1 gene mutation. 60. The subject is a pharmaceutical composition according to any one of embodiments 55 to 59, having a UNC13A gene mutation in intron 20. 61. The pharmaceutical composition according to Embodiment 60, wherein the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof. 62. An antisense oligonucleotide according to any one of Embodiments 1 to 38, for use as a pharmaceutical agent. 63. The antisense oligonucleotide according to Embodiment 62, wherein the drug is administered to a target. 64. An antisense oligonucleotide according to any one of Embodiments 1 to 38, for use in a method for treating a disease associated with abnormal UNC13A expression in a subject, the method comprising administering an antisense oligonucleotide provided herein to the subject. 65. An antisense oligonucleotide according to any one of Embodiments 1 to 38, for use in a method for treating a disease associated with TDP-43 dysfunction in a subject, the method comprising administering an antisense oligonucleotide provided herein to the subject. 66. An antisense oligonucleotide according to any one of embodiments 63 to 65, wherein the subject is human. 67. The subject is an antisense oligonucleotide according to any one of embodiments 63 to 66, which exhibits reduced expression of the TDP-43 gene or protein. 68. The subject is an antisense oligonucleotide according to any one of embodiments 63 to 67, which does not have a SOD-1 gene mutation. 69. The subject is an antisense oligonucleotide according to any one of embodiments 63 to 68, having a UNC13A gene mutation in intron 20. 70. The antisense oligonucleotide according to Embodiment 69, wherein the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

[0450] Equal portions This disclosure can be embodied in other specific forms without departing from its intent or essential features. Therefore, the embodiments described above should be considered illustrative and not limiting in any way to this disclosure. Accordingly, the scope of this disclosure is indicated by the appended claims rather than the foregoing description, and all modifications within the meaning and equivalence of the claims are therefore intended to be incorporated herein.

Claims

1. An antisense oligonucleotide comprising a first antisense sequence targeting a first target region and a second antisense sequence targeting a second target region, wherein the first target region and / or the second target region each comprise a UNC13A sequence, the antisense oligonucleotide modulates splicing of a UNC13A hidden exon, and the first target region or the second target region comprises a nucleotide sequence shown in SEQ ID NO: 313 or SEQ ID NO:

315.

2. The antisense oligonucleotide according to claim 1, wherein the UNC13A hidden exon is located in the intron 20 of UNC13A premRNA.

3. The antisense oligonucleotide according to claim 1 or 2, wherein the first target region and the second target region are located in the intron 20 of UNC13A premRNA.

4. The antisense oligonucleotide according to any one of claims 1 to 3, wherein the first target region is adjacent to the second target region in UNC13A premRNA.

5. The antisense oligonucleotide according to any one of claims 1 to 4, wherein the first target region is located downstream of the second target region in UNC13A premRNA.

6. The antisense oligonucleotide according to any one of claims 1 to 5, wherein the first target region contains more than one nucleoside downstream of the second target region.

7. The antisense oligonucleotide according to any one of claims 1 to 6, wherein the first target region is located downstream of the hidden exon, and the second target region is located in the hidden exon.

8. The antisense oligonucleotide according to any one of claims 1 to 7, wherein the first target region comprises the nucleotide sequence of SEQ ID NO: 315, and the second target region comprises the nucleotide sequence of SEQ ID NO:

313.

9. The antisense oligonucleotide according to any one of claims 1 to 8, wherein the first antisense sequence and / or the second antisense sequence is 6 to 15 nucleoside lengths, and optionally, the first antisense sequence and / or the second antisense sequence is 6 to 15 nucleoside lengths.

10. The antisense sequence 1 described above includes sequence numbers 191-247, 274, 288, 495-515, AGCCAACGA, ACGAATC, CGAATCT, GAATCTA, AATCTA, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTA, TCACCCA, ACGAATCTTA, GCCACGA, GAATCTA, CGAATCTTA, CGAATCTAC, GAATCTA, TCTACCC, ATCTACC, GTCGCCG, GGGGTCG, GGGTCCG An antisense oligonucleotide according to any one of claims 1 to 7 and 9, comprising at least six consecutive nucleic acid bases of any one of C and GGTCGCC, and / or the second antisense sequence comprising at least six consecutive nucleic acid bases of any one of SEQ ID NOs: 194, 199, 212, 226, 227, 246-306, 516-535, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TGTACTC, and TCACCCA.

11. The antisense sequence described above includes sequence numbers 191-247, 274, 288, 495-515, AGCCAACGA, ACGAATC, CGAATCT, GAATCTA, AATCTAC, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TCACCCA, ACGAATCTTA, GCCACGA, GAATCTAC, CGAATCTTA, CGAATCTAC, GAATCTA, TCTACCC, ATCTACC, GTCGCCG, GGGGTC An antisense oligonucleotide according to any one of claims 1 to 7, 9, and 10, comprising one nucleic acid base sequence of G, GGGTCGC, and GGTCGCC, and / or the second antisense sequence comprising one nucleic acid base sequence of SEQ ID NOs: 194, 199, 212, 226, 227, 246-306, 516-535, CAATCAT, GTTCAAT, TTCAATC, TCAATCA, TTTTATC, CTTTTAT, TGTACTC, and TCACCCA.

12. The antisense oligonucleotide according to any one of claims 1 to 11, wherein the first antisense sequence and the second antisense sequence are directly adjacent to each other.

13. The antisense oligonucleotide according to any one of claims 1 to 12, comprising a spacer between the first antisense sequence and the second antisense sequence.

14. An antisense oligonucleotide according to any one of claims 1 to 11, wherein one or more nucleic acid bases at the 3' end of the first antisense sequence are complementary to one or more nucleic acid bases at the 3' end of the second target region, and / or one or more nucleic acid bases at the 5' end of the second antisense sequence are complementary to one or more nucleic acid bases at the 5' end of the first target region.

15. An antisense oligonucleotide according to any one of claims 1 to 7 and 9 to 14, comprising one nucleic acid base sequence from among SEQ ID NOs: 1 to 190 and 338 to 494.

16. The antisense oligonucleotide according to any one of claims 1 to 15, comprising one or more modified nucleosides, wherein each nucleoside of the antisense oligonucleotide is optionally a modified nucleoside.

17. The antisense oligonucleotide according to claim 16, wherein the one or more modified nucleosides include a non-bicyclic 2'-modified nucleoside, a 2'-4'-bridged nucleoside, or a combination thereof.

18. The antisense oligonucleotide according to claim 17, wherein the non-bicyclic 2'-modified nucleoside is a 2'-O-methoxyethyl (2'-MOE) modified nucleoside, a 2'-O-N-methylacetamide (2'-O-NMA) modified nucleoside, a 2'-O-methyl (2'-O-Me) modified nucleoside, or a 2'-fluoro (2'-F) modified nucleoside, and / or the 2'-4' crosslinked nucleoside is locked nucleic acid (LNA, 2'-4' methylene crosslinked), ethylene crosslinked nucleic acid (ENA, 2'-4' ethylene crosslinked), restricted ethyl nucleic acid (cEt, 2'-4' ethylene crosslinked), 2'-O,4'-C-spirocyclopropylene crosslinked nucleic acid (scpBNA), amide crosslinked nucleic acid (AmNA), or 2'-O,4'-C-aminomethylene crosslinked nucleic acid (BNA(NC)).

19. An antisense oligonucleotide according to any one of claims 1 to 18, comprising one or more 2'-MOE modified nucleosides and one or more LNAs.

20. The antisense oligonucleotide according to any one of claims 1 to 18, wherein each nucleoside of the antisense oligonucleotide is a 2'-MOE modified nucleoside.

21. An antisense oligonucleotide according to any one of claims 1 to 19, comprising one or more modified nucleosides selected from ENA, scpBNA, 2'-O-NMA, AmNA, and BNA(NC).

22. The antisense oligonucleotide according to claim 16, wherein each nucleoside of the antisense oligonucleotide is a modified nucleoside, and the antisense oligonucleotide comprises one or more modified nucleosides selected from ENA, scpBNA, 2'-O-NMA, AmNA, and BNA(NC), and the remaining modified nucleosides are a 2'-MOE modified nucleoside, LNA, or a mixture of a 2'-MOE modified nucleoside and LNA.

23. An antisense oligonucleotide according to any one of claims 1 to 22, comprising one or more modified nucleoside linkages.

24. The antisense oligonucleotide according to any one of claims 1 to 23, wherein each nucleoside linkage of the oligonucleotide is a modified nucleoside linkage.

25. The antisense oligonucleotide according to claim 23 or claim 24, wherein the modified nucleoside linkage is a phosphorothioate linkage.

26. The antisense oligonucleotide according to any one of claims 1 to 25, wherein the linkage between each nucleoside of the oligonucleotide is a phosphorothioate linkage.

27. An antisense oligonucleotide according to any one of claims 1 to 25, comprising a mixture of phosphodiester linkages and phosphorothioate linkages.

28. The antisense oligonucleotide according to any one of claims 1 to 16, wherein the oligonucleotide is a phosphorodiamidate oligomer (PMO).

29. The antisense oligonucleotide according to any one of claims 1 to 28, wherein each cytosine in the oligonucleotide is not 5-methylcytosine.

30. The antisense oligonucleotide according to any one of claims 1 to 28, wherein one or more cytosines of the oligonucleotide are 5-methylcytosine, and optionally each cytosine of the oligonucleotide is 5-methylcytosine.

31. The antisense oligonucleotide according to any one of claims 1 to 30, wherein the antisense oligonucleotide is linked to a lipid, optionally the lipid being a C16 lipid, and optionally the C16 lipid being linked to the 5' nucleoside of the antisense chain via a DNA linker.

32. An antisense oligonucleotide according to any one of claims 1 to 30, comprising the structure provided in Table 5 or Table 11.

33. The antisense oligonucleotide according to any one of claims 1 to 32, which inhibits the inclusion of the UNC13A hidden exon in mature UNC13A mRNA.

34. The antisense oligonucleotide according to any one of claims 1 to 33, which induces a secondary structure between the first target region and the second target region of the UNC13A premRNA.

35. The following structure: [iTs] [iGs] [iTs] [iTs] [i 5 Cs] [iAs] [iAs] [iTs] [i 5 Cs] [iAs] [iTs] [iTs] [i 5 Cs] [iGs] [iGs] [iGs] [iAs] [iTs] [iAs] [iAs] [iG] [iA] [iG] [iT] [iTs] [i 5 Includes C] (Sequence ID 569), iA, iG, i 5 The antisense oligonucleotide according to any one of claims 1 to 34, wherein C and iT are 2'-O-methoxyethyl (2'-MOE) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, and s is a phosphorothioate nucleoside linkage.

36. The following structure: [iTs][iGs][iTs][iTs][i 5 Cs][iAs][iAs][iTs][i 5 Cs][iAs][iTs][iTs][i 5 Cs][iGs][iGs][iGs][iAs][iTs][iAs][iAs][iGs][iA][iG][iT][iTs][i 5 C] (SEQ ID NO: 570), wherein iA, iG, i 5 C, and iT are 2'-O-methoxyethyl (2'-MOE) modified adenosine, guanosine, 5'-methylcytidine, and thymidine respectively, and s is a phosphorothioate internucleoside linkage, the antisense oligonucleotide according to any one of claims 1 to 34.

37. The following structure: [i 5 Cs] [iGs] [iAs] [iAs] [iTs] [i 5 Cs] [iTs] [iAs] [i 5 Cs [i 5 Cs [i 5 Cs][iAs][i 5 Cs] [iAs] [iTs] [i 5 Cs] [iTs] [iGs] [iTs] [iTs] [i 5 Cs] [iAs] [iAs] [iTs] [i 5 Includes Cs][iA] (Sequence ID 571), iA, iG, i 5 The antisense oligonucleotide according to any one of claims 1 to 34, wherein C and iT are 2'-O-methoxyethyl (2'-MOE) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, and s is a phosphorothioate nucleoside linkage.

38. The following structure: [iTs] [iG] [iT] [iTs] [i 5 Cs] [iAs] [iAs] [iTs] [i 5 Cs] [iAs] [iTs] [iTs] [i 5 Cs] [iGs] [iGs] [iGs] [iAs] [iTs] [iAs] [iAs] [iGs] [iAs] [iG] [iT] [iTs] [i 5 Includes C] (Sequence ID 572), iA, iG, i 5 The antisense oligonucleotide according to any one of claims 1 to 34, wherein C and iT are 2'-O-methoxyethyl (2'-MOE) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, and s is a phosphorothioate nucleoside linkage.

39. The following structure: [iTs][iG][iT][iT][i 5 Cs] [iAs] [iAs] [iTs] [i 5 Cs] [iAs] [iTs] [iTs] [i 5 Cs] [iGs] [iGs] [iGs] [iAs] [iTs] [iAs] [iAs] [iGs] [iA] [iG] [iT] [iTs] [i 5 C] (Sequence ID 573) includes iA, iG, i 5 The antisense oligonucleotide according to any one of claims 1 to 34, wherein C and iT are 2'-O-methoxyethyl (2'-MOE) modified adenosine, guanosine, 5'-methylcytidine, and thymidine, respectively, and s is a phosphorothioate nucleoside linkage.

40. An antisense oligonucleotide according to any one of claims 1 to 39, in the form of a pharmaceutically acceptable salt.

41. A composition comprising an antisense oligonucleotide according to any one of claims 1 to 40.

42. The composition according to claim 41, further comprising a pharmaceutically acceptable carrier.

43. A method for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in cells, comprising contacting the cells with an antisense oligonucleotide according to any one of claims 1 to 40, or a composition according to claim 41 or claim 42.

44. A method for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in target cells, comprising administering to the target an antisense oligonucleotide according to any one of claims 1 to 40, or a composition according to claim 41 or claim 42.

45. A method for treating a disease associated with abnormal UNC13A expression in a subject, comprising administering to the subject an antisense oligonucleotide according to any one of claims 1 to 40, or a composition according to claim 41 or claim 42.

46. A method for treating a disease associated with TDP-43 dysfunction in a subject, comprising administering to the subject an antisense oligonucleotide according to any one of claims 1 to 40, or a composition according to claim 41 or claim 42.

47. The method according to claim 45 or claim 46, wherein the disease is a neurodegenerative disease.

48. The method according to any one of claims 45 to 47, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

49. The method according to any one of claims 45 to 47, wherein the neurodegenerative disease is frontotemporal dementia (FTD).

50. The method according to any one of claims 46 to 49, wherein the subject is a human.

51. The method according to any one of claims 47 to 50, wherein the subject has dysfunction of the TDP-43 protein.

52. The method according to any one of claims 48 to 51, wherein the subject does not have an SOD-1 gene mutation.

53. The method according to any one of claims 49 to 52, wherein the subject has a UNC13A gene mutation in intron 20.

54. The method according to claim 53, wherein the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.

55. A pharmaceutical composition for use in a method for inhibiting the inclusion of UNC13A hidden exons in UNC13A mature mRNA and / or restoring UNC13A expression in target cells, comprising a therapeutically effective amount of the antisense oligonucleotide described in any one of claims 1 to 40.

56. A pharmaceutical composition for use in treating a disease associated with abnormal UNC13A expression in a subject, comprising a therapeutically effective amount of an antisense oligonucleotide according to any one of claims 1 to 40.

57. A pharmaceutical composition for use in treating a disease associated with TDP-43 dysfunction in a subject, comprising a therapeutically effective amount of an antisense oligonucleotide according to any one of claims 1 to 40.

58. A pharmaceutical composition according to any one of claims 55 to 57, further comprising a pharmaceutically acceptable carrier.

59. The pharmaceutical composition according to any one of claims 55 to 58, wherein the subject is a human.

60. The method according to any one of claims 57 to 59, wherein the subject has dysfunction of the TDP-43 protein.

61. The method according to any one of claims 57 to 60, wherein the subject does not have an SOD-1 gene mutation.

62. The subject is the pharmaceutical composition according to any one of claims 57 to 61, wherein the intron 20 has a UNC13A gene mutation.

63. The pharmaceutical composition according to claim 62, wherein the UNC13A gene mutation includes rs12608932, rs12973192, rs56041637, rs116169349, rs62121687, or any combination thereof.