Novel neurotropic adeno-associated virus capsid that detargets peripheral organs
Modified AAV capsid variants with targeted mutations improve CNS transduction and reduce peripheral organ transduction, addressing inefficiencies in existing AAV capsids for CNS gene therapy.
Patent Information
- Application Number
- JP2025560692
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-04-18
- Filing Date
- 2024-04-18
- Publication Date
- 2026-05-26
AI Technical Summary
Existing adeno-associated virus (AAV) capsids for gene therapy face challenges in efficiently transducing cells of the central nervous system (CNS) while minimizing transduction in peripheral organs, primarily due to inefficiencies in crossing the blood-brain barrier and high sequestration in organs like the liver.
Development of AAV capsid variants with specific mutations in amino acid regions, such as 452-458, 498-504, 590-595, and 582-589, to enhance CNS transduction and reduce hepatic transduction, combined with additional mutations in T138, S414, G453, K557, T568, and Q590 to achieve selective detargeting of peripheral organs.
The modified AAV capsid variants demonstrate enhanced CNS transduction and reduced transduction in peripheral organs, providing a broader therapeutic window for CNS-targeted gene therapy.
Smart Images

Figure 2026516709000005 
Figure 2026516709000006 
Figure 2026516709000007
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of medicine, molecular biology, gene therapy, and insect cell culture. In particular, the present invention relates to novel neurotropic adeno-associated virus capsids. The present invention further relates to methods for identifying adeno-associated virus capsid variants having desired characteristics.
Background Art
[0002] Adeno-associated virus (AAV) has emerged as a preferred platform for gene therapy. However, the success of AAV-based therapeutic strategies is limited, inter alia, by non-specific tropism. Specifically, the development of novel adeno-associated virus (AAV) capsids capable of transducing cells of the central nervous system (CNS) by systemic administration has become one of the most interesting challenges in the field of AAV-based gene therapy for CNS diseases. Inefficiency of blood-brain barrier (BBB) crossing, as well as high levels of sequestration and transduction in peripheral organs, limit the CNS application of first-generation AAV-based vectors due to a narrow therapeutic window. Therefore, in recent years, several next-generation AAV capsids have been engineered, resulting in CNS capsid variants with different modes of action.
[0003] For example, Hanlon et al. (2019, Mol Ther Methods Clin Dev. 15:320-332) and Nonnenmacher et al. (2020, Mol Ther Methods Clin Dev. 20:366-378) have reported AAV9 capsid variants with higher CNS transduction efficiency compared to wild-type AAV9. However, upon systemic administration, these AAV9 capsid variants still transduce peripheral organs such as the liver, skeletal muscle, and heart with efficiency comparable to wild-type AAV9. Goersten et al. (2022, Nat Neurosci. 25(1):106-115) have disclosed an AAV capsid variant in which, after intravenous delivery, the transgene is widely expressed throughout the brain and liver targeting is reduced. Pulicherla et al (2011, Mol Ther. 19(6):1070-8) reported the generation of AAV9 capsid variants using random mutagenesis of residues within the surface-exposed region of the major AAV9 capsid protein. These capsid variants were classified into three functional subgroups with respect to the parent AAV9: (i) a functionally defective phenotype with reduced transduction efficiency across multiple tissues; (ii) selective reduction of hepatic transduction; or (iii) a similar transduction profile.
[0004] However, there is still a need in the art for an improved AAV capsid that efficiently transduces cells in the CNS upon systemic administration, but exhibits reduced transduction in peripheral organs. The object of the present invention is to provide an AAV capsid having such CNS targeting and peripheral organ detargeting, and to provide means and methods for screening such AAV capsids.
[0005] Furthermore, an object of the present invention is to provide means and methods for screening and identifying AAV capsid variants having desired characteristics, such as a combination of CNS directivity and peripheral organ detargeting. [Overview of the project]
[0006] In a first embodiment, an adeno-associated virus (AAV) serotype 9 (AAV9) or clade F AAV capsid protein variant is provided, comprising a mutation in one or more amino acids, wherein the mutation confers at least one of the following phenotypes to the capsid protein variant: i) a reduced hepatic transduction phenotype compared to a control capsid protein without the mutation, and ii) a reduced overall transduction phenotype compared to a control capsid protein without the mutation, and the capsid protein variant further comprises an amino acid sequence resulting in increased CNS transduction (compared to a control capsid protein without the amino acid sequence).
[0007] In one embodiment, an AAV capsid protein variant is a variant that i) comprises a mutation in one or more amino acids in the amino acid regions 452-458, 498-504, 590-595, and / or 582-589, the mutation resulting in a phenotype of reduced hepatic transduction compared to a control without the mutation; ii) comprises a mutation in T138, S414, G453, K557, T568, T582, and Q590, or any combination thereof, the mutation resulting in a phenotype of reduced overall transduction compared to a control capsid protein without the mutation; and iii) comprises at least one amino acid sequence that confers increased CNS transduction to the variant, comprising STTLYSP, FVVGQSY, DGTLAVPFK, and WPTSYDA, and an amino acid sequence selected from the group consisting of sequences that differ from them by 4, 3, 2, or 1 or fewer amino acids.
[0008] In one embodiment, an AAV capsid protein variant is a variant that i) contains at least one mutation selected from the group consisting of mutations at positions W595, Q592, W503, N498, and E500, and the amino acid sequence DGAATKN at positions 452-458, and the mutation results in a hepatic transduction reduction phenotype compared to a control without the mutation; ii) contains mutations in both T568 and Q590, or both S414 and G453, or all of T138, S414, G453, K557, and T582, or all of S414, G453, K557, and T582, and the mutation results in a hepatic transduction reduction phenotype compared to a control without the mutation. iii) an amino acid sequence that results in a phenotype of overall reduced transduction compared to; and iii) an amino acid sequence that confers increased CNS transduction to the variant is at least one selected from the group consisting of FVVGQSY, FVVAQSY, FVVVQSY, FVVLQSY, FVVIQSY, FVVNQSY, FVVSQSY, FVVEQSY, FVVQQSY, FVVCQSY, FVVTQSY, FVVPQSY, FVVQSY, FVGVQSY, FVVQGSY, FVQGVSY, FSVGQVY, and FSQGVVY, preferably an amino acid sequence selected from the group consisting of FVVGQSY, FVVAQSY, FVVPQSY, FVGVQSY, and FVVQGSY.
[0009] In one embodiment, an AAV capsid protein variant is a variant comprising: i) a mutation in W595C, a mutation in Q592L, a mutation in W503R, a mutation in N498Y, a mutation in E500D, or any combination thereof, wherein the mutation results in a hepatic transduction reduction phenotype compared to a control without the mutation; ii) a mutation in T568P and Q590L, or a mutation in S414 and G453D, or a mutation in T138A, S414N, G453D, K557E, and T582I, or a mutation in S414N, G453D, K557E, and T582I; and iii) an insertion amino acid sequence which is inserted into the variant into the hypervariable region of the AAV capsid protein sequence, preferably into a hypervariable region selected from loop IV or loop VIII.
[0010] In one embodiment, the AAV capsid protein variant is a) T138A, S414N, G453D, K557E, and T582I mutations, and the amino acid sequence FVVGQSY inserted into loop VIII, preferably between positions 588 and 589; b) S414N, G453D, K557E, and T582I mutations, and the amino acid sequence FVVGQSY or FVVAQSY inserted into loop VIII, preferably between positions 588 and 589; c) T138A, S414N, G453D, K557E, and T582I mutations, and the amino acid sequence FVVGQSY or FVVAQSY inserted into loop VIII, preferably between positions 588 and 589 A variant comprising the amino acid sequence WPTSYDA inserted between position 9; d) S414N, G453D, K557E, and T582I mutations, and the amino acid sequence WPTSYDA inserted in loop VIII, preferably between positions 588 and 589; e) the amino acid sequence DGAATKN at positions 452-458, and the amino acid sequence FVVGQSY inserted in loop VIII, preferably between positions 588 and 589; or f) the amino acid sequence DGAATKN at positions 452-458, and the amino acid sequence WPTSYDA inserted in loop VIII, preferably between positions 588 and 589.
[0011] In one embodiment, the AAV capsid protein variant is a variant contained in an amino acid sequence selected from the group consisting of SEQ ID NOs: 6, 7, 9, 10, and 96.
[0012] In one embodiment, the AAV capsid protein variant is at least one variant of the VP1, VP2, and VP3 capsid proteins.
[0013] In a second aspect, nucleic acids encoding the AAV capsid protein variant described herein are provided.
[0014] In a third aspect, a host cell is provided comprising a nucleic acid molecule or expression construct for expressing a capsid protein variant described herein.
[0015] A fourth aspect provides a method for generating an AAV vector virion described herein, comprising a capsid protein variant described herein.
[0016] A fifth embodiment provides a recombinant AAV (rAAV) vector virion comprising at least one AAV capsid protein variant described herein, preferably an rAAV vector virion that does not contain at least one of the wild-type VP1, VP2, and VP3 capsid proteins.
[0017] In one embodiment, the rAAV vector virion comprises a nucleic acid molecule capsid-formed by at least one capsid protein variant, the nucleic acid molecule comprising a transgene flanked by at least one AAV reverse terminal repeat (ITR).
[0018] In a sixth aspect, a composition comprising the AAV vector virion described herein is provided, preferably a pharmaceutical composition comprising the AAV vector virion and at least one pharmaceutically acceptable carrier.
[0019] In a seventh aspect, an AAV vector virion or composition described herein is provided for use as a pharmaceutical, preferably the pharmaceutical being used to treat a central nervous system disorder.
[0020] In an eighth aspect, an AAV vector virion or a composition comprising AAV vector virion as described herein is provided for use (as a pharmaceutical) in gene therapy. In one embodiment, a method of gene therapy is provided, comprising the step of administering an effective amount of an AAV vector virion or a composition comprising AAV vector virion as described herein to a subject in need of gene therapy. In one embodiment, the gene therapy is for the treatment of a disease as defined herein above (for example, a disease or condition that can be treated by gene therapy of the central nervous system).
[0021] In the ninth aspect, a method for identifying AAV capsid variants having desired properties, a) providing a library comprising a plurality of individually generated AAV capsid variants, each member in the library differing from the AAV capsid variant of another member in the library by at least one amino acid, each member in the library comprising a DNA construct, the DNA construct comprising i) a unique molecular identifier (UMI) specific to the member in the library; ii) a reporter gene operably linked to a promoter that drives expression in mammalian cells; and iii) at least one AAV The present invention provides a method comprising the steps of: a) contacting the library with a culture of cells, organoids, or tissues, or administering the library to a non-human animal; c) enabling the transduction of AAV capsid variants in the library into cells, organoids, tissues, or animal cells; and d) identifying at least one AAV capsid variant transductioned into at least one cell of a desired cell type in the cells, organoids, tissues, or animals of b) as an AAV capsid variant having desired properties by determining the sequence of its UMI, and optionally recovering the AAV capsid variant having the desired properties from cells of the desired cell type.
[0022] In one embodiment of this method, step d) includes detecting the transduction of cells of a desired cell type by detecting the expression of a reporter gene in at least one cell of the desired cell type.
[0023] In one embodiment of this method, in step d), for at least two members of the library in at least one cell of a desired cell type, at least one mRNA and genome copy number expressed from those at least two members is quantified and identified by determining the UMI sequence, and the member having the highest mRNA expression level and at least one of the genome copy numbers is identified as an AAV capsid variant having the desired characteristics.
[0024] In one embodiment, the method quantifies and identifies, in at least one cell of a desired cell type, for at least two members in a library, at least one of the mRNA expressed from the at least two members and the genomic copy number, by sequencing its UMI, and identifies the member having the most desired distribution across two or more cell types as an AAV capsid variant having the desired property.
Mode for Carrying Out the Invention
[0025] [Description of the Invention] [Definitions] Unless otherwise defined, technical terms and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein that can be used in the practice of the present invention. In fact, the present invention is in no way limited to these methods.
[0026] In this specification and the claims thereof, the verb "comprising" and its conjugations are used in their non-limiting sense to mean that the items following the word include, but items not specifically mentioned are not excluded. Further, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element exists, unless the context clearly requires that only one of the elements exists. Thus, the indefinite article "a" or "an" typically means "at least one".
[0027] As used herein, the term "and / or" indicates that one or more of the recited instances may occur alone, or in combination with at least one, and up to all of the recited instances.
[0028] As used herein, "at least" a particular value means that value or more. For example, "at least two" is understood to be "two or more", i.e., the same as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15... etc.
[0029] The term "about" or "approximately", when used in relation to a numerical value (e.g., about 10), preferably means that the value can be the given value (10) plus or minus 0.1%.
[0030] As used herein, "effective amount" means the amount of a drug necessary to improve the symptoms of a disease compared to an untreated patient. For example, the effective amount of an active agent used to practice the present invention for the treatment of cancer or a neurological disorder will vary depending on the mode of administration, the age, weight and general health of the subject. Ultimately, the attending physician or veterinarian will determine the appropriate amount and dosing regimen. Such amount is referred to as an "effective" amount and can be determined, for example, as the number of genomic copies per kilogram (GC / kg) or as the number of GCs per administration. Thus, in the context of the present disclosure, in relation to the administration of a drug that is "effective against" a disease or condition, the disease or condition is such that administration in a clinically appropriate manner results in an improvement in symptoms, a cure, a reduction in at least one disease sign or symptom, an extension of lifespan, an improvement in quality of life, or other effects generally recognized by a physician skilled in the treatment of a particular type of disease or condition to be beneficial to at least a statistically significant proportion of patients, such as beneficial effects.
[0031] The use of a substance as a pharmaceutical described herein can also be construed as the use of said substance in the manufacture of a pharmaceutical. Similarly, whenever a substance is used for treatment or as a pharmaceutical, it can also be used for the manufacture of a pharmaceutical for treatment. A product for use as a pharmaceutical described herein can be used in a method of treatment, such method of treatment including the administration of the product for use.
[0032] The terms "homology" and "sequence identity" are used interchangeably herein. Sequence identity is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, determined by comparing sequences. In the art, "identity" and "similarity" also mean the degree of sequence relevance between amino acid or nucleic acid sequences, which may be determined by matching strings of such sequences. "Identity" and "similarity" can be readily calculated by known methods.
[0033] Sequence identity and sequence similarity can be determined by the alignment of two peptide or nucleotide sequences using a global or local alignment algorithm, depending on the lengths of the two sequences. Sequences of similar lengths are preferably aligned using a global alignment algorithm (e.g., Needleman-Wunsch) that optimally aligns the sequences over their entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g., Smith-Waterman). Sequences may be referred to as "substantially identical" or "essentially similar" when they share at least a certain minimum percentage of sequence identity (as defined below) (e.g., when optimally aligned by the program GAP or BESTFIT using default parameters). GAP uses the Needleman-Wunsch global alignment algorithm to align two sequences over their full length (total length), maximizing the number of matches and minimizing the number of gaps. When two sequences have similar lengths, global alignment is appropriately used to determine sequence identity. Generally, the default GAP parameters are used with a gap creation penalty of 50 (nucleotides) / 8 (proteins) and a gap elongation penalty of 3 (nucleotides) / 2 (proteins). For nucleotides, the default scoring matrix used is nwsgapdna, and for proteins, the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS89, 915-919).Sequence alignment and scoring for sequence identity percentage can be determined using computer programs such as the GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or using open-source software such as EmbossWIN version 2.10.0's "needle" program (using the global Needleman-Wunsch algorithm) or "water" program (using the local Smith-Waterman algorithm), using the same parameters as GAP described above, or using default settings (for both "needle" and "water," and for both protein and DNA alignments, the default gap opening penalty is 10.0, the default gap elongation penalty is 0.5, and the default scoring matrix is Blossum62 for protein and DNAFull for DNA). If the sequences have substantially different full lengths, local alignment, such as that using the Smith-Waterman algorithm, is preferred.
[0034] Alternatively, the degree of similarity or identity can be determined by searching public databases using algorithms such as FASTA and BLAST. Therefore, the nucleic acid and protein sequences of the present invention can be further used as "query sequences" for performing searches against public databases, for example, to identify other family members or related sequences. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) from Altschul, et al. (1990) J.Mol.Biol.215:403-10. A BLAST nucleotide search can be performed using the NBLAST program, score=100, word length=12, to obtain nucleotide sequences homologous to the oxidoreductase nucleic acid molecule of the present invention. A BLAST protein search can be performed using the BLASTx program, score=50, word length=3, to obtain amino acid sequences homologous to the protein molecule of the present invention. To obtain gapped alignments for comparative purposes, gapped BLAST can be used, as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When using the BLAST and Gapped BLAST programs, the default parameters for each program (e.g., BLASTX and BLASTn) can be used. See the National Center for Biotechnology Information website (http: / / www.ncbi.nlm.nih.gov / ) for more information.
[0035] As used herein, the terms “selectively hybridize,” “selectively hybridize,” and similar terms are intended to describe hybridization and washing conditions in which nucleotide sequences that are at least 66%, at least 70%, at least 75%, at least 80%, more preferably at least 85%, even more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, or more preferably at least 99% homologous to each other typically remain hybridized. That is, such hybridized sequences may share at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, more preferably at least 85%, even more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, or more preferably at least 99% sequence identity.
[0036] A preferred, non-limiting example of such hybridization conditions is hybridization in 6x sodium chloride / sodium citrate (SSC) at about 45°C, followed by one or more washes in 1x SSC, 0.1% SDS at about 50°C, preferably about 55°C, preferably about 60°C, and even more preferably about 65°C.
[0037] Highly stringent conditions include, for example, hybridization in 5x SSC / 5x Denhardt solution / 1.0% SDS at approximately 68°C and washing in 0.2x SSC / 0.1% SDS at room temperature. Alternatively, washing may be carried out at 42°C.
[0038] Those skilled in the art will know the conditions that should be applied to stringent hybridization conditions and highly stringent hybridization conditions. Further guidance on such conditions can be found, for example, in Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, NY; and Ausubel et al. (eds.), Sambrook and Russell (2001) “Molecular Cloning: A Laboratory Manual (3 rd This is readily available in the field in the book *Current Protocols in Molecular Biology* (John Wiley & Sons, NY), published by Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York, 1995.
[0039] Naturally, polynucleotides that hybridize only to poly(A) sequences (such as the 3'-terminal poly(A) region of mRNA) or only to the complementary stretch of T (or U) will not be included in the polynucleotides of the present invention used to specifically hybridize to a portion of the nucleic acids of the present invention. This is because such polynucleotides hybridize to any nucleic acid molecule containing the poly(A) stretch or its complement (e.g., substantially any double-stranded cDNA clone).
[0040] In this specification, “nucleic acid construct” or “nucleic acid vector” is understood to mean an artificial nucleic acid molecule resulting from the use of recombinant DNA technology. Therefore, the term “nucleic acid construct” does not include naturally occurring nucleic acid molecules, although a nucleic acid construct may include (some of) naturally occurring nucleic acid molecules. A “vector” is a nucleic acid construct (typically DNA or RNA) that helps to transfer an exogenous nucleic acid sequence (i.e., DNA or RNA) into a host cell. A vector is preferably maintained in a host by at least one of autonomous replication and integration into the host cell’s genome. The term “expression vector” or “expression construct” refers to a nucleotide sequence that can influence the expression of a gene in a host cell or host organism that is compatible with such a sequence. These expression vectors typically comprise at least one “expression cassette,” which is a functional unit that can influence the expression of a sequence encoding the product to be expressed, the coding sequence being operably linked to at least a suitable transcriptional regulatory sequence and, optionally, a suitable expression regulatory sequence including a 3' transcription termination signal. Further factors necessary or useful for influencing expression, such as expression enhancer elements, may also exist. Expression vectors can be introduced into suitable host cells and influence the expression of coding sequences in in vitro cell cultures of the host cells. Preferred expression vectors are suitable for the expression of viral proteins and / or nucleic acids, particularly recombinant parvovirus proteins and / or nucleic acids, such as baculovirus vectors for the expression of parvovirus proteins and / or nucleic acids in insect cells.
[0041] A “parvovirus vector” is defined as a recombinantly produced parvovirus or parvovirus particle containing a polynucleotide that is delivered to a host cell either in vivo, ex vivo, or in vitro. Adeno-associated virus (AAV) vectors are an example of parvovirus vectors. In this specification, a parvovirus or AAV vector refers to a portion of the parvovirus genome, usually at least one ITR, and a polynucleotide containing a transgene, which is preferably packaged within a parvovirus or AAV capsid.
[0042] As used herein, the terms “promoter” or “transcriptional regulatory sequence” refer to a nucleic acid fragment structurally identified by the presence of a binding site to any other DNA sequence known to those skilled in the art, which functions to control the transcription of one or more coding sequences, is located upstream of the transcription start site of the coding sequence, and includes, but is not limited to, a DNA-dependent RNA polymerase, a transcription start site, and transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequences that act to directly or indirectly regulate the amount of transcription from the promoter. A “component” promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An “inducible” promoter is a promoter that is physiologically or developmentally modulated, for example, by the application of a chemical inducer or biological entity.
[0043] The term "reporter" can be used interchangeably with "marker," but it is primarily used to refer to visible markers such as green fluorescent protein (GFP) or luciferase.
[0044] The terms "protein" and "polypeptide" are used interchangeably to refer to molecules consisting of chains of amino acids, without referring to a specific mode of action, size, three-dimensional structure, or origin.
[0045] The term "gene" refers to a DNA fragment that contains a region (transcription region) that is transcribed into an RNA molecule (e.g., mRNA) within a cell and operably ligated to an appropriate regulatory region (e.g., a promoter). A gene will typically contain several operably ligated fragments, such as a promoter, a 5' leader sequence, a coding region, and a 3' untranslated sequence (3' end) containing polyadenylation sites. "Genetic expression" refers to the process by which the DNA region operably ligated to an appropriate regulatory region, particularly a promoter, is transcribed into RNA that is biologically active, i.e., can be translated into a biologically active protein or peptide.
[0046] When the term "homologous" is used to describe the relationship between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, in nature, it is understood to mean that the nucleic acid or polypeptide molecule is produced by a host cell or organism of the same species, preferably the same type or strain. When homologous to a host cell, the nucleic acid sequence encoding the polypeptide is typically (but not necessarily) operably linked to a different (heterogeneous) promoter sequence, and, if applicable, another (heterogeneous) secretory signal sequence and / or terminator sequence, than those in its natural environment. It is understood that regulatory sequences, signal sequences, terminator sequences, etc., may also be homologous to the host cell. In this regard, the use of "homologous" sequence elements alone enables the construction of "self-cloning" genetically modified organisms (GMOs) (self-cloning is defined herein as in Annex II of European Directive 98 / 81 / EC). When used to describe the relationship between two nucleic acid sequences, the term "homologous" means that one single-stranded nucleic acid sequence can hybridize to a complementary single-stranded nucleic acid sequence. The degree of hybridization can depend on many factors, including the amount of identity between sequences and hybridization conditions such as temperature and salt concentration, as will be discussed later.
[0047] The terms “heterogeneous” and “exogenous,” when used in reference to nucleic acids (DNA or RNA) or proteins, refer to nucleic acids or proteins that are not naturally present as part of the organism, cell, genome, or DNA or RNA sequence in which they exist, or that are found in a different cell or location in the genome or DNA or RNA sequence than where they are found naturally. Heterogeneous and exogenous nucleic acids or proteins are not endogenous to the cell into which they are introduced, but are obtained from another cell or produced synthetically or recombinantly. Generally, though not always, such nucleic acids encode proteins that are not normally produced by the cell in which the DNA is transcribed or expressed, i.e., exogenous proteins. Similarly, exogenous RNA encodes proteins that are not normally expressed in the cell in which the exogenous RNA exists. Heterogeneous / exogenous nucleic acids and proteins are sometimes also called foreign nucleic acids or proteins. Any nucleic acid or protein that a person skilled in the art would recognize as foreign to the cell in which it is expressed is included herein in the term heterogeneous or exogenous nucleic acid or protein. The terms heterogeneous and exogenous also apply to unnatural combinations of nucleic acids or amino acid sequences, i.e., combinations in which at least two of the combined sequences are heterogeneous.
[0048] As used herein, the term “not naturally occurring” when used in reference to an organism means that the organism has at least one genetic alteration not typically found in naturally occurring strains of the species mentioned, including wild-type strains of the species mentioned. Genetic alterations include, for example, modifications that introduce expressible nucleic acids encoding proteins or enzymes, other nucleic acid additions, nucleic acid deletions, nucleic acid substitutions, or other functional disruptions of the organism’s genetic material. Such modifications include, for example, coding regions and functional fragments of heterologous or homologous polypeptides of the referenced species. Further modifications include, for example, non-coding regulatory regions in which the modification alters the expression of a gene or operon. Genetic modifications to nucleic acid molecules encoding enzymes or functional fragments thereof can confer biochemical reaction capacity or metabolic pathway capacity to unnaturally occurring organisms that have been altered from their naturally occurring state.
[0049] As used herein, the term “operably linked” refers to the linking of functionally related polynucleotide (or polypeptide) elements. A nucleic acid is “operably linked” if it is functionally related to another nucleic acid sequence. For example, a transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of that coding sequence. Being operably linked means that the linked DNA sequences are typically contiguous and, if necessary, contiguous and within a read frame when two protein-coding regions need to be linked.
[0050] When an expression regulatory sequence controls and regulates the transcription and / or translation of a nucleotide sequence, the expression regulatory sequence is "operably ligated" to the nucleotide sequence. Thus, an expression regulatory sequence may include a promoter, enhancer, internal ribosome entry site (IRES), transcription terminator, start codon prior to a protein-coding gene, splicing signal for an intron, and stop codon.
[0051] The term “expression regulatory sequence” is intended to include, at a minimum, sequences designed so that their presence affects expression, and may also include additional beneficial components. For example, leader sequences and fusion partner sequences are expression regulatory sequences. The term may also include the design of nucleic acid sequences such that undesirable potential start codons inside or outside the frame are removed from the sequence. It may also include the design of nucleic acid sequences such that undesirable potential splice sites are removed. This includes sequences called poly-A tails, i.e., sequences that direct the addition of a series of adenine residues to the 3' end of mRNA, or polyadenylation sequences (pA), or poly-A sequences. They can also be designed to enhance mRNA stability. Expression regulatory sequences that affect transcriptional and translational stability, such as promoters, and sequences that affect translation, such as Kozak sequences, are known in insect cells. Expression regulatory sequences may be of a nature that modulates the nucleotide sequence to which they are operably linked so that lower or higher expression levels are achieved.
[0052] As used herein, the term “library” refers to a collection of elements or members that are distinct from each other in at least one embodiment. For example, a library of nucleic acid molecules or a library of nucleic acid constructs is a collection of at least two nucleic acid molecules or at least two nucleic acid constructs in which at least one nucleotide is distinct from each other. Similarly, a library of AAV capsid variants is a collection of at least two AAV capsid variants (virions) in which at least one nucleotide and / or at least one amino acid in their capsid proteins is distinct from each other.
[0053] As used herein, the term “targeting” refers to the preferential targeting by a virus (e.g., AAV) by cells of a particular host species or by a particular cell type within a host species. For example, a virus that can infect heart, lung, liver, and muscle cells has broader (i.e., increased) targeting than a virus that can infect only lung and muscle cells. Targeting can also include the dependence of a virus on a particular type of cell surface molecule of its host. For example, some viruses can infect only cells that have surface glycosaminoglycans, while others can infect only cells that have sialic acid (such dependence can be tested using various cell lines that lack a particular class of molecules as potential host cells for viral infection). In some cases, viral affinity describes the relative preference of a virus. For example, a first virus can infect all cell types, but is far more successful in infecting those cells with surface glycosaminoglycans. Even if the absolute transduction efficiency of the second virus is not similar, if the second virus also prefers the same characteristics (for example, the second virus also succeeds by infecting these cells with surface glycosaminoglycans), it can be considered to have similar (or identical) directivity to the first virus. For example, if the second virus may be more efficient than the first virus in infecting any given cell type tested, but the relative priorities are similar (or five are identical), the second virus can still be considered to have similar (or identical) directivity to the first virus. In some embodiments, the directivity of virions containing the target variant AAV capsid protein is unchanged compared to naturally occurring virions. In some embodiments, the directivity of virions containing the target variant AAV capsid protein is expanded (i.e., spreads) compared to naturally occurring virions. In some embodiments, the directivity of virions containing the target variant AAV capsid protein is reduced compared to naturally occurring virions.
[0054] References to nucleotide or amino acid sequences available in public sequence databases herein refer to versions of sequence entries available as of the filing date of this specification.
[0055] [Detailed description of the invention] Surprisingly, the inventors have found that the functionally defective phenotype of the AAV9 capsid variant can be rescued by introducing additional modifications to the amino acid sequence of the functionally defective capsid that promotes CNS targeting, thereby generating a novel capsid variant that combines enhanced CNS targeting with hepatic detargeting characteristics.
[0056] [Adeno-associated virus capsid protein variant] In a first embodiment, an adeno-associated virus (AAV) capsid protein variant is provided. In one embodiment, the AAV capsid protein is a variant of AAV serotype 9 (AAV9) or clade F AAV capsid protein. The “variant” of AAV9 or clade F AAV capsid protein is understood herein as an AAV capsid protein having at least one amino acid difference (mutation) compared to the wild-type AAV9 or clade F AAV capsid protein. The at least one amino acid difference may be an amino acid substitution, insertion, or deletion in the amino acid sequence of the wild-type capsid protein.
[0057] The wild-type AAV9 capsid protein is understood herein to consist of, contain, or include the amino acid sequence of Sequence ID No. 2 (AAV9 VP1 capsid protein; GenBank® database accession number AY530579.1; GenBank® database accession number AAS99264.1). The wild-type clade F AAV capsid protein is understood herein to be the capsid protein of the clade F AAV isolate as defined by Gao et al. (2004, J. Virol. 78:6381-6388), which includes AAV9, as well as hu.31 (coded by GenBank® database accession number JA400111.1) and hu.32 (coded by GenBank® database accession number JA400112.1). In one embodiment, the wild-type clade F AAV capsid protein is understood herein as a capsid protein of an AAV isolate comprising, consisting of, or containing an amino acid sequence having more than 87.5%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 2.
[0058] The designation of all amino acid positions in the AAV capsid protein and its variants used herein relates to the AAV9 VP1 capsid subunit numbering of SEQ ID NO: 2. Corresponding positions in amino acid sequences other than SEQ ID NO: 2 are identified using sequence alignment, preferably using the algorithms and settings described above.
[0059] Therefore, in one embodiment, an AAV9 or clade F AAV capsid protein variant is provided, wherein the mutation confers at least one of the following phenotypes to the capsid protein: i) a reduced hepatic transduction phenotype compared to a control capsid protein without the mutation, and ii) a reduced overall transduction phenotype compared to a control capsid protein without the mutation, and the capsid protein further comprises an amino acid sequence that results in increased CNS transduction (compared to a control capsid protein without the amino acid sequence).
[0060] In one embodiment, the phenotypes of reduced hepatic transduction, reduced overall transduction, and CNS transduction of the capsid protein variant are phenotypes achieved upon systemic administration of a recombinant AAV (rAAV) vector containing the capsid protein variant, compared to a control capsid protein.
[0061] Compared to a control capsid protein, the phenotypes of reduced hepatic transduction, reduced overall transduction, and increased CNS transduction of a capsid protein variant can be determined by administering an rAAV vector containing the capsid protein variant to a non-human animal, determining the transduction profile (i.e., distribution) of the rAAV vector in various target tissues of the animal, and preferably comparing the transduction profile of the rAAV vector containing the capsid protein variant to the transduction profile of a control rAAV vector, preferably under otherwise identical conditions. In one embodiment, the transduction profile is determined at systemic administration. In one embodiment, the transduction profile is determined at 2, 3, 4, 5, or 6 weeks after administration. In one embodiment, the non-human animal is a mouse or other research animal, such as a rabbit, rat, monkey, or non-human primate, but is not limited to these.
[0062] As is understood, the target tissue for determining the transduction profile depends on the desired targeting and detargeting of the capsid protein variant. For improved CNS targeting and liver detargeting, the target tissues include at least the CNS (brain) and liver, but may also include major organs such as the heart, lungs, and skeletal muscle. For a more specific determination of the CNS transduction profile, different parts of the brain, such as the frontal, hindbrain, and cerebellum, can be examined separately.
[0063] Methods for determining the transduction profile are known in the art and are described, for example, by Pulicherla et al. (2011, cited above), Hanlon et al. (2019, cited above), Nonnenmacher et al. (2020, cited above), Goersten et al. (2022, cited above), and further in this specification and in the examples.
[0064] Accordingly, in one embodiment, the capsid protein variant described herein has at least one mutation that confers a hepatic transduction-reduced phenotype compared to an unmutated control capsid protein. In this specification, the hepatic transduction-reduced phenotype is understood as a phenotype showing a significant reduction in hepatic transduction (at least 2, 3, 5, 10, 20, 50, 100, 200, or more than 500 times) compared to an unmutated control capsid protein, but showing moderate to no change or reduction (less than 2 times) in other histological types.
[0065] In one embodiment, the capsid protein variant described herein has at least one mutation that confers a global transduction reduction phenotype compared to an unmutated control capsid protein. The global transduction reduction phenotype is understood herein as a phenotype showing a significant reduction in transduction of multiple organ / tissue types (at least 2, 3, 5, 10, 20, 50, 100, 200, or more than 500 times) compared to an unmutated control capsid protein.
[0066] In one embodiment, the capsid protein variant described herein contains an amino acid sequence that results in increased CNS transduction (compared to a control capsid protein that does not have an amino acid sequence). The phenotype of increased CNS transduction is understood herein as a phenotype showing a significant increase in transduction to CNS tissue (at least 2, 3, 5, 10, 20, 50, 100, 200, or more than 500 times) compared to a control capsid protein that does not have an amino acid sequence. In one embodiment, the capsid protein variant described herein contains an amino acid sequence that results in increased transduction to at least one of the frontal, hindbrain, and cerebellum. In preferred embodiments, the CNS transduction-enhanced phenotype is understood herein as a phenotype showing a significant increase in transduction into CNS tissue (at least 2, 3, 5, 10, 20, 50, 100, 200, or more than 500 times) compared to a control capsid protein without an amino acid sequence, but showing moderate to no change or increase (less than 2 times) in other tissue types.
[0067] In one embodiment, the capsid protein variant described herein comprises at least one mutation that confers a hepatic transduction-reduced phenotype compared to a control capsid protein without the mutation, wherein the at least one mutation comprises one or more amino acid mutations in the amino acid regions 452-458, 498-504, 590-595, and / or 582-587. In one embodiment, the at least one mutation comprises at least one mutation selected from the group consisting of mutations at positions W595, Q592, W503, N498, E500, and the amino acid sequence DGAATKN at positions 452-458. In one embodiment, the capsid protein variant comprises the W595C mutation, Q592L mutation, W503R mutation, N498Y mutation, E500D mutation, or any combination thereof. Thus, it is understood that at least one mutation results in a hepatic transduction-reduced phenotype compared to a control without the mutation.
[0068] In one embodiment, the capsid protein variant described herein comprises at least one mutation that confers an overall transduction reduction phenotype compared to a control capsid protein without the mutation, wherein the capsid protein variant comprises mutations in T138, S414, G453, K557, T568, T582, and Q590, or any combination thereof. In one embodiment, the capsid protein variant comprises mutations in T568 and Q590, or in T138, S414, G453, K557, and T582. In one embodiment, the capsid protein variant comprises mutations in T568P and Q590L, or in T138A, S414N, G453D, K557E, and T582I. In one embodiment, the capsid protein variant includes mutations in S414 and G453, or in S414, G453, K557, and T582. Therefore, it is understood that at least one mutation results in a global transduction phenotype compared to a control without the mutation.
[0069] In one embodiment, the capsid protein variant described herein comprises an amino acid sequence that results in increased CNS transduction, the amino acid sequence comprising or consisting of amino acid sequences selected from the group consisting of STTLYSP, FVVGQSY, DGTLAVPFK, and WPTSYDA, and amino acid sequences that differ by 4, 3, 2, or 1 or fewer amino acids from these. In one embodiment, the amino acid sequence that results in increased CNS transduction comprises or consists of an amino acid sequence selected from the group consisting of FVVGQSY, FVVAQSY, FVVVQSY, FVVLQSY, FVVIQSY, FVVNQSY, FVVSQSY, FVVEQSY, FVVQQSY, FVVCQSY, FVVTQSY, FVVPQSY, FVVQSY, FVGVQSY, FVVQGSY, FVQGVSY, FSVGQVY, and FSQGVVY. In a preferred embodiment, the amino acid sequence resulting in increased CNS transduction includes or consists of an amino acid sequence selected from the group consisting of FVVGQSY, FVVAQSY, FVVPQSY, FVGVQSY, and FVVQGSY. In one embodiment, the amino acid sequence resulting in increased CNS transduction is inserted into a hypervariable region of the AAV capsid protein sequence, preferably a hypervariable region selected from loop IV or loop VIII.
[0070] In one embodiment, the capsid protein variant described herein is a capsid protein variant comprising mutations in T138A, S414N, G453D, K557E, and T582I, as well as the amino acid sequence FVVGQSY inserted into loop VIII, preferably between the amino acid at position 588 and the amino acid at position 589.
[0071] In one embodiment, the capsid protein variant described herein is a capsid protein variant comprising the mutations S414N, G453D, K557E, and T582I, wherein the amino acid sequence is selected from the group FVVGQSY, FVVAQSY, and FVVQGSY, inserted into loop VIII, preferably between the amino acids at position 588 and 589. In one embodiment, the capsid protein variant described herein is a capsid protein variant comprising the mutations S414N, G453D, K557E, and T582I, and the amino acid sequence FVVGQSY, inserted into loop VIII, preferably between the amino acids at position 588 and 589. In alternative embodiments, the capsid protein variants described herein are capsid protein variants comprising the S414N, G453D, K557E, and T582I mutations, and the amino acid sequence is selected from the group FVGVQSY and FVVPQSY, which are inserted into loop VIII, preferably between the amino acids at positions 587 and 588.
[0072] In one embodiment, the capsid protein variant described herein is a capsid protein variant comprising mutations in T138A, S414N, G453D, K557E, and T582I, as well as the amino acid sequence WPTSYDA inserted into loop VIII, preferably between the amino acid at position 588 and the amino acid at position 589.
[0073] In one embodiment, the capsid protein variant described herein is a capsid protein variant comprising the S414N, G453D, K557E, and T582I mutations, and the amino acid sequence WPTSYDA inserted into loop VIII, preferably between the amino acid at position 588 and the amino acid at position 589.
[0074] In one embodiment, the capsid protein variant described herein is a capsid protein variant comprising the amino acid sequence DGAATKN at positions 452-458 and the amino acid sequence FVVGQSY inserted into loop VIII, preferably between the amino acid at position 588 and the amino acid at position 589.
[0075] In one embodiment, the capsid protein variant described herein is a capsid protein variant comprising the amino acid sequence DGAATKN at positions 452-458 and the amino acid sequence WPTSYDA inserted into loop VIII, preferably between the amino acid at position 588 and the amino acid at position 589.
[0076] In one embodiment, the capsid protein variant described herein is a capsid protein variant comprising, containing, or comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 6, 7, 9, and 10. In one embodiment, the capsid protein variant described herein is a capsid protein variant comprising, containing, or comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 6, 7, 9, 10, and 96.
[0077] In one embodiment, the capsid protein variant described herein is at least one variant of the VP1, VP2, and VP3 capsid proteins. Those skilled in the art will understand that when the modifications described herein are inserted into the AAV cap gene, modifications may be brought about in the VP1, VP2, and / or VP3 capsid subunits, depending on their positions in the VP1 amino acid sequence. However, in one embodiment, the capsid subunits may be expressed independently to achieve the modifications, with only one or two of the capsid subunits being expressed, for example, in VP1, VP2, VP3, VP1 and VP2, VP1 and VP3, or VP2 and VP3.
[0078] [Nucleic acid molecules, host cells, and methods for producing AAV vectors] In a second embodiment, nucleic acids encoding the AAV capsid protein variant described herein are provided. In one embodiment, the nucleic acid molecule is an expression construct for expressing the capsid protein. Preferably, the expression construct is a construct for expressing the capsid protein in a host cell suitable for AAV production, such as a mammalian cell species or insect cell lineage, as further defined below.
[0079] Therefore, in one embodiment, the expression construct for expressing a capsid protein is an insect cytocompatible vector or a mammalian cytocompatible vector. A “mammalian cytocompatible vector” is understood to be a nucleic acid molecule capable of productive transformation or transfection of mammalian cells or cell lines. Mammalian cytocompatible vectors are well known in the art. An “insect cytocompatible vector” is understood to be a nucleic acid molecule capable of productive transformation or transfection of insects or insect cells. Exemplary insect cytocompatible vectors include plasmids, linear nucleic acid molecules, and recombinant viruses such as baculoviruses. Any vector can be used as long as it is insect cytocompatible. Mammalian or insect cytocompatible vectors can be incorporated into the genome of a cell, but the presence of the vector in the cell does not need to be permanent, and transient episomal vectors are also included. Vectors can be introduced by any known means, for example, by chemical treatment of cells, electroporation, or infection.
[0080] In one embodiment, the vector is a baculovirus, a viral vector, or a plasmid. In a more preferred embodiment, the insect cell-compatible vector is a baculovirus, i.e., the nucleic acid construct is a baculovirus expression vector (BEV). It is well known that baculovirus expression vectors are particularly suitable for the transfer of nucleic acids into insect cells, and their use can be found in, for example, Summers and Smith, 1986, “A Manual of Methods for Baculovirus Vectors and Insect Culture Procedures”, Texas Agricultural Experimental Station Bull. No. 7555, College Station Tex.; Luckow, 1991, In Prokop et al., “Cloning and Expression of Heterologous Genes in Insect Cells with Baculovirus Vectors' Recombinant DNA Technology and Applications”, 97-152; King and Possee, 1992, “The baculovirus expression system”, Chapman and Hall, United Kingdom; O'Reilly, Miller, and Luckow, 1992, “Baculovirus Expression Vectors: A Laboratory Manual”, New York; Freeman and Richardson, 1995, “Baculovirus Expression Protocols”, Methods in Molecular This is described in Biology, volume 39; U.S. Patent No. 4,745,051; U.S. Patent Application Publication No. 2003148506; and International Publication No. 03 / 074714.
[0081] In one embodiment, at least one expression construct is provided, comprising separate expression cassettes for each of the VP1, VP2, and VP3 capsid protein variants described herein. In one embodiment, at least one expression construct is provided, comprising a separate expression cassette for the VP1 capsid protein variant described herein and separate expression cassettes for the VP2 and VP3 protein variants described herein. The various expression cassettes for the different capsid protein variants described herein may be present together in a single expression construct / nucleic acid molecule, or one or more expression cassettes for different capsid proteins may be present on two or three separate expression constructs / nucleic acid molecules, each containing one of the expression cassettes for different capsid proteins. As understood, by using separate expression cassettes for one or more different capsid proteins, it becomes possible to produce AAV vectors in which only some capsid proteins have the above modifications / mutations, for example, only in VP1 and not in VP2 and VP3, or vice versa, or to produce AAV vectors in which different capsid proteins have different above modifications / mutations. Expression constructs for the individual expression of various capsid proteins in mammalian cells are disclosed, for example, in Judd et al. (Mol Ther Nucleic Acids. 2012;1:e54). Expression constructs for the separate expression of various capsid proteins in insect cells are disclosed in international publication brochure 2022 / 253955.
[0082] In another embodiment, an expression construct is provided that includes a single expression cassette for expressing all three VP1, VP2, and VP3 capsid protein variants described herein, preferably from a single coding sequence. Expression constructs for expressing all three VP1, VP2, and VP3 capsid proteins from a single expression cassette in mammalian cells are disclosed, for example, in Clark et al. (1995, Hum. Gene Ther. 6, 1329-134), Gao et al. (1998, Hum. Gene Ther. 9, 2353-2362), Inoue and Russell (1998, J. Virol. 72, 7024-7031), Grimm et al. (1998, Hum. Gene Ther. 9, 2745-2760), and Xiao et al. (1998, J. Virol. 72, 2224-2232). Expression constructs for expressing all three VP1, VP2, and VP3 capsid proteins from a single expression cassette in insect cells are disclosed, for example, in Urabe et al. (2002, Hum. Gene Ther. 13:1935-1943), International Publication No. 2007 / 046703, International Publication No. 2015 / 137802, and International Publication No. 2019 / 016349. As understood, expressing all three VP1, VP2, and VP3 capsid protein variants described herein from a single coding sequence (in a single expression cassette) makes it possible to produce an AAV vector containing the mutations / modifications described herein in all three VP1, VP2, and VP3 capsid proteins.
[0083] In a third aspect, a host cell is provided comprising a nucleic acid molecule or expression construct for expressing a capsid protein variant described herein. The host cell is preferably a host cell suitable for the production of AAV vectors. Therefore, the host cell is suitable for in vitro culture, preferably on a large scale. Host cells suitable for the production of AAV vectors are well known in the art and are typically mammalian cell lines or insect cell lines. Mammalian cell lines for producing AAV vectors are selected from any mammalian species and include, but are not limited to, A549, WEHI, 3T3, 10T1 / 2, BHK, MDCK, COS1, COS7, BSC1, BSC40, BMT10, VERO, WI38, HeLa, HEK293 cells (expressing functional adenovirus E1), Saos, C2C12, L cells, HT1080, HepG2, and primary fibroblasts, hepatocytes, and myoblasts derived from mammals including humans, monkeys, mice, rats, rabbits, and hamsters. The selection of mammalian species providing cells is not limited to the disclosure, nor is it limited to the type of mammalian cell, i.e., fibroblasts, hepatocytes, or tumor cells. Mammalian cell lines for producing AAV vectors particularly include a wide range of HEK293 cell lines, of which HEK293T cell lines are preferred.
[0084] The insect cell line for producing the AAV vector can be any cell line suitable for the production of heterologous proteins. The insect cells are preferably capable of replicating the baculovirus vector and can be maintained in culture, more preferably in suspension culture. In a preferred embodiment, the insect cells can replicate recombinant parvovirus vectors containing the rAAV vector. For example, the cell line used may be derived from Spodoptera frugiperda, Drosophila, or mosquito cell lines, such as Aedes albopictus. Preferred insect cells or cell lines are those derived from insect species susceptible to baculovirus infection, such as S2 (CRL-1963, ATCC), Se301, SeIZD2109, SeUCR1, Sf9, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAm1, Ha2302, Hz2E5, High Five (Invitrogen, CA, USA), and expressSF+ (registered trademark) (U.S. Patent No. 6,103,526; Protein Sciences Corp., CT, USA).
[0085] In one embodiment, a host cell comprising an expression construct for the expression of a capsid protein variant described herein further comprises a nucleotide sequence for expressing an AAV vector. Such a further nucleotide sequence typically comprises an expression construct for expressing an AAV rep protein in the host cell in question. Such a further nucleotide sequence further comprises a nucleic acid construct comprising a transgene typically flanked by at least one AAV ITR sequence.
[0086] Therefore, a nucleic acid construct containing a transgene adjacent to at least one AAV ITR sequence is incorporated into the genome of a recombinant parvovirus (rAAV) vector, preferably when produced in a suitable host cell expressing AAV rep and cap gene products. In one embodiment, the nucleotide sequence containing the transgene is adjacent to two AAV ITR nucleotide sequences, and therefore the nucleotide sequence containing the transgene is located between the two AAV ITR nucleotide sequences. In one embodiment, the nucleotide sequence containing the transgene can be incorporated into an rAAV vector produced in insect cells if it is located between two normal ITRs or on either side of two ITRs manipulated by D regions. Therefore, in a preferred embodiment, a nucleic acid construct containing two AAV ITR nucleotide sequences is provided, where the nucleotide sequence containing the transgene is located between the two AAV ITR nucleotide sequences.
[0087] Typically, nucleic acid constructs comprising an ITR and an AAV capsid variant expression cassette and a nucleotide sequence containing an enhancer element operably ligated thereto are no longer than 5,000 nucleotides (nt) to ensure they do not exceed the maximum AAV packaging limit of 5.5 kbp. However, in other embodiments using nucleic acid constructs that are larger than usual, for example, longer than 5,000 nt or exceeding the maximum AAV packaging limit of 5.5 kbp, the production of rAAV vectors is still possible and therefore not excluded.
[0088] For the generation of recombinant AAV virions, i.e., AAV vectors, in insect cells, AAV sequences that can be used as described herein may be derived from the genome of any AAV serotype. Generally, AAV serotypes have genomic sequences with significant homology at the amino acid and nucleic acid levels, provide the same set of gene functions, produce virions that are substantially physically and functionally equivalent, and replicate and assemble by substantially the same mechanisms. For an overview of the genomic sequences and genomic similarities of various AAV serotypes, see, for example, GenBank accession numbers U89790, J01901, AF043303, AF085716, Chlorini et al. (1997, J.Vir.71:6823-33), Srivastava et al. (1983, J.Vir.45:555-64), Chlorini et al. (1999, J.Vir.73:1309-1319), Rutledge et al. (1998, J.Vir.72:309-319), and Wu et al. (2000, J.Vir.74:8635-47). Any AAV serotype can be used as a source of AAV nucleotide sequences for use in the context of this invention. The AAV ITR sequences for use in connection with the present invention are preferably derived from AAV1, AAV2, AAV4 and / or AAV7. Similarly, the Rep(Rep78 / 68 and Rep52 / 40) code sequences are preferably derived from AAV1, AAV2, AAV4 and / or AAV7.
[0089] AAV Rep and ITR sequences are particularly conserved among most serotypes. Rep78 proteins from various AAV serotypes are, for example, over 89% identical, and the total nucleotide sequence identity at the genomic level between AAV2, AAV3A, AAV3B, and AAV6 is approximately 82% (Bantel-Schaal et al., 1999, J. Virol., 73(2):939-947). Furthermore, many AAV serotype Rep and ITR sequences are known to efficiently cross-complement (i.e., functionally substitute) corresponding sequences from other serotypes in the production of AAV particles in mammalian cells. U.S. Patent Application Publication No. 2003148506 also reports that AAV Rep and ITR sequences efficiently cross-complement other AAV Rep and ITR sequences in insect cells. Modified “AAV” sequences can also be used in this context, for example, for the production of rAAV vectors in insect cells. Examples of such modified sequences include sequences having at least approximately 70%, at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95%, or more nucleotide and / or amino acid sequence identity with AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13ITR (for example, sequences with approximately 75-99% nucleotide sequence identity), or Rep can be used instead of the wild-type AAV ITR or Rep sequence.
[0090] A fourth aspect provides a method for generating an AAV vector virion as described herein, comprising a capsid protein variant as described herein. The method preferably comprises a) culturing a host cell as defined herein under conditions such that an AAV vector is generated; and b) optionally performing one or more of the following steps: recovery, purification, and formulation of the AAV vector.
[0091] The AAV in the supernatant can be recovered and / or purified using preferred techniques known to those skilled in the art. For example, monolithic columns (e.g., ion exchange, affinity, or IMAC modes), chromatography (e.g., capture chromatography, fixed chromatography, and extended-bed chromatography), centrifugation, filtration, and precipitation can be used for purification and concentration. These methods can be used alone or in combination. In one embodiment, a capture chromatography method including a column-based or membrane-based system is used in combination with filtration and precipitation. For example, a preferred precipitation method using polyethylene glycol (PEG) 8000 and NH3SO4 can be readily selected by those skilled in the art. The precipitate can then be treated with benzonase and purified using preferred techniques. Furthermore, recovery may preferably include a step of affinity purification of recombinant parvovirus (rAAV) vector (containing virions) using an anti-AAV antibody, preferably an immobilized antibody. The anti-AAV antibody is preferably a monoclonal antibody. Particularly preferred antibodies are, for example, single-stranded camel antibodies or fragments thereof available from camels or llamas (see, e.g., Muyldermans, 2001, Biotechnol. 74:277-302). Antibodies for affinity purification of rAAV are preferably antibodies that specifically bind to epitopes on AAV capsid proteins, and preferably the epitopes are epitopes present on the capsid proteins of two or more AAV serotypes. For example, an antibody may be prepared or selected based on specific binding to the AAV2 capsid, but at the same time, it may also specifically bind to AAV9 on the clade F capsid.
[0092] Generally, preferred methods and means (e.g., expression constructs for expressing AAV rep proteins) for constructing the AAV vector virions described herein in mammalian or insect host cells are described for mammalian cells by Clark et al. (1995, Hum. Gene Ther. 6, 1329-134), Gao et al. (1998, Hum. Gene Ther. 9, 2353-2362), Inoue and Russell (1998, J. Virol. 72, 7024-7031), Grimm et al. (1998, Hum. Gene Ther. 9, 2745-2760), Xiao et al. (1998, J. Virol. 72, 2224-2232), and Judd et al. (Mol Ther Nucleic Acids. 2012;1:e54), and for insect cells by Urabe et al. This is described in al. (2002, Hum. Gene Ther. 13:1935-1943), in International Publication Nos. 2007 / 046703, 2007 / 148971, 2009 / 014445, 2009 / 104964, 2011 / 122950, 2013 / 036118, 2015 / 137802, 2019 / 016349, and in concurrently filed European Patent No. 21177449.2, PCT / EP2021 / 058794, and PCT / EP2021 / 058798, all of which are incorporated herein by reference in their entirety.
[0093] [Recombinant AAV Vector Billion] In a fifth aspect, a recombinant AAV (rAAV) vector virion comprising at least one AAV capsid protein variant described herein is provided.
[0094] In this specification, “rAAV vector,” “rAAV virion,” or “rAAV vector virion” is defined as a genetically modified AAV or AAV particle containing polynucleotides delivered to a host cell in vivo, ex vivo, or in vitro. In this specification, “AAV vector construct” or “AAV provector” refers to a viral genome or a portion thereof, typically containing at least one ITR and a polynucleotide including a transgene.
[0095] In one embodiment, an rAAV vector virion comprising at least one AAV capsid protein variant described herein does not contain at least one of the wild-type VP1, VP2, and VP3 capsid proteins. Therefore, the described rAAV vector virion may contain one or at most two of the wild-type VP1, VP2, and VP3 capsid proteins, but may not contain all three.
[0096] In one embodiment, an rAAV vector virion comprising at least one AAV capsid protein variant described herein comprises a nucleic acid molecule capsid-formed by at least one capsid protein variant. Thus, an rAAV vector virion described herein comprises a capsid comprising one or more of the VP1, VP2, and VP3 AAV capsid protein variants described herein, the capsid comprising (or "packaging") a nucleic acid molecule. In one embodiment, the nucleic acid molecule comprises a transgene (a nucleotide sequence encoding a transgene) flanked by at least one AAV reverse terminal repeat (ITR). In one embodiment, the nucleic acid molecule comprises a transgene flanked by two ITRs, one on each side. Such a nucleic acid molecule, i.e., an AAV provector, can be replicated and packaged into infectious viral particles when present in a suitable host cell expressing the AAV rep and cap gene products (i.e., AAV Rep and Cap proteins).
[0097] [Transgenes] In this specification, the nucleotide sequence comprising the transgene as defined above may therefore include a nucleotide sequence encoding a gene product of interest (for expression in mammalian cells) or a nucleotide sequence targeting a gene of interest (for silencing a gene of interest in mammalian cells), and may be positioned to be incorporated into a recombinant parvovirus (rAAV) vector replicated in insect cells. It is understood that human cells are particularly preferred mammalian cells for expressing or silencing the “gene product of interest.” Any nucleotide sequence may be incorporated for subsequent expression in mammalian cells transfected with the recombinant parvovirus (rAAV) vector produced as described herein. The nucleotide sequence may, for example, encode a protein, or express an RNAi agent, i.e., an RNA molecule capable of RNA interference, such as shRNA (short hairpin RNA) or siRNA (small interfering RNA). "siRNA" refers to small interfering RNA, which is a short, double-stranded RNA that is non-toxic to mammalian cells (Elbashir et al., 2001, Nature 411:494-98; Caplen et al., 2001, Proc. Natl. Acad. Sci. USA 98:9742-47). In a preferred embodiment, the nucleotide sequence containing the transgene may include two coding nucleotide sequences, each encoding a single target gene product expressed in a mammalian cell. Each of the two nucleotide sequences encoding the target product is positioned to be incorporated into a recombinant parvovirus (rAAV) vector replicated in insect cells.
[0098] The desired product for expression in mammalian cells may be a therapeutic gene product. A therapeutic gene product may be a polypeptide, an RNA molecule (si / sh / miRNA), or another gene product that provides a desired therapeutic effect when expressed in target cells. The desired therapeutic effect may be, for example, the removal of undesirable activity (e.g., VEGF), the completion of a gene defect, the silencing of a disease-causing gene, the restoration of enzyme activity deficiencies, or any other disease-modifying effect. Examples of therapeutic polypeptide gene products include, but are not limited to, growth factors, factors forming part of the coagulation cascade, enzymes, lipoproteins, cytokines, neurotrophic factors, hormones, and therapeutic immunoglobulins, as well as variants thereof. Examples of therapeutic RNA molecular products include, but are not limited to, miRNAs effective in silencing diseases, including polyglutamine diseases, dyslipidemia, or amyotrophic lateral sclerosis (ALS).
[0099] The diseases that can be treated with recombinant parvovirus (rAAV) vectors produced as described herein are not particularly limited, except that they generally have a genetic cause or genetic basis. For example, diseases that can be treated with the vectors of this disclosure include acute intermittent porphyria (AIP), age-related macular degeneration, Alzheimer's disease, arthritis, Batten disease, Canavan disease, citrullinemia type 1, Kriglan-Nager, congestive heart failure, cystic fibrosis, Duchenne muscular dystrophy, dyslipidemia, glycogen storage disease type 1 (GSD-I), hemophilia A, hemophilia B, hereditary emphysema, homozygous familial hypercholesterolemia (HoFH), Huntington's disease (HD), Leber congenital amaurosis, methylmalonic acidemia, ornithine transcarbamylase deficiency (OTC), Parkinson's disease, phenylketonuria (PKU), spinal muscular atrophy, paralysis, Wilson's disease, epilepsy, Pompe disease, amyotrophic lateral sclerosis (ALS), and Tey= Examples of preferred AAV vectors in this specification include, but are not limited to, Sachs' disease, hyperoxaluria (PH-1), spinocerebellar degeneration type 1 (SCA-1), SCA-2, SCA-3, microdystrophin, Gaucher disease type II or III, arrhythmic right ventricular cardiomyopathy (ARVC), Fabry disease, familial Mediterranean fever (FMF), propionic acidemia, fragile X syndrome, Rett syndrome, Niemann-Pick disease, and Krabbe disease. Since preferred AAV vectors in this specification are CNS-targeting, preferred diseases that can be treated with AAV vectors produced as described herein are diseases of the central nervous system, preferably hereditary diseases, and / or (hereditary) diseases that can be treated by targeting the CNS with the AAV vector.
[0100] Examples of therapeutic gene products that may be expressed include antibodies, N-acetyl-alpha-glucosaminidase (NaGLU), Treg167, Treg289, EPO, IGF, IFN, GDNF, FOXP3, factor VIII, factor IX, insulin, aromatic L-amino acid decarboxylase (AADC), ApoE2, frataxin, motor neuron survival (SMN) protein, glucocerebrosidase, N-sulfoglucosamine sulfohydrolase, iduronate 2-sulfatase, alpha-L-iduronidase, palmitoyl-protein thioesterase 1, tripeptidyl peptidase 1, batenin, CLN5, CLN6 (linkrin), MFSD8, CLN8, aspartoacylase (ASPA), progranulin (GRN), MeCP2, beta-galactosidase (GLBl), and / or gigaxonin (GAN). Since the preferred AAV vectors provided herein are CNS-oriented, the preferred therapeutic gene products are useful for treating genetic disorders of the central nervous system.
[0101] Examples of endogenous genes whose expression is inhibited and / or modified for therapeutic effects by targeting with RNAi agents include superoxide dismutase 1 (SOD1), chromosome 9 open reading frame 72 (C9ORF72), TAR DNA-binding protein (TARDBP), ataxin-1 (ATXN1), ataxin-2 (ATXN2), ataxin-3 (ATXN3), huntingtin (HTT), amyloid precursor protein (APP), apolipoprotein E (ApoE), microtubule-associated protein tau (MAPT), alpha-synuclein (SNCA), voltage-gated sodium channel alpha subunit 9 (SCN9A), and / or voltage-gated sodium channel alpha subunit 10 (SCN1OA). Since the preferred AAV vectors provided herein are CNS-targeted, preferred endogenous genes whose expression is inhibited and / or modified for therapeutic effects by targeting with RNAi agents include endogenous genes that play a role in hereditary diseases of the central nervous system.
[0102] Alternatively, or as a different gene product, the nucleotide sequence comprising the transgene defined above may further comprise a nucleotide sequence encoding a polypeptide that acts as a select marker protein for evaluating cell transformation and expression. Suitable marker proteins for this purpose include, for example, the fluorescent protein GFP, and the select marker genes HSV thymidine kinase (for selection in HAT medium), bacterial hygromycin B phosphotransferase (for selection in hygromycin B), Tn5 aminoglycoside phosphotransferase (for selection in G418), and dihydrofolate reductase (DHFR) (for selection in methotrexate), CD20, and the low affinity nerve growth factor gene. Sources for obtaining these marker genes and methods for using them are provided in Sambrook and Russel (cited above). Furthermore, the nucleotide sequence comprising the transgene defined above may further comprise, if deemed necessary, a nucleotide sequence encoding a polypeptide that can function as a fail-safe mechanism enabling the healing of a target from cells transduced with the recombinant parvovirus (rAAV) vector described herein. Often referred to as suicide genes, these nucleotide sequences encode proteins that can convert a prodrug into a toxic substance capable of killing transgenic cells expressing the protein. Suitable examples of such suicide genes include, for instance, the Escherichia coli (E. coli) cytosine deaminase gene, or one of the thymidine kinase genes derived from herpes simplex virus, cytomegalovirus, and varicella-zoster virus, in which case ganciclovir can be used as a prodrug to kill transgenic cells in the target (see, e.g., Clair et al., 1987, Antimicrob. Agents Chemother. 31:844-849).
[0103] For expression in mammalian cells, the nucleotide sequence comprising the transgene as defined above more preferably comprises at least one mammalian cell-compatible expression regulatory sequence, such as a promoter, operably ligated to the sequence encoding the gene product of interest. Many such promoters are known in the art (see Sambrook and Russel, 2001 (cited above)). Constitutive promoters widely expressed in many cell types, such as CMV, CAG, and PGK promoters, can be used. However, more preferred are inducible, tissue-specific, cell-type-specific, or cell cycle-specific promoters. For example, for liver-specific expression (as disclosed in PCT / EP2019 / 081743), promoters may be selected from the α1-antitrypsin promoter, thyroid hormone-binding globulin promoter, albumin promoter, LPS (thyroxine-binding globin) promoter, HCR-ApoCII hybrid promoter, HCR-hAAT hybrid promoter, and apolipoprotein E promoter, LP1, HLP, minimal TTR promoter, FVIII promoter, hyperon enhancer, and ealb-hAAT. Other examples include the E2F promoter for tumor-selective, particularly neuronal tumor-selective expression (Parr et al., 1997, Nat. Med. 3:1145-9), or the IL-2 promoter for use in mononuclear blood cells (Hagenbaugh et al., 1997, J Exp Med; 185:2101-10). For example, for neuron-specific expression, promoters include the neuron-specific enolase (NSE) promoter, platelet-derived growth factor (PDGF) promoter, platelet-derived growth factor B chain (PDGF-(3) promoter, synapsin or synapsin-1 (Syn or Syn-1) promoter, methyl-CpG-binding protein 2 (MeCP2) promoter, and Ca + / The promoters can be selected from the calmodulin-dependent protein kinase II (CaMKII) promoter, the metabotropic glutamate receptor 2 (mGluR2) promoter, the neurofilament light chain (NFL) or heavy chain (NFH) promoter, the β-globin minigene nβ2 promoter, the preproenkephalin (PPE) promoter, the enkephalin (Enk) promoter, and the excitatory amino acid transporter 2 (EAAT2) promoter. For astrocyte-specific expression, the promoters can be selected from the glial fibrillary acidic protein (GFAP) and EAAT2 promoters. For oligodendrocyte-specific expression, the myelin basic protein (MBP) promoter promoter can be selected. The CBh promoter (Gray et al., 2011, Hum. Gene Ther. 22:1143-1153) is a particularly preferred promoter for transgene expression in the peripheral and / or central nervous system.
[0104] In one embodiment, if the transgene / therapeutic gene product is or contains a (small molecule) RNA molecule such as siRNA, shRNA, miRNA, crRNA, or guide RNA, the promoter is an RNA polymerase III promoter, preferably a U6 snRNA gene-derived promoter, such as a primate or human U6 promoter.
[0105] Various modifications of the nucleotide sequences defined above, including, for example, wild-type parvovirus sequences, for suitable expression in insect cells, can be achieved by applying well-known genetic engineering techniques, such as those described, for example, Sambrook and Russell (2001) “Molecular Cloning: A Laboratory Manual (3rd edition),” Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York. Various further modifications of the coding region are known to those skilled in the art and can increase the yield of coding proteins. These modifications are within the scope of this disclosure.
[0106] [Composition] In a sixth aspect, a composition is provided comprising an AAV vector virion as described herein, i.e., an AAV vector virion comprising at least one AAV capsid protein variant as described herein.
[0107] In one embodiment, a composition is provided comprising the AAV vector virion described herein and a suitable excipient such as a buffer, stabilizer, or antioxidant. In a particular embodiment, these compositions are used to transduce cells in vitro or ex vivo, in which case the excipients need to be compatible with the cell culture.
[0108] In other preferred embodiments, the composition is used for the treatment of a (human) subject. For that purpose, pharmaceutical compositions comprising the AAV vector virion described herein and at least one pharmaceutically acceptable carrier are provided. In the case of an AAV gene delivery vehicle, the pharmaceutical composition typically further comprises a physiological buffer such as PBS, and further comprises a stabilizer such as sucrose. Such compositions are adapted, preferred, and intended for use in subsequent intravenous, intrathecal, intraparenchymal, intravitreous, or subretinal administration, or in organ-targeted vascular delivery such as intra-portal or intra-coronary delivery or isolated limb perfusion.
[0109] [use] In a seventh aspect, the use of the AAV vector virion described herein, or a composition comprising the AAV vector virion, is provided.
[0110] In one embodiment, an AAV vector virion or a composition comprising an AAV vector virion described herein is provided for use as a pharmaceutical. In one embodiment, the AAV vector virion or a composition comprising an AAV vector virion described herein is for use (as a pharmaceutical) in the treatment of a central nervous system disorder.
[0111] In the eighth aspect, an AAV vector virion or a composition comprising an AAV vector virion as described herein is provided for use (as a pharmaceutical) in gene therapy. In one embodiment, a method of gene therapy is provided, comprising the step of administering an effective amount of an AAV vector virion or a composition comprising an AAV vector virion as described herein to a subject in need of gene therapy.
[0112] In one embodiment, gene therapy is for the treatment of a disease as defined above (for example, a disease or condition that can be treated by gene therapy of the central nervous system), and preferably uses the therapeutic gene shown above and / or uses an RNAi agent for inhibiting or modifying the expression of the endogenous gene shown above.
[0113] [Method for identifying AAV capsid variants with desired characteristics] In a ninth aspect, a method is provided for identifying AAV capsid variants having desired properties. In one embodiment, the method is a) to provide a library comprising a plurality of individually generated AAV capsid variants, wherein each member in the library differs from the AAV capsid variant of another member in the library by at least one amino acid, and each member in the library comprises a DNA construct, the DNA construct comprising i) a unique molecular identifier (UMI) specific to the member in the library; ii) a reporter gene operably linked to a promoter that drives expression in mammalian cells; and iii) at least one AAV The process includes: a) contacting the library with a culture of cells, organoids, or tissues, or administering the library to a non-human animal; c) enabling the transduction of AAV capsid variants in the library into cells, organoids, tissues, or animal cells; and d) identifying at least one AAV capsid variant transductioned into at least one cell type of cells, organoids, tissues, or animals in b) as an AAV capsid variant having desired properties by determining the sequence of its UMI, and optionally recovering the AAV capsid variant having the desired properties from the desired cells.
[0114] Therefore, in this method, each member in the library differs from the AAV capsid variant of the other members in the library by at least one amino acid. In one embodiment, the amino acid sequence of the AAV capsid variant of a member in the library includes one or more amino acid mutations (e.g., insertions, deletions, and / or substitutions). In one embodiment, the amino acid sequence of the AAV capsid variant of a member in the library includes at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein. The wild-type AAV capsid protein is understood herein as the AAV capsid protein having the amino acid sequence of a naturally occurring AAV isolate, e.g., a clinical isolate. In one embodiment, the amino acid sequence of a member AAV capsid variant in the library contains at least one amino acid difference (mutation) in the VR region of the surface loop of the capsid protein variant, compared to the wild-type AAV capsid protein, in at least one of VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII, and VR-IX (of which VR-IV and VR-VIII are preferred, and VR-VIII is more preferred). In one embodiment, the amino acid sequence of a member AAV capsid variant in the library contains at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein and includes a peptide insertion. The inserted peptide may contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acids.
[0115] In one embodiment, the above-mentioned difference (mutation) of at least one amino acid compared to the wild-type AAV capsid protein is introduced into AAV capsid proteins VP1, VP2, or VP3, or any combination of two or all three capsid proteins. In some embodiments, the mutation is introduced into VP1. In some embodiments, the mutation is introduced into VP2. In some embodiments, the mutation is introduced into VP3. In some embodiments, the mutation is introduced into VP1 and VP2. In some embodiments, the mutation is introduced into VP1 and VP3. In some embodiments, the mutation is introduced into VP2 and VP3. In some embodiments, the mutation is introduced into VP1, VP2, and VP3.
[0116] In one embodiment, the above-mentioned difference (mutation) of at least one amino acid compared to the wild-type AAV capsid protein is a single mutation (e.g., an amino acid insertion, deletion, and / or substitution) introduced at a single site in the amino acid sequence of the capsid protein, while in other embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 100 or more (including any number from 1 to 100 or more) mutations (e.g., insertions, deletions, and / or substitutions) are introduced into the amino acid sequence of the capsid protein.
[0117] In one embodiment, the amino acid sequence of a member AAV capsid variant in the library contains at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein, and the wild-type AAV capsid protein may be a capsid protein of a serotype selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and AAVrh10. In further embodiments, the wild-type AAV capsid protein may be the capsid protein of a clade A, clade B, clade C, clade D, clade E, or clade F AAV isolate, as defined by Gao et al. (2004, J. Virol. 78:6381-6388), the exemplary sequences of which are disclosed in International Publication No. 2005 / 033321 and are also available from the GenBank® database under accession numbers AY530553 to AY530629.
[0118] A method for identifying AAV capsid variants having the desired properties described herein, wherein each member in the library comprises a DNA construct, the DNA construct comprising i) a unique molecular identifier (UMI) specific to the member of the library; ii) a reporter gene operably linked to a promoter for driving expression in mammalian cells; and iii) at least one AAV ITR.
[0119] Therefore, in one embodiment, the nucleic acid construct includes a reporter gene operably linked to a promoter for driving expression in mammalian cells. As understood herein, the reporter gene preferably encodes a protein that, when expressed in mammalian cells, produces a colorimetric signal, a fluorescent signal, or a luminescent signal that enables cells containing and expressing the reporter gene to be distinguished from surrounding cells that do not contain the reporter gene. In one embodiment, the reporter gene encodes a protein that produces a colorimetric signal, such as a gene encoding secreted alkaline phosphatase (SEAP) or β-galactosidase. In one embodiment, the reporter gene encodes a protein that produces a fluorescent signal, preferred examples of which include EGFP, mCherry, mCloverS, mRubyS, mApple, iRFP, tdTomato, mVenus, YFP, and RFP. In one embodiment, the reporter gene encodes a protein that generates a luminescence signal, preferred examples of which include genes encoding Photinus pyralis (firefly) luciferase, Renilla reniformis (sea coral) luciferase, and nanoluciferase. In one embodiment of the nucleic acid construct, the promoter operably ligated to the reporter gene to drive its expression in mammalian cells is a constitutive promoter. In other embodiments, the promoter operably ligated to the reporter gene is a cell-type and / or tissue-specific promoter. As will be understood by those skilled in the art, the cell-type and / or tissue specificity of the promoter depends on the desired cell-type and / or tissue-directivity of the resulting AAV capsid variant.In some embodiments, the cell type and / or tissue-specific promoter for driving the expression of a reporter gene in mammalian cells is a promoter selected from the group consisting of the human synapsin promoter (hSynl), the trans tyretin promoter (TTR), the cytokeratin 18, cytokeratin 19, the unc-45 myosin chaperone B (unc45b) promoter, the cardiac troponin T (cTnT) promoter, the glial fiber acidic protein (GFAP) promoter, the myelin basic protein (MBP) promoter, and the methyl-CpG binding protein 2 (Mecp2) promoter. In preferred embodiments, the cell type and / or tissue-specific promoter is the human synapsin promoter (hSynl).
[0120] In one embodiment, a nucleic acid construct includes a unique molecular identifier (UMI), also known as a “barcode.” The UMI is a substantially unique, preferably completely unique, sequence or barcode specific to the nucleic acid molecule, i.e., unique to each construct used in the library. The UMI may have random, pseudo-random, partially random, or non-random nucleotide sequences. The UMI can be used to uniquely identify the original molecules from which sequencing reads originate. For example, reads of amplified nucleic acid molecules can be folded from each original nucleic acid molecule into a single consensus sequence. As described above, the UMI may be completely or substantially unique. All nucleic acid molecules or constructs provided herein should be understood as completely unique, containing a unique tag distinct from all other tags contained in further nucleic acid molecules / constructs used herein. Substantially unique, as understood herein, means that each nucleic acid molecule or construct provided herein contains a random UMI, but these nucleic acid molecules / constructs may contain the same UMI at a low percentage. Preferably, substantially unique molecular identifiers are used when the chance of tagging exactly the same molecule containing the same sequence with the same UMI is negligible. Preferably, the UMI is completely unique with respect to a particular sequence of nucleic acid molecule or construct, for example, completely unique with respect to a particular capsid variant to which a nucleic acid construct containing a particular UMI is packaged. Preferably, the UMI is long enough to ensure this uniqueness. Identifier sequences may be about 2 to 100 nucleotides or longer, preferably about 4 to 18 nucleotides long, and typically about 8 to 12 nucleotides long. Preferably, identifier sequences do not contain two or more consecutive identical bases. Furthermore, preferably, there are differences of at least two, preferably at least three, bases between individual identifier sequences.
[0121] In one embodiment, the nucleic acid construct comprises, as herein defined, at least one AAV ITR as described above. In the nucleic acid construct, a reporter gene and UMI operably ligated to a promoter for driving expression in mammalian cells are preferably adjacent to at least one AAV ITR sequence, more preferably they are located between two AAV ITR sequences, and as a result, the promoter-ligated reporter gene and UMI are incorporated into the genome of an rAAV vector produced in a host cell suitable for the expression of AAV rep and cap gene products.
[0122] A method for identifying AAV capsid variants having the desired characteristics described herein further comprises step (b) contacting the library with a culture of cells, organoids, or tissues, or administering the library to a non-human animal. In one embodiment, the culture of cells, organoids, or tissues, or the non-human animal, comprises at least one desired cell type, e.g., a cell type from which an AAV capsid variant with improved directivity is identified. In one embodiment, the culture of cells, organoids, or tissues, or the non-human animal, may further comprise at least one undesired cell type, e.g., a cell type in which the transduction efficiency of the identified AAV capsid variant is reduced. In one embodiment, the library is systemically administered to a non-human animal, e.g., by an intravenous route.
[0123] In the next step (c) of the method for identifying AAV capsid variants having the desired features described herein, the AAV capsid variant in the library is transduced into cells, organoids, tissues, or animal cells. Thus, in one embodiment of step (c), the AAV capsid variant in the library is transduced into (desired) cells, organoids, tissues, or animal cells, and sufficient time is allowed to elapse for the reporter gene to be expressed.
[0124] In the next step (d) of the method for identifying an AAV capsid variant having desired features as described herein, at least one AAV capsid variant transduced into at least one cell of a desired cell type in a cell, organoid, tissue, or animal is identified. In one embodiment, the at least one AAV capsid variant is identified by sequencing its UMI. In one embodiment, the at least one AAV capsid variant is identified as an AAV capsid variant having desired features. In one embodiment, step (d) further includes recovering the AAV capsid variant having desired features from a cell of the desired cell type.
[0125] In one embodiment, step (d) includes detecting transduction of a cell of a desired cell type by detecting the expression of a reporter gene in at least one cell of the desired cell type.
[0126] In one embodiment of the method for identifying AAV capsid variants having the desired characteristics described herein, the desired cell type, for example, the cell type to which the improved-targeting AAV capsid variant should be identified, is a cell from an organ or tissue selected from the liver, skeletal muscle, cardiac muscle, diaphragmatic muscle, kidney, brain, stomach, intestine, skin, endothelial cells, and lung. In one embodiment of the method for identifying AAV capsid variants having the desired characteristics described herein, the AAV capsid variant to be identified has a low transduction efficiency of an undesirable cell type, which may be a cell from an organ or tissue selected from the liver, skeletal muscle, cardiac muscle, diaphragmatic muscle, kidney, brain, stomach, intestine, skin, endothelial cells, and lung.
[0127] In one embodiment, a method for identifying an AAV capsid variant having the desirable characteristics described herein is a method in step d) in which, for at least two members in a library, at least one of the mRNA expressed from at least two members and at least one of the genome copy numbers of at least two members is quantified and identified by sequencing of their UMI, and the member having the highest mRNA expression level and at least one of the genome copy numbers is identified as an AAV capsid variant having the desirable characteristics. In one embodiment of the method, in step d) in cells of two or more cell types including at least the desired cell type, at least one of the mRNA expressed from at least two members and at least one of the genome copy numbers of at least two members is quantified and identified by sequencing of their UMI, and the member showing the most desired distribution across two or more cell types is identified as an AAV capsid variant having the desired characteristics. In one embodiment, the two or more cell types include at least the undesired cell type.
[0128] The present invention has been described above with reference to several exemplary embodiments shown in the drawings. Several modifications and alternative implementations of parts or elements are possible and fall within the scope of protection as defined in the appended claims. [Brief explanation of the drawing]
[0129] [Figure 1] Barcoding genome used for AAV production in HEK293T cells. GFP and nanoluciferase reporter, followed by a 12-nucleotide barcode, and then a polyadenylation signal, under the control of the CBh promoter. [Figure 2] Measurements using qPCR specific to the GFP reporter showed that the AAV titer of the novel variant (black bar) was approximately equivalent to that of the known variant (gray bar). [Figure 3]Purified AAV and known capsid batches were electrophoresed on an SDS-Page gel. The VP123 ratio of the resulting capsids was approximately 1:1:10, which is the natural stoichiometric ratio of VP1:VP2:VP3 in AAV. [Figure 4] Composition of the final AAV capsid library injected into mice. The capsid library consists of 26 different capsid variants, which are not shown equally. Data labeling focuses on the respective percentages of novel and known capsids in the capsid library. [Figure 5] Enrichment levels of novel and known capsids compared to AAV9 in the frontal, hindbrain, and cerebellum of C57BL6 mice. Bars represent the average of four mice. [Figure 6] Enrichment levels of novel and known capsids compared to AAV9 in the frontal, hindbrain, and cerebellum of BALBc mice. Bars represent the average of four mice. [Figure 7] Enrichment factors of novel and known capsids compared to AAV9 in the livers of both C57BL6 and BALBC mice. [Figure 8] Vector genomes and transcripts in recovered tissues. Vector genomes in the cerebrum (A), cerebellum (B), and liver (C), and vector transcripts in the cerebrum (D), cerebellum (E), and liver (F). The horizontal dotted line indicates the limit of quantification (LLOQ) of the assay. Each bar represents the mean and standard deviation (SD) of six mice, and each dot represents the value for each mouse. [Figure 9] Nanoluciferase (nLuc) protein levels in cerebrum, cerebellum, and liver tissue. Each bar represents the mean and standard deviation (SD) of six mice, and each dot represents the value for each individual mouse. [Figure 10] Changes in the nanoluciferase relative fluorescence unit (RFU) ratio in cells overexpressing the Ly6C1 receptor compared to cells overexpressing the negative control receptor TMEM30a. [Figure 11] In vivo validation of xBBB capsid experimental design. [Figure 12]vDNA concentrations in liver tissue of a control capsid (AAV9) and two BBB-crossing capsids at 4 weeks of age. [Figure 13] vDNA concentrations in the cerebellum of the control capsid (AAV9) and two BBB-crossing capsids. [Figure 14] Brain enrichment for AAV9 after normalization to AAV-F library input. Horizontal lines indicate the absence of enrichment and correspond to the AAV9 wild-type capsid. [Examples]
[0130] [Introduction] Developing novel adeno-associated virus (AAV) capsids that can efficiently and clearly transduce central nervous system (CNS) cells via systemic administration is one of the most intriguing challenges in the field of AAV-based gene therapy. The presence of the blood-brain barrier (BBB) limits the entry of large molecules and viruses from the bloodstream into the CNS. Furthermore, the broad tissue targeting of first-generation AAVs results in high levels of vector sequestration and transduction into peripheral off-target organs such as the liver during systemic delivery. This not only raises safety concerns, including immunoactivation and hepatotoxicity, but also reduces the amount of AAV vector successfully delivered to the CNS, resulting in a narrower therapeutic range. To date, several novel AAV capsids with improved CNS targeting or liver detargeting characteristics have been engineered and discovered. These novel capsid candidates have emerged from in vivo or in vitro screening of collections of capsids known as capsid libraries, and from the use of next-generation sequencing (NGS) as experimental readouts to recover the most concentrated capsid candidates in the tissue of interest. The initial capsid libraries can be generated by various methods, such as random mutagenesis, peptide insertion / display in one or more exposed loops of the capsid gene, or science-based rational design.
[0131] In the first embodiment, the inventors investigated whether novel capsids (AAV.CAP-B10-9P31, AAV.CAP-B10-F, 9.47-9P31, and 9.47-AAV-F) resulted in good aggregation of vector particles containing barcoded genomes. Furthermore, in the second embodiment, the inventors provide in vivo evidence that the novel capsids exhibited enhanced CNS targeting and liver targeting detachment characteristics compared to known variants collected from the literature.
[0132] [Example 1: Generation of AAV of a novel capsid] [1.1 Method] [1.1.1 Construction of Novel Capsid Variants] The inventors generated 26 AAV capsids and screened them in parallel in vivo in a multiplexed "race" to determine which capsid was most efficiently transduced into the brain upon systemic administration. For reference, the inventors' capsid library included wild-type variants and known variants collected from the literature, including random mutations or peptide insertions that provide liver detargeting or CNS targeting properties. The library further included novel capsids obtained as a result of combining known peptides or point mutations. Each capsid was generated individually in HEK293T cells using triple plasmid transfection. As a result, all capsids have a self-complementary (sc)barcoding genome consisting of two reporter genes, green fluorescent protein (GFP) and nanoluciferase (nLuc), and a 12-nucleotide barcode unique to each capsid after the nLuc stop codon and before the poly-A tail (Table 1) under the control of the CBh promoter (Figure 1). After generation, the capsids were pooled, and the resulting capsid library was administered intravenously (IV) to 7-week-old C57BL6 and BALBC strain mice at a dose of 1.4e11 vg / mouse (5.4e9 vg / mouse per capsid; vg = vector genome) via tail vein injection. Two weeks after vector delivery, the frontal brain, hindbrain, cerebellum, and liver (as representative peripheral organs) were collected. The barcoded reporter transgene was amplified by PCR, and the resulting amplicons were analyzed by next-generation sequencing (NGS) to evaluate the enrichment levels of each CNS capsid in each tissue.
[0133] [Table 1]
[0134] [1.1.2 Generation of Novel Capsid Variants in HEK293T Cells] AAV virus vectors were generated in HEK293T cells using the triple plasmid transfection standard method. Briefly, HEK293T cells were maintained in Dulbecco's modified Eagle medium containing GlutaMAX and 10% fetal bovine serum. Transfection with polyethyleneimine hydrochloride transfection reagent (PEImax®) was performed using 16.6 μg of adenovirus helper plasmid (pHelper), 16.6 μg of barcoded transgene plasmid (pITR), 16.6 μg of RepCap plasmid-containing AAV2 replicase (Rep), and the tested capsid gene (Genewiz).
[0135] 72 hours after transfection, cells were lysed at 28°C for 1 hour using lysis buffer (1.5 M NaCl, 0.5 M Tris-HCl, 1 mM MgCl2, 10% Triton X-100, pH 8.5), followed by benzoase treatment at 37°C for 1 hour. Cell debris was removed by centrifugation at 1900 × g for 15 minutes, and the supernatant (crude lysate) containing virus particles was purified for 2 hours using POROS® CaptureSelect® AAVX affinity resin (ThermoFisher) according to a batch binding protocol. After 2 hours, the affinity resin was washed with 0.2 M HPO4 (pH 7.5 buffer), and the binding vector was eluted by adding 0.2 M glycine (pH 2.5). The pH of the eluted vector was immediately neutralized by adding 0.5 M Tris-HCl (pH 8.5). The purified AAV vector batch was stored at -20°C.
[0136] [1.1.3 Analysis of novel capsid variants by qPCR and SDS-PAGE gel electrophoresis] The titer of the purified vector batch was determined by qPCR using primers and probes that bind to the GFP transgene. AAV was treated with DNAse at 37°C to degrade the exogenous DNA. Then, it was heat-treated for a short time (30 minutes) at 37°C in the presence of 1M NaOH to release the AAV DNA from the particles. Next, the alkaline environment was neutralized by adding an equal volume of 1M HCl. The neutralized DNA was diluted 10-fold in 16 ng / μl PolyA WFI, and the sample was then used in qPCR with primers specific to the GFP transgene (forward AGCAAAGACCCCAACGAGAA, reverse GCGGCGGTCACGAACTC) and probe Fam-CGCGATCACATGGTCCTGCT-mgb.
[0137] The composition of the VP protein in the purified vector was determined by SDS-Page gel electrophoresis. Briefly, 15 μl of the purified vector was mixed with 5 μl of 4×Laemmli loading buffer (Biorad) supplemented with β-mercaptoethanol (Biorad). After denaturing the protein at 95°C for 5 minutes, the material was loaded onto a stain-free polyacrylamide gel (Biorad). Next, the sample was separated by electrophoresis at 200 volts for 35 minutes. Following electrophoretic staining (tryptophan-based), the sample was developed under UV light for 5 minutes, and then the VP protein was visualized under UV light using a Chemidoc imaging system (Biorad).
[0138] [1.2 Results] The novel capsids were successfully assembled into vector particles containing barcoded genomes. After generation and purification, AAV titers were determined using GFP-specific qPCR. All novel capsids, using the same transfection method and the same amount of plasmid DNA per dish, showed genome titers comparable to previously described capsids, ranging from 2.2e11 to 7.1e11 vector genomes (vg) per mL of AAV capsid batch-bound (BB) material (Figure 2). To investigate whether the novel AAV capsids yielded correct VP stoichiometry, SDS-PAGE gel electrophoresis was performed on the batch-bound purified material (Figure 3). The resulting VP 1:2:3 ratio of the capsids had a native ratio of approximately 1:1:10, reflecting infectious AAV capsids.
[0139] [2. Example 2: Composition of AAV capsid library and in vivo analysis of its tissue distribution in mice after intravenous administration] [2.1 Method] [2.1.1 Composition, quality control, and formulation of AAV capsid libraries] As shown in Table 1, 26 individual library members were prepared individually as described in Example 1.1.2. 72 hours after transfection, the cells were dissolved in lysis buffer, followed by benzonase treatment, and cell debris was removed by centrifugation as described.
[0140] After centrifugation, aliquots were taken from each capsid crude lysate bulk (CLB) for titer analysis (qPCR). The remaining CLB was pooled and purified as a library using POROS® CaptureSelect® AAVX affinity resin (ThermoFisher) in an affinity chromatography setting (AeKTA system). After purification, ultrafiltration / dialysis filtration (UD / DF) was performed using a hollow fiber setup, and the buffer was replaced with PCR-0.001% Pluronic.
[0141] The titer of the final library in the formulation buffer was determined using qPCR with primers and probes that bind to the GFP transgene, as described in Example 1.1.3.
[0142] [2.1.2 In vivo testing, tissue processing, and amplicon NGS and analysis] The final library was administered intravenously (IV) to 7-week-old C57BL6 and BALBC mice at a dose of 1.4e11 vg / mouse via tail vein injection. Two weeks after vector delivery, the frontal brain, hindbrain, cerebellum, and liver (as representative peripheral organs) were collected. The tissue samples were pulverized, and DNA and RNA were isolated using AllPrep DNA / RNA Mini (Qiagen). OligodT (18)Total RNA was reverse transcribed using Maxima H minus reverse transcriptase (Thermo Fisher) primed with [specified primer]. Furthermore, viral DNA was isolated from the original AAV capsid library injected into mice according to the Purelink viral DNA / RNA mini-kit (ThermoFisher) protocol. The barcoded reporter transgene was amplified from DNA, cDNA, and the original library by 40 cycles of PCR using Q5® Hot Start High-Fidelity DNA polymerase (NEB) with specific primers (forward CGCCGAACATGATCGACTATT, reverse CCCTTGGACGAGACTGAAC). The resulting amplicons were processed using the NEBNext® Ultra II DNA Library Prep kit (Illumina). Library quality and yield were measured using a Fragment Analyzer, and further clustering was performed in NovaSeq6000 flow cells according to the manufacturer's protocol (Illumina). Each sample was sequenced using paired-end 151bp reads (PE150) with a minimum of 10 million paired-end reads (GenomeScan). Known 12-nucleotide barcode sequences were detected and counted from sequence readings using a barcode identification and Python counting script downloaded from GitHub (https: / / github.com / JonasWeinmann / AAV-barcode-detection-and-normalization), matching the inventors' barcode sequences (Table 1), length (12 nucleotides), and adjacent sequences (BCV_left=「GTGGTCTTCTCA」 and BCV_right=「TTACGCCAGAAT」). The script was run on a Linux virtual machine running Ubuntu 20.04.3 LTS. The script outputs a text file containing barcode identification information and the corresponding number or sequencing reads.For each sample, the number of reads aligned to each barcode was divided by the total number of reads aligned to barcodes in the given sample. To further normalize for capsid variability in the injected original capsid library, the proportion of each barcode in each tissue was divided by the proportion of each barcode in the original library. The resulting numbers represent the enrichment factor of each capsid in each tissue relative to the injected library. Finally, all numbers were scaled to 1 to represent the normalized proportion of each capsid in the given tissue.
[0143] [2.2 Results] Before injection into mice, the titer of the final purified AAV capsid library was measured using primers and probes targeting the GFP transgene, yielding a result of 7.7e11 vg / mL. Furthermore, the capsid-packaged DNA was extracted from the library, the barcode sequence was amplified by PCR, and the resulting amplicons were sequenced using NGS to evaluate the contribution of each capsid in the initial library (Figure 4). Subsequently, the expression levels of each capsid in each tissue were normalized using these normalized sequences.
[0144] Both mouse strains (BALBc and C57BL6) were administered 175 μL of the capsid library by intravenous injection into the tail vein, resulting in a dose of 1.4e11 vg / mouse. Two weeks after library injection, liver and brain tissue (divided into frontal, hindbrain, and cerebellum) was collected, and DNA and RNA isolation, cDNA synthesis, and PCR were performed to amplify the barcodes present in the transgenes. The amplicons were sequenced using NGS, and the sequencing data was analyzed to evaluate the concentration and proportion of each capsid in each tissue relative to the injected library.
[0145] Figures 5 and 6 show the transcription enrichment ratios of novel and known total capsids in the C57BL6 lineage (Figure 5) or the BALBC lineage (Figure 6) compared to AAV9, while Figure 7 shows the liver transcription enrichment ratios of both lineages relative to AAV9.
[0146] As expected from previous results published in the literature, AAV-F targets all brain regions in both mouse strains, showing a 33- to 52-fold increase in transduction in C57BL6 mice compared to AAV9, depending on the brain region (Figure 5), and a 136- to 219-fold increase in BALBC mice (Figure 6). However, AAV-F liver transduction remains substantially the same as AAV9 in both mouse strains (Figure 7). When the F peptide was constructed on a transduction-deficient 9.47 capsid (which, according to our NGS results, does not transduce the brain at the delivery dose in either mouse strain), brain transduction remained higher than AAV9 in both mouse strains, particularly in the hindbrain of BALBC mice (a 47-fold increase, Figure 6), while liver transduction decreased 24-fold in C57BL6 and 55-fold in BALBC mice compared to AAV9 (Figure 7). On the other hand, when the F peptide was constructed on top of a known AAV.CAP-B10 capsid variant, both strains showed lower hepatic transduction than AAV9 (Figure 7). According to our results at the delivery dose, only the C57BL6 mouse strain showed higher brain transduction than AAV9 (up to a 24-fold increase, Figure 5). Brain and hepatic transduction remained similar to AAV.CAP-B10 in the C57BL6 strain, but brain transduction was rescued in the BALBC strain, which had up to a 61-fold higher transcription than AAV9 (Figure 6) and maintained hepatic detargeting (Figure 7).
[0147] Regarding the 9P31 peptide display capsid, as expected from published results, brain transcription was enhanced compared to AAV9, particularly in the frontal brain, up to 104-fold in C57BL6 and up to 291-fold in BALBC (Figures 5 and 6, respectively), while liver transcription was detargeted (Figure 7). When this 9P31 peptide was constructed on a transduction-deficient 9.47 capsid, brain transduction remained higher than AAV9 in both lines (again, particularly in the frontal brain), while liver transcription was significantly reduced compared to AAV9, particularly in BALBC (Figure 7). On the other hand, when the 9P31 peptide was constructed on a known AAV.CAP-B10 capsid variant, brain transduction was slightly increased in the C57BL6 line compared to the 9P31 capsid variant alone, but this effect was observed only in the hindbrain and cerebellum of the BALBC line (Figure 6). Regarding hepatic transduction of the AAV.CAP-B10-9P31 variant, this is reduced by up to 32 times compared to AAV9, remains similar to the parent capsid 9P31, but is higher than the parent capsid AAV.CAP-B10, and does not show a synergistic effect of the characteristics of both capsids in terms of hepatic detargeting (Figure 7).
[0148] In summary, the inventors created four novel capsids (9.47-F, 9.47-9P31, AAV.CAP-B10-F, and AAV.CAP-B10-9P31), tested them in vivo, and compared their brain and liver performance with known parental capsids (9.47, AAV.CAP-B10, AAV-F, and 9P31) and representative standard AAV9 to investigate whether synergistic effects of capsid features (peptide insertions, random mutations) result in novel capsids that possess a better ability to transduce into the brain than AAV9 while maintaining liver detargeting characteristics (Table 2).
[0149] [Table 2]
[0150] Our results show that the novel capsids 9.47-F and 9.47-9P31 transduce into the brain more efficiently than AAV9, but less efficiently than the parental capsids AAV-F and 9P31. However, both capsids transduce the liver more strongly than the parental capsid (due to random mutations in the 9.47 skeleton), and therefore may reduce hepatotoxicity and increase the therapeutic range. The novel capsids AAV.CAP-B10-F and AAV.CAP-B10-9P31 transduce into the brain better than AAV9 in both mouse strains, but less efficiently than the parental capsid AAV-F. Regarding liver targeting, capsid 9P31 already shows potent liver targeting compared to AAV9, and AAV.CAP-B10-9P31 offers little phenotypic advantage as liver targeting is similar for both capsids. However, AAV.CAP-B10-F retains the liver targeting detargeting characteristics due to the AAV.CAP-B10 skeleton. Furthermore, while AAV.CAP-B10 could only be transduced into the brain in the previously discovered mouse strain C57BL6, our results show that it could not be transduced in BALBC, and the addition of F peptide allowed us to rescue the phenotype in this mouse strain.
[0151] [3. Example 3: In vivo singleplex validation of 9.47-F candidate] [3.1 Method] [3.1.1 Generation of AAV Capsid Variants] AAV viral vectors AAV9, AAV-F, and 9.47-F were generated in HEK293T cells using the triple plasmid transfection standard method. 72 hours after transfection, the viruses were recovered, purified by capture with Poros CaptureSelect AAV9 resin (ThermoFisher), and further concentrated with Amicon ULTRA 15, Ultracel PL Membrane, 100 kDa. The mixture was then prepared in formulation buffer PBS-0.001% Pluronic and filtered. AAV was titrated by qPCR using ITR-specific PCR primers. AAV purity was checked by separating viral proteins in 10% SDS-PAGE, and the integrity of the packed vector genome was checked on 0.8% agarose. Furthermore, endotoxin levels in the final product were determined using an Endosafe-nestgen-PTS spectrometer (Charles River laboratories). The sequence of the expressed transgene is the same for all three capsids (SEQ ID NO: 70), while the sequences of the AAV9, AAV-F, and 9.47-F capsid proteins are SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 6, respectively.
[0152] [3.1.2 In vivo testing and tissue collection in BALBc mice] Each of the three AAV capsids was administered intravenously (IV) to 7-week-old BALBc mice at a dose of 5e12vg / mouse via tail vein injection (6 mice per capsid group). Four weeks after vector delivery, the mice were anesthetized with 5% isoflurane, perfused with saline, decapitated, and the whole brain and liver were collected. The whole brain was further divided into two parts: the cerebellum and the rest of the brain (cerebrum). Finally, all samples were rapidly frozen until further molecular analysis could be performed.
[0153] [3.1.3 Sample preparation for molecular biological readings] Frozen tissue samples were pulverized using the CryoPrep System CP02 (Covaris) and lysed in RLT lysis buffer in a Tissue Lyser II instrument (Qiagen). For protein analysis, total protein was measured from homogenized tissues using the Bradford assay, and nanoLuc protein was quantified using the Nano-Glo® luciferase assay system (Promega) during total protein normalization of the samples. Furthermore, DNA and RNA were simultaneously isolated from each sample using the AllprepDNA / RNA96 kit (Qiagen). During nucleic acid isolation, 100ug of total RNA was reverse transcribed using the Maxima First Strand cDNA synthesis kit (ThermoFisher Scientific) for RT-qPCR with dsDNase primed with random hexamers.
[0154] The transgene (SEQ ID NO: 74) from DNA or cDNA templates was quantified using TaqMan Fast Universal PCR MasterMix 2X (ThermoFisher Scientific). For quantification of vector genomic DNA (vDNA), primers / probes targeting the CMV enhancer sequence (Fw:AGTAACGCCAATAGGGACTTTC, Rev:GGCGTACTTGGCATATGATACA, probe:TTACGGTAAACTGCCCACTTGGCA; SEQ ID NOs: 75-77) were used. For quantification of vector transcripts from cDNA samples, primers / probes targeting the NLuc transgene (Fw:GGAGGTGTGTCCAGTTTGTT, Rev:ATGTCGATCTTCAGCCCATTT, probe:ATCCAAAGGATTGTCCTGAGCGG; SEQ ID NOs: 78-80) were used.
[0155] [3.2 Results] In this example, we investigated whether the 9.47-F candidate successfully transduced the brain while maintaining the characteristics of liver detargeting. Vector genome analysis in the brain and cerebellum showed that both AAV-F and 9.47-F capsids delivered more than 10 times the vector to these tissues compared to AAV9 (Figure 8A-B), while liver analysis showed that although the vector genomes were similar for both AAV9 and AAV-F, levels decreased by more than 500-fold in the livers of mice injected with the 9.47-F capsid (Figure 8C). Analysis of vector transcripts in the brain, cerebellum, and liver (Figure 8D-F) was consistent with the vector genome results, showing increased functional transduction for both AAV-F and 9.47-F capsids in both brain regions (particularly the cerebellum), while showing decreased transduction in the liver of mice injected with 9.47-F.
[0156] Furthermore, luciferase (nLuc) protein levels in the forebrain and cerebellum showed that both AAV-F and 9.47-F capsids had higher nLuc readouts than AAV9, particularly in the cerebellum (Figure 9). On the other hand, nLuc protein levels in the liver were at least 30-fold lower with the 9.47-F capsid compared to AAV9.
[0157] Overall, in this embodiment, the in vivo behavior of AAV9-derived candidate 9.47-F, which has point mutations S414N, G453D, K557E, and T582I, and a heptamer FVVGQSY peptide inserted between Q588 and A589, was evaluated in a singleplex manner. We can conclude that 9.47-F, due to the presence of the heptamer peptide, exhibits increased in vivo distribution and functional transduction in both cerebellar and cerebral regions compared to AAV9 wild-type, while retaining the liver targeting characteristics derived from the four point mutations.
[0158] [4 Example 4: In vitro Ly6C1 binding assay of AAV-F capsid variant] [4.1 Method] [4.1.1 Generation of AAV-F Variants] Each AAV-F capsid variant (including AAV-F) was individually generated in HEK293T cells using the triple plasmid transfection standard method. 72 hours after transfection, the virus was recovered and purified by capture with POROS® CaptureSelect® AAVX affinity resin (ThermoFisher). The transgene sequence was identical for all capsids and is shown in SEQ ID NO: 83. In summary, each capsid possesses a self-complementary (sc) genome consisting of two reporter genes (GRP and nLuc). AAV titers were measured at the time of generation using GFP-targeting primers and probes (Fw primer: AGCAAAGACCCCAACGAGAA, Rev primer: GCGGCGGTCACGAACTC, probe: CGCGATCACATGGTCCTGCT; SEQ ID NOs: 11-13), and viral proteins were evaluated on 4-10% SDS-PAGE gel. Based on the QC results, each of the 28 candidates that successfully assembled AAV capsids was used in in vitro assays to evaluate their ability to interact with the Ly6c1 receptor.
[0159] [4.1.2 Ly6C1 In Vitro Binding Assay] To evaluate the interaction of each AAV-F capsid variant with the Ly6c1 receptor, HEK293T cells were seeded in 48-well plates (1e5 cells / well) and reverse-transfected with either a mouse Ly6C1 overexpression plasmid (SEQ ID NO: 81) or a human TMEM30a plasmid (SEQ ID NO: 82) to introduce an unrelated transmembrane protein acting as a negative control. Forty-eight hours after reverse transfection, the cells were transfected with one of the AAV-F variants. Forty-eight hours after transduction, the cells were lysed, and nanoluciferase activity derived from the capsid transgene was measured in each well using the Nano-Glo® luciferase assay system (Promega). Finally, enrichment of each capsid in Ly6C1 overexpressing cells was evaluated by calculating the fold change in nLuc readout between Ly6C1 and the TMEM30a receptor.
[0160] [4.2 Results] In this example, 28 AAV-F variants were created (Table 3), and their ability to bind to the Ly6C1 receptor was explored in vitro.
[0161] [Table 3]
[0162] During cell transfection to overexpress Ly6C1 or the negative control receptor (TMEM30a), transduction-derived nLuc activity was measured for each transfected cell. The ploidy level was calculated by dividing the nLuc RLU reading of the Ly6C1 receptor by the same activity derived from cells overexpressing TMEM30a. Based on these results (Figure 10), only the AlF1 peptide (FVVAQSY inserted between amino acids Q588-A589) showed enrichment in Ly6C1 compared to the TMEM30a receptor, at levels comparable to those found in the AAV-F capsid.
[0163] Based on these results, the inventors can conclude that AAV-AlF1 maintains its ability to interact with the Ly6C1 receptor in vivo. To demonstrate this in vivo while maintaining the liver detargeting characteristics of 9.47-AAV, the inventors conducted in vivo studies to evaluate whether 9.47-AAV-AlF1 (SEQ ID NO: 84) maintains its ability to cross the blood-brain barrier upon systemic administration while maintaining its liver detargeting characteristics. Furthermore, 9.47ND-AAV-AIF1 (SEQ ID NO: 85), a modified 9.47-AAV skeleton containing the AlF1 peptide, with two mutations removed (from four point mutations: S414N, G453D, K557E, T582I to only two point mutations: S414N, G453D), was also tested in vivo.
[0164] [5 Example 5: In vivo validation of capsids] [5.1 Method] [5.1.1 Isolation of DNA / RNA from in vitro samples] For the isolation of DNA and RNA, the AllPrep Mini Kit (catalog number 80204) from Qiagen was used in all experiments described according to the manufacturer's protocol. RLT Plus lysis buffer was applied to the ground animal tissue. The tissue suspension was then applied to a Lysing Matrix D tube containing Matrix D beads (MP Biomedicals 116913100) and homogenized using a TissueLyser system (Qiagen). DNA and RNA were then isolated from this extract by first applying it to the DNA binding column of the All Prep DNA / RNA Mini Kit. The flow-through from the DNA column was then added to the RNA binding column. After centrifugation and washing, DNA and RNA were eluted from the corresponding columns. In this way, DNA and RNA were isolated from the same sample. The quantity and integrity of DNA and RNA were determined by Nanodrop.
[0165] [5.1.2 Quantification of vector DNA from in vivo samples] Vector genome copies were quantified using a TaqMan qPCR assay (Thermo Fisher Scientific) with primers and probes for the vector's CMV enhancer region, as well as primers and probes for mouse β-actin as a housekeeping gene control (SEQ ID NOs. 74-76 and 89-91). Quantification (GC / μg DNA) was performed using a linear plasmid, and a standard curve representing the dilution range of this plasmid was generated. Using this standard curve, the copy number of vector DNA from DNA isolated from in vivo tissue samples was calculated.
[0166] [5.2 Results] This in vivo experiment further evaluates the efficiency of capsids crossing the blood-brain barrier (BBB) by comparing them to a control capsid (AAV9). The study used vectors encoding two proteins expressed from two open reading frames (ORFs). The investigation was conducted using male wild-type C57BL / 6J mice, with each vector being intravenously injected into a total of n=6 animals at a rate of 2.2E11 gc / animal. After a 4-week in vivo period, the mice were euthanized, and liver and cerebellar tissues were collected and processed to assess vector DNA (vDNA) levels. This experimental design (Figure 11) aimed to elucidate the transduction efficiency and potential tissue-specific effects of BBB-crossing capsids.
[0167] The vDNA concentrations in liver tissue were compared between a control capsid (AAV9) and two BBB-passing capsids (9.47-AAV-AIF1 and 9.47ND-AAV-AIF1, also known as 4mut 9.47-AAV-AIF-1 and 2mut 9.47ND-AAV-AIF-1, respectively; SEQ ID NOs. 84 and 85). As shown in Figure 12, the control AAV9 capsid showed significantly higher vDNA levels (measured in μg / ml) compared to both 9.47-AAV-AIF1 and 9.47ND-AAV-AIF1 (unpaired t-test, p=0.03425 and p=0.03502, respectively).
[0168] vDNA concentrations in cerebellar tissue were also compared between the control capsid (AAV9) and two BBB-passing capsids (9.47-AAV-AIF1 and 9.47ND-AAV-AIF1), as shown in Figure 13. 9.47-AAV-AIF1 was observed to have significantly higher vDNA concentrations compared to the control AAV9 capsid (unpaired t-test, p=0.04748). Furthermore, AIF1 showed a trend toward increasing vDNA levels compared to the control capsid, although this trend did not reach statistical significance.
[0169] The findings of this study demonstrate that the control AAV9 capsid results in significantly higher vDNA concentrations in liver tissue compared to the BBB-transmitting capsids 9.47-AAV-AIF1 and 9.47ND-AAV-AIF1. This suggests a potential advantage of BBB-transmitting capsids in terms of reduced untargeted transduction in the liver, which may be beneficial for achieving targeted gene delivery to the brain.
[0170] This study also showed that 9.47-AAV-AIF1 resulted in significantly higher vDNA concentrations in cerebellar tissue compared to the control AAV9 capsid. Conversely, 9.47ND-AAV-AIF1 showed a statistically insignificant but increasing trend in vDNA levels compared to the control. These findings suggest different effects of BBB-crossing capsids on vDNA distribution in the cerebellum.
[0171] [Example 6: In vivo study of AAV-F variant] [6.1 Method] [6.1.1 Generation of AlF Variants] Each AAV-F capsid variant (containing AAV-F) was produced in HEK293T cells using the triple plasmid transfection standard method and purified with POROS® CaptureSelect® AAVX affinity resin (ThermoFisher). Each AAV-F variant consists of two reporter genes (GFP, nLuc) followed by a 12-nucleotide barcode (unique to each capsid, Table 4) and possesses a self-complementary (sc) barcoded genome (plasmid backbone sequence number 86) under the control of the human synapsin promoter (hSyn1). After titration of each individual variant (qPCR), all variants were mixed to prepare a capsid cocktail, which was further buffered with PBS-0.001% Pluronic using a D-Tube Dialyzer Mega MWCO 6-8kDa (Merk) and enriched using an Amicon® ultracentrifuge filter (Sigma) with a 100kDa MWCO. The final cocktail was titrated, and endotoxin levels were tested to validate its efficacy in in vitro neuroblastoma-derived (SH-SY5Y) cells prior to in vivo testing in mice. Furthermore, viral DNA was again isolated from the original AAV capsid cocktail injected into mice according to the Purelink viral DNA / RNA mini-kit (ThermoFisher) protocol.
[0172] [Table 4]
[0173] [6.1.2 In vivo testing and tissue collection in BALBc mice] The capsid cocktail was administered intravenously (IV) to 7-week-old BALBc mice via tail vein injection at a dose of 2.2e11vg / mouse (5 mice per capsid group). Four weeks after vector delivery, the mice were anesthetized with 5% isoflurane, perfused with saline, decapitated, and the whole brain and liver were collected. All samples were rapidly frozen until further molecular analysis was performed.
[0174] [6.1.3 Sample preparation, amplicon NGS, and analysis] Frozen tissue samples were pulverized using a CryoPrep System CP02 (Covaris) and lysed in RLT lysis buffer in a Tissue Lyser II instrument (Qiagen). DNA and RNA were simultaneously isolated from each sample using the AllprepDNA / RNA96 kit (Qiagen). During nucleic acid isolation, 100 ug of total RNA was reverse transcribed using the Maxima First Strand cDNA synthesis kit (ThermoFisher Scientific) for RT-qPCR with dsDNase primed with a random hexamer. The transgene (SEQ ID NO: 74) from the DNA template or cDNA template was quantified using TaqMan Fast Universal PCR MasterMix 2X (ThermoFisher Scientific). For the quantification of vector genomic DNA (vDNA), primers / probes targeting the CMV enhancer sequence (Fw:AGTAACGCCAATAGGGACTTTC, Rev:GGCGTACTTGGCATATGATACA, probe:TTACGGTAAACTGCCCACTTGGCA; SEQ ID NOs. 75-77) were used. For the quantification of vector transcripts from cDNA samples, primers / probes targeting the NLuc transgene (Fw:GGAGGTGTGTCCAGTTTGTT, Rev:ATGTCGATCTTCAGCCCATTT, probe:ATCCAAAGGATTGTCCTGAGCGGT; SEQ ID NOs. 78-80) were used. In addition, barcodes derived from the transgene were amplified by PCR from brain cDNA and an input AAV capsid cocktail administered to mice using Q5® Hot Start High-Fidelity DNA polymerase (NEB) with forward primer CGCCGAACATGATCGACTATT and reverse primer CCCTTGGACGAGACTGAAC for 35 cycles (SEQ ID NOs. 87 and 88). Using the TruSeq Nano DNA Library Preparation Kit (Illumina), sequencing libraries were generated in NovaSeq6000 flow cells according to the manufacturer's protocol (Illumina).Each sample was sequenced using paired-end 151bp reads (PE150) with a minimum of 10 million paired-end reads (Macrogen Europe). Known 12-nucleotide barcode sequences were detected and counted from sequence readings using a barcode identification and Python counting script downloaded from GitHub (https: / / github.com / JonasWeinmann / AAV-barcode-detection-and-normalization), matching the inventors' barcode sequences (Table 3), length (12 nucleotides), and adjacent sequences (BCV_left=「GTGGTCTTCTCA」 and BCV_right=「TTACGCCAGAAT」). The script was run on a Linux virtual machine running Ubuntu 20.04.3 LTS. The script outputs a text file containing barcode identification information and the corresponding number or sequencing reads. For each sample, the number of reads aligned to each barcode was divided by the total number of reads aligned to barcodes in the given sample. To further normalize for capsid variability in the injected original capsid library, the proportion of each barcode in each tissue was divided by the proportion of each barcode in the original library. The resulting numbers represent the enrichment factor of each capsid in each tissue relative to the injected library. Finally, all numbers were scaled to AAV values to visualize the enrichment factor relative to AAV9.
[0175] [6.2 Results] A capsid cocktail of AAV-F variants containing barcoded genomes with GFP and nLuc transgenes, controlled by a neuron-specific hSyn1 promoter, was administered intravenously to BALBc mice to evaluate the transduction levels of each capsid in the brain, their in vitro ability to bind to the Ly6C1 receptor, and their in vivo distribution to the liver. This was done because AAV9 expressed in the brain is known not to bind to the Ly6C1 receptor. The barcoded genome was amplified from the administered AAV cocktail, and the resulting amplicons were sequenced using NGS to evaluate the contribution of each capsid in the initial library. This was then used to normalize the expression levels of each capsid in the mouse brain (cDNA). Finally, all capsids were normalized against wild-type AAV9 expressed in the brain, compared to the input, and enrichment in the brain was calculated compared to AAV9 (Figure 14).
[0176] By analyzing brain enrichment scores in the brain (Figure 14), we found that 10 of the AAV-F variants were more enriched in the mouse brain than the original AAV-F capsid, and based on Example 4, we can conclude that these 10 variants are not mLy6C1 receptor binding agents, according to our results. This suggests that other receptors are used to cross the mouse blood-brain barrier.
[0177] Based on these results, the three most productive capsids (SEQ ID NOs. 92-94) from the top 10 candidates will be mass-produced in Sf+ cells using transient transfection followed by baculovirus infection for replication, and used in singleplex mouse studies to confirm their BBB cross-passing ability.
Claims
1. An adeno-associated virus (AAV) serotype 9 (AAV9) or clade F AAV capsid protein variant containing mutations in one or more amino acids, wherein the mutation is i) Compared to a control capsid protein without the aforementioned mutation, the phenotype of reduced hepatic transduction, and ii) Compared to a control capsid protein without the aforementioned mutation, the phenotype of overall transduction reduction At least one of the above is conferred to the capsid protein variant, The aforementioned capsid protein variant is an AAV capsid protein variant that further includes an amino acid sequence that results in increased CNS transduction (compared to a control capsid protein lacking the aforementioned amino acid sequence).
2. i) The variant comprises a mutation in one or more amino acids in the amino acid regions 452-458, 498-504, 590-595, and / or 582-587, wherein the mutation results in a phenotype of reduced hepatic transduction compared to a control without the mutation; ii) The capsid protein variant includes mutations in T138, S414, G453, K557, T568, T582, and Q590, or any combination thereof, wherein the mutations result in a phenotype of reduced overall transduction compared to a control capsid protein without the mutations; and iii) The amino acid sequence that confers increased CNS transduction includes an amino acid sequence selected from the group consisting of STTLYSP, FVVGQSY, DGTLAVPFK, and WPTSYDA, and sequences in which 4, 3, 2, or 1 or fewer amino acids differ from these. An AAV capsid protein variant according to claim 1, which is at least one of the following.
3. i) The capsid protein variant comprises at least one mutation selected from the group consisting of mutations at positions W595, Q592, W503, N498, and E500, and the amino acid sequence DGAATKN at positions 452-458, wherein the mutation results in a phenotype of reduced hepatic transduction compared to a control without the mutation; ii) The capsid protein variant includes mutations in both T568 and Q590, or both S414 and G453, or all of T138, S414, G453, K557, and T582, or all of S414, G453, K557, and T582, wherein the mutations result in a phenotype of reduced overall transduction compared to a control capsid protein without the mutations; and iii) The amino acid sequence that provides increased CNS transduction includes an amino acid sequence selected from the group consisting of FVVGQSY, FVVAQSY, FVVVQSY, FVVLQSY, FVVIQSY, FVVNQSY, FVVSQSY, FVVEQSY, FVVQQSY, FVVCQSY, FVVTQSY, FVVPQSY, FVVQSY, FVGVQSY, FVVQGSY, FVQGVSY, FSVGQVY, and FSQGVVY, preferably selected from the group consisting of FVVGQSY, FVVAQSY, FVVPQSY, FVGVQSY, and FVVQGSY. An AAV capsid protein variant according to claim 1 or 2, which is at least one of the following.
4. i) The capsid protein variant includes a mutation in W595C, a mutation in Q592L, a mutation in W503R, a mutation in N498Y, a mutation in E500D, or any combination thereof, wherein the mutation results in a phenotype of reduced hepatic transduction compared to a control without the mutation; ii) The AAV capsid protein variants include mutations in T568P and Q590L, or mutations in S414 and G453D, or mutations in T138A, S414N, G453D, K557E, and T582I, or mutations in S414N, G453D, K557E, and T582I; and iii) The inserted amino acid sequence is inserted into the hypervariable region of the AAV capsid protein sequence, preferably into a hypervariable region selected from loop IV or loop VIII. An AAV capsid protein variant according to any one of claims 1 to 3, wherein at least one of the above.
5. The aforementioned capsid protein variant is a) T138A, S414N, G453D, K557E, and T582I mutations, and amino acid sequences FVVGQSY or FVVAQSY inserted into loop VIII, preferably between positions 588 and 589; b) S414N, G453D, K557E, and T582I mutations, and amino acid sequences FVVGQSY or FVVAQSY inserted into loop VIII, preferably between positions 588 and 589; c) T138A, S414N, G453D, K557E, and T582I mutations, and the amino acid sequence WPTSYDA inserted into loop VIII, preferably between positions 588 and 589; d) S414N, G453D, K557E, and T582I mutations, and the amino acid sequence WPTSYDA inserted into loop VIII, preferably between positions 588 and 589; e) an amino acid sequence DGAATKN at positions 452 to 458, and an amino acid sequence FVVGQSY or FVVAQSY inserted into loop VIII, preferably between positions 588 and 589; or f) The amino acid sequence DGAATKN at positions 452-458, and the amino acid sequence WPTSYDA inserted into loop VIII, preferably between positions 588 and 589. An AAV capsid protein variant according to any one of claims 1 to 3, comprising:
6. The AAV capsid protein variant according to any one of claims 1 to 5, wherein the AAV capsid protein variant comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 6, 7, 9, 10, and 96.
7. The AAV capsid protein variant according to any one of claims 1 to 6, wherein the AAV capsid protein variant is at least one variant of VP1, VP2, and VP3 capsid proteins.
8. A nucleic acid encoding an AAV capsid protein variant according to any one of claims 1 to 7.
9. A recombinant AAV (rAAV) vector virion comprising at least one AAV capsid protein variant as described in any one of claims 1 to 7, preferably not comprising at least one of the wild-type VP1, VP2, and VP3 capsid proteins.
10. The rAAV vector virion according to claim 9, comprising a nucleic acid molecule capsid-formed by at least one capsid protein variant, wherein the nucleic acid molecule comprises a transgene adjacent to at least one AAV reverse terminal repeat (ITR).
11. A composition comprising the AAV vector virion described in claim 9 or 10, preferably a pharmaceutical composition comprising the AAV vector virion and at least one pharmaceutically acceptable carrier.
12. An AAV vector virion according to claim 9 or 10, or a composition according to claim 11, for use as a pharmaceutical, wherein the pharmaceutical is used for the treatment of a central nervous system disorder.
13. A method for identifying AAV capsid variants having desired properties, a) A step of providing a library comprising a plurality of individually generated AAV capsid variants, wherein each member of the library differs from the AAV capsid variant of another member of the library by at least one amino acid, and each member of the library comprises a DNA construct, the DNA construct is i) Unique molecular identifiers (UMIs) specific to each member in the library; ii) A reporter gene operably linked to a promoter that drives expression in mammalian cells; and iii) At least one AAV ITR Processes including; b) The step of contacting the library with a culture of cells, organoids, or tissue, or administering the library to a non-human animal; c) A step that enables the transduction of the AAV capsid variant in the library into the cells, organoids, tissues, or animal cells; and d) In the cells, organoids, tissues, or animals of the above-mentioned cell type, at least one AAV capsid variant transduced into at least one cell of the desired cell type is identified as an AAV capsid variant having the desired properties by determining the sequence of its UMI, and optionally, the AAV capsid variant having the desired properties is recovered from the cells of the desired cell type. A method that includes this.
14. The method according to claim 13, wherein step d) is to detect the transduction of cells of the desired cell type by detecting the expression of the reporter gene in at least one cell of the desired cell type.
15. The method according to claim 13 or 14, wherein in step d), for at least one cell of the desired cell type, at least one of the mRNA and genome copy number expressed from at least two members in the library is quantified and identified by determining the sequence of its UMI, and the member having the highest mRNA expression level and genome copy number is identified as the AAV capsid variant having the desired characteristics.
16. The method according to claim 15, wherein, in cells of two or more cell types including at least the desired cell type, at least one of the mRNA and genome copy number expressed from at least two members in the library is quantified and identified by determining the sequence of its UMI, and the member having the most desired distribution across the two or more cell types is identified as the AAV capsid variant having the desired characteristics.