Gene Regulatory Compositions and Methods for Improved Immunotherapy - Patent application

Abstract

The present disclosure provides methods and compositions related to modifying Tregs to improve therapeutic efficacy. In some embodiments, modified Tregs are provided by reducing the expression of one or more endogenous target genes or by reducing the function of one or more endogenous proteins to enhance the immunosuppressive function of the immune cells. In some embodiments, Tregs are provided that are further modified by introducing a transgene that confers antigen specificity, such as an exogenous T cell receptor (TCR) or chimeric antigen receptor (CAR). Methods of treating autoimmune diseases using the modified Tregs described herein are also provided.

Description

[Technical field]

[0001] The present disclosure relates to methods, compositions and components for editing a target nucleic acid sequence or modulating the expression of a target nucleic acid sequence, and their immunotherapy-related uses, including use with T regulatory cells (optionally receptor transduced regulator T cells) in the treatment of autoimmune diseases. [Background technology]

[0002] Inappropriate or excessive immune system responses result in a variety of conditions in affected organisms, including autoimmune diseases. Adoptive cell transfer using genetically modified T cells, particularly CAR-T cells, has entered clinical trials as a therapy for solid and hematological malignancies. Adoptive cell transfer may also be useful in diseases other than cancer, such as autoimmune disorders. However, factors that limit the efficacy of genetically modified immune cells include (1) cell proliferation (e.g., limited T cell proliferation after adoptive transfer), (2) cell survival (e.g., induction of T cell apoptosis), and (3) cell function (e.g., inhibition of T cell function and exhaustion of immune cells by inhibitors during the manufacturing process and / or after transfer). The use of adoptive T cells has considerable room for growth, especially in the treatment of autoimmune disorders, and there is a need to improve the efficacy of adoptive transfer of modified immune cells in the treatment of autoimmune disorders. Summary of the Invention

[0003] One aspect of the invention disclosed herein relates to a T regulatory cell (Treg) comprising a gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, including TNFRSF4, whereby the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Treg. One aspect of the invention disclosed herein relates to a modified Treg, whereby the expression and / or function of one or more endogenous target genes, including TNFRSF4, is reduced by the gene regulatory system, whereby the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Treg.

[0004] One aspect of the invention disclosed herein relates to modified Tregs comprising a gene regulatory system capable of reducing the expression and / or function of one or more endogenous target genes, including PRDM1, wherein the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Tregs. One aspect of the invention disclosed herein relates to modified Tregs wherein the expression and / or function of one or more endogenous target genes, including PRDM1, is reduced by the gene regulatory system, and the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Tregs.

[0005] One aspect of the present invention disclosed herein relates to a modified Treg comprising a gene regulatory system capable of reducing the expression and / or function of one or more endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP, wherein the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Treg. One aspect of the present invention disclosed herein relates to a modified Treg wherein the expression and / or function of one or more endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP is reduced by the gene regulatory system, and the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Treg.

[0006] In certain embodiments, the gene regulation system comprises (i) a nucleic acid molecule, (ii) an enzyme protein, or (iii) a nucleic acid molecule and an enzyme protein. In one embodiment, the gene regulation system comprises a nucleic acid molecule selected from siRNA, shRNA, microRNA (miR), antagomir, or antisense RNA. In one embodiment, the gene regulation system comprises an enzyme protein, and the enzyme protein is engineered to specifically bind to a target sequence in one or more of the endogenous genes. In some embodiments, the protein is a transcription activator-like effector nuclease (TALEN), zinc finger nuclease, or meganuclease.

[0007] In one embodiment, the gene regulation system comprises a nucleic acid molecule and an enzymatic protein, the nucleic acid molecule being a guide RNA (gRNA) molecule, and the enzymatic protein being a Cas protein or a Cas orthologue. In one embodiment, the Cas protein is a Cas9 protein. In some embodiments, the Cas protein is a wild-type Cas protein that comprises two enzymatic activity domains and is capable of inducing double-stranded DNA breaks. In various embodiments, the Cas protein is a Cas nickase mutant that comprises one enzymatic activity domain and is capable of inducing single-stranded DNA breaks. In one embodiment, the Cas protein is an inactivated Cas protein (dCas) and is associated with a heterologous protein that is capable of regulating the expression of the one or more endogenous target genes. In various embodiments, the heterologous protein is selected from the group consisting of MAX interacting protein 1 (MXI1), Kruppel-associated box (KRAB) domain, methyl-CpG binding protein 2 (MECP2), and mSin3 4-linking domain (SID4X).

[0008] In embodiments, the gene regulation system is capable of reducing the expression and / or function of at least two, three, four, five, six or more of the endogenous target genes.

[0009] In embodiments, the gene regulation system is capable of reducing expression and / or function of multiple endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP. In some embodiments, the gene regulation system is capable of reducing expression and / or function of at least two, three, four, five, six, or more endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP.

[0010] In one embodiment, the gene regulation system is capable of decreasing expression and / or function of a plurality of endogenous target genes, wherein at least one of the plurality of target genes is TNFRSF4 and at least one of the plurality of target genes is selected from PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP. In one embodiment, one of the plurality of target genes is TNFRSF4 and at least two, three, four, five, six, or more of the plurality of target genes are selected from PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP.

[0011] In one embodiment, the gene regulation system is capable of decreasing expression and / or function of a plurality of endogenous target genes, wherein at least one of the plurality of target genes is PRDM1 and at least one of the plurality of target genes is selected from TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP. In one embodiment, one of the plurality of target genes is PRDM1 and at least two, three, four, five, six, or more of the plurality of target genes are selected from TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP.

[0012] In some embodiments, the gene regulatory system comprises multiple gRNA molecules.In other embodiments, the gene regulatory system is introduced into the Treg by transfection, transduction, electroporation or physical disruption of cell membrane by microfluidic device.In various embodiments, the gene regulatory system is introduced as a polynucleotide, protein or ribonucleoprotein (RNP) complex that encodes one or more components of the system.

[0013] In certain embodiments, the immunosuppressive function is selected from Treg proliferation, Treg survival, Treg stability, increased expression or secretion of an immunosuppressive cytokine (optionally, the immunosuppressive cytokine is IL-10), increased co-expression of Foxp3 and Helios, and / or exhaustion resistance. In one embodiment, the modified Treg further comprises an engineered immune receptor displayed on the cell surface. In embodiments, the engineered immune receptor is a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular signaling domain.

[0014] In certain embodiments, the engineered immune receptor is an engineered T cell receptor (TCR). In one embodiment, the engineered immune receptor specifically binds to an antigen expressed on a target cell.

[0015] One aspect of the invention disclosed herein relates to modified Tregs having reduced expression and / or function of one or more endogenous genes compared to the expression and / or function of one or more endogenous genes in unmodified Tregs, wherein the one or more endogenous genes include TNFRSF4, and the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Tregs.

[0016] One aspect of the invention disclosed herein relates to modified Tregs having reduced expression and / or function of one or more endogenous genes compared to the expression and / or function of one or more endogenous genes in unmodified Tregs, wherein the one or more endogenous genes include PRDM1, and the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Tregs.

[0017] One aspect of the present invention disclosed herein relates to modified Tregs in which the expression and / or function of one or more endogenous genes is reduced compared to the expression and / or function of one or more endogenous genes in unmodified Tregs, wherein the one or more endogenous genes are selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP, and the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Tregs.

[0018] In some embodiments, the engineered Treg further comprises an engineered immune receptor displayed on the cell surface. In various embodiments, the engineered immune receptor is a CAR or an engineered TCR. In one embodiment, the engineered immune receptor specifically binds to an antigen expressed on a target cell.

[0019] In one embodiment, the modified Treg further comprises reduced expression of TNFRSF4. In one embodiment, the modified Treg comprises reduced expression and / or function of TNFRSF4 and reduced expression and / or function of at least one target gene selected from PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. In one embodiment, the modified Treg comprises reduced expression and / or function of TNFRSF4 and reduced expression and / or function of at least two, three, four, five, six or more target genes selected from the group consisting of PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP.

[0020] In one embodiment, the modified Treg further comprises reduced expression of PRDM1. In one embodiment, the modified Treg comprises reduced expression and / or function of PRDM1 and reduced expression and / or function of at least one target gene selected from TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. In one embodiment, the modified Treg comprises reduced expression and / or function of PRDM1 and reduced expression and / or function of at least two, three, four, five, six or more target genes selected from the group consisting of TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP.

[0021] In various embodiments, the gene regulation system comprises a nucleic acid molecule selected from siRNA and shRNA. In certain embodiments, the gene regulation system is further capable of reducing expression of one or more endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. In one embodiment, the gene regulation system is capable of reducing expression and / or function of multiple endogenous target genes and comprises multiple siRNAs or shRNAs, and at least one endogenous target gene is selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP.

[0022] In certain embodiments, the gene regulation system is capable of reducing expression and / or function of at least two, three, four, five, six or more endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP. In one embodiment, the gene regulation system is capable of reducing expression and / or function of a plurality of endogenous target genes and comprises a plurality of siRNAs or shRNAs, where at least one of the plurality of target genes is TNFRSF4 and at least one of the plurality of target genes is selected from PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP2. In certain embodiments, at least one of the plurality of target genes is TNFRSF4 and at least two, three, four, five, six or more of the plurality of target genes are selected from PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. In another embodiment, the gene regulation system is capable of reducing expression and / or function of a plurality of endogenous target genes and comprises a plurality of siRNAs or shRNAs, at least one of the plurality of target genes is PRDM1 and at least one of the plurality of target genes is selected from TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP2. In one embodiment, at least one of the plurality of target genes is PRDM1 and at least two, three, four, five, six or more of the plurality of target genes are selected from TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP.

[0023] One aspect of the invention disclosed herein relates to a composition comprising the modified Tregs disclosed herein. In one embodiment, the composition comprises at least 1x10 4pieces, 1x10 5 pieces, 1x10 6 pieces, 1x10 7 pieces, 1x10 8 pieces, 1x10 9 Pieces or 1x10 10 In certain embodiments, the composition is suitable for administration to a subject in need of the composition. In some embodiments, the composition comprises autologous Tregs derived from a subject in need of the composition. In one embodiment, the composition comprises allogeneic Tregs derived from a donor subject.

[0024] One aspect of the invention disclosed herein relates to a gene regulation system capable of reducing expression of one or more endogenous target genes in a cell, the gene regulation system comprising (i) a nucleic acid molecule, (ii) an enzyme protein, or (iii) a nucleic acid molecule and an enzyme protein, wherein the one or more endogenous target genes comprise TNFRSF4. In various embodiments, the system comprises a guide RNA (gRNA) nucleic acid molecule and a Cas endonuclease.

[0025] One aspect of the invention disclosed herein relates to a gene regulation system capable of reducing expression of one or more endogenous target genes in a cell, the gene regulation system comprising (i) a nucleic acid molecule, (ii) an enzymatic protein, or (iii) a nucleic acid molecule and an enzymatic protein, wherein the one or more endogenous target genes comprise PRDM1. In some embodiments, the system comprises a guide RNA (gRNA) nucleic acid molecule and a Cas endonuclease.

[0026] One aspect of the invention disclosed herein relates to a gene regulation system capable of reducing expression and / or function of one or more endogenous target genes in a cell, comprising (i) a nucleic acid molecule, (ii) an enzymatic protein, or (iii) a nucleic acid molecule and an enzymatic protein, wherein the one or more endogenous target genes are selected from the group consisting of REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP2. In embodiments, the system comprises a guide RNA (gRNA) nucleic acid molecule and a Cas endonuclease.

[0027] Any Cas protein can be used, including those provided herein. In various embodiments, the Cas protein is a Cas9 protein. In some embodiments, the Cas protein is a wild-type Cas protein that contains two enzymatically active domains and can induce double-stranded DNA breaks. In certain embodiments, the Cas protein is a Cas nickase mutant that contains one enzymatically active domain and can induce single-stranded DNA breaks. In some embodiments, the Cas protein is an inactivated Cas protein (dCas) and is associated with a heterologous protein that can regulate the expression of one or more endogenous target genes.

[0028] In one embodiment, the heterologous protein is selected from the group consisting of MAX interacting protein 1 (MXI1), Kruppel-associated box (KRAB) domain, and mSin3 4-linking domain (SID4X).

[0029] In one embodiment, the system comprises a nucleic acid molecule, which is a siRNA, shRNA, microRNA (miR), antagomir, or antisense RNA.

[0030] In some embodiments, the system comprises a protein comprising a DNA binding domain and an enzymatic domain, and is selected from a zinc finger nuclease and a transcription activator-like effector nuclease (TALEN).

[0031] One aspect of the invention disclosed herein relates to a kit comprising the gene regulatory system disclosed herein.

[0032] One aspect of the invention disclosed herein relates to a gRNA nucleic acid molecule comprising a targeting domain nucleic acid sequence that is complementary to a target sequence in an endogenous target gene, the endogenous target gene being TNFRSF4. One aspect of the invention disclosed herein relates to a gRNA nucleic acid molecule comprising a targeting domain nucleic acid sequence that is complementary to a target sequence in an endogenous target gene, the endogenous target gene being PRDM1. One aspect of the invention disclosed herein relates to a gRNA nucleic acid molecule comprising a targeting domain nucleic acid sequence that is complementary to a target sequence in an endogenous target gene, the endogenous target gene being selected from REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP2.

[0033] In embodiments, the target sequence comprises a PAM sequence. In certain embodiments, the gRNA is a modular gRNA molecule. In one embodiment, the gRNA is a dual gRNA molecule. In some embodiments, the targeting domain is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or more nucleotides in length. In one embodiment, the gRNA comprises a modification at or near its 5' end (e.g., within 1-10, 1-5 or 1-2 nucleotides of its 5' end) and / or a modification at or near its 3' end (e.g., within 1-10, 1-5 or 1-2 nucleotides of its 3' end).

[0034] In some embodiments, the modified gRNA when introduced into a T cell enhances stability against nucleases.In some embodiments, the modified gRNA when introduced into a T cell reduces the innate immune response.

[0035] One aspect of the invention disclosed herein relates to a polynucleotide molecule encoding a gRNA molecule disclosed herein.One aspect of the invention disclosed herein relates to a polynucleotide molecule encoding a plurality of gRNA molecules disclosed herein.

[0036] One aspect of the invention disclosed herein relates to a composition comprising one or more gRNA molecules disclosed herein or a polynucleotide disclosed herein.One aspect of the invention disclosed herein relates to a kit comprising a gRNA molecule disclosed herein or a polynucleotide disclosed herein.

[0037] One aspect of the invention disclosed herein relates to a method of producing modified Tregs, the method comprising: obtaining Tregs from a subject; introducing into the Tregs a gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising TNFRSF4; and culturing the Tregs such that expression and / or function of the one or more endogenous target genes is reduced compared to unmodified Tregs.

[0038] One aspect of the invention disclosed herein relates to a method of producing modified Tregs, the method comprising: harvesting Tregs from a subject; introducing into the Tregs a gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising PRDM1; and culturing the Tregs such that expression and / or function of the one or more endogenous target genes is reduced compared to unmodified Tregs.

[0039] One aspect of the invention disclosed herein relates to a method of making modified Tregs comprising introducing a gene regulatory system into the Tregs, the gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising TNFRSF4.One aspect of the invention disclosed herein relates to a method of making modified Tregs comprising introducing a gene regulatory system into the Tregs, the gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising PRDM1.

[0040] In embodiments, the gene regulatory system is any system disclosed herein. In embodiments, the method further comprises introducing a polynucleotide sequence encoding an engineered immune receptor selected from CAR and TCR. In embodiments, the gene regulatory system and / or the polynucleotide encoding the engineered immune receptor is introduced into the Treg by transfection, transduction, electroporation or physical disruption of the cell membrane with a microfluidic device. In one embodiment, the gene regulatory system is introduced as a polynucleotide sequence encoding one or more components of the system, as a protein, or as a ribonucleoprotein (RNP) complex.

[0041] One aspect of the invention disclosed herein relates to a method of producing modified Tregs, comprising harvesting a population of Tregs, expanding the Treg population, and introducing a gene regulatory system into the Treg population, the gene regulatory system being capable of reducing expression and / or function of one or more endogenous target genes, including TNFRSF4. In embodiments, the gene regulatory system is introduced into the Treg population prior to expansion. In one embodiment, the gene regulatory system is introduced into the Treg population after expansion.

[0042] One aspect of the invention disclosed herein relates to a method of making modified Tregs, comprising harvesting a population of Tregs, expanding the Treg population, and introducing a gene regulatory system into the Treg population, the gene regulatory system being capable of reducing expression and / or function of one or more endogenous target genes, including PRDM1. In one embodiment, the gene regulatory system is introduced into the Treg population prior to expansion. In embodiments, the gene regulatory system is introduced into the Treg population after expansion.

[0043] One aspect of the invention disclosed herein relates to a method for treating a disease or disorder in a subject in need of treatment, comprising administering an effective amount of a modified Treg disclosed herein or a composition disclosed herein.

[0044] In embodiments, the disease or condition is an autoimmune disorder. In embodiments, the autoimmune disorder is autoimmune hepatitis, inflammatory bowel disease (IBD), Crohn's disease, colitis, ulcerative colitis, type 1 diabetes, alopecia areata, vasculitis, temporal arthritis, lupus, celiac disease, Sjogren's syndrome, polymyalgia rheumatica, multiple sclerosis, arthritis, rheumatoid arthritis, graft-versus-host disease (GVHD), or psoriasis. In certain embodiments, the autoimmune disorder is inflammatory bowel disease (IBD), such as Crohn's disease or ulcerative colitis. In certain embodiments, the autoimmune disorder is systemic lupus erythematosus. In certain embodiments, the autoimmune disorder is an autoimmune response associated with solid organ transplantation, such as GVHD. In certain embodiments, the modified Treg is autologous to the subject. In one embodiment, the modified Treg is allogeneic to the subject.

[0045] One aspect of the invention disclosed herein relates to a method for enhancing one or more immunosuppressive functions of Tregs, comprising introducing a gene regulatory system into the Tregs, the gene regulatory system being capable of reducing expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising TNFRSF4, and culturing the Tregs such that the expression and / or function of the one or more endogenous target genes is reduced compared to unmodified Tregs, wherein the one or more immunosuppressive functions are enhanced in the modified Tregs compared to unmodified Tregs.

[0046] One aspect of the invention disclosed herein relates to a method for enhancing one or more immunosuppressive functions of Tregs, comprising introducing a gene regulatory system into the Tregs, the gene regulatory system being capable of reducing expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising PRDM1, and culturing the Tregs such that the expression and / or function of the one or more endogenous target genes is reduced compared to unmodified Tregs, wherein the one or more immunosuppressive functions are enhanced in the modified Tregs compared to unmodified Tregs.

[0047] One aspect of the invention disclosed herein relates to a method for enhancing one or more immunosuppressive functions of Tregs, comprising introducing into the Tregs a gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising TNFRSF4.

[0048] One aspect of the invention disclosed herein relates to a method for enhancing one or more immunosuppressive functions of Tregs, comprising introducing into the Tregs a gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising PRDM1.

[0049] In embodiments, the one or more immunosuppressive functions are selected from Treg proliferation, Treg survival, Treg stability, increased expression or secretion of an immunosuppressive cytokine (optionally, the immunosuppressive cytokine is IL-10), increased co-expression of Foxp3 and Helios, and / or exhaustion resistance.

[0050] One aspect of the invention disclosed herein relates to a method of enhancing one or more immunosuppressive functions of Tregs, comprising introducing a gene regulatory system into the Tregs, the gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising TNFRSF4, wherein introducing the gene regulatory system does not decrease the stability of the Tregs, which can be assessed, for example, by measuring methylation of Foxp3 TSDR.

[0051] One aspect of the invention disclosed herein relates to a method of enhancing one or more immunosuppressive functions of Tregs, comprising introducing a gene regulatory system into the Tregs, the gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising PRDM1, wherein introducing the gene regulatory system improves the stability of the Tregs, which can be assessed, for example, by measuring methylation of Foxp3 TSDR.

[0052] Thus, for example, by introducing the gene regulatory system, the percentage (%) of demethylated Foxp3 TSDR can be increased by at least 10%, at least 15%, at least 20%, or at least 25%. By introducing the gene regulatory system, the percentage of demethylated Foxp3 TSDR can be increased by 10-50%, 10-30%, 15-50%, 15-30%, 20-50%, 20-30%, 25-50%, or 25-30%.

[0053] One aspect of the invention disclosed herein relates to a method for treating an autoimmune disease in a subject in need of treatment, comprising administering an effective amount of modified Tregs disclosed herein or a composition disclosed herein.In various embodiments, the autoimmune disease is selected from the group consisting of autoimmune hepatitis, inflammatory bowel disease (IBD), Crohn's disease, colitis, ulcerative colitis, type 1 diabetes, alopecia areata, vasculitis, temporal arthritis, lupus, celiac disease, Sjogren's syndrome, polymyalgia rheumatica, multiple sclerosis, arthritis, rheumatoid arthritis, graft-versus-host disease (GVHD), and psoriasis.In certain embodiments, the autoimmune disorder is inflammatory bowel disease (IBD), such as Crohn's disease or ulcerative colitis.In certain embodiments, the autoimmune disorder is systemic lupus erythematosus.

[0054] One aspect of the invention disclosed herein relates to a method of treating an autoimmune response associated with solid organ transplantation (e.g., GVHD) in a subject in need of treatment, comprising administering an effective amount of an engineered Treg as disclosed herein or a composition disclosed herein.

[0055] In some embodiments, the modified Tregs are tissue-resident Tregs. In some embodiments, the Tregs are tissue-resident Tregs. [Brief description of the drawings]

[0056] [Figure 1] Summary of Treg-selective targets identified by in vitro CRISPR / Cas9 functional genomic screening. [Diagram 2] 1 shows Foxp3 and CD45 gene editing in human Treg cells using the methods described herein. [Diagram 3] 1 shows improved proliferation capacity of PRDM1 and TNFRSF edited Treg cells in an in vitro culture system. [Figure 4]This shows an increase in the percentage of Foxp3+Helios+ cells in PRDM1-edited Treg cells in an in vitro culture system. [Diagram 5] We show that demethylation of the Foxp3 Treg-specific demethylated region (TSDR), a measure of Treg stability, is maintained in TNFRSF4-edited Treg cells and increased in PRDM1-edited Treg cells. [Figure 6] We show increased production of the immunosuppressive cytokine interleukin-10 in PRDM1- and TNFRSF-edited Treg cells in an in vitro culture system. [Figure 7] We show that PRDM1-edited Treg cells persist under inflammatory conditions. [Figure 8] This shows that the suppressive ability of PRDM1- and TNFRSF4-edited Tregs is comparable to that of control-edited Tregs. [Figure 9A] In a GvHD model, treatment of mice with PRDM1- and TNFRSF4-edited Tregs has been shown to extend survival compared to mice treated with control-edited Tregs. [Figure 9B] 1 shows the reduced proliferative capacity of CD8+ T effector cells as a result of Treg treatment. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0057] The present disclosure provides methods and compositions relating to modifying T regulatory (Treg) cells to improve their therapeutic efficacy in the context of immunotherapy for autoimmune diseases. In some embodiments, Tregs are modified by the methods of the present disclosure to reduce expression of one or more endogenous target genes or reduce one or more functions of endogenous proteins such that one or more immunosuppressive functions of the immune cells are enhanced. In some embodiments, the Tregs are further modified by introduction of a transgene that confers antigen specificity, such as introduction of a T cell receptor (TCR) expression construct or a chimeric antigen receptor (CAR) expression construct. In some embodiments, the present disclosure provides compositions and methods for modifying Tregs, such as compositions of gene regulatory systems. In some embodiments, the present disclosure provides a method of treating an autoimmune disorder, comprising administering to a subject in need of treatment a modified Treg as described herein.

[0058] I. Definition As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0059] As used herein, the term "and / or" is intended to mean either "and" or "or" in this disclosure, unless otherwise indicated.

[0060] Throughout this specification, unless the context requires otherwise, the word "comprise" or variations such as "comprises" or "comprising" shall be understood to imply the inclusion of a stated element or whole, or group of elements or wholes, but not the exclusion of any other element or whole, or group of elements or wholes.

[0061] As used herein, the terms "about" and "approximately" are used synonymously. Any numbers used herein, with or without about / approximately, are intended to cover any normal variations recognized by those of ordinary skill in the art. In certain embodiments, the term "about" or "approximately" refers to a range of values ​​that is within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the stated value in either direction (above or below the stated value) unless otherwise stated or otherwise clear from the context (except when the number is greater than 100% of the possible values).

[0062] "Decrease" or "reduce" refers to a decrease or decrease in a particular value by at least 5%, e.g., a 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% decrease compared to a reference value. A decrease or reduction in a particular value may also be expressed as a fold change in that value compared to a reference value, e.g., a decrease of at least 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 500-fold, 1000-fold or more compared to the reference value.

[0063] By "increasing" it is meant that a particular value is increased by at least 5%, e.g., a 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%, 200%, 300%, 400%, 500% or greater increase as compared to a reference value. An increase in a particular value may also be expressed as a fold change in that value compared to a reference value, e.g., an increase of at least 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 500-fold, 1000-fold, or more, relative to the level of the reference value.

[0064] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymeric forms of amino acids of any length, which can include coded amino acids, non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones.

[0065] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, the terms include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases, other natural bases, chemically modified bases, biochemically modified bases, non-natural bases, or derivatized nucleotide bases. "Oligonucleotide" generally refers to a polynucleotide of about 5 to about 100 nucleotides of single-stranded or double-stranded DNA. However, for purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides, also known as "oligomers" or "oligos," may be isolated from genes or chemically synthesized by methods known in the art. The terms "polynucleotide" and "nucleic acid" should be understood to include single-stranded polynucleotides (such as sense or antisense strands) and double-stranded polynucleotides, as applicable to the described embodiments.

[0066] "Fragment" refers to a portion of a polypeptide or polynucleotide molecule that contains less than the entire polypeptide or polynucleotide sequence. In some embodiments, a polypeptide or polynucleotide fragment comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% of the full length of a reference polypeptide or polynucleotide. In some embodiments, a polypeptide or polynucleotide fragment may comprise 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more nucleotides or amino acids.

[0067] The term "sequence identity" refers to the percentage of bases or amino acids that are the same and in the same relative positions between two polynucleotide or polypeptide sequences. Thus, one polynucleotide or polypeptide sequence has a certain percentage of sequence identity to another polynucleotide or polypeptide sequence. During sequence comparison, typically, one sequence serves as a reference sequence to which a test sequence is compared. The term "reference sequence" refers to a molecule to which a test sequence is compared.

[0068] "Complementary" refers to the ability to pair through base stacking and specific hydrogen bonding between two sequences containing natural or unnatural bases or their analogs. For example, if a base at one position of a nucleic acid can hydrogen bond with a base at the corresponding position of a target, the bases are considered to be complementary to each other at that position. Nucleic acids can contain universal bases or inert abasic spacers that do not contribute positively or negatively to hydrogen bonding. Base pairing can include both canonical Watson-Crick base pairing and non-Watson-Crick base pairing (e.g., wobble base pairing and Hoogsteen base pairing). In complementary base pairing, it is understood that adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), cytosine-type bases (C) are complementary to guanosine-type bases (G), and universal bases such as 3-nitropyrrole or 5-nitroindole can hybridize with and be considered complementary to either A, C, U or T. Nichols et al., Nature, 1994; 369: 492-493 and Loakes et al., Nucleic Acids Res., 1994; 22: 4039-4043. Inosine (I) has also been considered in the art to be a universal base and is considered complementary to either A, C, U or T. See Watkins and SantaLucia, Nucl. Acids Research, 2005;33(19):6258-6267.

[0069] As referred to herein, a "complementary nucleic acid sequence" is a nucleic acid sequence that contains a nucleotide sequence that allows that sequence to non-covalently bind to another nucleic acid in a sequence-specific and antiparallel manner under appropriate conditions of temperature and solution ionic strength in vitro and / or in vivo (i.e., the nucleic acid specifically binds to a complementary nucleic acid).

[0070] Methods of sequence alignment for comparison and for determining percent sequence identity and percent complementarity are well known in the art. For comparison, sequences are optimally aligned by, for example, the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443, by the similarity search method of Pearson and Lipman, (1988) Proc. Nat'l. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, 575 Science Dr., Madison, WI)), by manual alignment and visual inspection (see, e.g., Brent et al., (2003) Current Protocols in Molecular Biology), by BLAST as described in Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402, and by the search for similarity method of Altschul et al. This can be done by using algorithms known in the art, including the BLAST 2.0 algorithm described in et al., (1990) J. Mol. Biol. 215:403-410. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.

[0071] As used herein, the term "hybridize" refers to pairing between complementary nucleotide bases (e.g., adenine (A) base pairs with thymine (T) in DNA molecules and uracil (U) in RNA molecules, and guanine (G) base pairs with cytosine (C) in both DNA and RNA molecules) to form a double-stranded nucleic acid molecule (see, e.g., Wahl and Berger (1987) Methods Enzymol. 152:399; Kimmel, (1987) Methods Enzymol. 152:507). In addition, it is known in the art that in the hybridization of two RNA molecules (e.g., dsRNA), guanine (G) base pairs with uracil (U). For example, the formation of G / U base pairs is a partial cause of the degeneracy (i.e., redundancy) of the genetic code with respect to the base pairing of the anticodon of tRNA with a codon in mRNA. In the context of the present disclosure, a guanine (G) of the protein-binding segment (double-stranded dsRNA) of a guide RNA molecule is considered to be complementary to a uracil (U), and a U is considered to be complementary to the G. Thus, when a G / U base pair can be formed at a given nucleotide position of a protein-binding segment (double-stranded dsRNA) of a guide RNA molecule, the position is not considered to be non-complementary, but rather is considered to be complementary. It is understood in the art that a polynucleotide sequence need not be 100% complementary to the sequence of its target nucleic acid to be specifically hybridizable. Furthermore, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., loop or hairpin structures). A polynucleotide may have at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence complementarity to a target region within its targeted target nucleic acid sequence.

[0072] The term "modified" refers to a substance or compound (eg, a cell, a polynucleotide sequence and / or a polypeptide sequence) that has been altered or changed compared to the corresponding unmodified substance or compound.

[0073] The term "naturally occurring," as used herein, when applied to a nucleic acid, polypeptide, cell, or organism, refers to a nucleic acid, polypeptide, cell, or organism found in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including viruses) that can be isolated from a natural source and that has not been intentionally modified by man in the laboratory is naturally occurring.

[0074] "Isolated" refers to material that is free, to varying degrees, from components that normally accompany it when found in the natural state.

[0075] "Expression cassette" or "expression construct" refers to a DNA polynucleotide sequence operably linked to a promoter. "Operably linked" refers to a juxtaposition in which the components described as operably linked are in a relationship that allows them to function in their intended manner. For example, a promoter is operably linked to a polynucleotide sequence if it affects the transcription or expression of the polynucleotide sequence.

[0076] The term "recombinant vector," as used herein, refers to a polynucleotide molecule capable of transferring or transporting another polynucleotide inserted into the vector. The inserted polynucleotide may be an expression cassette. In some embodiments, the recombinant vector may be a viral vector or a non-viral vector (e.g., a plasmid).

[0077] The term "sample" refers to a biological composition (e.g., a cell, or a portion of a tissue) that is to be analyzed and / or genetically modified. In some embodiments, the sample is a "primary sample" in that it is taken directly from a subject, and in some embodiments, the "sample" is the result of processing the primary sample, e.g., to remove certain components and / or to isolate or purify certain components of interest.

[0078] The term "subject" includes animals, such as, for example, mammals. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, the subject is a livestock animal, such as cows, sheep, goats, dairy cows, pigs, etc., or a farmed animal, such as dogs and cats. In some embodiments (e.g., particularly in research settings), the subject is a rodent (e.g., mouse, rat, hamster), rabbit, primate, or pig, such as an inbred pig, etc. The terms "subject" and "patient" are used interchangeably herein.

[0079] "Administering," as used herein, refers to the introduction of an agent or composition into a subject.

[0080] "Treatment," as used herein, refers to the delivery of an agent or composition to a subject to affect a physiological outcome.

[0081] As used herein, the term "effective amount" refers to the minimum amount of an agent or composition required to produce a particular physiological effect. The effective amount of a particular agent may be expressed in a variety of ways, depending on the nature of the agent, such as mass / volume, number of cells / volume, particles / volume, (mass of agent) / (mass of subject), number of cells / (mass of subject), or particles / (mass of subject). The effective amount of a particular agent is expressed as the half maximal effective concentration (EC 50 ), which refers to the concentration of a drug that produces a particular physiological response halfway between a basal level and a maximum response level.

[0082] A "population" of cells refers to any number of cells greater than or equal to two, but preferably at least 1×10 3 cells, at least 1 x 10 4 cells, at least 1 x 10 5 cells, at least 1 x 10 6 cells, at least 1 x 10 7 cells, at least 1 x 10 8 cells, at least 1 x 10 9 cells, at least 1 x 10 10 A cell population may refer to an in vitro population (e.g., a population of cells in culture) or an in vivo population (e.g., a population of cells present in a particular tissue).

[0083] General methods in molecular and cellular biochemistry are described in Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001), Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999), Protein Methods (Bollag et al., John Wiley & Sons 1996), Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999), Viral Vectors (Kaplift & Loewy eds., Academic Press 1995), Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997) and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference.

[0084] II. Modified T regulatory cells In some embodiments, the present disclosure provides modified T regulatory cells (Tregs). As used herein, the term "modified Tregs" includes Treg cells that contain one or more genomic modifications that reduce the expression and / or function of one or more endogenous target genes, as well as Tregs that contain a gene regulatory system that can reduce the expression and / or function of one or more endogenous target genes. As used herein, "unmodified Tregs" or "control Tregs" refers to cells or cell populations that are not genomically modified and do not contain a gene regulatory system or that contain a control gene regulatory system (e.g., empty vector control, non-targeting gRNA, scrambled siRNA, etc.). In some embodiments, the Tregs or modified Tregs are tissue-resident Tregs.

[0085] In some embodiments, the modified Tregs are animal cells or are derived from cells of animals, including invertebrates and vertebrates (e.g., fish, amphibians, reptiles, birds, or mammals). In some embodiments, the modified Tregs are mammalian cells or are derived from mammalian cells (e.g., pigs, cows, goats, sheep, rodents, non-human primates, humans, etc.). In some embodiments, the modified Tregs are rodent cells or are derived from rodent cells (e.g., rats or mice). In some embodiments, the modified Tregs are human cells or are derived from human cells.

[0086] In some embodiments, the modified Treg comprises one or more modifications (e.g., one or more nucleic acid insertions, deletions, or mutations) in the genomic DNA sequence of an endogenous target gene that reduce expression and / or function of the endogenous gene. In such embodiments, the modified Treg comprises a "modified endogenous target gene." In some embodiments, the modifications in the genomic DNA sequence reduce or inhibit transcription of the mRNA, thereby reducing expression levels of the encoded mRNA transcript and protein. In some embodiments, the modifications in the genomic DNA sequence reduce or inhibit translation of the mRNA, thereby reducing expression levels of the encoded protein. In some embodiments, the modifications in the genomic DNA sequence encode a modified endogenous protein (e.g., a dominant negative mutant, as described below) that has reduced or altered function compared to the unmodified (i.e., wild-type) endogenous protein.

[0087] In some embodiments, the modified Treg comprises one or more genomic modifications at a genomic location other than the endogenous target gene that reduce expression and / or function of the endogenous target gene or express a modified endogenous protein. For example, in some embodiments, a polynucleotide sequence encoding a gene regulatory system is inserted at one or more locations in the genome such that upon expression of the gene regulatory system, expression and / or function of the endogenous target gene is reduced. In some embodiments, a polynucleotide sequence encoding a modified endogenous protein is inserted at one or more locations in the genome such that the function of the modified protein is reduced compared to the unmodified or wild-type protein (e.g., a dominant negative mutant, as described below).

[0088] In some embodiments, the modified Tregs described herein comprise one or more modified endogenous target genes, where the modification(s) result in reduced expression and / or function of a gene product (i.e., mRNA transcript or protein) encoded by the endogenous target gene compared to an unmodified Treg. For example, in some embodiments, the modified Tregs have reduced expression of an mRNA transcript and / or reduced expression of a protein. In some embodiments, the expression of the gene product in the modified Tregs is reduced by at least 5% compared to the expression of the gene product in the unmodified Treg. In some embodiments, the expression of the gene product in the modified Tregs is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the expression of the gene product in the unmodified Treg. In some embodiments, the modified Tregs described herein have reduced expression and / or function of a gene product encoded by multiple (e.g., two or more) endogenous target genes compared to the expression of the gene product in the unmodified Treg. For example, in some embodiments, modified Tregs have reduced expression and / or function of gene products from two, three, four, five, six, seven, eight, nine, ten or more endogenous target genes compared to the expression of those gene products in unmodified Tregs.

[0089] In some embodiments, the disclosure provides modified Tregs in which one or more endogenous target genes or portions thereof have been deleted (i.e., "knocked out") so as not to express their mRNA transcripts or proteins. In some embodiments, the modified Tregs comprise deletions of multiple endogenous target genes or portions thereof. In some embodiments, the modified Tregs comprise deletions of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more endogenous target genes.

[0090] In some embodiments, the modified Tregs described herein comprise one or more modified endogenous target genes, the one or more modifications to the target DNA sequence resulting in the expression of a protein (e.g., an "modified endogenous protein") that has reduced or altered function compared to the function of the corresponding protein (e.g., an "unmodified endogenous protein") expressed in an unmodified Treg. In some embodiments, the modified Tregs described herein comprise two, three, four, five, six, seven, eight, nine, ten or more modified endogenous target genes that encode two, three, four, five, six, seven, eight, nine, ten or more modified endogenous proteins. In some embodiments, the modified endogenous proteins have reduced or altered binding affinity for another protein expressed by the modified Treg or by another cell, reduced or altered signaling ability, reduced or altered enzymatic activity, reduced or altered DNA binding activity, or reduced or altered ability to function as a scaffold protein.

[0091] In some embodiments, the modified endogenous target gene comprises one or more dominant-negative mutations. As used herein, a "dominant-negative mutation" refers to one or more nucleotides of a target gene that are substituted, deleted, or inserted such that the encoded protein acts antagonistically to the protein encoded by the unmodified target gene. The mutation is dominant-negative because the negative phenotype is genetically dominant over the positive phenotype of the corresponding unmodified gene. Genes that comprise one or more dominant-negative mutations and the proteins encoded by the genes are referred to as "dominant-negative mutants", e.g., dominant-negative genes and dominant-negative proteins. In some embodiments, the dominant-negative mutant proteins are encoded by an exogenous transgene inserted into one or more locations in the genome of the Treg.

[0092] Various dominant-negative mechanisms are known. Typically, the gene product of a dominant-negative mutant retains some functions of the unmodified gene product, but lacks one or more other important functions of the unmodified gene product. This allows the dominant-negative mutant to competitively inhibit the unmodified gene product. For example, as an exemplary embodiment, a dominant-negative mutant of a transcription factor may lack a functional activation domain but retain a functional DNA-binding domain. In this example, the dominant-negative transcription factor cannot activate DNA transcription like the unmodified transcription factor, and the dominant-negative transcription factor can indirectly inhibit gene expression by preventing the unmodified transcription factor from binding to the transcription factor binding site. As another exemplary embodiment, a dominant-negative mutant of a protein that functions as a dimer is known. A dominant-negative mutant of such a dimeric protein may retain the ability to form a dimer with the unmodified protein, but may not function otherwise. The dominant negative monomer dimerizes with an unmodified monomer, thereby forming a heterodimer and preventing the unmodified monomer from forming a functional homodimer.

[0093] In some embodiments, the modified Tregs of the present invention comprise a gene regulatory system capable of reducing the expression or function of one or more endogenous target genes by a variety of mechanisms, including by modifying the genomic DNA sequence of the endogenous target gene (e.g., by inserting, deleting, or mutating one or more nucleic acids within the genomic DNA sequence), regulating the transcription of the endogenous target gene (e.g., inhibiting or suppressing the transcription of mRNA), and / or regulating the translation of the endogenous target gene (e.g., by degradation of mRNA).

[0094] In some embodiments, the modified Tregs described herein comprise a gene regulatory system (e.g., a nucleic acid-based gene regulatory system, a protein-based gene regulatory system, or a protein / nucleic acid complex-based gene regulatory system). In such embodiments, the gene regulatory system comprised in the modified Tregs can modify one or more endogenous target genes. In some embodiments, the modified Tregs described herein comprise (a) one or more nucleic acid molecules capable of reducing the expression of or altering the function of a gene product encoded by one or more endogenous target genes; (b) one or more polynucleotides encoding nucleic acid molecules capable of reducing expression or altering the function of a gene product encoded by one or more endogenous target genes; (c) one or more proteins capable of reducing the expression of or altering the function of a gene product encoded by one or more endogenous target genes; (d) one or more polynucleotides encoding proteins capable of reducing the expression of or altering the function of a gene product encoded by one or more endogenous target genes; (e) one or more guide RNAs (gRNAs) capable of binding to a target DNA sequence within the endogenous gene; (f) one or more polynucleotides encoding one or more gRNAs capable of binding to a target DNA sequence within an endogenous gene; (g) one or more site-specific modifying polypeptides capable of interacting with the gRNA to modify a target DNA sequence within the endogenous gene; (h) one or more polynucleotides encoding a site-specific modifying polypeptide capable of interacting with a gRNA to modify a target DNA sequence within an endogenous gene; (i) one or more guide DNAs (gDNAs) capable of binding to a target DNA sequence within an endogenous gene; (j) one or more polynucleotides encoding one or more gDNAs capable of binding to a target DNA sequence within an endogenous gene; (k) one or more site-specific modifying polypeptides capable of interacting with gDNA to modify a target DNA sequence within an endogenous gene; (l) one or more polynucleotides encoding site-specific modifying polypeptides capable of interacting with gDNA and modifying a target DNA sequence within an endogenous gene; (m) one or more gRNAs capable of binding to a target mRNA sequence encoded by an endogenous gene; (n) one or more polynucleotides encoding one or more gRNAs capable of binding to a target mRNA sequence encoded by an endogenous gene; (o) one or more site-specific modifying polypeptides capable of interacting with the gRNA to modify a target mRNA sequence encoded by an endogenous gene; (p) one or more polynucleotides encoding a site-specific modifying polypeptide capable of interacting with the gRNA to modify a target mRNA sequence encoded by an endogenous gene; or (q) a gene regulatory system comprising any combination of the above; Includes.

[0095] In some embodiments, the one or more polynucleotides encoding the gene regulatory system are inserted into the genome of the Treg. In some embodiments, the one or more polynucleotides encoding the gene regulatory system are episomally expressed and are not inserted into the genome of the Treg.

[0096] In some embodiments, the modified Tregs described herein have reduced expression and / or function of one or more endogenous target genes and further comprise one or more exogenous transgenes inserted into one or more genomic loci (e.g., gene "knock-ins"). In some embodiments, the one or more exogenous transgenes encode a detectable tag, a safety switch system, a chimeric switch receptor, and / or an engineered antigen-specific receptor.

[0097] In some embodiments, the modified Treg described herein further comprises an exogenous transgene encoding a detectable tag. Examples of detectable tags include, but are not limited to, a FLAG tag, a polyhistidine tag (e.g., 6xHis), a SNAP tag, a Halo tag, a cMyc tag, a glutathione-S-transferase tag, avidin, an enzyme, a fluorescent protein, a luminescent protein, a chemiluminescent protein, a bioluminescent protein, and a phosphorescent protein.In some embodiments, the fluorescent protein is a blue / UV protein (such as BFP, TagBFP, mTagBFP2, Azurite, EBFP2, mKalama1, Sirius, Sapphire, and T-Sapphire), a cyan protein (such as CFP, eCFP, Cerulean, SCFP3A, mTurquoise, mTurquoise2, Monomeric Midoriishi-Cyan, TagCFP, and mTFP1), a green protein (such as GFP, eGFP, meGFP (A208K mutation), Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, Clover, and mNeonGreen), a yellow protein (such as YFP, eYFP, Citrine, Venus, SYFP2, and TagYFP), an orange protein (such as Monomeric Kusabira-Orange, mKOκ, mKO2, mOrange and mOrange2, etc.), red proteins (RFP, mRaspberry, mCherry, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby and mRuby2, etc.), far-red proteins (mPlum, HcRed-Tandem, mKate2, mNeptune and NirFP, etc.), near-infrared fluorescent proteins (TagRFP657, IFP1.4 and iRFP, etc.), proteins with long Stokes shifts (mKeima Red, LSS-mKate1, LSS-mKate2 and mBeRFP, photoactivatable proteins (such as PA-GFP, PAmCherry1 and PATagRFP), photoconvertible proteins (such as Kaede(green), Kaede(red), KikGR1(green), KikGR1(red), PS-CFP2, PS-CFP2, mEos2(green), mEos2(red), mEos3.2(green), mEos3.2(red), PSmOrange and PSmOrange), and light-switchable proteins (such as Dronpa).In some embodiments, the detectable tag can be selected from AmCyan, AsRed, DsRed2, DsRed Express, E2-Crimson, HcRed, ZsGreen, ZsYellow, mCherry, mStrawberry, mOrange, mBanana, mPlum, mRasberry, tdTomato, DsRed Monomer, and / or AcGFP, all of which are available from Clontech.

[0098] In some embodiments, the modified Tregs described herein further comprise an exogenous transgene encoding a safety switch system. A safety switch system (also referred to in the art as a suicide gene system) comprises an exogenous transgene encoding one or more proteins that allow the modified Tregs to be removed after administration to a subject. Examples of safety switch systems are known in the art. For example, a safety switch system comprises a gene encoding a protein that converts a non-toxic prodrug into a toxic compound, such as the herpes simplex thymidine kinase (Hsv-tk) and ganciclovir (GCV) system (Hsv-tk / GCV). Hsv-tk converts non-toxic GCV into a toxic compound that leads to cell apoptosis. Thus, administration of GCV to a subject treated with modified Tregs containing a transgene encoding the Hsv-tk protein can selectively remove the modified Tregs, while leaving endogenous Tregs unaffected. (See, e.g., Bonini et al., Science, 1997, 276(5319):1719-1724; Ciceri et al., Blood, 2007, 109(11):1828-1836; Bondanza et al., Blood 2006, 107(5):1828-1836).

[0099] Additional safety switch systems include genes encoding cell surface markers such that the modified Tregs can be removed via ADCC by administration of monoclonal antibodies specific for the cell surface marker. In some embodiments, the cell surface marker is CD20 and the modified Tregs can be removed by administration of anti-CD20 monoclonal antibodies such as rituximab (see, e.g., Introna et al., Hum Gene Ther, 2000, 11(4):611-620; Serafini et al., Hum Gene Ther, 2004, 14, 63-76; van Meerten et al., Gene Ther, 2006, 13, 789-797). A similar system using EGF-R and cetuximab or panitumumab is described in International PCT Publication No. WO2018006880. Additional safety switch systems include a transgene encoding a pro-apoptotic molecule that contains one or more binding sites for a chemical inducer of dimerization (CID), such that the engineered Tregs can be removed by administration of the CID, which induces oligomerization of the pro-apoptotic molecule and activation of the apoptotic pathway. In some embodiments, the pro-apoptotic molecule is Fas (also known as CD95) (Thomis et al., Blood, 2001, 97(5), 1249-1257). In some embodiments, the pro-apoptotic molecule is caspase-9 (Straathof et al., Blood, 2005, 105(11), 4247-4254).

[0100] In some embodiments, the modified Tregs described herein further comprise an exogenous transgene encoding a chimeric switch receptor. A chimeric switch receptor is an engineered cell surface receptor that includes an extracellular domain derived from an endogenous cell surface receptor and a heterologous intracellular signaling domain such that recognition of a ligand by the extracellular domain activates a signaling cascade that is distinct from that activated by the wild-type cell surface receptor. In some embodiments, the chimeric switch receptor includes an extracellular domain of an inhibitory cell surface receptor fused to an intracellular domain that transmits an activating signal rather than an inhibitory signal normally transmitted by the inhibitory cell surface receptor. In certain embodiments, an extracellular domain derived from a cell surface receptor known to inhibit Treg activation can be fused to an intracellular activation domain. Binding of the corresponding ligand then activates a signaling cascade that enhances, rather than inhibits, the activation of the Treg.

[0101] In some embodiments, the engineered Tregs described herein further comprise an engineered antigen-specific receptor that recognizes a protein target expressed by a target cell (herein referred to as an "engineered receptor-transduced cell" or "engineered RE cell"). The term "engineered antigen receptor" refers to a non-natural antigen-specific receptor, such as a chimeric antigen receptor (CAR) or a recombinant T cell receptor (TCR). In some embodiments, the engineered antigen receptor is a CAR that comprises an extracellular antigen-binding domain fused to a cytoplasmic domain that comprises a signaling domain via a hinge domain and a transmembrane domain. In some embodiments, the extracellular domain of the CAR binds to an antigen expressed by a target cell in an MHC-independent manner, activating and proliferating the RE cell. In some embodiments, the extracellular domain of the CAR recognizes a tag fused to an antibody or antigen-binding fragment thereof. In such embodiments, the antigen specificity of the CAR relies on the antigen specificity of the labeled antibody, such that a single CAR construct can be used to target multiple different antigens by replacing one antibody with another (see, e.g., U.S. Pat. Nos. 9,233,125 and 9,624,279, U.S. Patent Application Publication Nos. 20150238631 and 20180104354). In some embodiments, the extracellular domain of the CAR may comprise an antigen-binding fragment derived from an antibody. Antigen-binding domains useful in the present disclosure include, for example, scFvs, antibodies, antigen-binding regions of antibodies, heavy / light chain variable regions, and single chain antibodies.

[0102] In some embodiments, the intracellular signaling domain of the CAR may be derived from a TCR complex zeta chain domain (such as the CD3 zeta signaling domain), an FcγRIII domain, an FcεRI domain, or a T lymphocyte activation domain. In some embodiments, the intracellular signaling domain of the CAR further comprises a costimulatory domain, such as a 4-1BB domain, a CD28 domain, a CD40 domain, a MyD88 domain, or a CD70 domain. In some embodiments, the intracellular signaling domain of the CAR comprises two costimulatory domains, such as any two of the 4-1BB domain, the CD28 domain, the CD40 domain, the MyD88 domain, or the CD70 domain. Exemplary CAR structures and intracellular signaling domains are known in the art (see, e.g., WO2009 / 091826, US20130287748, WO2015 / 142675, WO2014 / 055657, and WO2015 / 090229, which are incorporated by reference herein).

[0103] CARs specific for antigens associated with autoimmune diseases (e.g., GVHD, colitis, and multiple sclerosis) are discussed, for example, in Zhang et al., Frontiers in Immunology 9:1-8(2018), International Publication No. WO2017218850A1, and McDonald et al., JCI 2016;126(4):1413-1424, each of which is incorporated herein by reference.

[0104] In some embodiments, the engineered antigen receptor is an engineered TCR. The engineered TCR comprises a TCR alpha and / or TCR beta chain isolated and cloned from a T cell population that recognizes a specific target antigen. For example, the TCR alpha and / or TCR beta genes (i.e., TRAC and TRBC) can be cloned from a T cell population isolated from an individual with a specific disease, or from a humanized mouse immunized with the cell type. The engineered TCR recognizes the antigen through the same mechanism as its endogenous counterpart (e.g., by recognizing its cognate antigen presented in the context of a major histocompatibility complex (MHC) protein expressed on the surface of the target cell). Binding to this antigen stimulates endogenous signaling pathways, which activate and proliferate the TCR engineered cell.

[0105] A. Immunosuppressive function In some embodiments, the modified Tregs described herein have one or more enhanced immunosuppressive functions, including generation, maintenance, and / or enhancement of immunosuppressive functions. In some embodiments, the modified Tregs described herein exhibit one or more of the following characteristics compared to unmodified Tregs: increased proliferation, increased or prolonged cell viability, improved stability, improved immunosuppressive function, or increased production of immunosuppressive immune factors (e.g., anti-inflammatory cytokines).

[0106] The Tregs described herein have improved cell proliferation compared to unmodified Tregs. In these embodiments, the result is that after a given period of time, there are an increased number of modified Tregs present compared to unmodified Tregs. For example, in some embodiments, the modified Tregs have an increased proliferation rate compared to unmodified Tregs, where the modified Tregs divide at a faster rate than unmodified Tregs. In some embodiments, the modified Tregs have a 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1.7 fold, 1.8 fold, 1.9 fold, 2 fold, 2.5 fold, 3 fold, 3.5 fold, 4 fold, 4.5 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold or more increased proliferation rate relative to unmodified Tregs. In some embodiments, the modified Tregs proliferate for a longer period of time relative to unmodified Tregs, where the modified and unmodified Tregs divide at the same rate but the modified Tregs remain proliferative for a longer period of time. In some embodiments, the engineered Tregs remain in a proliferative state for 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1.7 fold, 1.8 fold, 1.9 fold, 2 fold, 2.5 fold, 3 fold, 3.5 fold, 4 fold, 4.5 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold or more times longer than non-engineered immune cells.

[0107] In some embodiments, the modified Tregs described herein have improved or extended cell viability compared to unmodified Tregs. In such embodiments, the result is that after a period of time, the number of modified Tregs present is increased compared to unmodified Tregs. For example, in some embodiments, the modified Tregs described herein remain viable and remain viable for 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold or more times longer than unmodified immune cells.

[0108] In some embodiments, the modified Tregs described herein exhibit improved resistance to Treg exhaustion compared to unmodified Tregs. In some embodiments, improved resistance to T cell exhaustion is demonstrated by a 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2.0-fold, 2.5-fold, 3.0-fold, 3.5-fold, 4.0-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold or greater increase in cytokine production by the modified immune effector cells compared to cytokine production by a control immune cell population. In some embodiments, resistance to T cell exhaustion is demonstrated by improved proliferation of the modified immune effector cells compared to that observed in a control immune cell population. In some embodiments, improved resistance to T cell exhaustion is indicated by a 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1.7 fold, 1.8 fold, 1.9 fold, 2.0 fold, 2.5 fold, 3.0 fold, 3.5 fold, 4.0 fold, 4.5 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold or more increase in the proliferation of engineered immune effector cells compared to the proliferation of a control immune cell population.

[0109] In some embodiments, exhaustion of engineered Tregs compared to a control immune cell population is measured during the in vitro or ex vivo manufacturing process.

[0110] In some embodiments, the modified Tregs described herein have increased expression or production of anti-inflammatory immune factors compared to non-modified Tregs. Examples of anti-inflammatory or immunosuppressive immune factors include anti-inflammatory or immunosuppressive cytokines such as IL-10. In embodiments, the modified Tregs described herein have improved stability. In embodiments, stability can be assessed, for example, by measuring methylation of Foxp3 TSDR. In embodiments, the modified Tregs described herein have improved immunosuppressive function. In some embodiments, the modified Tregs described herein do not affect pro-inflammatory cytokines including IL-17A and IFNγ.

[0111] In some embodiments, expression of Foxp3 and / or Helios is increased in modified Tregs described herein compared to unmodified Tregs, in some embodiments, co-expression of Foxp3 and Helios is increased in modified Tregs described herein compared to unmodified Tregs.

[0112] Assays for measuring immunosuppressive function are known in the art. Expression of cell surface receptors can be determined by flow cytometry, immunohistochemistry, immunofluorescence, Western blot and / or qPCR. Expression and production of cytokines and chemokines can be measured by flow cytometry, immunohistochemistry, immunofluorescence, Western blot, ELISA and / or qPCR. Responsiveness or sensitivity to extracellular stimuli (e.g., cytokines, inhibitory ligands or antigens) can be measured by assaying cell proliferation and / or activation of downstream signaling pathways (e.g., phosphorylation of downstream signaling intermediates) in response to the stimuli.

[0113] B. Regulation of Endogenous Pathways and Genes In some embodiments, the modified Tregs described herein have reduced expression or function of one or more endogenous target genes. In some embodiments, the one or more endogenous target genes are in a pathway associated with enhanced immunosuppressive function. In such embodiments, the reduced expression or function of the one or more endogenous target genes enhances one or more immunosuppressive functions of the immune cells.

[0114] Exemplary pathways suitable for modulation by the methods described herein include, for example, Treg proliferation, Treg viability, Treg stability, and / or Treg immunosuppressive activity pathways. In some embodiments, the expression of endogenous target genes in a particular pathway is reduced in the modified Treg. In some embodiments, the expression of multiple (e.g., two or more) endogenous target genes in a particular pathway is reduced in the modified Treg. For example, the expression of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more endogenous target genes in a particular pathway may be reduced. In some embodiments, the expression of endogenous target genes in one pathway and endogenous target genes in another pathway is reduced in the modified Treg. In some embodiments, the expression of multiple endogenous target genes in one pathway and multiple endogenous target genes in another pathway is reduced in the modified Treg. For example, expression of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more endogenous target genes in one pathway may be reduced, and expression of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more endogenous target genes in another particular pathway may be reduced.

[0115] In some embodiments, the expression of multiple endogenous target genes in multiple pathways is reduced.For example, one endogenous gene from each of multiple pathways (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pathways) can be reduced.In additional aspects, the expression of multiple endogenous genes (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more genes) from each of multiple pathways (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pathways) can be reduced.

[0116] Exemplary endogenous target genes are shown in Table 1 below.

[0117] In some embodiments, the expression of TNFRSF4 is reduced. TNFRSF4 is also known as "tumor necrosis factor superfamily member 4", "ACT35 antigen", "TNFRSF4L receptor", "CD134", "OX40" and "TAX transcription activator glycoprotein 1 receptor". TNFRSF4 is a receptor for TNFSF4 (also known as OX40L and GP34). A soluble isoform of human TNFRSF4 has also been reported (Taylor L et al., (2001) J Immunol Methods 255:67-72).

[0118] In some embodiments, expression of PRDM1 is reduced. PRDM1 is also known as "PR domain zinc finger protein 1", "BLIMP1", "PRDI-BF1" and "beta-interferon gene positive regulatory domain I binding factor". PRDM1 is a transcription factor.

[0119] In some embodiments, the modified effector cells comprise reduced expression and / or function of one or more of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, or ADNP. In some embodiments, the modified Treg comprises reduced expression and / or function of a gene selected from Table 1. In some embodiments, the modified Treg comprises reduced expression and / or function of at least two genes selected from Table 1 (e.g., at least two genes selected from TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP). Exemplary methods for modifying expression of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP are described herein, although expression of these endogenous target genes can also be modified by methods known in the art.

[0120] In some embodiments, the engineered effector cell comprises reduced expression of TNFRSF4. In some embodiments, the engineered effector cell comprises reduced expression of PRDM1.

[0121] In some embodiments, the modified effector cells comprise reduced expression of TNFRSF4 and one or more of PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP. In some embodiments, the modified Tregs comprise reduced expression of a gene selected from Table 1 and reduced expression of TNFRSF4. In some embodiments, the modified effector cells comprise reduced expression of PRDM1 and one or more of TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP. In some embodiments, the modified Tregs comprise reduced expression of a gene selected from Table 1 and reduced expression of PRDM1. In some embodiments, the modified Tregs comprise reduced expression of TNFRSF4 and reduced expression of two genes selected from Table 1. In some embodiments, the modified Tregs comprise reduced expression of PRDM1 and reduced expression of two genes selected from Table 1. In some embodiments, the modified Tregs comprise reduced expression of a plurality of genes selected from Table 1 and reduced expression of TNFRSF4. In some embodiments, the modified Tregs comprise reduced expression of a plurality of genes selected from Table 1 and reduced expression of PRDM1. In some embodiments, the modified Tregs comprise reduced expression of two genes selected from Table 1 and reduced expression of TNFRSF4. In some embodiments, the modified Tregs comprise reduced expression of two genes selected from Table 1 and reduced expression of PRDM1. In some embodiments, the modified Tregs can comprise reduced expression of three or more of PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP, and reduced expression of TNFRSF4. In some embodiments, the modified Tregs can comprise reduced expression of three or more of TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP, and reduced expression of PRDM1.

[0122] In some embodiments, the expression of TNFRSF4 is reduced by the gene regulation system described herein. In some embodiments, the expression of PRDM1 is reduced by the gene regulation system described herein. [Table 1-1] [Table 1-2]

[0123] III. Gene Regulatory Systems As used herein, the term "gene regulatory system" refers to a protein, a nucleic acid, or a combination thereof that, when introduced into a cell, can regulate the expression or function of the encoded gene product by modifying the endogenous target DNA sequence. Many gene editing systems suitable for use in the methods of the present disclosure are known in the art, including, but not limited to, shRNA, siRNA, zinc finger nuclease system, TALEN system, and CRISPR / Cas system.

[0124] As used herein, when "modulate" is used in reference to the effect of a gene regulatory system on an endogenous target gene, "modulate" includes any change in the sequence of that endogenous target gene, any change in the epigenetic state of that endogenous target gene, and / or any change in the expression or function of a protein encoded by that endogenous target gene.

[0125] In some embodiments, the gene regulation system can mediate the sequence change of the endogenous target gene by introducing one or more mutations into the endogenous target sequence, for example, by inserting or deleting one or more nucleic acids in the endogenous target sequence.Exemplary mechanisms that can mediate the change of the endogenous target sequence include, but are not limited to, non-homologous end joining (NHEJ) (e.g., classical or alternative), microhomology-mediated end joining (MMEJ), homology-directed repair (e.g., endogenous donor template-mediated), SDSA (synthesis-dependent single-strand annealing), single-strand annealing or single-strand invasion.

[0126] In some embodiments, the gene regulatory system may mediate changes in the epigenetic state of the endogenous target sequence. For example, in some embodiments, the gene regulatory system may mediate covalent modifications of the DNA of the endogenous target gene (e.g., cytosine methylation and hydroxymethylation), or modifications of associated histone proteins (e.g., lysine acetylation, lysine and arginine methylation, serine and threonine phosphorylation, and lysine ubiquitination and sumoylation).

[0127] In some embodiments, the gene regulatory system may mediate the change in expression of the protein encoded by the endogenous target gene. In such embodiments, the gene regulatory system may regulate the expression of the encoded protein by modifying the endogenous target DNA sequence or by acting on the mRNA product encoded by the DNA sequence. In some embodiments, the gene regulatory system may express a modified endogenous protein. In such embodiments, the gene regulatory system mediates the modification of the endogenous DNA sequence to express an endogenous protein with reduced function compared to the corresponding endogenous protein in unmodified Treg. In such embodiments, the expression level of the modified endogenous protein may be increased or decreased compared to the expression level of the corresponding endogenous protein in unmodified immune cells, or may be the same or substantially the same as the expression level of the corresponding endogenous protein.

[0128] A. Nucleic Acid-Based Gene Regulation Systems As used herein, nucleic acid-based gene regulation system is a system that comprises one or more nucleic acid molecules that can regulate the expression of endogenous target genes without the need for exogenous protein.In some embodiments, the nucleic acid-based gene regulation system comprises the RNA interference molecule or antisense RNA molecule that is complementary to the target nucleic acid sequence.

[0129] "Antisense RNA molecule" refers to an RNA molecule, regardless of length, that is complementary to an mRNA transcript.Antisense RNA molecule refers to a single-stranded RNA molecule that can be introduced into a cell, tissue, or subject to reduce the expression of an endogenous target gene product through a mechanism that does not rely on endogenous gene silencing pathways, but relies on RNaseH-mediated degradation of the target mRNA transcript.In some embodiments, the antisense nucleic acid may contain modified backbones, such as phosphorothioates, phosphorodithioates, or other backbones known in the art, or may contain non-natural internucleoside linkages.In some embodiments, the antisense nucleic acid may contain locked nucleic acids (LNAs).

[0130] "RNA interference molecule," as used herein, refers to an RNA polynucleotide that mediates the reduction of expression of an endogenous target gene product by degrading the target mRNA through the endogenous gene silencing pathway (e.g., Dicer and RNA-induced silencing complex (RISC)). Exemplary RNA interference agents include microRNAs (also referred to herein as "miRNAs"), short hairpin RNAs (shRNAs), small interfering RNAs (siRNAs), RNA aptamers, and morpholinos.

[0131] In some embodiments, the nucleic acid-based gene regulation system of the present invention comprises one or more miRNAs. miRNA refers to a naturally occurring, small, non-coding RNA molecule that is approximately 21-25 nucleotides in length. miRNAs are at least partially complementary to one or more target mRNA molecules. miRNAs can downregulate (e.g., reduce) expression of endogenous target gene products through translational repression, mRNA cleavage and / or deadenylation.

[0132] In some embodiments, the nucleic acid-based gene regulation system of the present invention comprises one or more shRNAs. shRNAs are single-stranded RNA molecules of about 50-70 nucleotides in length that form a stem-loop structure and degrade complementary mRNA sequences. shRNAs can be cloned into plasmids or non-replicating recombinant viral vectors that are introduced into cells so that the shRNA coding sequence is integrated into the genome. Thus, shRNAs can stably and steadily suppress the translation and expression of endogenous target genes.

[0133] In some embodiments, the nucleic acid-based gene regulation system includes one or more siRNAs. siRNA refers to a double-stranded RNA molecule, typically about 21-23 nucleotides in length. siRNAs associate with a multiprotein complex, the RNA-induced silencing complex (RISC), during which the "passenger" sense strand is enzymatically cleaved. The antisense "guide" strand contained in the activated RISC then guides the RISC to the corresponding mRNA by sequence homology, where the same nuclease cleaves the target mRNA, resulting in specific gene silencing. Optimally, the siRNA is 18, 19, 20, 21, 22, 23, or 24 nucleotides in length and has a 2-base overhang at its 3' end. siRNAs can be introduced into individual cells and / or cultures to degrade the target mRNA sequence. siRNAs and shRNAs are further described in Fire et al., Nature, 391:19, 1998, and in U.S. Patent Nos. 7,732,417, 8,202,846, and 8,383,599.

[0134] In some embodiments, the nucleic acid-based gene regulation system of the present invention comprises one or more morpholinos. "Morpholino" as used herein refers to a modified nucleic acid oligomer in which a standard nucleobase is bound to a morpholine ring and linked through phosphorodiamidate bonds. Similar to siRNA and shRNA, morpholinos bind to complementary mRNA sequences. However, morpholinos do not target complementary mRNA sequences for degradation, but rather function through sterically inhibiting mRNA translation and altering mRNA splicing.

[0135] In some embodiments, the nucleic acid-based gene regulatory system of the present invention comprises a nucleic acid molecule (e.g., siRNA, shRNA, RNA aptamer, or morpholino) that binds to a target RNA sequence that is at least 90% identical to the RNA encoded by the DNA sequence of a target gene selected from the genes listed in Table 1. In some embodiments, the nucleic acid-based gene regulatory system comprises a nucleic acid molecule (e.g., siRNA, shRNA, RNA aptamer, or morpholino) that binds to a target RNA sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the RNA encoded by the DNA sequence of a target gene selected from the genes listed in Table 1. In some embodiments, the nucleic acid-based gene regulatory system comprises a nucleic acid molecule (e.g., siRNA, shRNA, RNA aptamer, or morpholino) that binds to a target RNA sequence that is 100% identical to the RNA encoded by the DNA sequence of a target gene selected from the genes listed in Table 1.

[0136] In some embodiments, the nucleic acid-based gene regulation system of the present invention comprises an siRNA or shRNA molecule selected from siRNA or shRNA molecules known in the art, such as siRNA and shRNA constructs available from commercial vendors such as Sigma Aldrich, Dharmacon, ThermoFisher, etc.

[0137] In some embodiments, the gene regulation system of the present invention comprises two or more nucleic acid molecules (e.g., two or more siRNAs, two or more shRNAs, two or more RNA aptamers, or two or more morpholinos), where at least one of the nucleic acid molecules binds to a target RNA sequence that is at least 90% identical to an RNA sequence encoded by a DNA sequence of a target gene selected from Table 1. In some embodiments, the gene regulation system comprises two or more nucleic acid molecules (e.g., two or more siRNAs, two or more shRNAs, two or more RNA aptamers, or two or more morpholinos), where at least one of the nucleic acid molecules binds to a target RNA sequence that is at least 95%, 96%, 97%, 98% or 99% identical to an RNA sequence encoded by a DNA sequence of a target gene selected from Table 1. In some embodiments, the gene regulation system comprises two or more nucleic acid molecules (e.g., two or more siRNAs, two or more shRNAs, two or more RNA aptamers, or two or more morpholinos), where at least one of the nucleic acid molecules binds to a target RNA sequence that is 100% identical to an RNA sequence encoded by a DNA sequence of a target gene selected from Table 1.

[0138] B. Protein-Based Gene Regulation Systems In some embodiments, the protein-based gene regulation system is a system that includes one or more proteins that can regulate the expression of endogenous target genes in a sequence-specific manner without the need for a nucleic acid guide molecule. In some embodiments, the protein-based gene regulation system includes a protein that includes one or more zinc finger binding domains and an enzyme domain. In some embodiments, the protein-based gene regulation system includes a protein that includes a transcription activator-like effector nuclease (TALEN) domain and an enzyme domain. Such embodiments are referred to herein as "TALENs."

[0139] 1. Zinc Finger System Zinc finger-based systems include fusion proteins that contain two protein domains: a zinc finger DNA binding domain and an enzymatic domain. A "zinc finger DNA binding domain," "zinc finger protein," or "ZFP" is a protein or a domain within a larger protein that binds to DNA in a sequence-specific manner through one or more zinc fingers, and is a region of amino acid sequence within the binding domain that is structurally stabilized through coordination with a zinc ion. By binding to a target DNA sequence, the zinc finger domain induces the activity of an enzymatic domain in the vicinity of the sequence, thereby inducing modification of an endogenous target gene in the vicinity of the target sequence. Zinc finger domains can be engineered to bind to virtually any desired sequence. Thus, after identifying a target locus (e.g., a target locus within a target gene referred to in Table 1) that contains a target DNA sequence to be cleaved or recombined, one or more zinc finger binding domains can be engineered to bind to one or more target DNA sequences within the target locus. A fusion protein containing the zinc finger binding domain and the enzyme domain is expressed in a cell to effect modification at the target locus.

[0140] In some embodiments, a zinc finger binding domain comprises one or more zinc fingers. Miller et al. (1985) EMBO J. 4:1609-1614, Rhodes (1993) Scientific American February:56-65, U.S. Patent No. 6,453,242. Typically, a single zinc finger domain is about 30 amino acids long. Each zinc finger binds to a three nucleotide (i.e. triplet) sequence (or a four nucleotide sequence that may overlap by one nucleotide with the four nucleotide binding sites of adjacent zinc fingers). Thus, the length of the sequence (e.g., target sequence) to which the zinc finger binding domain is engineered to bind will determine the number of zinc fingers in the engineered zinc finger binding domain. For example, in the case of a ZFP whose finger motif does not bind to overlapping subsites, a six nucleotide target sequence will be bound by two finger binding domains, a nine nucleotide target sequence will be bound by three binding domains, and so on. The binding sites (i.e., subsites) of individual zinc fingers at a target site do not have to be contiguous and can be separated by one or a few nucleotides, depending on the length and nature of the amino acid sequences between the zinc fingers (i.e., the linkers between the fingers) in the multi-finger binding domain. In some embodiments, the DNA binding domain of an individual ZFN contains 3-6 individual zinc finger repeats, each capable of recognizing 9-18 base pairs.

[0141] Zinc finger binding domains can be engineered to bind to a given sequence. See, for example, Beerli et al. (2002) Nature Biotechnol. 20:135-141, Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340, Isalan et al. (2001) Nature Biotechnol. 19:656-660, Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637, Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416. Engineered zinc finger binding domains can have novel binding specificities compared to naturally occurring zinc finger proteins. Engineering methods include, but are not limited to, rational design and various types of selection.

[0142] Selection of target DNA sequences for binding by zinc finger domains can be performed, for example, according to the method disclosed in U.S. Pat. No. 6,453,242. It will be clear to those skilled in the art that simple visual inspection of nucleotide sequences can also be used to select target DNA sequences. Thus, any means for selecting target DNA sequences can be used in the methods described herein. Target sites are generally at least 9 nucleotides in length, and thus bind to zinc finger binding domains that contain at least three zinc fingers. However, for example, binding of a four-finger binding domain to a 12-nucleotide target site, binding of a five-finger binding domain to a 15-nucleotide target site, or binding of a six-finger binding domain to a 18-nucleotide target site is also possible. Obviously, binding of larger binding domains (e.g., 7, 8, 9 or more fingers) to longer target sites is also possible.

[0143] In some embodiments, the zinc finger binding domain binds to a target DNA sequence that is at least 90% identical to a target DNA sequence of a target gene selected from the genes listed in Table 1. In some embodiments, the zinc finger binding domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98% or 99% identical to a target DNA sequence of a target gene selected from the genes listed in Table 1. In some embodiments, the zinc finger binding domain binds to a target DNA sequence that is 100% identical to a target DNA sequence of a target gene selected from the genes listed in Table 1. In some embodiments, the zinc finger system is selected from zinc finger systems known in the art, such as zinc finger systems available from commercial vendors such as Sigma Aldrich.

[0144] In some embodiments, the gene regulation system comprises two or more ZFP fusion proteins each comprising a zinc finger binding domain, at least one of which binds to a target DNA sequence that is at least 90% identical to a target DNA sequence of a target gene selected from Table 1. In some embodiments, the gene regulation system comprises two or more ZFP fusion proteins each comprising a zinc finger binding domain, at least one of which binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a target DNA sequence of a target gene selected from Table 1. In some embodiments, the gene regulation system comprises two or more ZFP fusion proteins each comprising a zinc finger binding domain, at least one of which binds to a target DNA sequence that is 100% identical to a target DNA sequence of a target gene selected from Table 1.

[0145] The enzyme domain portion of the zinc finger fusion protein can be derived from any endonuclease or exonuclease. Exemplary endonucleases from which the enzyme domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, e.g., 2002-2003 Catalogue, New England Biolabs, Beverly, Mass. and Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes that cleave DNA are known (e.g., 51 nuclease, mung bean nuclease, pancreatic DNase I, micrococcal nuclease, yeast HO endonuclease; see also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or functional fragments thereof) can be used as the source of the cleavage domain.

[0146] Exemplary restriction endonucleases (restriction enzymes) suitable for use as the enzymatic domain of the ZFPs described herein exist in many species and can bind sequence-specifically to DNA (at a recognition site) and cleave the DNA at or near the binding site. Certain restriction enzymes (e.g., type IIS) cleave DNA at a site distant from the recognition site and have binding and cleavage domains that can be separated. For example, the type IIS enzyme FokI catalyzes double-stranded cleavage of DNA at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other strand. See, e.g., U.S. Patent Nos. 5,356,802, 5,436,150, and 5,487,994, as well as Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279, Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768, Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887, Kim et al. (1994b) J. Biol. Chem. 269:31,978-31,982. Thus, in one embodiment, the fusion protein comprises an enzyme domain derived from at least one type IIS restriction enzyme and one or more zinc finger binding domains.

[0147] An exemplary type IIS restriction enzyme in which the cleavage domain can be separate from the binding domain is FokI. This particular enzyme is active as a dimer. Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95:10,570-10,575. Thus, to perform targeted cleavage of double-stranded DNA using a zinc finger-FokI fusion, two fusion proteins each containing a FokI enzymatic domain can be used to reconstitute a catalytically active cleavage domain. Alternatively, a single polypeptide molecule containing a zinc finger binding domain and two FokI enzymatic domains can be used. Exemplary ZFPs containing a FokI enzymatic domain are described in U.S. Pat. No. 9,782,437.

[0148] 2.TALEN System TALEN-based system comprises a protein that comprises a TAL effector DNA binding domain and an enzyme domain. This system is created by fusing the TAL effector DNA binding domain to a DNA cleavage domain (a nuclease that cleaves DNA strands). The above-mentioned FokI restriction enzyme is an exemplary enzyme domain that is suitable for use in TALEN-based gene regulation system.

[0149] TAL effectors are proteins secreted by Xanthomonas bacteria via their type III secretion system when they infect plants. The DNA binding domains described above contain a highly conserved repeat sequence of 33-34 amino acids, but differ at the 12th and 13th amino acids. These two positions, called repeat variable diresidues (RVDs), are highly variable and closely correlate with specific nucleotide recognition. Thus, by selecting a combination of repeat segments containing appropriate RVDs, the TAL effector domains can be engineered to bind to specific target DNA sequences. The nucleic acid specificities of the RVD combinations are as follows: HD targets cytosine, NI targets adenine, NG targets thymine, and NN targets guanine (although in some embodiments, NN can also bind adenine with less specificity than guanine).

[0150] In some embodiments, the TAL effector domain binds to a target DNA sequence that is at least 90% identical to the DNA sequence of a target gene selected from the genes listed in Table 1. In some embodiments, the TAL effector domain binds to a target DNA sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the DNA sequence of a target gene selected from the genes listed in Table 1. In some embodiments, the TAL effector domain binds to a target DNA sequence that is 100% identical to the DNA sequence of a target gene selected from the genes listed in Table 1.

[0151] In some embodiments, the gene regulation system of the present invention comprises two or more TAL effector fusion proteins each comprising a TAL effector domain, at least one of which binds to a target DNA sequence that is at least 90% identical to a target DNA sequence of a target gene selected from Table 1. In some embodiments, the gene regulation system of the present invention comprises two or more TAL effector fusion proteins each comprising a TAL effector domain, at least one of which binds to a target DNA sequence that is at least 95%, 96%, 97%, 98% or 99% identical to a target DNA sequence of a target gene selected from Table 1. In some embodiments, the gene regulation system of the present invention comprises two or more TAL effector fusion proteins each comprising a TAL effector domain, at least one of which binds to a target DNA sequence that is at least 100% identical to a target DNA sequence of a target gene selected from Table 1.

[0152] Methods and compositions for assembling TAL effector repeats are known in the art. See, for example, Cermak et al, Nucleic Acids Research, 39:12, 2011, e82. Plasmids for constructing TAL effector repeats are commercially available from Addgene.

[0153] C. Nucleic acid / protein complex-based gene regulation systems The hybrid gene regulation system includes a site-specific modifying polypeptide and a nucleic acid guide molecule. As used herein, a "site-specific modifying polypeptide" refers to a polypeptide that binds to a nucleic acid guide molecule, is guided to a target nucleic acid sequence (e.g., an endogenous target DNA sequence or an endogenous target RNA sequence) by the nucleic acid guide molecule, and modifies the target nucleic acid sequence (e.g., by cleavage, mutation, or methylation of the target nucleic acid sequence).

[0154] A site-specific modification polypeptide comprises two portions: a portion that binds to a nucleic acid guide and an active portion. In some embodiments, a site-specific modification polypeptide comprises an active portion that exhibits a site-specific enzymatic activity (e.g., DNA methylation, DNA or RNA cleavage, histone acetylation, histone methylation, etc.), and the site of the enzymatic activity is determined by the guide nucleic acid. In some cases, a site-specific modification polypeptide comprises an active portion that has an enzymatic activity that modifies an endogenous target nucleic acid sequence (e.g., nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, or glycosylase activity). In another case, the site-specific modifying polypeptide comprises an active portion having an enzymatic activity (e.g., methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitination activity, adenylation activity, deadenylation activity, sumoylation activity, desumoylation activity, ribosylation activity, deribosylation activity, myristoylation activity or demyristoylation activity) that modifies a polypeptide (e.g., histone) associated with an endogenous target nucleic acid sequence. In some embodiments, the site-specific modifying polypeptide comprises an active portion that modulates the transcription (e.g., increases or decreases transcription) of a target DNA sequence. In some embodiments, the site-specific modifying polypeptide comprises an active portion that modulates the expression or translation (e.g., increases or decreases transcription) of a target RNA sequence.

[0155] The nucleic acid guide comprises two portions: a first portion (herein referred to as the "nucleic acid binding segment") that is complementary to and capable of binding to an endogenous target nucleic acid sequence, and a second portion (herein referred to as the "protein binding segment") that is capable of interacting with a site-directed modifying polypeptide. In some embodiments, the nucleic acid binding segment and the protein binding segment of the nucleic acid guide are comprised within a single polynucleotide molecule. In some embodiments, the nucleic acid binding segment and the protein binding segment of the nucleic acid guide are each comprised within a separate polynucleotide molecule, such that the nucleic acid guide comprises two polynucleotide molecules that associate together to form a functional guide.

[0156] The nucleic acid guide mediates the target specificity of the protein / nucleic acid hybrid gene regulatory system by specifically hybridizing with the target nucleic acid sequence. In some embodiments, the target nucleic acid sequence is an RNA sequence, such as an RNA sequence contained within an mRNA transcript of the target gene. In some embodiments, the target nucleic acid sequence is a DNA sequence contained within the DNA sequence of the target gene. When referring to a target gene herein, it includes the full-length DNA sequence of the particular gene, including multiple target loci (i.e., a portion (e.g., exon or intron) of the particular target gene sequence). Within each target locus is a shorter region of DNA sequence (referred to herein as a "target DNA sequence") that can be modified by the gene regulatory system described herein. Additionally, each target locus includes a "target modification site," which refers to the precise location of the modification induced by the gene regulatory system (e.g., the location of an insertion, deletion or mutation, the location of a DNA break, or the location of an epigenetic modification).

[0157] The gene regulatory systems described herein may include a single nucleic acid guide or may include multiple nucleic acid guides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acid guides).

[0158] In some embodiments, the protein / nucleic acid hybrid gene regulatory system comprises a site-specific modifying polypeptide derived from an Argonaute (Ago) protein (e.g., T. thermophiles Ago, or TtAgo). In such embodiments, the site-specific modifying polypeptide is a T. thermophiles Ago DNA endonuclease and the nucleic acid guide is a guide DNA (gDNA) (see Swarts et al., Nature 507 (2014), 258-261). In some embodiments, the disclosure provides a polynucleotide encoding a gDNA. In some embodiments, the nucleic acid encoding a gDNA is included in an expression vector, e.g., a recombinant expression vector. In some embodiments, the disclosure provides a polynucleotide encoding a site-specific modifying polypeptide, TtAgo, or a variant thereof. In some embodiments, the polynucleotide encoding a site-specific modifying polypeptide, TtAgo, is included in an expression vector, e.g., a recombinant expression vector.

[0159] In some embodiments, the gene editing system described herein is a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated) nuclease system. In some embodiments, the CRISPR / Cas system is a class 2 system. Class 2 CRISPR / Cas systems are classified into three types: type II systems, type V systems, and type VI systems. In some embodiments, the CRISPR / Cas system is a class 2 type II system that uses a Cas9 protein. In such embodiments, the site-directed modifying polypeptide is Cas9 (or a variant thereof), a DNA endonuclease, and the nucleic acid guide molecule is a guide RNA (gRNA). In some embodiments, the CRISPR / Cas system is a class 2 type V system that uses a Cas12 protein (e.g., Cas12a (also known as Cpf1), Cas12b (also known as C2c1), Cas12c (also known as C2c3), Cas12d (also known as CasY), and Cas12e (also known as CasX)). In such embodiments, the site-specific modifying polypeptide is Cas12 (or a variant thereof), a DNA endonuclease, and the nucleic acid guide molecule is a gRNA. In some embodiments, the CRISPR / Cas system is a Class 2 Type VI system that uses Cas13 proteins (e.g., Cas13a (also known as C2c2), Cas13b, and Cas13c). (See Pyzocha et al., ACS Chemical Biology, 13(2), 347-356.) In such embodiments, the site-specific modifying polypeptide is Cas13, an RNA riboendonuclease, and the nucleic acid guide molecule is a gRNA.

[0160] A Cas polypeptide refers to a polypeptide that can interact with a gRNA molecule and be directed or localized to a target DNA or RNA sequence in response to the gRNA molecule. Cas polypeptides include naturally occurring Cas proteins and engineered, altered or otherwise modified Cas proteins that differ from the naturally occurring Cas sequence by one or more amino acid residues.

[0161] A guide RNA (gRNA) comprises two segments: a DNA-binding segment and a protein-binding segment. In some embodiments, the protein-binding segment of a gRNA is contained in one RNA molecule and the DNA-binding segment is contained in another, different RNA molecule. Such embodiments are referred to herein as "double-molecule gRNA," "bi-molecule gRNA," or "dual gRNA." In some embodiments, the gRNA is a single RNA molecule, referred to herein as "single guide RNA" or "sgRNA." The term "guide RNA" or "gRNA" is a generic term and refers to both bi-molecule guide RNAs and sgRNAs.

[0162] The protein-binding segment of the gRNA contains, in part, two complementary nucleotide regions that hybridize to form a double-stranded RNA (dsRNA) that facilitates binding to the Cas protein. The nucleic acid-binding segment of the gRNA (or "nucleic acid-binding sequence") contains a nucleotide sequence that is complementary to and capable of binding to a specific target nucleic acid sequence. The protein-binding segment of the gRNA interacts with a Cas polypeptide, and the interaction of the gRNA molecule with the site-directed modification polypeptide results in binding of Cas to an endogenous nucleic acid sequence and one or more modifications are made in or around the target nucleic acid sequence. The exact location of the target modification site is determined by both (i) the base-pairing complementarity between the gRNA and the target nucleic acid sequence, and (ii) the location of a short motif, called a protospacer adjacent motif (PAM), in the target DNA sequence (referred to as a protospacer adjacent sequence (PFS) in the target RNA sequence). The PAM / PFS sequence is required for Cas to bind to the target nucleic acid sequence. A variety of PAM / PFS sequences are known in the art and are suitable for use with certain Cas endonucleases, such as Cas9 endonucleases (see, e.g., Nat Methods. 2013 Nov; 10(11): 1116-1121 and Sci Rep. 2014; 4: 5405). In some embodiments, the PAM sequence is located within 50 base pairs of the target modification site in the target DNA sequence. In some embodiments, the PAM sequence is located within 10 base pairs of the target modification site in the target DNA sequence. The DNA sequences that can be targeted by the methods of the invention are limited only by the relative distance between the PAM sequence and the target modification site, and the presence of a unique 20 base pair sequence to mediate sequence-specific and gRNA-mediated Cas binding. In some embodiments, the PFS sequence is located at the 3' end of the target RNA sequence. In some embodiments, the target modification site is located at the 5' end of the target locus. In some embodiments, the target modification site is located at the 3' end of the target locus. In some embodiments, the target modification site is located within an intron or exon of the target locus.

[0163] In some embodiments, the disclosure provides a polynucleotide encoding a gRNA. In some embodiments, the nucleic acid encoding the gRNA is included in an expression vector, e.g., a recombinant expression vector. In some embodiments, the disclosure provides a polynucleotide encoding a site-directed modified polypeptide. In some embodiments, the polynucleotide encoding the site-directed modified polypeptide is included in an expression vector, e.g., a recombinant expression vector.

[0164] 1. Cas proteins In some embodiments, the site-directed modifying polypeptide is a Cas protein. Any Cas protein can be used, including those provided herein. Cas molecules from a variety of species can be used in the methods and compositions described herein, including those from S. pyogenes, S. aureus, N. meningitidis, S. thermophiles, Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., Cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhizobium sp., Brevibacillus laterospoxus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, Gammaproteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputomm, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria meningitidis, Neisseria sp., Neisseria wadsworthii、Nitrosomonas sp.、Parvibaculum lavamentivorans、Pasteurella multocida、Phascolarctobacterium succinatutens、Ralstonia syzygii、Rhodopseudomonas palustris、Rhodovulum sp.、Simonsiella muelleri、Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus aureus, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tistrella mobilis, Treponema sp. or Verminephrobacter eiseniae.

[0165] In some embodiments, the Cas protein is a naturally occurring Cas protein. In some embodiments, the Cas endonuclease is C2C1, C2C3, Cpf1 (also known as Cas12a), Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas1 0, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3 and Csf4.

[0166] In some embodiments, the Cas protein is an endoribonuclease, such as a Cas13 protein. In some embodiments, the Cas13 protein is a Cas13a protein (Abudayyeh et al., Nature 550 (2017), 280-284), a Cas13b protein (Cox et al., Science (2017) 358:6336, 1019-1027), a Cas13c protein (Cox et al., Science (2017) 358:6336, 1019-1027), or a Cas13d protein (Zhang et al., Cell 175 (2018), 212-223).

[0167] In some embodiments, the Cas9 protein is any Cas9 protein, including any Cas9 protein specifically provided herein. In some embodiments, the Cas protein is a wild-type or naturally occurring Cas9 protein or a Cas9 ortholog. Wild-type Cas9 is a multi-domain enzyme that uses an HNH nuclease domain to cleave the target strand of DNA and a RuvC-like domain to cleave the non-target strand. Based on the specificity of the gRNA, when wild-type Cas9 binds to DNA, double-stranded DNA is broken, and the break can be repaired by non-homologous end joining (NHEJ) or homology-directed repair (HDR). Exemplary naturally occurring Cas9 molecules are described in Chylinski et al., RNA Biology 2013 10:5,727-737, and additional Cas9 orthologs are described in International PCT Publication No. WO2015 / 071474. Such Cas9 molecules include cluster 1 bacterial family, cluster 2 bacterial family, cluster 3 bacterial family, cluster 4 bacterial family, cluster 5 bacterial family, cluster 6 bacterial family, cluster 7 bacterial family, cluster 8 bacterial family, cluster 9 bacterial family, cluster 10 bacterial family, cluster 11 bacterial family, cluster 12 bacterial family, cluster 13 bacterial family, cluster 14 bacterial family, cluster 15 bacterial family, cluster 16 bacterial family, cluster 17 bacterial family, cluster 18 bacterial family, cluster 19 bacterial family, cluster 20 bacterial family, cluster 21 bacterial family, cluster 22 bacterial family, cluster 23 bacterial family, cluster 24 bacterial family, cluster 25 bacterial family, cluster 26 bacterial family, cluster 27 bacterial family, cluster 28 bacterial family, cluster 29 bacterial family, cluster 30 bacterial family, cluster 31 bacterial family, cluster 32 bacterial family, cluster 33 bacterial family, cluster 34 bacterial family, cluster 35 bacterial family, cluster 36 bacterial family, cluster 37 bacterial family, cluster 38 bacterial family,Cluster 39 Bacterial Family, Cluster 40 Bacterial Family, Cluster 41 Bacterial Family, Cluster 42 Bacterial Family, Cluster 43 Bacterial Family, Cluster 44 Bacterial Family, Cluster 45 Bacterial Family, Cluster 46 Bacterial Family, Cluster 47 Bacterial Family, Cluster 48 Bacterial Family, Cluster 49 Bacterial Family, Cluster 50 Bacterial Family, Cluster 51 Bacterial Family, Cluster 52 Bacterial Family, Cluster 53 Bacterial Family, Cluster 54 Bacterial Family, Cluster 55 Bacterial Family, Cluster 56 Bacterial Family, Cluster 57 Bacterial Family, Cluster 58 Bacterial Family, Cluster 59 The Cas9 molecule may be from a bacterial family, a cluster 60 bacterial family, a cluster 61 bacterial family, a cluster 62 bacterial family, a cluster 63 bacterial family, a cluster 64 bacterial family, a cluster 65 bacterial family, a cluster 66 bacterial family, a cluster 67 bacterial family, a cluster 68 bacterial family, a cluster 69 bacterial family, a cluster 70 bacterial family, a cluster 71 bacterial family, a cluster 72 bacterial family, a cluster 73 bacterial family, a cluster 74 bacterial family, a cluster 75 bacterial family, a cluster 76 bacterial family, a cluster 77 bacterial family, or a cluster 78 bacterial family.

[0168] In some embodiments, the native Cas9 polypeptide is selected from the group consisting of SpCas9, SpCas9-HF1, SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, SaCas9, FnCpf, FnCas9, eSpCas9, and NmeCas9. In some embodiments, the Cas9 protein comprises an amino acid sequence that has at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the Cas9 amino acid sequence set forth in Chylinski et al., RNA Biology 2013 10:5,727-737; Hou et al., PNAS Early Edition 2013,1-6.

[0169] In some embodiments, the Cas polypeptide comprises: (a) nickase activity, i.e., the ability to cleave a single strand, e.g., a non-complementary or complementary strand, of a nucleic acid molecule; (b) double-stranded nuclease activity, i.e., the ability to cleave both strands of a double-stranded nucleic acid and generate a double-stranded break (in one embodiment, the presence of two nickase activities); (c) endonuclease activity, (d) exonuclease activity and / or (e) helicase activity, i.e., the ability to unwind the helical structure of double-stranded nucleic acids; The present invention includes one or more of the following activities:

[0170] In some embodiments, the Cas polypeptide is fused to a heterologous protein that recruits a DNA damage signaling protein, an exonuclease, or a phosphatase to further improve the likelihood or rate of repair of the target sequence by various repair mechanisms. In some embodiments, wild-type Cas polypeptides are co-expressed with a nucleic acid repair template to facilitate the introduction of exogenous nucleic acid sequences by homology-directed repair.

[0171] In some embodiments, different Cas proteins (i.e., Cas9 proteins from different species) may be beneficial for use in the various methods provided in order to exploit different enzymatic properties of different Cas proteins (e.g., for different PAM sequence preferences, increased or decreased enzymatic activity, increased or decreased levels of cytotoxicity, altered balance of NHEJ, homology-directed repair, single-strand breaks, double-strand breaks, etc.).

[0172] In some embodiments, the Cas protein is a Cas9 protein from S. pyogenes that recognizes the PAM motifs NGG, NAG, NGA (Mali et al, Science 2013;339(6121):823-826). In some embodiments, the Cas protein is a Cas9 protein from S. thermophiles that recognizes the PAM motifs NGGNG and / or NNAGAAW (W=A or T) (see, e.g., Horvath et al, Science, 2010;327(5962):167-170 and Deveau et al, J Bacteriol 2008;190(4):1390-1400). In some embodiments, the Cas protein is a Cas9 protein from S. mutans that recognizes the PAM sequence motifs NGG and / or NAAR (R=A or G) (see, e.g., Deveau et al, J BACTERIOL 2008;190(4):1390-1400). In some embodiments, the Cas protein is a Cas9 protein from S. aureus that recognizes the PAM sequence motif NNGRR (R=A or G). In some embodiments, the Cas protein is a Cas9 protein from S. aureus that recognizes the PAM sequence motif NGRRT (R=A or G). In some embodiments, the Cas protein is a Cas9 protein from S. aureus that recognizes the PAM sequence motif NGRRV (R=A or G). In some embodiments, the Cas protein is the Cas9 protein from N. meningitidis, which recognizes the PAM sequence motif NGATT or NGCTT (R=A or G, V=A, G or C) (see, e.g., Hou et al., PNAS 2013, 1-6). In the above embodiments, N can be any nucleotide residue, e.g., A, G, C or T.In some embodiments, the Cas protein is a Cas13a protein from Leptotrichia shahii, which recognizes a single 3' A, U or C PFS sequence motif.

[0173] In some embodiments, a polynucleotide is provided that encodes a Cas protein. In some embodiments, the polynucleotide encodes a Cas protein that is at least 90% identical to a Cas protein described in International PCT Publication No. WO2015 / 071474 or Chylinski et al., RNA Biology 2013 10:5,727-737. In some embodiments, the polynucleotide encodes a Cas protein that is at least 95%, 96%, 97%, 98% or 99% identical to a Cas protein described in International PCT Publication No. WO2015 / 071474 or Chylinski et al., RNA Biology 2013 10:5,727-737. In some embodiments, the polynucleotide encodes a Cas protein that is 100% identical to a Cas protein described in International PCT Publication No. WO2015 / 071474 or Chylinski, RNA Biology 2013 10:5,727-737.

[0174] 2.Cas mutants In some embodiments, the Cas polypeptide is engineered to modify one or more properties of the Cas polypeptide. For example, in some embodiments, the Cas polypeptide has modified enzymatic properties, such as modified nuclease activity or modified helicase activity (compared to a naturally occurring or other reference Cas molecule). In some embodiments, the engineered Cas polypeptide can have a modification that modifies its size, such as a deletion of an amino acid sequence that reduces its size without significantly affecting another property of the Cas polypeptide. In some embodiments, the engineered Cas polypeptide includes a modification that affects PAM recognition. For example, the engineered Cas polypeptide can be modified to recognize a PAM sequence other than the PAM sequence recognized by the corresponding wild-type Cas protein.

[0175] Cas polypeptides with desired properties can be generated in several ways, including modifying a naturally occurring or parent Cas polypeptide to obtain a mutant or modified Cas polypeptide with desired properties. For example, one or more mutations can be introduced into the sequence of a parent Cas polypeptide (e.g., a naturally occurring or engineered Cas polypeptide). Such mutations and differences can include substitutions (e.g., conservative substitutions or substitutions of non-essential amino acids), insertions or deletions. In some embodiments, a mutant Cas polypeptide contains one or more mutations (e.g., at least 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, or 50 mutations) relative to the parent Cas polypeptide.

[0176] In one embodiment, the mutant Cas polypeptide comprises a cleavage characteristic different from that of a native Cas polypeptide. In some embodiments, the Cas is an inactive Cas (dCas) mutant. In such embodiments, the Cas polypeptide does not comprise any endogenous enzymatic activity and cannot mediate target nucleic acid cleavage. In such embodiments, the dCas may be fused to a heterologous protein that can modify the target nucleic acid in a non-cleavage-based manner. For example, in some embodiments, the dCas protein is fused to a transcription activator or transcription repressor domain (e.g., Kruppel-associated box (KRAB or SKD), Mad mSIN3-interacting domain (SID or SID4X), ERF repression domain (ERD), MAX-interacting protein 1 (MXI1), methyl-CpG-binding protein 2 (MECP2), etc.). In some such cases, the dCas fusion protein is guided by the gRNA to a predetermined location (i.e., sequence) in the target nucleic acid to effect locus-specific regulation, such as blocking binding of RNA polymerase to the promoter (thereby selectively inhibiting function of a transcriptional activator) and / or altering the local chromatin state (e.g., when using a fusion sequence that modifies the target DNA or modifies a polypeptide associated with the target DNA). In some cases, the change is transient (e.g., repression or activation of transcription). In some cases, the change is heritable (e.g., when making epigenetic modifications to the target DNA or to proteins associated with the target DNA, such as nucleosomal histones).

[0177] In some embodiments, the dCas is a dCas13 mutant (Konermann et al., Cell 173 (2018), 665-676). These dCas13 mutants can then be fused to RNA-modifying enzymes, including adenosine deaminases (e.g., ADAR1 and ADAR2). Adenosine deaminases convert adenine to inosine, which the translation machinery treats like guanine, resulting in a functional A→G change in the RNA sequence. In some embodiments, the dCas is a dCas9 mutant.

[0178] In some embodiments, the mutant Cas9 is a Cas9 nickase mutant. The Cas9 nickase mutant contains only one catalytic domain (either the HNH domain or the RuvC domain). The Cas9 nickase mutant retains DNA binding based on gRNA specificity, but can only cleave one strand of DNA, resulting in a single-strand break (e.g., a "nick"). In some embodiments, two complementary Cas9 nickase mutants (e.g., one Cas9 nickase mutant with an inactivated RuvC domain and one Cas9 nickase mutant with an inactivated HNH domain) are expressed in the same cell with two gRNAs corresponding to two respective target sequences (one target sequence on the DNA sense strand and one target sequence on the DNA antisense strand). This dual nickase system can improve target specificity by making double-strand breaks at staggered positions, reducing the chance of two off-target nicks occurring close enough to cause a double-strand break. In some embodiments, a Cas9 nickase mutant is co-expressed with a nucleic acid repair template to facilitate introduction of an exogenous nucleic acid sequence by homology-directed repair.

[0179] In some embodiments, the Cas polypeptides described herein can be engineered to modify the PAM / PFS specificity of the Cas polypeptide. In some embodiments, a mutant Cas polypeptide has a PAM / PFS specificity that differs from that of the parent Cas polypeptide. For example, a native Cas protein can be modified to modify the PAM / PFS sequence recognized by the mutant Cas polypeptide to reduce off-target sites, improve specificity, or eliminate the PAM / PFS recognition requirement. In some embodiments, the Cas protein can be modified to increase the length of the PAM / PFS recognition sequence. In some embodiments, the PAM recognition sequence is at least 4, 5, 6, 7, 8, 9, 10, or 15 amino acids in length. Directed evolution methods can be used to generate Cas polypeptides that recognize different PAM / PFS sequences and / or have reduced off-target activity. Exemplary methods and systems that can be used in the directed evolution of Cas polypeptides are described, for example, in Esvelt et al. Nature 2011, 472(7344):499-503.

[0180] Exemplary Cas mutants are described in International PCT Publication No. WO2015 / 161276 and Konermann et al., Cell 173 (2018), 665-676, which are incorporated by reference in their entireties.

[0181] 3.gRNA The present disclosure provides a guide RNA (gRNA) that guides a site-specific modified polypeptide to a predetermined target nucleic acid sequence. The gRNA comprises a nucleic acid targeting segment and a protein binding segment. The nucleic acid targeting segment of the gRNA comprises a nucleotide sequence that is complementary to a sequence in the target nucleic acid sequence. Thus, the nucleic acid targeting segment of the gRNA interacts with the target nucleic acid in a sequence-specific manner by hybridization (i.e., base pairing), and the nucleotide sequence of the nucleic acid targeting segment determines the position in the target nucleic acid to which the gRNA binds. The nucleic acid targeting segment of the gRNA can be modified (e.g., by genetic engineering) to hybridize to any desired sequence in the target nucleic acid sequence.

[0182] The protein-binding segment of the guide RNA interacts with a site-specific modifying polypeptide (e.g., Cas protein) to form a complex. The guide RNA guides the bound polypeptide to a predetermined nucleotide sequence in the target nucleic acid by the above-mentioned nucleic acid targeting segment. The protein-binding segment of the guide RNA comprises two consecutive nucleotide regions that are complementary to each other and form a double-stranded RNA.

[0183] In some embodiments, the gRNA comprises two separate RNA molecules. In such embodiments, each of the two RNA molecules comprises a stretch of nucleotides that are complementary to each other, such that the complementary nucleotides of the two RNA molecules hybridize to form the double-stranded RNA of the protein-binding segment. In some embodiments, the gRNA comprises a single RNA molecule (sgRNA).

[0184] The specificity of the gRNA for the target locus is mediated by the sequence of the nucleic acid binding segment, which comprises about 20 nucleotides that are complementary to the target nucleic acid sequence in the target locus. In some embodiments, the corresponding target nucleic acid sequence is about 20 nucleotides in length. In some embodiments, the nucleic acid binding segment of the gRNA sequence of the present disclosure is at least 90% complementary to the target nucleic acid sequence in the target locus. In some embodiments, the nucleic acid binding segment of the gRNA sequence of the present disclosure is at least 95%, 96%, 97%, 98% or 99% complementary to the target nucleic acid sequence in the target locus. In some embodiments, the nucleic acid binding segment of the gRNA sequence of the present disclosure is 100% complementary to the target nucleic acid sequence in the target locus.

[0185] In some embodiments, the target nucleic acid sequence is an RNA target sequence. In some embodiments, the target nucleic acid sequence is a DNA target sequence. In some embodiments, the nucleic acid binding segment of the gRNA sequence binds to a target DNA sequence that is at least 90% identical to a target DNA sequence of a target gene selected from those listed in Table 1. In some embodiments, the nucleic acid binding segment of the gRNA sequence binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a target DNA sequence of a target gene selected from those listed in Table 1. In some embodiments, the nucleic acid binding segment of the gRNA sequence binds to a target DNA sequence that is 100% identical to a target DNA sequence of a target gene selected from those listed in Table 1.

[0186] In some embodiments, the gene regulation system comprises two or more gRNA molecules, each comprising a DNA binding segment, where at least one of the nucleic acid binding segments binds to a target DNA sequence that is at least 90% identical to a target DNA sequence of a target gene selected from Table 1. In some embodiments, the gene regulation system comprises two or more gRNA molecules, each comprising a nucleic acid binding segment, where at least one of the nucleic acid binding segments binds to a target DNA sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to a target DNA sequence of a target gene selected from Table 1. In some embodiments, the gene regulation system comprises two or more gRNA molecules, each comprising a nucleic acid binding segment, where at least one of the nucleic acid binding segments binds to a target DNA sequence that is 100% identical to a target DNA sequence of a target gene selected from Table 1.

[0187] In some embodiments, the nucleic acid binding segments of the gRNA sequences described herein are designed to minimize off-target binding using algorithms known in the art (e.g., Cas-OFF finder) to identify target sequences that are unique to a particular target locus or gene.

[0188] In some embodiments, the gRNAs described herein can include one or more modified nucleosides or nucleotides that confer stability against nucleases. In such embodiments, these modified gRNAs can induce a reduced innate immune response compared to unmodified gRNAs. The term "innate immune response" includes cellular responses to exogenous nucleic acids, including single-stranded nucleic acids, generally from viruses or bacteria, that involve the expression and release of cytokines, particularly interferons, and the induction of cell death.

[0189] In some embodiments, the gRNA described herein is modified at or near its 5' end (e.g., within 1-10, 1-5, or 1-2 nucleotides of its 5' end). In some embodiments, the 5' end of the gRNA is modified by including a eukaryotic mRNA cap structure or cap analog (e.g., a cap analog of G(5')ppp(5')G, a cap analog of m7G(5')ppp(5')G, or an anti-reverse cap analog of 3'-O-Me-m7G(5')ppp(5')G (ARCA)). In some embodiments, the in vitro transcribed gRNA is modified by treatment with a phosphatase (e.g., calf intestinal alkaline phosphatase) to remove the 5' triphosphate group. In some embodiments, the gRNA includes a modification at or near its 3' end (e.g., within 1-10, 1-5, or 1-2 nucleotides of its 3' end). For example, in some embodiments, the 3' end of the gRNA is modified by the addition of one or more (e.g., 25-200) adenine (A) residues.

[0190] In some embodiments, modified nucleosides and nucleotides can be present in gRNA, but can also be present in other gene regulatory systems, such as mRNA, RNAi, or siRNA based systems. (a) modification, e.g., substitution, of one or both of the unlinked phosphate oxygens and / or one or more of the linked phosphate oxygens in the phosphodiester backbone linkages; (b) modification, e.g., substitution, of a component of the ribose sugar, e.g., the 2' hydroxyl of the ribose sugar; (c) extensive replacement of phosphate moieties with “dephospho” linkers; (d) modification or substitution of natural nucleobases; (e) substitutions or modifications of the ribose-phosphate backbone; (f) modification of the 3' or 5' end of an oligonucleotide, such as removal, modification or replacement of a terminal phosphate group, or cojugation of a moiety; and (g) sugar modifications; may include one or more of:

[0191] In some embodiments, the modifications listed above can be combined to provide modified nucleosides and nucleotides that can have two, three, four, or more modifications. For example, in some embodiments, a modified nucleoside or nucleotide can have a modified sugar and a modified nucleobase. In some embodiments, all bases of the gRNA are modified. In some embodiments, all of the phosphate groups of the gRNA molecule are replaced with phosphorothioate groups, respectively.

[0192] In some embodiments, a software tool can be used to optimize the selection of gRNAs within a user's target sequence, for example, to minimize total off-target activity across the genome. Off-target activity can be other than cleavage. For example, when selecting each possible gRNA with S.pyogenes Cas9, the software tool can identify all potential off-target sequences (located immediately before either NAG or NGG PAMs) across the genome that contain no more than a certain number of mismatched base pairs (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10). The cleavage efficiency at each off-target sequence can be predicted, for example, using an empirically derived weighting scheme. Each possible gRNA can then be ranked by the total predicted number of off-target cleavage, with the top gRNAs being the ones with the highest probability of on-target cleavage and the lowest probability of off-target cleavage. The tools may also include other functions, such as automated design of reagents for construction of gRNA vectors, design of primers for on-target Surveyor assays, and design of primers for high-throughput detection and quantification of off-target cleavage by next-generation sequencing.

[0193] IV. Methods for Making Engineered T Regulatory Cells In some embodiments, the disclosure provides methods for producing engineered Tregs, in some embodiments, the methods comprise introducing a gene regulatory system into a Treg population, wherein the gene regulatory system is capable of reducing expression and / or function of one or more endogenous target genes.

[0194] Components of the gene regulatory systems described herein, e.g., nucleic acid-based, protein-based, or nucleic acid / protein-based systems, can be introduced into target cells in a variety of forms using a variety of delivery methods and formulations. In some embodiments, polynucleotides encoding one or more components of the system are delivered by a recombinant vector (e.g., a viral vector or a plasmid). In some embodiments, when the system includes more than one component, a vector may include multiple polynucleotides encoding the components of the system. In some embodiments, when the system includes more than one component, multiple vectors may be used, each vector including a polynucleotide encoding a particular component of the system. In some embodiments, a vector may also include a sequence encoding a signal peptide (e.g., for nuclear localization, nucleolar localization, mitochondrial localization) fused to a polynucleotide encoding one or more components of the system. For example, a vector may include a nuclear localization sequence (e.g., from SV40) fused to a polynucleotide encoding one or more components of the system. In some embodiments, the gene regulatory system is introduced into a cell in vitro. In some embodiments, the gene regulatory system is introduced into a cell in vivo. In some embodiments, introduction of the gene regulatory system into the cell occurs ex vivo.

[0195] In some embodiments, a recombinant vector comprising a polynucleotide encoding one or more components of the gene regulatory system described herein is a viral vector. Suitable viral vectors include vaccinia virus, poliovirus, adenovirus (see, e.g., Li et al., Invest Opthalmol Vis Sci 35:2543 2549, 1994; Borras et al., Gene Ther 6:515 524, 1999; Li and Davidson, PNAS 92:7700 7704, 1995; Sakamoto et al., H Gene Ther 5:1088 1097, 1999; WO94 / 12649, WO93 / 03769, WO93 / 19191, WO94 / 28938, WO95 / 11984 and WO95 / 00655), adeno-associated virus (see, e.g., U.S. Pat. No. 7,078,387; Ali et al., Hum Gene Ther 9:81 86,1998, Flannery et al., PNAS 94:6916 6921,1997, Bennett et al., Invest Opthalmol Vis Sci 38:2857 2863,1997, Jomary et al., Gene Ther 4:683 690,1997, Rolling et al., Hum Gene Ther 10:641 648,1999, Ali et al., Hum Mol Genet 5:591 594,1996, WO93 / 09239 by Srivastava, Samulski et al., J. Vir. (1989) 63:3822-3828, Mendelson et al., Virol. (1988) 166:154-165 and Flotte et al. al., PNAS (1993) 90:10613-10617), SV40, herpes simplex virus, human immunodeficiency virus (e.g., Miyoshi et al., PNAS 94:10319 23, 1997; Takahashi et al., J Virol 73:7812 7816, 1999), retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus).

[0196] In some embodiments, the recombinant vector comprising the polynucleotide encoding one or more components of the gene regulation system described herein is a plasmid. Numerous suitable plasmid expression vectors are known to those skilled in the art, and many are commercially available. For example, for eukaryotic host cells, the vectors pXT1, pSG5 (Stratagene), pSVK3, pBPV, pMSG and pSVLSV40 (Pharmacia) are provided. However, any other plasmid vector compatible with the host cell may be used. Depending on the cell type and gene regulation system used, any of a number of suitable transcriptional and translational control elements may be used in the expression vector, including constitutive promoters, inducible promoters, transcriptional enhancer elements, transcriptional terminators, and the like (see, for example, Bitter et al. (1987) Methods in Enzymology, 153:516-544).

[0197] In some embodiments, the polynucleotide sequence encoding one or more components of the gene regulation system described herein is operably linked to a control element, e.g., a transcriptional control element, such as a promoter. The transcriptional control element may function in either eukaryotic cells (e.g., mammalian cells) or prokaryotic cells (e.g., bacterial or archaeal cells). In some embodiments, the polynucleotide sequence encoding one or more components of the gene regulation system described herein is operably linked to multiple control elements that allow expression of the polynucleotide in both prokaryotic and eukaryotic cells. Depending on the cell type and gene regulation system used, any of a number of suitable transcriptional and translational control elements may be used in the expression vector, including constitutive promoters, inducible promoters, transcriptional enhancer elements, transcriptional terminators, and the like (see, e.g., Bitter et al. (1987) Methods in Enzymology, 153:516-544).

[0198] Non-limiting examples of suitable eukaryotic promoters (including promoters that function in eukaryotic cells) include the cytomegalovirus (CMV) immediate early promoter, the herpes simplex virus (HSV) thymidine kinase promoter, the early and late SV40 promoters, the long terminal repeat (LTR) promoters derived from retroviruses, and the mouse metallothionein-1 promoter. The selection of appropriate vectors and promoters is well within the level of ordinary skill in the art. The expression vector may also include a ribosome binding site for translation initiation and a transcription terminator. The expression vector may also include appropriate sequences for amplifying expression. The expression vector may also include a nucleotide sequence encoding a protein tag (e.g., 6xHis tag, hemagglutinin tag, green fluorescent protein, etc.) that is fused to the site-directed modified polypeptide, thereby resulting in a chimeric polypeptide.

[0199] In some embodiments, the polynucleotide sequences encoding one or more components of the gene regulation system described herein are operably linked to an inducible promoter. In some embodiments, the polynucleotide sequences encoding one or more components of the gene regulation system described herein are operably linked to a constitutive promoter.

[0200] Methods for introducing polynucleotides and recombinant vectors into host cells are known in the art, and any known method can be used to introduce the components of gene regulatory system into cells.Suitable methods include, for example, viral infection, bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery (see, for example, Panyam et al., Adv Drug Deliv Rev. 2012 Sep 13.pii:S0169-409X(12)00283-9), microfluidics delivery methods (see, for example, International PCT Publication No. WO2013 / 059343), etc. In some embodiments, delivery by electroporation involves mixing cells and components of a gene regulatory system in a cartridge, chamber, or cuvette, and applying an electrical stimulus one or more times at a predetermined duration and amplitude. In some embodiments, cells are mixed with components of a gene regulatory system in a reaction vessel connected to a device (e.g., a pump) that delivers the mixture of cells and components of a gene regulatory system to a cartridge, chamber, or cuvette, and an electrical stimulus is applied one or more times at a predetermined duration and amplitude before the cells are delivered to a second reaction vessel.

[0201] In some embodiments, one or more components of the gene regulatory system described herein or a polynucleotide sequence encoding one or more components of the gene regulatory system are introduced into a cell in a non-viral delivery vehicle, such as a transposon, a nanoparticle (e.g., lipid nanoparticle), a liposome, an exosome, an attenuated bacterium, or a virus-like particle. In some embodiments, the vehicle is an attenuated bacterium (e.g., naturally occurring or engineered bacteria that are invasive but attenuated to prevent pathogenesis, including Listeria monocytogenes, certain Salmonella strains, Bifidobacterium longum, and engineered Escherichia coli), bacteria with nutrient- and tissue-specific tropism for target-specific cells, or bacteria with modified surface proteins to alter target cell specificity. In some embodiments, the vehicle is a genetically engineered bacteriophage (e.g., engineered phage with increased packaging capacity, reduced immunogenicity, mammalian plasmid retention sequences, and targeting ligands incorporated therein). In some embodiments, the vehicle is a mammalian virus-like particle. For example, modified virus particles can be produced (e.g., by purifying "empty" particles and then assembling the virus with the desired cargo ex vivo). The vehicle can also be engineered to incorporate targeting ligands to modify target tissue specificity. In some embodiments, the vehicle is a bioliposome. For example, the bioliposome can be a phospholipid-based particle derived from a human cell (e.g., erythrocyte ghosts (red blood cells derived from a subject are hemolyzed into a spherical structure, and tissue targeting can be achieved by binding various tissue-specific or cell-specific ligands)), a secreted exosome, i.e., an endocytosis-derived membrane-bound nanovesicle (30-100 nm) obtained from a subject (e.g., can be produced from various types of cells and can be taken up by cells without the need for targeting ligands).

[0202] In some embodiments, the engineered Treg methods described herein include harvesting a Treg population from a sample. In some embodiments, the sample includes a tissue sample, a fluid sample, a cell sample, a protein sample, or a DNA or RNA sample. In some embodiments, the tissue sample may be from any tissue type in the body, including, but not limited to, gut, skin, lung, liver, spleen, lymph node, and adipose tissue, cell culture medium containing one or more cell populations, buffered solutions containing one or more cell populations, and the like.

[0203] In some embodiments, the sample is treated to enrich or isolate particular cell types, such as Tregs, from the remainder of the sample.

[0204] In some embodiments, isolated Tregs are expanded in culture to generate an expanded Treg population. During the expansion process, one or more activating or growth factors can be added to the culture system. For example, in some embodiments, one or more cytokines (e.g., TGF-β and / or IL-2) can be added to the culture system to enhance or promote cell proliferation. In some embodiments, one or more activating antibodies (e.g., anti-CD3 antibodies) can be added to the culture system to enhance or promote cell proliferation. In some embodiments, Tregs can be co-cultured with feeder cells during the expansion process. In some embodiments, the methods provided herein include one or more expansion phases. Methods for ex vivo expansion of immune cells are known in the art, for example, as described in U.S. Patent Application Publication Nos. 20180282694 and 20170152478, and U.S. Patent Nos. 8,383,099 and 8,034,334.

[0205] The gene regulatory system described herein can be introduced into Tregs at any point during the culture and expansion process to generate modified Tregs. In some embodiments, the gene regulatory system is introduced into the Treg population immediately after enrichment of Tregs from a sample. In some embodiments, the gene regulatory system is introduced into the Treg population before, during, or after one or more expansion processes. In some embodiments, the gene regulatory system is introduced into the Treg population immediately after enrichment of Tregs from a sample or harvesting from a subject and before any expansion round. In some embodiments, the gene regulatory system is introduced into the Treg population after expansion.

[0206] In some embodiments, the modified Tregs produced by the methods described herein can be used immediately. Alternatively, the cells can be frozen and stored for long periods at liquid nitrogen temperature, and can be thawed and reused. In such cases, the cells are frozen in 10% dimethylsulfoxide (DMSO), 50% serum, 40% buffered medium, or any other such solution that is commonly used in the art to store cells at similar freezing temperatures, and thawed in a manner commonly known in the art for thawing frozen cultured cells.

[0207] In some embodiments, the modified Tregs can be cultured in vitro under various culture conditions. The cells can be expanded in culture, i.e., grown under conditions that promote their proliferation. The culture medium can be liquid or semi-solid, e.g., comprising agar, methylcellulose, etc. The cell population can be suspended in a suitable nutrient medium, such as Iscove's modified DMEM or RPMI 1640, which is typically supplemented with fetal bovine serum (about 5-10%), L-glutamine, thiols, particularly 2-mercaptoethanol, and antibiotics (e.g., penicillin and streptomycin). The culture can include growth factors to which the T regulatory cells respond. Growth factors, as defined herein, are molecules that can promote the survival, growth and / or differentiation of cells, either in culture or in intact tissue, through specific action on transmembrane receptors. Growth factors include polypeptide and non-polypeptide factors.

[0208] A. Creating engineered T regulatory cells using the CRISPR / Cas system In some embodiments, the method of generating modified Treg cells involves contacting a target DNA sequence with a complex comprising a gRNA and a Cas polypeptide. As discussed above, the gRNA and Cas polypeptide form a complex, the DNA binding domain of the gRNA guides the complex to the target DNA sequence, and the Cas protein (or a heterologous protein fused to an enzymatically inactive Cas protein) modifies the target DNA sequence. In some embodiments, the complex is formed in the cell after the gRNA and Cas protein (or a polynucleotide encoding the gRNA and Cas protein) are introduced into the cell. In some embodiments, the nucleic acid encoding the Cas protein is a DNA nucleic acid and is introduced into the cell by transduction. In some embodiments, the Cas9 and gRNA components of the CRISPR / Cas gene editing system are encoded by a single polynucleotide molecule. In some embodiments, the polynucleotides encoding the Cas protein and gRNA components are contained in a viral vector and are introduced into the cell by viral transduction. In some embodiments, the Cas9 and gRNA components of the CRISPR / Cas gene editing system are encoded by different polynucleotide molecules. In some embodiments, the polynucleotide encoding the Cas protein is included in a first viral vector, and the polynucleotide encoding the gRNA is included in a second viral vector. In some aspects of this embodiment, the first viral vector is introduced into the cell before the second viral vector. In some aspects of this embodiment, the second viral vector is introduced into the cell before the first viral vector. In such embodiments, the integration of the vectors sustains expression of the Cas9 and gRNA components. However, in some cell types, sustained expression of Cas9 may increase off-target mutations and off-target cleavage. Thus, in some embodiments, an mRNA nucleic acid sequence encoding a Cas protein may be introduced into a cell population by transfection.In such embodiments, expression of Cas9 will decrease over time, which may reduce the number of off-target mutation sites or off-target cleavage sites.

[0209] In some embodiments, the complex is formed in a cell-free system by mixing the gRNA molecule and the Cas protein together and incubating for a period of time sufficient to allow the complex to form. This preformed complex, comprising the gRNA and the Cas protein (herein referred to as CRISPR-ribonucleoprotein (CRISPR-RNP)), can then be introduced into a cell for the purpose of modifying a target DNA sequence.

[0210] B. Generation of modified T regulatory cells using the shRNA system In some embodiments, the method of producing modified Tregs comprises introducing into cells one or more DNA polynucleotides encoding one or more shRNA molecules having sequences complementary to the mRNA transcripts of target genes. Tregs can be modified to produce shRNAs by introducing a predetermined DNA sequence into the cell nucleus via a small gene cassette. Both retroviruses and lentiviruses can be used to introduce DNA encoding shRNAs into Tregs. The introduced DNA can become part of the cell's own DNA or persist in the nucleus, instructing the cellular machinery to produce shRNAs. The shRNAs can be processed by the Dicer or Ago2-mediated slicer activity in the cell to induce RNAi-mediated gene knockdown.

[0211] V. Compositions and Kits The term "composition" as used herein refers to a formulation of the gene regulatory system or modified Treg described herein that can be administered or delivered to a subject or cell. Typically, the formulation includes any physiologically acceptable composition (including derivatives and / or prodrugs, solvates, stereoisomers, racemates or tautomers thereof) together with any physiologically acceptable carriers, diluents and / or excipients. A "therapeutic composition" or "pharmaceutical composition" (used interchangeably herein) is a composition of the gene regulatory system or modified Treg that can be administered to a subject or contacted with a cell to modify one or more endogenous target genes to treat a particular disease or disorder.

[0212] The phrase "pharmacologically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, and commensurate with a reasonable benefit / risk ratio.

[0213] In some embodiments, the present disclosure provides kits for carrying out the methods described herein. In some embodiments, the kits include: (a) one or more nucleic acid molecules capable of reducing the expression of or altering the function of a gene product encoded by one or more endogenous target genes; (b) one or more polynucleotides encoding nucleic acid molecules capable of reducing expression or altering the function of a gene product encoded by one or more endogenous target genes; (c) one or more proteins capable of reducing the expression of or altering the function of a gene product encoded by one or more endogenous target genes; (d) one or more polynucleotides encoding variant proteins capable of reducing expression or altering the function of a gene product encoded by one or more endogenous target genes; (e) one or more gRNAs capable of binding to a target DNA sequence within an endogenous gene; (f) one or more polynucleotides encoding one or more gRNAs capable of binding to a target DNA sequence within an endogenous gene; (g) one or more site-specific modifying polypeptides capable of interacting with the gRNA to modify a target DNA sequence within the endogenous gene; (h) one or more polynucleotides encoding a site-specific modifying polypeptide capable of interacting with a gRNA to modify a target DNA sequence within an endogenous gene; (i) one or more guide DNAs (gDNAs) capable of binding to a target DNA sequence within an endogenous gene; (j) one or more polynucleotides encoding one or more gDNAs capable of binding to a target DNA sequence within an endogenous gene; (k) one or more site-specific modifying polypeptides capable of interacting with gDNA to modify a target DNA sequence within an endogenous gene; (l) one or more polynucleotides encoding site-specific modifying polypeptides capable of interacting with gDNA and modifying a target DNA sequence within an endogenous gene; (m) one or more gRNAs capable of binding to a target mRNA sequence encoded by an endogenous gene; (n) one or more polynucleotides encoding one or more gRNAs capable of binding to a target mRNA sequence encoded by an endogenous gene; (o) one or more site-specific modifying polypeptides capable of interacting with the gRNA to modify a target mRNA sequence encoded by an endogenous gene; (p) one or more polynucleotides encoding a site-specific modifying polypeptide capable of interacting with the gRNA to modify a target mRNA sequence encoded by an endogenous gene; (q) an engineered Treg as described herein; or (r) Any combination of the above. may include.

[0214] In some embodiments, the kit comprises one or more components of a gene regulatory system (or one or more polynucleotides encoding one or more components) and reagents for reconstituting and / or diluting the components. In some embodiments, the kit comprising one or more components of a gene regulatory system (or one or more polynucleotides encoding one or more components) further comprises one or more additional reagents, which may be selected from buffers for introducing the gene regulatory system into cells, wash buffers, control reagents, control expression vectors or RNA polynucleotides, reagents for generating the gene regulatory system in vitro from DNA, and the like. The components of the kit may be in separate containers or may be combined in a single container.

[0215] In addition to the above components, in some embodiments, the kit further comprises instructions for carrying out the disclosed method using the components of the kit. The instructions for carrying out the disclosed method are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic. Thus, the instructions may be present in the kit as a package insert or on the label of the container of the kit or its components (i.e., associated with the package or subpackage). In another embodiment, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, such as a CD-ROM, diskette, flash drive, etc. In yet another embodiment, the actual instructions are not present in the kit, but a means is provided for obtaining the instructions from a remote source, such as the Internet. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or downloaded. With respect to the instructions, this means for obtaining the instructions is recorded on a suitable substrate.

[0216] VI. Treatment Methods and Uses In some embodiments, the engineered Tregs and gene regulatory systems described herein may be used in a variety of therapeutic applications, for example, in some embodiments, the engineered Tregs and / or gene regulatory systems described herein may be administered to a subject, e.g., for gene therapy purposes to treat disease, for use as an autoimmune disease therapeutic, or for biological research.

[0217] In some embodiments, the subject may be a neonate, juvenile or adult. Of particular interest are mammalian subjects. Mammalian species that may be treated with the method of the present invention include canines and felines, equines, bovines, ovines, and the like, as well as primates, particularly humans. Animal models, particularly small mammals (e.g., mice, rats, guinea pigs, hamsters, rabbits, and the like), may be used in experimental studies.

[0218] The administration of the modified Tregs, populations thereof and compositions thereof described herein can be by injection, irrigation, inhalation, feeding, electroosmosis, hemodialysis, iontophoresis, and other methods known in the art. In some embodiments, the route of administration is a local or systemic route. In some embodiments, the route of administration is an intra-arterial, intracranial, intradermal, intraduodenal, intramammary, intrathecal, intraperitoneal, intrathecal, intratumoral, intravenous, intravitreal, intraocular, parenteral, spinal, subcutaneous, ureteral, urethral, ​​vaginal, or intrauterine route.

[0219] In some embodiments, the route of administration is by injection (e.g., continuous infusion or bolus). Examples of methods of local administration, i.e., delivery to the site of injury or disease, include, for example, by an On Meyer reservoir for intrathecal delivery (see, for example, U.S. Patent Nos. 5,222,982 and 5,385,582, which are incorporated herein by reference), by bolus injection, for example, by syringe, into a joint, by continuous infusion, for example, by intubation, such as with convection (see, for example, U.S. Patent Application Publication No. 2007-0254842, which is incorporated herein by reference), or by implanting a device to which the cells are reversibly loaded (see, for example, U.S. Patent Application Publication Nos. 2008-0081064 and 2009-0196903, which are incorporated herein by reference). In some embodiments, the route of administration is by local administration or direct injection. In some embodiments, the modified Tregs described herein may be provided to a subject alone or, for example, with a suitable substrate or matrix to aid in the growth and / or organization of the cells within the tissue into which they are transplanted.

[0220] In some embodiments, at least 1×10 3 In some embodiments, at least 5×10 cells are administered to the subject. 3 cells, 1 x 10 4 cells, 5 x 10 4 cells, 1 x 10 5 cells, 5 x 10 5 cells, 1 x 10 6 pieces, 2×10 6 pieces, 3×10 6 pieces, 4×10 6 pieces, 5×10 6 pieces, 1×10 7 pieces, 1×10 8 pieces, 5×10 8 pieces, 1×10 9 pieces, 5×10 9 pieces, 1×10 10 pieces, 5×10 10 pieces, 1×10 11pieces, 5×10 11 pieces, 1×10 12 pieces, 5×10 12 In some embodiments, about 1×10 cells or more are administered to the subject. 7 ~Approx. 1×10 12 In some embodiments, about 1×10 cells are administered to the subject. 8 ~Approx. 1×10 12 In some embodiments, about 1×10 cells are administered to the subject. 9 ~Approx. 1×10 12 In some embodiments, about 1×10 cells are administered to the subject. 10 ~Approx. 1×10 12 In some embodiments, about 1×10 cells are administered to the subject. 11 ~Approx. 1×10 12 In some embodiments, about 1×10 cells are administered to the subject. 7 ~Approx. 1×10 11 In some embodiments, about 1×10 cells are administered to the subject. 7 ~Approx. 1×10 10 In some embodiments, about 1×10 cells are administered to the subject. 7 ~Approx. 1×10 9 In some embodiments, about 1×10 cells are administered to the subject. 7 ~Approx. 1×10 8 The cells are administered to the subject. The number of administrations to a subject for treatment can vary. In some embodiments, the modified Tregs may be introduced into the subject only once. In some embodiments, such treatment may require a continuous series of repeated treatments. In some embodiments, multiple administrations of modified Tregs may be required before an effect is observed. The exact protocol will depend on the disease or condition, stage, and parameters of the individual subject being treated.

[0221] In some embodiments, the gene regulatory system described herein is used to modify DNA or RNA of cells in vivo, such as for gene therapy or biological research. In such embodiments, the gene regulatory system may be administered directly to a subject, such as by the methods described above. In some embodiments, the gene regulatory system described herein is used to modify Treg populations ex vivo or in vitro. In such embodiments, the gene regulatory system described herein is administered to a sample containing Tregs.

[0222] In some embodiments, the modified Tregs described herein are administered to a subject. In some embodiments, the modified Tregs described herein administered to a subject are autologous Tregs. The term "autologous" in this context refers to cells obtained from the same subject to which they are administered. For example, Tregs may be taken from a subject and modified ex vivo according to the methods described herein, and then administered to the same subject to treat a disease. In such embodiments, the cells administered to the subject are autologous Tregs. In some embodiments, the modified Tregs or compositions thereof administered to a subject are allogeneic Tregs. The term "allogeneic" in this context refers to cells taken from one subject and administered to another subject. For example, Tregs may be taken from a first subject and modified ex vivo according to the methods described herein, and then administered to a second subject to treat a disease. In such embodiments, the cells administered to the subject are allogeneic Tregs.

[0223] In some embodiments, the modified Tregs described herein are administered to a subject for the purpose of treating a disease. In some embodiments, the treatment includes delivering an effective amount of a cell population (e.g., a modified Treg population) or a composition thereof to a subject in need of treatment. In some embodiments, the treatment refers to the treatment of a disease in a mammal, e.g., a human, including (a) suppressing the disease, i.e., arresting the onset of the disease or preventing the progression of the disease, (b) relieving the disease, i.e., improving the pathology or reducing one or more symptoms of the disease, and (c) curing the disease, i.e., ameliorating one or more symptoms of the disease. In some embodiments, the treatment may refer to the short-term (e.g., temporary and / or short-term) and / or long-term (e.g., sustained) reduction of one or more symptoms of the disease. In some embodiments, the treatment improves or alleviates the symptoms of the disease. The improvement may be an observable or measurable improvement, or may be an improvement in the subject's physical state.

[0224] The effective amount of engineered Tregs administered to a particular subject will depend on a variety of factors, some of which will vary from patient to patient, including the disorder being treated and the severity of the disorder, the activity of the specific agent(s) used, the patient's age, weight, general health, sex, and diet, the timing of administration, the route of administration, the duration of treatment, concomitant medications, the judgment of the prescribing physician, and similar factors known in the medical arts.

[0225] In some embodiments, the effective amount of engineered Tregs is at least 1×10 3 cells, e.g., 5 x 10 3 cells, 1 x 10 4 cells, 5 x 10 4 cells, 1 x 10 5 cells, 5 x 10 5 cells, 1 x 10 6 pieces, 2×10 6 pieces, 3×10 6 pieces, 4×10 6 pieces, 5×106 pieces, 1×10 7 pieces, 1×10 8 pieces, 5×10 8 pieces, 1×10 9 pieces, 5×10 9 pieces, 1×10 10 pieces, 5×10 10 pieces, 1×10 11 pieces, 5×10 11 pieces, 1×10 12 pieces, 5×10 12 This can result in a number of cells or more.

[0226] In some embodiments, the modified Treg and gene regulatory system described herein can be used to treat autoimmune disease.Unless otherwise stated, the terms "disorder" and "disease" are used interchangeably herein.As used herein, the term "autoimmune disorder" refers to a disease or disorder that originates from and is directed against an individual's own tissue or organ, or the co-segregation or expression thereof, or the condition resulting therefrom.Autoimmune disease is primarily caused by dysregulation of adaptive immune response, resulting in the formation of autoantibodies or autoreactive T cells against self-structures.

[0227] Exemplary autoimmune disorders include autoimmune hepatitis, inflammatory bowel disease (IBD), Crohn's disease, colitis, ulcerative colitis, type 1 diabetes, alopecia areata, vasculitis, temporal arthritis, lupus, celiac disease, Sjogren's syndrome, polymyalgia rheumatica, multiple sclerosis, arthritis, rheumatoid arthritis, graft-versus-host disease (GVHD), and psoriasis.

[0228] Incorporation by Reference All references, articles, publications, patents, patent publications and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes. However, the mention of any references, articles, publications, patents, patent publications and patent applications cited herein is not, and should not be, construed, acknowledged or in any way suggested as constituting any legitimate prior art or forming part of the common general knowledge in any country in the world. EXAMPLES

[0229] Example 1: Materials and Methods In the experiments described herein, the CRISPR / Cas9 system is used to regulate the expression of endogenous target genes in T regulatory cells (Tregs) for clinical use as an immunotherapy for the treatment of autoimmune diseases.

[0230] I. Material gRNA: All experiments use single molecule gRNA (sgRNA) unless otherwise indicated. Dual gRNA molecules were used as indicated, which were formed by complexing 200 μM tracrRNA (IDT Cat. No. 1072534) with 200 μM target specific crRNA (IDT) in Nuclease Free Duplex Buffer (IDT Cat. No. 11-01-03-01) for 5 min at 95°C to form 100 μM tracrRNA:crRNA complex (tracrRNA and crRNA are present in a 1:1 ratio).

[0231] Cas9: Cas9 was expressed in target cells by introducing either Cas9 mRNA or Cas9 protein. Unless otherwise indicated, the experiments described below used Cas9-encoding mRNA containing a nuclear localization sequence (Cas9-NLS mRNA) from S. pyogenes (Trilink L-7206) or Cas9 protein from S. pyogenes (IDT catalog number 1074182).

[0232] RNP:gRNA-Cas9 ribonucleoprotein (RNP) was formed by mixing 1.2 μL of 100 μM tracrRNA:crRNA complex with 1 μL of 20 μM Cas9 protein and 0.8 μL of PBS. The mixture was incubated at room temperature for 20 min to allow the formation of the RNP complex.

[0233] Lentiviral expression construct: A library of 56,408 sgRNAs, each targeting a single gene in the human genome, was cloned into an expression vector containing the human U6 promoter. A total of 5,137 genes were targeted by this gRNA library. The plasmid further contained the EF1L promoter driving expression of RFP, a T2A sequence, and a puromycin resistance cassette.

[0234] Lentiviruses encoding the above sgRNA libraries were generated as follows. Briefly, 24 hours prior to transfection, 578 × 10 6LentiX-293T cells were seeded in 10-layer CellSTACK. Serum-free OptiMEM, TransIT-293 and helper plasmids (116 μg VSVG and 231 μg PAX2-Gag-Pol) were combined with 462 μg of the sgRNA expression plasmid and incubated for 5 min. This mixture was added to the LentiX-293T cells with fresh medium. 18 hours after transfection, the medium was replaced, and 48 hours after transfection, the viral supernatant was harvested. The supernatant was treated with nuclease Benzonase® and filtered through a 0.45 μm filter to isolate viral particles. The viral particles were then concentrated by tangential flow filtration (TFF), aliquoted, titered, and stored at -80°C.

[0235] II. Method Isolation of human Treg cells: Peripheral blood Treg and CD4+ T effector (Teff) cells were isolated in a stepwise manner from fresh leukopacks or whole blood from healthy volunteer blood donors. First, peripheral blood mononuclear cells (PBMCs) were obtained by Ficoll gradient centrifugation. Then, CD4+ T cells were isolated by negative immunomagnetic selection using the EasySep Human CD4+ T Cell Isolation Kit (StemCell Technologies, Cat. No. 17952). To enrich for Tregs, the isolated CD4+ T cells were further labeled with a monoclonal antibody against CD25-PE, followed by positive selection using the EasySep Human PE Positive Selection Kit (StemCell Technologies, Cat. No. 18561). The enriched CD4+CD25+ cells were then labeled with monoclonal antibodies specific for CD4 and CD127, followed by fluorescence-activated cell sorting (FACS) to obtain a pure Treg population. Tregs were characterized by the following parameters: CD4+CD25 high CD127 dim were selected based on.

[0236] Ex vivo expansion of human Treg cells: Isolated Tregs were cultured at 2 × 10 in X-VIVO15 T cell expansion medium (Lonza, Cat. No. 04-418Q) supplemented with human inactivated serum AB (10%) and human IL-2 (60 ng / ml or 300 units / ml). 6 Cells were plated at 1000 cells / mL. Anti-CD3 / CD28 Treg expander beads or Immunocult human CD3 / CD28 / CD2 T cell activator (tetramer) were added to the cultures at 1:4 or 1:1 cell:bead ratios, respectively, or in a 1x format for the activator, on days 0 and 10 of culture. Additional human IL-2 was supplemented to the cultures every 2-3 days.

[0237] Lentiviral transduction of Treg cells: After 10 days of expansion, Tregs were reactivated for 18 h using anti-CD3 / CD28 Treg expander beads, and then plated in 6-well plates with 5 × 10 cells per well. 6 Cells were seeded in a volume of 1.5 mL in X-VIVO15 medium, 6 ng / mL human IL-2. After the same expansion, Teffs were reactivated with Immunocult human CD3 / CD28 / CD2 T cell activator for 18 h, and then plated at 5 × 10 cells per well in 6-well plates. 6 Cells were seeded in a volume of 1.5 mL of X-VIVO15 medium, 10 ng / mL human IL-2. Lentivirus expressing the sgRNA library was added separately to both cell types at an MOI that could infect 80% of the total cells. 20 μL of Retronectin (1 mg / mL) was added to each well. X-VIVO15 medium was added to a final volume of 2.0 mL per well. Plates were spun at 600 × g for 1.5 h at room temperature. After 18 h (day 2), cells were washed and aliquoted at 1 × 10 6 Cells were seeded at 1000 cells / mL in X-VIVO 15. Treg cultures were supplemented with 60 ng / mL IL2 and Teff cultures were supplemented with 10 ng / mL IL2 and T cell activating factor.

[0238] Electroporation of T cells: Where indicated, gRNA and / or Cas9 were introduced into Treg cells by electroporation. For example, if Treg cells were transduced with a lentivirus expressing a specific sgRNA, Cas9 mRNA can be electroporated into the cells after transduction. Alternatively, double-stranded gRNA can be complexed with Cas9 protein to form RNPs, which can then be electroporated into Treg cells. The electroporation protocol for Cas9 mRNA or RNP is as follows:

[0239] Three days after reactivation of Treg and Teff cells (day 13 of expansion), Treg and Teff cells transduced with lentiviruses expressing specific sgRNAs were harvested and cultured at 100 × 10 6 The primary cells were resuspended in nucleofection buffer (18% supplement 1, 82% P3 buffer from Amaxa P3 4D-Nuclefector X-Kit S (catalog no. V4XP-3032)) at a concentration of 100 cells / mL. 4 μg of S. pyogenes Cas9-NLS mRNA per 20 μL of cell solution (4 μL per 1 mg / mL) was added to the cell mixture, and then 24 μL of the cell / mRNA mixture was added to each reaction well. The cells were electroporated according to the "T cell, human, Stim" program (EO-115). After electroporation, 80 μL of warm X-VIVO15 medium was added to each well, and the cells were transferred to the culture flask, 2 × 10 cells / mL in X-VIVO15 medium containing IL-2 (Treg: 60 ng / mL; Teff: 10 ng / mL). 6 Cells were pooled at a density of 10000000000 cells / mL. On day 4 after reactivation, cells were washed, counted, and utilized for functional assays as described below. Target gene editing efficiency was measured by FACS analysis of surface or intracellular proteins (e.g., CD45, Foxp3) and / or TIDE / NGS analysis of genomic break sites.

[0240] Gene editing is assessed by next-generation sequencing. In this method, genomic DNA (gDNA) was isolated and quantified from edited T cells using the Qiagen Blood and Cell Culture DNA Mini Kit (Cat. No. 13323) according to the manufacturer's recommended protocol. After gDNA isolation, PCR was performed to amplify the edited region of genomic DNA using locus-specific PCR primers containing overhangs required for addition of Illumina next-generation sequencing adapters. The resulting PCR products were run on a 1% agarose gel to ensure specific and sufficient amplification of the genomic locus, followed by PCR cleanup using the Monarch PCR & DNA Cleanup Kit (Cat. No. T1030S) according to the manufacturer's recommended protocol. The purified PCR products were then quantified and a second PCR was performed to anneal Illumina sequencing adapters and sample-specific indexing sequences required for multiplexing. After this, the PCR products were run on a 1% agarose gel, assessed for size, and purified using AMPure XP beads (made in-house). The purified PCR products were then quantified by qPCR using the Kapa Illumina Library Quantification Kit (Cat. No. KK4923) and Kapa Illumina Library Quantification DNA Standards (Cat. No. KK4903). The quantified products were then loaded onto an Illumina NextSeq 500 system using an Illumina NextSeq 500 / 550 Mid Output Reagent Cartridge v2 (Cat. No. FC-404-2003). Analysis of the generated sequencing data was performed to assess insertions and deletions (indels) at the predicted break sites in the DNA of the pool of edited T cells.

[0241] Immunophenotyping and TSDR analysis of edited Treg cells: Four days after Treg cell editing, cells were labeled with CellTrace Violet reagent to track cell division and stimulated with anti-CD3 / CD28 Treg expander beads in the presence of human IL-2 (500 units / ml). After 4 days of stimulation, cells were restimulated for 5 hours with eBioscience Cell Stimulation Cocktail (plus protein transport inhibitor) (eBioscience, Cat. No.: 00-4975-03). Cell surface staining was performed with the following antibodies: anti-CD4 (SK3), -CD25 (MA-251), -TNFRSF4 (Ber-ACT35) and CD45 (HI30). Staining was performed for 20 minutes at 4°C in the presence of human FcBlock reagent (BD Biosciences, Cat. No.: 564219). To detect intracellular proteins, after surface staining, cells were fixed, permeabilized with eBioscience Foxp3 / Transcription Factor Staining Buffer Set (eBioscience, Cat. No.: 00-5523-00) and stained with the following antibodies: anti-Foxp3 (259D / C7), Helios (22F6) and IL-10 (JES3-9D7). LSRFortessa (BD Biosciences) was used for data collection and analysis was performed using FlowJo software (TreeStar). For TSDR analysis, genomic DNA was isolated from edited Tregs as previously described using Qiagen Blood and Cell Culture DNA Mini Kit (Cat. No.: 13323) following the vendor recommended protocol. Bisulfite conversion and pyrosequencing of genomic DNA was performed by EpigenDx (Assay ID ADS783-FS2) to measure the methylation status of the FOXP3 gene region.

[0242] In vitro suppression of allogeneic T effector cells by edited Tregs: A modified version of the method developed by Collison et al. ("In vitro Treg suppression assays," Methods Mol Biol. 707:21-37 (2011)) was used to measure the suppressive function of Tregs. Frozen sgRNA-edited Tregs and non-edited allogeneic T effector cells (hereafter referred to as T responder cells) were thawed and placed overnight in X-VIVO15 T cell growth medium (Lonza, catalog number 04-418Q) supplemented with 10% inactivated male human serum and 600 units / ml of IL-2. T responder cells and Tregs were washed in PBS containing 0.1% BSA and then incubated in the same buffer containing 10 μM CellTrace Violet or 4 μM CFSE, respectively, for 10 min at room temperature. Labeled T responder cells were resuspended in T cell growth medium and seeded at 50,000 cells (50 μl) per well in 96-well U-bottom plates. In a separate plate, labeled Tregs resuspended in T cell growth medium were seeded at 50,000 cells (50 μl) per well, serially diluted, and then mixed with T responder cells at ratios of 1:2 to 1:32. Finally, 100 μl of 0.5 μl / ml ImmunoCult™ human CD3 / CD28 T cell activator was added to each well. Wells without Tregs or CD3 / 28 tetramers served as positive and negative controls, respectively. After 4 days of incubation at 37°C, cells were stained with antibodies against CD4, CD3, Foxp3, and Helios (mentioned above). Data were acquired on a BD LSRFortessa X-20 cell analyzer (BD Biosciences) and T responder cell proliferation was analyzed using FlowJo (TreeStar Inc.). Treg suppression was measured as suppression (%): 100-[100 × (% of proliferating cells with Tregs) / (% of proliferating cells without Tregs).

[0243] In vivo evaluation of edited Treg function: The ability of CRISPR-edited human Tregs to reduce autoimmune responses was evaluated in an NSG-human PBMC xenogeneic mouse model of graft-versus-host disease (GvHD). A model previously described by Cuende et al. ("Monoclonal antibodies against GARP / TGF-β1 complexes inhibit the immunosuppressive activity of human regulatory T cells in vivo," Sci Transl Med. 7(284):284ra56 (2015)) was adapted to be modulated by transfer of human Tregs. Female NCG mice (8-12 weeks old) were injected with 20 × 10 6 Human peripheral blood mononuclear cells (PBMCs) were injected intravenously. After 14 days, mice were randomized into 4 groups (5 mice per group) according to body weight, with 2 × 10 6 Edited human Tregs were administered intravenously. One group served as an untreated control and did not receive Treg treatment. Prior to treatment, human Tregs were edited by electroporation with gRNA / Cas9 RNP complexes containing (1) a control gRNA targeting the OR1A1 gene (SEQ ID NO: 1 GCTGACCAGTAACTCCCAGG), (2) a single gRNA targeting the PRDM1 gene (SEQ ID NO: 2 TTGGACAGATCTATTCCAGA), and (3) a single gRNA targeting the TNFRSF4 gene (SEQ ID NO: 3 GGATGTGCGTGGGGGCTCGG). Editing efficiencies of gRNA / Cas9 complexes targeting the PRDM1 and TNFRSF4 genes were assessed by next generation sequencing and were determined to be 99% and 83%, respectively. Body weight and GvHD scores (sum of scores given for weight loss, activity, posture, hair texture, and skin integrity) were measured three times a week after Treg transfer. To follow the proliferation and activation of CD8+ T effector cells, flow cytometry was also performed on peripheral blood samples taken 15 days after Treg transfer. The results are discussed in Example 4.

[0244] Example 2: Identification of targets for immune regulation of Treg cells by in vitro CRISPR / Cas9 functional genomic screening Experiments were performed to identify targets that modulate Treg fitness during in vitro expansion. A pooled genome-wide CRISPR screen was performed in which a pool of sgRNAs, each targeting a single gene, was introduced into a population of human Treg cells or donor-matched Teff cells such that each cell in the population contained a single sgRNA targeting a single gene. To measure the effect of a particular gene on Treg (or Teff cells) during ex vivo expansion, the frequency of each sgRNA in the population of Treg (or Teff cells) at the start of the experiment was measured and compared to the frequency of the same sgRNA at a later time point in the experiment. The frequency of sgRNAs targeting genes that positively regulate Treg (or Teff cell) proliferation in vitro (e.g., genes that positively regulate Treg (or Teff cell) proliferation or viability) is expected to increase over time, while the frequency of sgRNAs targeting genes that negatively regulate Treg (or Teff cell) proliferation in vitro (e.g., genes that negatively regulate Treg (or Teff cell) proliferation or viability) is expected to decrease over time.

[0245] The distribution and / or frequency of each sgRNA in aliquots taken at various time points during in vitro expansion was analyzed and compared to the distribution and / or frequency of each sgRNA in the initial edited Treg (or Teff cell) population. Statistical analysis was performed for each individual sgRNA to identify sgRNAs that were significantly enriched in the Treg (or Teff cell) population after in vitro expansion and assigned an enrichment score to each guide. For each individual sgRNA in the screening library, an enrichment score was calculated by taking the ratio of guide counts observed at the screening endpoint and dividing by the number of reads observed for that guide at the beginning of the screen. To calculate gene-level enrichment scores, a total enrichment score was calculated as the median of the sgRNA enrichment scores. To calculate the statistical significance of gene-level enrichment, a nominal p-value was calculated for each guide as the percentile of the enrichment of that guide relative to all other guides in the library. These p-values ​​were combined using the logit p-value combining method (Mudholkar 1977) to generate a total gene-level p-value for target enrichment. Gene-level p-values ​​were corrected for multiple testing using the Benjamini-Hochberg method. A false discovery rate (FDR) cutoff value of 0.2 or less was set to identify target genes with consistent and reproducible effects on Treg (or Teff cell) accumulation in vitro across multiple sgRNAs. The results of these experiments are shown in Table 2 below and in Figure 1. The genes in Table 2 are the top 10 genes by gene-level enrichment score, and PRDM1 and TNFRSF4 were the two genes that passed the FDR criteria. [Table 2]

[0246] Example 3: Validation of targets of immune regulation of Treg cells Targets with an FDR cutoff of 0.2 or less were selected for further evaluation in a single-guide format to determine whether editing the target gene in Treg cells alters the stability and / or function of these cells. Exemplary target evaluations are described herein, and these methods can be used to evaluate any of the promising targets listed above.

[0247] Immunophenotyping of edited human Treg cells: Human Treg cells were isolated ex vivo as described above, expanded and edited by electroporation with guide RNA complexed to Cas9 in RNP format for individual target genes. As shown in Figure 2, highly efficient targeted gene editing could be achieved using the described method. The results of editing of individual target genes identified by in vitro CRISPR / Cas9 functional genomics screening in human Treg cells were measured by flow cytometry to quantitate per cell any changes in proliferation capacity and frequency and extent of specific transcription factors and cytokines known to be important for Treg stability and function.

[0248] Edited Treg cells were restimulated with anti-CD3 / CD28 Treg expander beads and assessed for proliferation capacity, transcription factor expression, and cytokine production on day 4. As shown in Figure 3, PRDM1 and TNFRSF4 edited Treg cells showed a 40% and 30% decrease in mean fluorescent intensity (MFI) of CTV staining, respectively, compared to control CD45 edited Treg cells. Since the decrease in CTV staining occurs during each round of cell division, the decrease in CTV staining observed in edited Treg cells is indicative of enhanced proliferation of PRDM1 and TNFRSF4 edited Treg cells.

[0249] The transcription factor Helios in Treg cells is known to be essential for the stability of Treg cells (Kim HJ, Barnitz RA, Kreslavsky T, et al. Stable inhibitory activity of regulatory T cells requires the transcription factor Helios. Science. 2015; 350(6258): 334-9.). Furthermore, binding of Helios to the Treg lineage-determining transcription factor FoxP3 is strongly associated with the expression of core Treg signature genes (Kwon HK, Chen HM, Mathis D, Benoist C. Different molecular complexes that mediate transcriptional induction and repression by FoxP3. Nat Immunol. 2017; 18(11): 1238-1248). Thus, co-expression of Helios and Foxp3 in Treg cells is associated with improved stability and enhanced immunosuppressive function. As shown in Figure 4, editing of PRDM1 in Treg cells increased the percentage of Treg cells co-expressing both Foxp3 and Helios by 2.6-fold, indicating that editing of PRDM1 results in a phenotypic change in Treg cells that is associated with improved Treg cell stability and immunosuppressive function.

[0250] In addition, several studies have shown that demethylation of a conserved region within the Foxp3 locus, named the Treg-specific demethylation region (TSDR), is required to maintain Foxp3 expression in the progeny of dividing Treg cells (Zheng et al. "Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate," Nature 463:808-12 (2010); Polansky JK, et al., "DNA methylation controls Foxp3 gene expression," Eur. J. Immunol. 38:1654-1663 (2008)). As shown in Figure 5, TNFRSF4 editing did not affect the methylation status of the TSDR in Treg cells, and PRDM1 editing increased TSDR demethylation (27% increase compared to control CD45-edited Treg cells). These data indicate that PRDM1 editing promotes the accumulation of stable Treg cells.

[0251] The production of immunosuppressive cytokines such as IL-10 by Treg cells is a major mechanism by which Treg cells can mediate their suppressive function. Indeed, Treg cells unable to produce IL-10 are unable to prevent T effector cell-mediated inflammation (Asseman C, Mauze S, Leach MW, Coffman RL, Powrie F. An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal inflammation. J Exp Med. 1999;190(7):995-1004). As shown in Figure 6, editing of TNFRSF4 in Treg cells increased the IL-10 production capacity of Treg cells by 40% compared to control CD45-edited Treg cells. Editing of PRDM1 increased IL-10 production in Treg cells by 10%. Similar experiments showed that editing of TNFRSF4 did not affect proinflammatory cytokines including IL-17A and IFNγ.

[0252] Inflammatory cytokines such as IL-6 can destabilize Tregs and weaken their suppressive function (Yang et al., “Molecular antagonism and plasticity of regulatory and inflammatory T cell programs,” Immunity 29:44-56 (2008)). In mice, destabilization of Tregs by IL-6 is promoted in the absence of PRDM1 (Garg et al., “Blimp1 Prevents Methylation of Foxp3 and Loss of Regulatory T Cell Identity at Sites of Inflammation,” Cell Reports 26:1854-1868 (2019)). To determine whether IL-6 promotes destabilization of PRDM1-deficient human Tregs, PRDM1 and control edited Tregs were cultured in the presence or absence of 50 ng / mL IL-6. The results shown in Figures 7A and B indicate that, in contrast to mouse Tregs, PRDM1-edited human Tregs maintain stability even in the presence of large amounts of IL-6, as indicated by high expression of Helios.

[0253] The suppressive function of Tregs is dependent on a variety of metabolic processes, some of which are downregulated as Tregs undergo in vitro expansion (Thornton AM, et al., "CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production," J Exp Med. 188:287-96 (1998); Kuniyasu Y, et al., "Naturally anergic and suppressive CD25(+)CD4(+) T cells as a functionally and phenotypically distinct immunoregulatory T cell subpopulation," Int Immunol. 12:1145-55 (2000)). Given that editing of PRDM1 and TNFRSF4 resulted in improved expansion of Tregs, the ability of such Tregs to suppress the proliferation of T effector cells was evaluated. In an in vitro coculture system in which Tregs were cultured with labeled T effector cells at ratios of 1:2 to 1:32 for 4 days (see Methods), both PRDM1- and TNFRSF4-edited Tregs were able to suppress T effector cell proliferation, and their suppressive function was comparable to that of control-edited Tregs (Figure 8).

[0254] Collectively, these data demonstrate that editing of Treg cells with individual guide sequences for genes identified via a CRISPR / Cas9 functional genomic screen results in distinct changes in proliferative capacity and the frequency and magnitude of expression of specific transcription factors and cytokines known to be important for Treg stability and function.

[0255] Example 4: Validation of targets of immune regulation of Treg cells The data in Figure 9A show that human Treg-treated mice that developed GvHD survived longer than untreated mice. All five untreated mice took 25 days to lose weight below the initial weight, compared to 32 days for the control edited Treg-treated mice. Mice in the TNFRSF4- / - Treg-treated group maintained weights above the initial measurement until 58 days after Treg transfer (72 days after PBMC transfer). Figure 9B shows flow cytometry data in peripheral blood of mice 15 days after Treg transfer. Ki67 staining intensity has been shown to be a surrogate marker for quantifying the proliferation potential of cells (Miller et al. (“Ki67 is a Graded Rather than a Binary Marker of Proliferation versus Quiescence,” Cell Rep.24(5):1105-1112.e5(2018)). Ki67 staining intensity was reduced in human CD8 cells from all Treg-transferred groups, indicating that Tregs can suppress inflammation. Furthermore, mice treated with TNFRSF4-edited Tregs revealed a further reduction in Ki67 staining intensity within the CD8+ T cell population, indicating that loss of TNFRSF4 results in more potent Tregs in vivo (Figure 9B). In certain embodiments, for example, the following are provided: (Item 1) 1. A modified T regulatory cell (Treg) comprising a gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, including TNFRSF4, The modified Treg, wherein the immunosuppressive function of the Treg is enhanced by reducing the expression and / or function of the one or more endogenous genes. (Item 2) The modified Treg of item 1, wherein the gene regulatory system comprises: (i) a nucleic acid molecule; (ii) an enzyme protein; or (iii) a nucleic acid molecule and an enzyme protein. (Item 3) The modified Treg of item 2, wherein the gene regulatory system comprises a nucleic acid molecule selected from siRNA, shRNA, microRNA (miR), antagomir or antisense RNA. (Item 4) 3. The modified Treg of item 2, wherein the gene regulatory system comprises an enzyme protein, and the enzyme protein is engineered to specifically bind to a target sequence in one or more of the endogenous genes. (Item 5) The modified Treg of item 4, wherein the protein is a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease or a meganuclease. (Item 6) The modified Treg of item 2, wherein the gene regulatory system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule and the enzyme protein is a Cas protein or a Cas orthologue. (Item 7) 7. The modified Treg of item 6, wherein the Cas protein is a Cas9 protein. (Item 8) The modified Treg of item 6, wherein the Cas protein is a wild-type Cas protein that contains two enzymatic activity domains and can induce double-stranded DNA breaks. (Item 9) 7. The modified Treg of item 6, wherein the Cas protein is a Cas nickase mutant that contains one enzymatic activity domain and can induce single-stranded DNA breaks. (Item 10) 7. The modified Treg of item 6, wherein the Cas protein is an inactivated Cas protein (dCas) and is linked to a heterologous protein capable of regulating the expression of the one or more endogenous target genes. (Item 11) 11. The modified Treg of item 10, wherein the heterologous protein is selected from the group consisting of MAX interacting protein 1 (MXI1), Kruppel-associated box (KRAB) domain, methyl-CpG binding protein 2 (MECP2) and mSin3 4-linking domain (SID4X). (Item 12) 1. A modified Treg comprising a gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes, including PRDM1, The modified Treg, wherein the immunosuppressive function of the Treg is enhanced by reducing the expression and / or function of the one or more endogenous genes. (Item 13) 13. The modified Treg of item 12, wherein the gene regulatory system comprises: (i) a nucleic acid molecule; (ii) an enzymatic protein; or (iii) a nucleic acid molecule and an enzymatic protein. (Item 14) The modified Treg of item 13, wherein the gene regulatory system comprises a nucleic acid molecule selected from siRNA, shRNA, microRNA (miR), antagomir or antisense RNA. (Item 15) 14. The modified Treg of item 13, wherein the gene regulatory system comprises an enzyme protein, and the enzyme protein is engineered to specifically bind to a target sequence in one or more of the endogenous genes. (Item 16) The modified Treg of item 15, wherein the protein is a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease or a meganuclease. (Item 17) 14. The modified Treg of item 13, wherein the gene regulatory system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule and the enzyme protein is a Cas protein or a Cas orthologue. (Item 18) 18. The modified Treg of item 17, wherein the Cas protein is a Cas9 protein. (Item 19) 18. The modified Treg of item 17, wherein the Cas protein is a wild-type Cas protein that contains two enzymatic activity domains and can induce double-stranded DNA breaks. (Item 20) 18. The modified Treg of item 17, wherein the Cas protein is a Cas nickase mutant that contains one enzymatic activity domain and can induce single-stranded DNA breaks. (Item 21) 18. The modified Treg of item 17, wherein the Cas protein is an inactivated Cas protein (dCas) and is linked to a heterologous protein capable of regulating the expression of the one or more endogenous target genes. (Item 22) 22. The modified Treg of item 21, wherein the heterologous protein is selected from the group consisting of MAX interacting protein 1 (MXI1), Kruppel-associated box (KRAB) domain, methyl-CpG binding protein 2 (MECP2) and mSin3 4-linking domain (SID4X). (Item 23) 23. The modified Treg of any one of items 1 to 22, wherein the gene regulatory system is capable of reducing expression and / or function of at least two, three, four, five, six or more of endogenous target genes. (Item 24) 1. A modified Treg comprising a gene regulatory system capable of reducing expression and / or function of one or more endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP, The modified Treg, wherein the immunosuppressive function of the Treg is enhanced by reducing the expression and / or function of the one or more endogenous genes. (Item 25) 25. The modified Treg of item 24, wherein the gene regulatory system comprises: (i) a nucleic acid molecule; (ii) an enzymatic protein; or (iii) a nucleic acid molecule and an enzymatic protein. (Item 26) 25. The modified Treg of item 24, wherein the gene regulatory system comprises a nucleic acid molecule selected from siRNA, shRNA, microRNA (miR), antagomir or antisense RNA. (Item 27) 25. The modified Treg of item 24, wherein the gene regulatory system comprises an enzyme protein, the enzyme protein being engineered to specifically bind to a target sequence in one or more of the endogenous genes. (Item 28) 28. The modified Treg of item 27, wherein the protein is a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease, or a meganuclease. (Item 29) 25. The modified Treg of item 24, wherein the gene regulatory system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule and the enzyme protein is a Cas protein or a Cas orthologue. (Item 30) 30. The modified Treg of item 29, wherein the Cas protein is a Cas9 protein. (Item 31) 30. The modified Treg of item 29, wherein the Cas protein is a wild-type Cas protein that contains two enzymatic activity domains and can induce double-stranded DNA breaks. (Item 32) 30. The modified Treg of item 29, wherein the Cas protein is a Cas nickase mutant that contains one enzymatic activity domain and can induce single-stranded DNA breaks. (Item 33) 30. The modified Treg of item 29, wherein the Cas protein is an inactivated Cas protein (dCas) and is linked to a heterologous protein capable of regulating the expression of the one or more endogenous target genes. (Item 34) 34. The modified Treg of item 33, wherein the heterologous protein is selected from the group consisting of MAX interacting protein 1 (MXI1), Kruppel-associated box (KRAB) domain, methyl-CpG binding protein 2 (MECP2) or mSin3 4-linking domain (SID4X). (Item 35) 35. The modified Treg of any one of items 24 to 34, wherein the gene regulatory system is capable of reducing expression and / or function of a plurality of endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 36) 36. The modified Treg of item 35, wherein the gene regulatory system is capable of reducing expression and / or function of at least two, three, four, five, six or more endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 37) 2. The modified Treg of item 1, wherein the gene regulatory system is capable of reducing expression and / or function of a plurality of endogenous target genes, wherein at least one of the plurality of target genes is TNFRSF4, and wherein at least one of the plurality of target genes is selected from PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP. (Item 38) 38. The modified Treg of item 37, wherein one of the plurality of target genes is TNFRSF4, and at least two, three, four, five, six or more target genes of the plurality of target genes are selected from PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 39) 13. The modified Treg of item 12, wherein the gene regulatory system is capable of reducing expression and / or function of a plurality of endogenous target genes, wherein at least one of the plurality of target genes is PRDM1, and at least one of the plurality of target genes is selected from TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP. (Item 40) 40. The modified Treg of item 39, wherein one of the plurality of target genes is PRDM1 and at least two, three, four, five, six or more target genes of the plurality of target genes are selected from TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 41) 41. The modified Treg cell of any one of items 37 to 40, wherein the gene regulatory system comprises a plurality of gRNA molecules. (Item 42) 42. The modified Treg of any one of items 1 to 41, wherein the gene regulatory system is introduced into the Treg by transfection, transduction, electroporation or physical disruption of the cell membrane by a microfluidics device. (Item 43) The modified Treg of item 42, wherein the gene regulatory system is introduced as a polynucleotide, protein, or ribonucleoprotein (RNP) complex encoding one or more components of the system. (Item 44) 44. The modified Treg according to any one of items 1 to 43, wherein the immunosuppressive function is selected from Treg proliferation, Treg viability, Treg stability, increased expression or secretion of an immunosuppressive cytokine (optionally, the immunosuppressive cytokine is IL-10), increased co-expression of Foxp3 and Helios, and / or exhaustion resistance. (Item 45) The modified Tregs of item 44, wherein Treg stability is evaluated during in vitro culture with IL-6. (Item 46) 46. ​​The modified Treg of any one of items 1 to 45, further comprising an engineered immune receptor displayed on the cell surface. (Item 47) 47. The modified Treg of item 46, wherein the engineered immune receptor is a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain and an intracellular signaling domain. (Item 48) 48. The modified Treg of item 47, wherein the engineered immune receptor is an engineered T cell receptor (TCR). (Item 49) 49. The modified Treg according to any one of items 46 to 48, wherein the engineered immune receptor specifically binds to an antigen expressed on a target cell. (Item 50) The modified Treg according to any one of items 1 to 49, wherein the Treg is a human Treg. (Item 51) A modified Treg having reduced expression and / or function of one or more endogenous genes compared to the expression and / or function of one or more endogenous genes in unmodified Treg, wherein the one or more endogenous genes include TNFRSF4, and the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Treg. (Item 52) A modified Treg having reduced expression and / or function of one or more endogenous genes compared to the expression and / or function of one or more endogenous genes in unmodified Treg, wherein the one or more endogenous genes include PRDM1, and the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Treg. (Item 53) A modified Treg in which the expression and / or function of one or more endogenous genes is reduced compared to the expression and / or function of one or more endogenous genes in unmodified Treg, wherein the one or more endogenous genes are selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP, and the reduced expression and / or function of the one or more endogenous genes enhances the immunosuppressive function of the Treg. (Item 54) 54. The modified Treg of any one of items 51 to 53, further comprising an engineered immune receptor displayed on the cell surface. (Item 55) 55. The modified Treg of item 54, wherein the engineered immune receptor is a CAR or an engineered TCR. (Item 56) 56. The modified Treg of item 54 or 55, wherein the engineered immune receptor specifically binds to an antigen expressed on a target cell. (Item 57) 57. The modified Treg of any one of items 53 to 56, further comprising a reduction in expression of TNFRSF4. (Item 58) 58. The modified Treg of item 57, comprising reduced expression and / or function of TNFRSF4 and reduced expression and / or function of at least one target gene selected from PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 59) 59. The modified Treg of item 58, comprising reduced expression and / or function of TNFRSF4 and reduced expression and / or function of at least two, three, four, five, six or more target genes selected from the group consisting of PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 60) 57. The modified Treg of any one of items 53 to 56, further comprising a reduced expression of PRDM1. (Item 61) 61. The modified Treg of item 60, comprising reduced expression and / or function of PRDM1, and reduced expression and / or function of at least one target gene selected from TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 62) 62. The modified Treg of item 61, comprising reduced expression and / or function of PRDM1 and reduced expression and / or function of at least two, three, four, five, six or more target genes selected from the group consisting of TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 63) The modified Treg of item 1 or item 13, wherein the gene regulatory system comprises a nucleic acid molecule selected from siRNA and shRNA. (Item 64) 64. The modified Treg of item 63, wherein the gene regulatory system is further capable of reducing expression of one or more endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 65) 64. The modified Treg of item 63, wherein the gene regulatory system is capable of reducing expression and / or function of multiple endogenous target genes and comprises multiple siRNAs or shRNAs, and at least one endogenous target gene is selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 66) 66. The modified Treg of item 65, wherein the gene regulatory system is capable of reducing expression and / or function of at least two, three, four, five, six or more endogenous target genes selected from the group consisting of TNFRSF4, PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 67) 64. The modified Treg of item 63, wherein the gene regulatory system is capable of reducing expression and / or function of a plurality of endogenous target genes, and comprises a plurality of siRNAs or shRNAs, wherein at least one of the plurality of target genes is TNFRSF4, and at least one of the plurality of target genes is selected from PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP2. (Item 68) 68. The modified Treg of item 67, wherein at least one of the plurality of target genes is TNFRSF4 and at least two, three, four, five, six or more target genes of the plurality of target genes are selected from PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 69) 64. The modified Treg of item 63, wherein the gene regulatory system is capable of reducing expression and / or function of a plurality of endogenous target genes, and comprises a plurality of siRNAs or shRNAs, wherein at least one of the plurality of target genes is PRDM1, and at least one of the plurality of target genes is selected from TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP2. (Item 70) 70. The modified Treg of item 69, wherein at least one of the plurality of target genes is PRDM1 and at least two, three, four, five, six or more target genes of the plurality of target genes are selected from TNFRSF4, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP. (Item 71) The modified Treg according to any one of items 51 to 70, wherein the Treg is a human Treg. (Item 72) A composition comprising the modified Treg according to any one of items 1 to 71. (Item 73) At least 1x10 4 pieces, 1x10 5 pieces, 1x10 6 pieces, 1x10 7 pieces, 1x10 8 pieces, 1x10 9 Pieces or 1x10 10 73. The composition of item 72, comprising an engineered Treg. (Item 74) 74. The composition according to item 72 or 73, wherein said composition is suitable for administration to a subject in need thereof. (Item 75) 75. The composition of any one of items 72 to 74, wherein the composition comprises autologous Tregs derived from the subject in need thereof. (Item 76) 75. The composition of any one of items 72 to 74, comprising allogeneic Tregs derived from a donor subject. (Item 77) A gene regulatory system capable of reducing the expression of one or more endogenous target genes in a cell, the gene regulatory system comprising (i) a nucleic acid molecule, (ii) an enzyme protein, or (iii) a nucleic acid molecule and an enzyme protein, wherein the one or more endogenous target genes include TNFRSF4. (Item 78) 78. The gene regulation system of item 77, wherein the system comprises a guide RNA (gRNA) nucleic acid molecule and a Cas endonuclease. (Item 79) A gene regulatory system capable of reducing the expression of one or more endogenous target genes in a cell, the gene regulatory system comprising (i) a nucleic acid molecule, (ii) an enzyme protein, or (iii) a nucleic acid molecule and an enzyme protein, wherein the one or more endogenous target genes include PRDM1. (Item 80) 80. The gene regulation system of item 79, wherein the system comprises a guide RNA (gRNA) nucleic acid molecule and a Cas endonuclease. (Item 81) A gene regulatory system capable of reducing the expression and / or function of one or more endogenous target genes in a cell, the gene regulatory system comprising (i) a nucleic acid molecule, (ii) an enzyme protein, or (iii) a nucleic acid molecule and an enzyme protein, wherein the one or more endogenous target genes are selected from the group consisting of REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and ADNP2. (Item 82) 82. The gene regulation system of item 81, wherein the system comprises a guide RNA (gRNA) nucleic acid molecule and a Cas endonuclease. (Item 83) 83. The gene regulatory system according to any one of items 78 to 82, wherein the Cas protein is a Cas9 protein. (Item 84) 83. The gene regulatory system according to any one of items 78 to 82, wherein the Cas protein is a wild-type Cas protein that contains two enzymatic activity domains and can induce double-stranded DNA breaks. (Item 85) 83. The gene regulatory system according to any one of items 78 to 82, wherein the Cas protein is a Cas nickase mutant that contains one enzymatic activity domain and can induce single-stranded DNA breaks. (Item 86) 83. The gene regulatory system according to any one of items 78 to 82, wherein the Cas protein is an inactivated Cas protein (dCas) and is bound to a heterologous protein capable of regulating the expression of the one or more endogenous target genes. (Item 87) 87. The gene regulation system of item 86, wherein the heterologous protein is selected from the group consisting of MAX interacting protein 1 (MXI1), Kruppel-associated box (KRAB) domain- and mSin3 4-linking domain (SID4X). (Item 88) 82. The gene regulation system of item 77, 79 or 81, wherein the system comprises a nucleic acid molecule, and the nucleic acid molecule is an siRNA, shRNA, microRNA (miR), antagomir or antisense RNA. (Item 89) 82. The gene regulation system according to item 77, 79 or 81, wherein the system comprises a protein comprising a DNA-binding domain and an enzymatic domain, and is selected from zinc finger nucleases and transcription activator-like effector nucleases (TALENs). (Item 90) 90. A kit comprising the gene regulatory system according to any one of items 77 to 89. (Item 91) A gRNA nucleic acid molecule comprising a targeting domain nucleic acid sequence that is complementary to a target sequence in an endogenous target gene, wherein the endogenous target gene is TNFRSF4. (Item 92) A gRNA nucleic acid molecule comprising a targeting domain nucleic acid sequence that is complementary to a target sequence in an endogenous target gene, wherein the endogenous target gene is PRDM1. (Item 93) A gRNA nucleic acid molecule comprising a targeting domain nucleic acid sequence that is complementary to a target sequence in an endogenous target gene, wherein the endogenous target gene is selected from REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16, and ADNP2. (Item 94) 94. The gRNA molecule according to any one of items 91 to 93, wherein the target sequence comprises a PAM sequence. (Item 95) 95. The gRNA molecule of any one of items 91 to 94, wherein the gRNA is a modular gRNA molecule. (Item 96) 95. The gRNA molecule of any one of items 91 to 94, wherein the gRNA is a dual gRNA molecule. (Item 97) 97. The gRNA molecule of any one of items 91 to 96, wherein the targeting domain is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or more nucleotides in length. (Item 98) 98. The gRNA molecule according to any one of items 91 to 97, comprising a modification at or near its 5' end (e.g., within 1 to 10 nucleotides, 1 to 5 nucleotides or 1 to 2 nucleotides from its 5' end) and / or a modification at or near its 3' end (e.g., within 1 to 10 nucleotides, 1 to 5 nucleotides or 1 to 2 nucleotides from its 3' end). (Item 99) 99. The gRNA molecule of item 98, wherein the modified gRNA has improved stability against nucleases when introduced into a T cell. (Item 100) 100. The gRNA molecule of item 98 or 99, wherein introducing the modified gRNA into a T cell reduces the innate immune response. (Item 101) A polynucleotide molecule encoding the gRNA molecule according to any one of items 91 to 100. (Item 102) A polynucleotide molecule encoding a plurality of gRNA molecules selected from any one of items 91 to 100. (Item 103) A composition comprising one or more gRNA molecules according to any one of items 91 to 100, or the polynucleotide according to item 101 or 102. (Item 104) A kit comprising the gRNA molecule according to any one of items 91 to 100, or the polynucleotide according to item 101 or 102. (Item 105) A method for producing modified Treg, comprising: harvesting Tregs from a subject; introducing into said Treg a gene regulatory system, said gene regulatory system being capable of reducing expression and / or function of one or more endogenous target genes, said one or more endogenous target genes comprising TNFRSF4; and culturing the Tregs such that expression and / or function of one or more endogenous target genes is reduced compared to unmodified Tregs; The method comprising: (Item 106) A method for producing modified Treg, comprising: harvesting Tregs from a subject; introducing into said Treg a gene regulatory system, said gene regulatory system being capable of reducing expression and / or function of one or more endogenous target genes, said one or more endogenous target genes comprising PRDM1; and culturing the Tregs such that expression and / or function of one or more endogenous target genes is reduced compared to unmodified Tregs; The method comprising: (Item 107) A method for producing modified Treg, comprising: The method comprises introducing a gene regulatory system into the Treg, the gene regulatory system being capable of reducing the expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising TNFRSF4. (Item 108) A method for producing modified Treg, comprising: The method comprises introducing a gene regulatory system into the Treg, the gene regulatory system being capable of reducing the expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising PRDM1. (Item 109) The method according to any one of items 105 to 108, wherein the gene regulatory system is selected from items 74 to 86. (Item 110) 109. The method of any one of items 105 to 108, further comprising introducing a polynucleotide sequence encoding an engineered immune receptor selected from a CAR and a TCR. (Item 111) 111. The method of claim 110, wherein the polynucleotide encoding the gene regulatory system and / or the engineered immune receptor is introduced into the Treg by transfection, transduction, electroporation or physical disruption of the cell membrane with a microfluidic device. (Item 112) 112. The method according to any one of items 107 to 111, wherein the gene regulatory system is introduced as a polynucleotide sequence encoding one or more components of the system, as a protein, or as a ribonucleoprotein (RNP) complex. (Item 113) A method for producing modified Treg, comprising: harvesting a Treg population; Expanding the Treg population; and The method comprises introducing a gene regulatory system into the Treg population, the gene regulatory system being capable of reducing the expression and / or function of one or more endogenous target genes, including TNFRSF4. (Item 114) 114. The method of claim 113, wherein the gene regulatory system is introduced into the Treg population prior to said expansion. (Item 115) 114. The method of claim 113, wherein the gene regulatory system is introduced into the Treg population after said expansion. (Item 116) A method for producing modified Treg, comprising: harvesting a Treg population; Expanding the Treg population; and The method comprises introducing a gene regulatory system into the Treg population, the gene regulatory system being capable of reducing the expression and / or function of one or more endogenous target genes, including PRDM1. (Item 117) 114. The method of claim 113, wherein the gene regulatory system is introduced into the Treg population prior to said expansion. (Item 118) 114. The method of claim 113, wherein the gene regulatory system is introduced into the Treg population after said expansion. (Item 119) The method according to any one of items 105 to 118, wherein the Treg is a human Treg. (Item 120) 76. A method for treating a disease or disorder in a subject in need of treatment, the method comprising administering an effective amount of the modified Treg according to any one of items 1 to 71, or the composition according to any one of items 72 to 76. (Item 121) 121. The method of claim 120, wherein the disease or disorder is an autoimmune disorder. (Item 122) 122. The method of item 121, wherein the autoimmune disorder is autoimmune hepatitis, inflammatory bowel disease (IBD), Crohn's disease, colitis, ulcerative colitis, type 1 diabetes, alopecia areata, vasculitis, temporal arthritis, lupus, celiac disease, Sjogren's syndrome, polymyalgia rheumatica, multiple sclerosis, arthritis, rheumatoid arthritis, graft versus host disease (GVHD), and psoriasis. (Item 123) 123. The method of any one of items 120-122, wherein the modified Treg is autologous to the subject. (Item 124) 123. The method of any one of items 120-122, wherein the modified Treg is allogeneic to the subject. (Item 125) 1. A method for enhancing one or more immunosuppressive functions of Tregs, comprising: introducing into said Treg a gene regulatory system, said gene regulatory system being capable of reducing expression and / or function of one or more endogenous target genes, said one or more endogenous target genes comprising TNFRSF4; and culturing the Tregs such that expression and / or function of one or more endogenous target genes is reduced compared to unmodified Tregs; The method, wherein one or more immunosuppressive functions are enhanced in the modified Tregs compared to unmodified Tregs. (Item 126) 1. A method for enhancing one or more immunosuppressive functions of Tregs, comprising: introducing into said Treg a gene regulatory system, said gene regulatory system being capable of reducing expression and / or function of one or more endogenous target genes, said one or more endogenous target genes comprising PRDM1; and culturing the Tregs such that expression and / or function of one or more endogenous target genes is reduced compared to unmodified Tregs; The method, wherein one or more immunosuppressive functions are enhanced in the modified Tregs compared to unmodified Tregs. (Item 127) 1. A method for enhancing one or more immunosuppressive functions of Tregs, comprising: The method comprises introducing a gene regulatory system into the Treg, the gene regulatory system being capable of reducing the expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising TNFRSF4. (Item 128) 1. A method for enhancing one or more immunosuppressive functions of Tregs, comprising: The method comprises introducing a gene regulatory system into the Treg, the gene regulatory system being capable of reducing the expression and / or function of one or more endogenous target genes, the one or more endogenous target genes comprising PRDM1. (Item 129) 129. The method according to any one of items 125 to 128, wherein the one or more immunosuppressive functions are selected from Treg proliferation, Treg viability, Treg stability, increased expression or secretion of an immunosuppressive cytokine (optionally, the immunosuppressive cytokine is IL-10), increased co-expression of Foxp3 and Helios, and / or exhaustion resistance. (Item 130) 130. The method of item 129, wherein Treg stability is assessed during in vitro culture with IL-6. (Item 131) 76. A method for treating an autoimmune disease in a subject in need of treatment, the method comprising administering an effective amount of the modified Treg according to any one of items 1 to 71, or the composition according to any one of items 72 to 76. (Item 132) 132. The method of claim 131, wherein the autoimmune disease is selected from the group consisting of autoimmune hepatitis, inflammatory bowel disease (IBD), Crohn's disease, colitis, ulcerative colitis, type 1 diabetes, alopecia areata, vasculitis, temporal arthritis, lupus, celiac disease, Sjogren's syndrome, polymyalgia rheumatica, multiple sclerosis, arthritis, rheumatoid arthritis, graft-versus-host disease (GVHD), and psoriasis. (Item 133) The modified Treg according to any one of items 1 to 71, wherein the modified Treg is a tissue-resident Treg. (Item 134) The method according to any one of items 105 to 132, wherein the Treg is a tissue-resident Treg.

Claims

1. A modified T regulatory cell (Treg) comprising a gene regulatory system capable of reducing expression and / or function of an endogenous gene compared to expression and / or function of the endogenous gene in a non-modified Treg, wherein the reduced expression and / or function of the endogenous gene enhances the immunosuppressive function of the Treg, and the endogenous gene is TNFRSF4.

2. The modified Treg of claim 1 , further comprising an engineered immune receptor displayed on the cell surface.

3. The modified Treg of claim 2 , wherein the engineered immune receptor is a CAR or an engineered TCR.

4. The modified Treg of any one of claims 1 to 3, wherein the gene regulatory system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule and the enzyme protein is a Cas protein or a Cas orthologue.

5. 4. The modified Treg of any one of claims 1 to 3, wherein the gene regulatory system comprises: (i) a guide RNA (gRNA) nucleic acid molecule and a Cas endonuclease; (ii) a nucleic acid molecule, wherein the nucleic acid molecule is an siRNA, shRNA, microRNA (miR), antagomir, or an antisense RNA; or (iii) a protein comprising a DNA-binding domain and an enzymatic domain, wherein the protein is selected from a zinc finger nuclease and a transcription activator-like effector nuclease (TALEN).

6. 6. The modified Treg of claim 5, wherein the Cas endonuclease is a Cas9 endonuclease, the Cas9 endonuclease being (i) a wild-type Cas9 protein comprising two enzymatic activity domains and capable of inducing double-stranded DNA breaks, (ii) a Cas9 nickase mutant comprising one enzymatic activity domain and capable of inducing single-stranded DNA breaks, or (iii) an inactivated Cas9 protein (dCas9), wherein dCas9 is linked to a heterologous protein capable of regulating expression of the endogenous gene.

7. 6. The modified Treg of claim 5, wherein the Cas endonuclease is (i) a wild-type Cas protein that contains two enzymatic activity domains and is capable of inducing double-stranded DNA breaks, (ii) a Cas nickase mutant that contains one enzymatic activity domain and is capable of inducing single-stranded DNA breaks, or (iii) an inactivated Cas protein (dCas), wherein dCas is linked to a heterologous protein that is capable of regulating expression of the endogenous gene.

8. The modified Treg of claim 7, wherein the heterologous protein is selected from the group consisting of MAX interacting protein 1 (MXI1), Kruppel-associated box (KRAB) domain- and mSin3 4-linking domain (SID4X).

9. 4. The modified Treg of any one of claims 1 to 3, wherein (i) the gene regulatory system comprises a nucleic acid molecule selected from siRNA, shRNA, microRNA (miR), antagomir or antisense RNA; or (ii) the gene regulatory system comprises an enzyme protein, the enzyme protein being engineered to specifically bind to a target sequence in the endogenous gene.

10. The modified Treg of claim 9 , wherein the enzymatic protein is a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease, or a meganuclease.

11. The modified Treg of any one of claims 1 to 10, wherein the gene regulatory system is further capable of reducing expression and / or function of PRDM1, REEP3, MRPL32, FSCN3, KLC3, C4BPA, LZTS1, CDK16 and / or ADNP.

12. The modified Treg of any one of claims 1 to 11, wherein the immunosuppressive function is selected from Treg proliferation, Treg survival, Treg stability, increased expression or secretion of immunosuppressive cytokines, increased co-expression of Foxp3 and Helios, and / or exhaustion resistance.

13. The modified Treg of claim 12, wherein the immunosuppressive cytokine is IL-10.

14. A composition comprising the modified Treg of any one of claims 1 to 13.

15. At least 1x10 ４ The composition of claim 14 comprising the modified Treg.

16. 1. A method for producing modified Tregs, comprising: The method comprises introducing into the Treg a gene regulatory system, the gene regulatory system being capable of reducing expression and / or function of an endogenous target gene, the endogenous target gene being TNFRSF4.

17. 17. The method of claim 16, further comprising introducing a polynucleotide sequence encoding an engineered immune receptor selected from a CAR and a TCR.

18. 16. The composition of claim 14 or 15, for use in treating an autoimmune disease or disorder in a subject, wherein the modified Tregs are (i) autologous to the subject, or (ii) allogeneic to the subject.

19. 19. The composition of claim 18, wherein the autoimmune disorder is autoimmune hepatitis, inflammatory bowel disease (IBD), Crohn's disease, colitis, ulcerative colitis, type 1 diabetes, alopecia areata, vasculitis, temporal arthritis, lupus, celiac disease, Sjogren's syndrome, polymyalgia rheumatica, multiple sclerosis, arthritis, rheumatoid arthritis, graft versus host disease (GVHD), and psoriasis.

20. 1. A method for enhancing one or more immunosuppressive functions of Tregs, comprising: introducing into said Treg a gene regulatory system, said gene regulatory system being capable of reducing expression and / or function of an endogenous target gene, said target gene being TNFRSF4.

21. 21. The method of claim 20, wherein the one or more immunosuppressive functions are selected from Treg proliferation, Treg survival, Treg stability, increased expression or secretion of immunosuppressive cytokines, increased co-expression of Foxp3 and Helios, and / or exhaustion resistance.

22. The method of claim 21, wherein the immunosuppressive cytokine is IL-10.

Images