Paint selection system and paint selection method

Abstract

The present invention provides a paint selection system for selecting a paint, the system comprising: a storage unit for storing paint antifouling data including correspondence relationships between location information about an assessment water area and the antifouling properties of a plurality of paints; an input unit that accepts the input of location information about a specific water area; a specifying unit that uses the paint antifouling data and the location information about the specific water area to specify a paint to be used in the specific water area; and an output unit that outputs identification information for the specified paint, wherein the paint antifouling data is created by analyzing organisms that have attached to a sample to which a paint has been pre-applied and which is immersed in the assessment water area.

Description

[Technical field]

[0001] The present disclosure relates to a paint selection system and a paint selection method. This application is based on Japanese Patent Application No. 2021-136344 filed on August 24, 2021, the contents of which are incorporated herein by reference. [Background technology]

[0002] It has been known for some time that aquatic organisms attach to the bottoms of ships and other vessels that are exposed to seawater for long periods of time (for example, Patent Document 1). Organism adhesion increases the resistance of the vessel when it is operating, which reduces the vessel's speed and reduces fuel efficiency. Organism adhesion to vessels and other vessels is also a factor that increases the cleaning costs of the vessel and may also deteriorate the durability of the vessel and other objects. In general, a paint having antifouling properties that inhibit the attachment of organisms to the vessel is applied to the vessel's hull. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] JP 2018-167654 A Summary of the Invention [Problem to be solved by the invention]

[0004] Evaluation of biofouling often requires evaluation time of several months to several years. In addition, methods with low accuracy such as visual inspection are often used as methods for evaluating biofouling. For this reason, it is currently difficult to select a paint suitable for a vessel, etc., and paint is selected by relying on so-called "experience and intuition." In other words, it is difficult to say that paint with appropriate antifouling properties has been selected. This problem is not limited to vessels, but is also common to paints used for any object such as fishing gear and piping used underwater. For this reason, a technology that can select paint with appropriate antifouling properties is desired. [Means for solving the problem]

[0005] The present invention can be realized in the following forms.

[0006] (1) According to one aspect of the present invention, a paint selection system for selecting a paint is provided. The paint selection system includes a storage unit storing paint antifouling data including a correspondence between location information of an evaluation water area and the antifouling properties of a plurality of paints, an input unit receiving input of location information of a specific water area, an identification unit using the paint antifouling data and the location information of the specific water area to identify the paint to be used in the specific water area, and an output unit outputting identification information of the identified paint, the paint antifouling data being a sample to which the paint has been applied in advance, and being created by analyzing organisms attached to the sample immersed in the evaluation water area. According to this aspect of the paint selection system, the paint antifouling data is stored in the storage unit, and the identification unit using the paint antifouling data and the location information of the specific water area to identify the paint to be used in the specific water area is included, so that a paint having appropriate antifouling properties according to the object to be used in the specific water area can be selected.

[0007] (2) In the paint selection system of the above aspect, the storage unit may store price data corresponding to the prices of each of the plurality of paints, and the identification unit may identify the paint to be used in the specific water area using the paint antifouling data, the price data, and location information of the specific water area. According to this aspect of the paint selection system, the paint to be used in the specific water area is identified using price data in addition to the paint antifouling data and the location information of the specific water area, so that an appropriate paint can be selected taking price into consideration.

[0008] (3) In the paint selection system of the above embodiment, the paint antifouling data includes a plurality of pieces of location information for the evaluation water area, and the identification unit determines whether the location information for the specific water area is the same as any one of the location information for the multiple evaluation water areas, and if it is determined that the location information is the same, identifies the paint based on the paint antifouling data for the evaluation water area determined to be the same, and if it is determined that the location information is not the same, identifies the paint based on the paint antifouling data for the evaluation water area that is closest to the specific water area among the multiple evaluation water areas. According to this embodiment of the paint selection system, if the location information for the specific water area is not the same as any one of the location information for the multiple evaluation water areas, the paint is identified based on the paint antifouling data for the evaluation water area that is closest to the specific water area among the multiple evaluation water areas, so that an appropriate paint can be selected even for an object to be used in a water area not included in the paint antifouling data.

[0009] (4) In the paint selection system of the above embodiment, the organism analyzed in creating the paint antifouling data may be a prokaryote. According to this embodiment, the paint antifouling data is created using as an indicator a prokaryote with a relatively uniform cell size, so that analytical errors regarding antifouling properties can be reduced, and as a result, the evaluation accuracy of antifouling properties can be improved.

[0010] (5) In the paint selection system of the above embodiment, the organisms analyzed in creating the paint antifouling data may be eukaryotes. According to this embodiment, the paint antifouling data is created using eukaryotes as an indicator, so that a group of organisms, such as large seaweed, that directly contributes to an increase in resistance when using an object such as a ship can be used as an indicator, and as a result, paints can be selected using direct data on antifouling properties.

[0011] (6) In the paint selection system of the above embodiment, the organisms analyzed in creating the paint antifouling data may be prokaryotes and eukaryotes. According to this embodiment, the paint antifouling data is created using prokaryotes and eukaryotes as indicators, so that paints can be selected using comprehensive paint antifouling data using prokaryotes and eukaryotes as indicators.

[0012] (7) In the paint selection system of the above aspect, the paint may be a paint used on ships. According to the paint selection system of this aspect, paint used on ships is selected, so that paint having appropriate antifouling properties according to the ship can be selected. As a result, an increase in resistance during operation of the ship caused by biofouling can be suppressed, and therefore a decrease in ship speed and a deterioration in fuel efficiency can be suppressed.

[0013] (8) According to another aspect of the present invention, there is provided a paint selection method for selecting a paint, comprising the steps of: generating paint antifouling property data including a correspondence between location information of the evaluation water area and the antifouling properties of a plurality of the paints by analyzing organisms attached to a sample to which the paint has been applied and which is immersed in an evaluation water area, receiving an input of location information of the specific water area, identifying the paint to be used in the specific water area using the paint antifouling property data and the location information of the specific water area, and outputting identification information of the identified paint.

[0014] (9) According to another aspect of the present invention, a paint selection system for selecting a paint for a ship is provided. The paint selection system includes a storage unit storing paint antifouling data including a correspondence between first biological species information, which is information on biological species attached to a sample to which the paint has been applied and immersed in an evaluation water area, and the antifouling properties of a plurality of the paints, an input unit receiving input of input data including second biological species information, which is information on biological species attached to the ship immersed in a use water area where the ship is used, an identification unit using the paint antifouling data and the input data to identify the paint to be applied to the ship, and an output unit outputting identification information of the identified paint. According to this aspect of the paint selection system, the identification unit is provided to identify the paint to be applied to the ship using the paint antifouling data including a correspondence between the first biological species information and the antifouling properties of a plurality of paints, and input data including the second biological species information, which is information on biological species attached to the ship in the use water area, so that a paint having an appropriate antifouling property for a biological species that is likely to attach to the target ship can be selected. As a result, paint with appropriate antifouling properties can be selected depending on the vessel.

[0015] (10) In the paint selection system of the above aspect, the memory unit may store price data corresponding to the prices of each of the multiple paints, and the identification unit may identify the paint to be applied to the ship using the paint antifouling data, the price data, and the second biological species information. According to the paint selection system of this aspect, the paint to be applied to the ship is identified using price data in addition to the paint antifouling data and the second biological species information, so that an appropriate paint can be selected taking price into consideration. As a result, a paint with excellent antifouling properties and cost-effectiveness can be selected according to the ship.

[0016] (11) In the paint selection system of the above aspect, the first biological species information and the second biological species information may include information on the composition of the biological species. According to this aspect of the paint selection system, since the first biological species information and the second biological species information include information on the composition of the biological species, it is possible to select a paint having an appropriate antifouling property according to the biological species composition in the water area in which the ship is used.

[0017] (12) In the paint selection system of the above aspect, the first biological species information and the second biological species information may include information on a predetermined biological species. According to this aspect of the paint selection system, since the first biological species information and the second biological species information include information on a predetermined biological species, it is possible to select a paint having an appropriate antifouling property for any biological species that should be noted as a biological species that may adhere to a ship.

[0018] (13) In the paint selection system of the above embodiment, the first biological species information and the second biological species information may be information on a prokaryotic species. According to the paint selection system of this embodiment, since the first biological species information and the second biological species information are information on a prokaryotic species, the paint antifouling data is created using prokaryotes with relatively uniform cell size as an index. As a result, a paint can be selected using paint antifouling data with small analytical error on antifouling properties and high evaluation accuracy of antifouling properties.

[0019] (14) In the paint selection system of the above embodiment, the first biological species information and the second biological species information may be information on eukaryotic species. According to this embodiment of the paint selection system, since the first biological species information and the second biological species information are information on eukaryotic species, the paint antifouling data is created using eukaryotes as an indicator. As a result, a group of organisms, such as large seaweed, that directly contributes to an increase in resistance when using an object such as a ship can be used as an indicator, and thus a paint can be selected using direct data on antifouling properties.

[0020] (15) In the paint selection system of the above aspect, the first biological species information and the second biological species information may be information on a prokaryotic species and a eukaryotic species. According to this aspect of the paint selection system, since the paint antifouling data is created using prokaryotes and eukaryotes as indicators, a paint can be selected using comprehensive paint antifouling data using prokaryotes and eukaryotes as indicators.

[0021] (16) In the paint selection system of the above aspect, the paint antifouling data may further include first speed information related to the operating speed of the ship, and the input data may further include second speed information related to the operating speed of the ship. According to the paint selection system of this aspect, the first speed information related to the operating speed of the ship is included in the paint antifouling data, and the second speed information related to the operating speed of the ship is included in the input data, so that a paint having appropriate antifouling properties according to the operating speed of the ship can be selected.

[0022] (17) In the paint selection system of the above aspect, the paint antifouling data may further include first frequency information related to the operation frequency of the ship, and the input data may further include second frequency information related to the operation frequency of the ship. According to the paint selection system of this aspect, the first frequency information related to the operation frequency of the ship is included in the paint antifouling data, and the second frequency information related to the operation frequency of the ship is included in the input data, so that a paint having appropriate antifouling properties according to the operation frequency of the ship can be selected.

[0023] (18) According to another aspect of the present invention, there is provided a paint selection method for selecting a paint for a ship, comprising the steps of: acquiring second biological species information, which is information on biological species attached to the ship to be coated with the paint, by analyzing organisms attached to the ship immersed in a water area in which the ship is used; receiving input data including the second biological species information; specifying the paint to be coated on the ship using paint antifouling property data including a correspondence between the first biological species information and the antifouling properties of a plurality of the paints and the input data; and outputting identification information of the specified paint, wherein the paint antifouling property data is created by acquiring the first biological species information, which is information on biological species attached to the sample, by analyzing organisms attached to the sample to which the paint has been applied and which has been immersed in an evaluation water area.

[0024] The present invention can be realized in various forms, for example, as a paint selection device, a program for executing a paint selection system, and the like. [Brief description of the drawings]

[0025] [Figure 1] FIG. 1 is a block diagram showing a schematic configuration of a paint selection system. [Diagram 2] FIG. 2 is an explanatory diagram showing an example of a sample used to create paint antifouling property data. [Diagram 3] FIG. 4 is an explanatory diagram showing an example of paint antifouling property data. [Figure 4] FIG. 4 is an explanatory diagram showing an example of price data. [Diagram 5] 1 is a flowchart showing the steps of a paint selection method. [Figure 6] 10 is a flowchart showing the steps of a paint selection method according to a second embodiment. [Figure 7] FIG. 13 is an explanatory diagram showing an example of paint antifouling property data in the third embodiment. [Figure 8] FIG. 11 is an explanatory diagram showing another example of paint antifouling property data. [Figure 9] 10 is a flowchart showing the steps of a paint selection method according to a third embodiment. [Figure 10] FIG. 13 is an explanatory diagram showing an example of paint antifouling property data in the fourth embodiment. [Figure 11] FIG. 13 is an explanatory diagram showing an example of paint antifouling property data in the fifth embodiment. [Figure 12] An explanatory diagram showing the amount of sea squirts and bryozoans attached at Ginowan Marina. [Figure 13] An explanatory diagram showing the amount of sea squirts and bryozoans attached at Yonabaru Marina. [Figure 14] An explanatory diagram showing the Shannon diversity index of prokaryotes at Ginowan Marina. [Figure 15] An explanatory diagram showing the Shannon diversity index of prokaryotes at Yonabaru Marina. [Figure 16] FIG. 1 is an explanatory diagram showing the trends in the Shannon diversity index and number of sequence types of prokaryotes. [Figure 17] FIG. 17 is an explanatory diagram showing the transition of the ranking of the antifouling properties of paints based on the results shown in FIG. 16. [Figure 18] An explanatory diagram showing the results of the evaluation of eukaryotic β diversity at Ginowan Marina. [Figure 19] An explanatory diagram showing the results of the evaluation of eukaryotic β diversity at Yonabaru Marina. [Figure 20] An explanatory diagram showing a panel removed from the sea. [Figure 21] An explanatory diagram showing the total number of prokaryotic sequence species detected in each sample. [Figure 22] An explanatory diagram showing biofouling on a ship laid out six months after painting. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0026] A. First embodiment FIG. 1 is a block diagram showing a schematic configuration of a paint selection system 100 according to an embodiment of the present invention. The paint selection system 100 according to the present embodiment is used to select a paint to be applied to an object such as a ship used underwater. The inventors of the present application have focused on the fact that different species of organisms live in different water areas, and since different species of organisms tend to adhere to objects such as ships in different water areas, they have arrived at the present invention by assuming that a paint having an appropriate antifouling property in the water area is selected and applied to the object. The object to which the paint is applied is not limited to a ship, and may be any object used underwater, such as fishing gear or piping in a power plant. In this specification, the term "ship" refers to a general term for a vehicle made for the purpose of moving on or underwater with people or objects on board, regardless of whether it has a propulsion device or not. Therefore, the term "ship" in this specification also includes submarines and ship structures under construction that have been launched. In this specification, "antifouling property" refers to the ability to suppress "fouling caused by organisms adhering to a surface". Therefore, the term "antifouling property of a paint" refers to the ability to suppress organisms from adhering to the surface of an object by applying the paint to the surface of the object. In this specification, a specific water area where an object is used is called a "specific water area." Specific examples of specific water areas include, for example, a seaport where a ship is anchored and a sea route where a ship navigates. The specific water area is not limited to the sea, and may be a lake, a river, or the like. The paint selection system 100 of this embodiment selects a paint having appropriate antifouling properties according to the object to be used in the specific water area. The paint to be selected is expected to be applied mainly to the outer wall surface of the object, and in particular, when the object is a ship, it is expected to be applied to the bottom of the ship.

[0027] The paint selection system 100 includes a storage unit 10, an input unit 20, an identification unit 30, and an output unit 40. The paint selection system 100 is realized by a CPU (Central Processing Unit) of a computer that operates according to a program. The storage unit 10 has a ROM (Read Only Memory) and a RAM (Random Access Memory), and a paint selection program 12 for selecting a paint to be applied to an object is stored in advance. The CPU functions as the identification unit 30 by executing the paint selection program 12 stored in advance in the storage unit 10.

[0028] The storage unit 10 stores paint antifouling data 14 and price data 16 in addition to the paint selection program 12. In this embodiment, the paint antifouling data 14 means data including a correspondence between the location information of the evaluation water area and the antifouling properties of a plurality of paints. In this specification, the evaluation water area means a water area in which the antifouling properties of a plurality of paints have been previously evaluated by an evaluation method described later. The location information of the evaluation water area may be, for example, the name or address of a port or the like that is the evaluation water area, or information on the latitude and longitude of the evaluation water area. In addition, the location information of the evaluation water area may be, for example, information on a specific route or sea area in which the antifouling properties have been evaluated. A detailed description of the paint antifouling data 14 will be given later. In this specification, the price data 16 means data corresponding to the prices of each of a plurality of paints. A detailed description of the price data 16 will be given later. The storage unit 10 may not store the price data 16. That is, the price data 16 may be omitted.

[0029] The input unit 20 accepts input of the position information of the specific water area. The specific configuration of the input unit 20 is not particularly limited, and may be, for example, an operation unit such as a keyboard, a button, or a touch panel screen, or may be a microphone that accepts the user's voice. The input unit 20 may also be a communication device having a function of performing wireless or wired communication. The communication device may, for example, accept the position information of the specific water area input to a user's mobile information terminal or the like. The position information of the specific water area may be any information capable of specifying the position of the specific water area, such as the name or address of a port, latitude and longitude information, or the like. The position information of the specific water area may also be any information capable of specifying the position of the specific water area, such as a specific route or sea area.

[0030] The identification unit 30 identifies the paint to be used in the specific water area using the paint antifouling data 14 stored in the memory unit 10 and the location information of the specific water area received by the input unit 20. Identifying the paint to be used in the specific water area using the paint antifouling data 14 and the location information of the specific water area corresponds to executing the paint selection program 12. A detailed explanation of the identification of the paint will be given later.

[0031] The output unit 40 outputs the identification information of the paint identified by the identification unit 30. The specific configuration of the output unit 40 is not particularly limited, and may be, for example, a display unit such as a monitor or touch panel screen, or may be, for example, a speaker. The output unit 40 may also be a communication device having a function of performing wireless or wired communication. The communication device may output the paint identification information to, for example, a user's mobile information terminal. The paint identification information is not particularly limited, and may be, for example, any information capable of identifying the paint, such as the paint name or paint identification number.

[0032] The paint antifouling data 14 is prepared by analyzing organisms attached to a sample that has been previously coated with paint and that has been immersed in the evaluation water area.

[0033] FIG. 2 is an explanatory diagram showing an example of a sample used to create the paint antifouling data 14. In the example shown in FIG. 2, a panel 60 is used to which a plurality of samples 50 coated with each paint are fixed. The samples 50 and the panel 60 are not particularly limited, but for example, a metal plate such as an iron plate, a plastic plate, at least a part of the surface of the bottom of a ship, etc. can be used. In addition, at least a part of the bottom of a ship actually operating may be used as the sample 50. In addition, it is not limited to using a panel 60 to which a plurality of samples 50 are fixed, and each sample 50 may be immersed in the evaluation water area in an independent manner. Note that the panel 60 may include, as a control, a sample that is not coated with paint, a sample that is coated with a paint that is predicted to have no antifouling properties, etc. In addition, the panel 60 may include, as a control, a seawater sample of the immersed water area. In addition, the number of samples 50 coated with each paint, i.e., the number of paints used for evaluation is not particularly limited, but can be set to any number, for example, 10 types, 20 types, 30 types, 40 types, etc. In order to reduce analytical errors, one type of paint may be applied to multiple locations.

[0034] The evaluation water area means the water area used for the antifouling evaluation of the paint. The evaluation water area is not particularly limited, but is preferably a water area where the object is expected to be used. For example, if the object is a ship, it is preferably a water area such as a seaport where the ship is expected to be anchored. The evaluation water area is not limited to the sea, and may be a lake, a river, or the like. The period during which the sample is immersed in the evaluation water area (hereinafter also referred to as the "immersion period" or "evaluation period") is not particularly limited, but can be set to any period such as one week, two weeks, four weeks, six weeks, or ten weeks. The immersion period may be set to any period such as several months or one year. By immersing the sample in the evaluation water area, multiple types of organisms are attached to the surface of the sample. The evaluation water area may be one water area or multiple water areas.

[0035] The analysis of the organisms attached to the sample is not particularly limited, and can be performed, for example, using a nucleic acid analysis method. The analysis of the organism composition can be performed by any method such as an amino acid analysis method, not limited to the nucleic acid analysis method, and any method such as an amino acid analysis method or visual observation can be combined with the nucleic acid analysis method. In this specification, the "nucleic acid analysis method" means a method for analyzing the base sequence contained in DNA or RNA. By analyzing organisms using the nucleic acid analysis method, it is possible to perform an evaluation with high accuracy of identifying the organism species and high sensitivity of detecting the organism species in a short time. Examples of the nucleic acid analysis method include a method that does not determine the base sequence and a method that determines the base sequence.

[0036] Methods that do not involve determining the base sequence include, but are not limited to, denaturing gradient gel electrophoresis (DGGE) and gene detection using a DNA chip. The DGGE method uses a gel containing a denaturant to perform electrophoresis of PCR-amplified DNA, and estimates the composition of a biological species from the pattern of the resulting DNA bands. The gene detection method using a DNA chip is a method in which nucleic acids are hybridized to a DNA array on which a species-specific sequence has been spotted, and the presence or absence of a living organism is estimated based on the intensity of the hybridization.

[0037] Methods for determining base sequences include, but are not limited to, next-generation sequencing, Sanger method, Maxim-Gilbert method, etc. In this embodiment, next-generation sequencing is used as the nucleic acid analysis method. In this specification, the "next-generation sequencing method" refers to a method other than the Sanger method and the Maxim-Gilbert method, which analyzes base sequences contained in more than 1,000 fragments of DNA or RNA in a single analysis.

[0038] Next-generation sequencing allows the analysis of a large number of nucleic acids at once, making it possible to identify even those species present at extremely low abundances in the test specimen.Furthermore, by using next-generation sequencing, the base sequences of the obtained nucleic acids can be compared with a base sequence database, making it possible to identify the species down to a fine level of classification.

[0039] Examples of next-generation sequencing methods include, but are not limited to, pyrosequencing, ion semiconductor sequencing, reversible terminator, single molecule real-time sequencing, nanopore sequencing, etc. Examples of devices used for pyrosequencing include, but are not limited to, GS FLX manufactured by Roche Diagnostics, etc. Examples of devices used for ion semiconductor sequencing include, but are not limited to, Ion PGM manufactured by Thermo Fischer Scientific, etc. Examples of devices used for reversible terminator methods include, but are not limited to, MiSeq manufactured by Illumina, etc. Examples of devices used for single molecule real-time sequencing include, but are not limited to, PacBio (registered trademark) RS II manufactured by Pacific Bioscience, etc. Examples of devices used for nanopore sequencing include, but are not limited to, MinION manufactured by Oxford Nanopore Technologies, etc.

[0040] The number of nucleic acid molecule fragments analyzed per sample is not particularly limited, but is preferably 100 or more, more preferably 1,000 or more, and even more preferably 10,000 or more. The more nucleic acid molecule fragments analyzed per sample, the more easily it is possible to detect the presence of a biological species with an extremely low abundance ratio.

[0041] The organisms analyzed in generating the paint antifouling data 14 may be only prokaryotes, only eukaryotes, or both prokaryotes and eukaryotes.

[0042] Prokaryotes are characterized by having a 70S ribosome. Prokaryotes are not particularly limited, but include, for example, eubacteria such as proteobacteria and cyanobacteria, and archaea such as methanogens. Analysis of the species of prokaryotes can be performed by analyzing the base sequence of a gene conserved in prokaryotes, such as 16S rRNA. In evaluating the antifouling properties of a paint by analyzing the species of prokaryotes, for example, the fewer the species of prokaryotes attached to a sample, the higher the antifouling properties of the paint may be evaluated. The species of prokaryotes may be analyzed, for example, at the phylum level, or the detected sequence may be distinguished and analyzed at the single base level, or may be shown as a relative value (relative occurrence frequency) to all species attached to the sample. In addition, the species of prokaryotes may be analyzed at a specific level, such as the genus or order level. Prokaryotes have relatively uniform cell sizes, so that analysis errors can be reduced in the evaluation of antifouling properties using, for example, alpha diversity. Therefore, by analyzing prokaryotes to generate paint antifouling data 14, it is possible to reduce analytical errors regarding antifouling properties and improve the accuracy of evaluation of antifouling properties.

[0043] Eukaryotes are characterized by having 80S ribosomes. Examples of eukaryotes include, but are not limited to, kelp, sea anemones, shellfish, shrimp, barnacles, sea squirts, and bryozoans. Analysis of eukaryote species can be performed by analyzing the base sequence of genes conserved in eukaryotes, such as 18S rRNA. In evaluating antifouling properties by analyzing eukaryote species, for example, the more eukaryote species attached to a sample, the higher the antifouling properties of the paint may be evaluated. Also, the lower the composition ratio of a specific taxonomic group, such as large seaweeds that have a negative effect on fuel economy, to the total number of species attached to the sample, the higher the antifouling properties of the paint may be evaluated. Eukaryote species may be analyzed, for example, at the class level, or the detected sequences may be analyzed by distinguishing them at the single base level, or may be shown as a relative value (relative occurrence frequency) to all species attached to the sample. Also, for example, the lower the amount of a predetermined species attached, the higher the antifouling properties of the paint may be evaluated. By evaluating antifouling properties using the composition of eukaryotic species, it is possible to use as an index the group of organisms that directly contribute to increased resistance when the target object is used, such as increased resistance when a ship is operating. Therefore, by analyzing eukaryotic organisms and creating paint antifouling data 14, paint antifouling data 14 showing direct results can be used to select paints.

[0044] Organisms analyzed in creating the paint antifouling data 14 may be both prokaryotes and eukaryotes. By creating the paint antifouling data 14 using prokaryotes and eukaryotes as indicators, paints can be selected using the comprehensive paint antifouling data 14 using prokaryotes and eukaryotes as indicators.

[0045] The organisms analyzed in creating the paint antifouling data 14 may be different for each evaluation water area. For example, when there are organisms such as sea squirts, bryozoans, bivalves, and barnacles that require attention, the amount of attachment of such specific organisms may be analyzed. More specifically, in an evaluation water area where barnacles are likely to attach to objects such as ships, the amount of attachment of barnacles may be analyzed to evaluate antifouling properties. Also, for example, the amount of attachment of sea squirts, which are representative organisms that attach to objects such as ships, may be analyzed to evaluate antifouling properties. Also, the organisms analyzed in creating the paint antifouling data 14 may be different for each type of object such as a ship. That is, the organisms analyzed in creating the paint antifouling data 14 may be different depending on the purpose of antifouling properties.

[0046] In the evaluation of the antifouling property of a paint, the evaluation may be performed using a diversity index of biological composition. In this specification, the term "diversity index" refers to an index that represents the diversity of biological species. By performing the evaluation using the diversity index, the antifouling property can be quantitatively evaluated. It is to be noted that a different diversity index may be used for each evaluation water area.

[0047] The diversity index is not particularly limited, but for example, (i) the total number of species of sequences that appeared, (ii) the Simpson index or Shannon index, which is an index containing information on the number of individuals for each sequence, and (iii) Faith's phylogenetic diversity index calculated from the phylogenetic distance for each sequence can be used. In addition, as the diversity index, an index indicating the diversity of organisms attached to one sample (so-called "α diversity"), an index indicating the diversity between multiple samples (so-called "β diversity"), or an index indicating the diversity of all multiple samples (so-called "γ diversity") can be used. The Simpson index, Shannon index, Faith's phylogenetic diversity index, α diversity, β diversity, and γ diversity can be calculated by the method described in Caporaso JG et al. "QIIME allows analysis of high-throughput community sequencing data" (Nat Methods. 2010 May;7(5):335-6).

[0048] FIG. 3 is an explanatory diagram showing an example of paint antifouling property data 14. As described above, the paint antifouling property data 14 shown in FIG. 3 shows the correspondence between the location information of the evaluation water area and the antifouling property of each paint. In the paint antifouling property data 14 shown in FIG. 3, the names of ports where the antifouling properties of multiple paints have been evaluated in advance are used as the location information of the evaluation water area. More specifically, FIG. 3 shows names such as port a, port b, and port c. In addition, in the paint antifouling property data 14 shown in FIG. 3, the antifouling properties of the paints are shown by numerical values ​​that rank the paints evaluated in the evaluation water area in order of their antifouling properties.

[0049] The antifouling properties of the paint in the paint antifouling data 14 are not limited to numerical values ​​that rank the antifouling properties of a plurality of paints as shown in Fig. 3, but may be indicated by any parameter, such as the antifouling level of the paint or a numerical value that indicates the antifouling properties of each paint. The antifouling level of the paint may be set, for example, by setting the top three paints, etc., that are evaluated as having high antifouling properties among the plurality of paints evaluated in the evaluation water area, to the highest level, such as level 5, and setting the next three paints, etc., that are evaluated as having high antifouling properties next to the top three paints, to level 4. The antifouling level of the paint may also be set, for example, by setting the top level, such as level 5, of the paints that are evaluated as having high antifouling properties among the plurality of paints evaluated in the evaluation water area, and setting the next highest level, such as level 4, of the paints that are evaluated as having high antifouling properties in terms of the relative frequency of appearance or the diversity index, and setting the next highest level, such as level 4. 3, the paint antifouling data 14 may be composed of any data including a correspondence between the location information of the evaluation water area and the antifouling properties of the paint obtained by the antifouling evaluation, such as data shown on a map, a graph, a map, etc. The number of evaluation water areas included in the paint antifouling data 14 may be any number equal to or greater than 1.

[0050] When the input unit 20 of the paint selection system 100 receives input of location information such as "Port A" as a specific water area, the identification unit 30 of the paint selection system 100 identifies the paint to be used in Port A using the paint antifouling property data 14 and the location information "Port A." In the case of the paint antifouling property data 14 shown in FIG. 3, Paint B is shown as the paint with the highest antifouling property in Port A, so the identification unit 30 identifies Paint B as the paint to be used in Port A. The output unit 40 then outputs the identification information of the identified Paint B.

[0051] Fig. 4 is an explanatory diagram showing an example of price data 16. In the price data 16 shown in Fig. 4, the price (yen / kg) of each paint is used as data corresponding to the price of each of the multiple paints. Note that the price data 16 is not limited to data on the price of each paint itself, but may be data in which multiple paints are ranked in order of lowest price, or data in which the prices of multiple paints are leveled by price range.

[0052] In a mode in which the memory unit 10 of the paint selection system 100 stores the price data 16, the identification unit 30 may identify the paint to be used in the specific water area using the paint antifouling data 14, the price data 16, and the location information of the specific water area. When the input unit 20 accepts the input of location information such as "Port b" as the specific water area, the identification unit 30 identifies the paint to be used in Port b using the paint antifouling data 14, the price data 16, and the location information of "Port b". When the paint antifouling data 14 shown in FIG. 3 and the price data 16 shown in FIG. 4 are used, Paint A and Paint D are shown as the paints with the highest antifouling properties in Port b, and the price data 16 indicates that Paint D is cheaper than Paint A. Therefore, the identification unit 30 identifies Paint D as the paint to be used in Port b. After that, the output unit 40 outputs the identification information of the identified Paint D.

[0053] FIG. 5 is a flow chart showing the procedure of the paint selection method. The paint selection method includes a step of creating paint antifouling data (step P110), a step of receiving input of location information of the specific water area (step P120), a step of identifying the paint to be used in the specific water area (step P130), and a step of outputting identification information of the identified paint (step P140). The paint antifouling data created in step P110 is created by analyzing organisms attached to a sample to which the paint has been applied in advance and which has been immersed in the evaluation water area, as described above. In step P130, the paint is identified using the paint antifouling data and the location information of the specific water area. In addition to the paint antifouling data and the location information of the specific water area, the paint may be identified in step P130 using price data as described above.

[0054] According to the paint selection system 100 in the first embodiment described above, the paint antifouling data 14 is created by analyzing organisms attached to a sample that has been previously coated with paint and that has been immersed in an evaluation water area, so that paint antifouling data based on the species of organisms that inhabit each water area can be created. The paint selection system 100 includes a memory unit 10 that stores the paint antifouling data 14 including the correspondence between the position information of the evaluation water area and the antifouling properties of a plurality of paints, and an identification unit 30 that identifies a paint to be used in a specific water area using the paint antifouling data 14 and the position information of the specific water area, so that a paint having appropriate antifouling properties according to the object to be used in the specific water area can be selected.

[0055] In addition, according to an embodiment in which the price data 16 is stored in the memory unit 10 and the specification unit 30 specifies the paint to be used in the specific water area using the paint antifouling property data 14, the price data 16, and the location information of the specific water area, it is possible to select an appropriate paint taking price into consideration. As a result, it is possible to select a paint that is excellent in antifouling property and cost-effectiveness depending on the object to be used in the specific water area.

[0056] B. Second embodiment The paint selection system of the second embodiment differs from the paint selection system 100 of the first embodiment in that the specific function of the identification unit is different from that of the identification unit 30 of the first embodiment. Since the other configurations are the same as those of the paint selection system 100 of the first embodiment, detailed description thereof will be omitted.

[0057] The identification unit included in the paint selection system of the second embodiment judges whether the location information of the received specific water area is the same as any one of the location information of the multiple evaluation water areas. If it is determined that the location information of the specific water area is the same as any one of the location information of the multiple evaluation water areas, the paint is identified based on the paint antifouling data of the evaluation water area that is determined to be the same. On the other hand, if it is determined that the location information of the specific water area is not the same as any one of the location information of the multiple evaluation water areas, the paint is identified based on the paint antifouling data of the evaluation water area that is closest to the specific water area among the multiple evaluation water areas. It is estimated that the composition of the biological species in the evaluation water area that is closest to the specific water area is most similar to the composition of the biological species in the specific water area among the multiple evaluation water areas. Note that the memory unit included in the paint selection system of the second embodiment pre-stores paint antifouling data including multiple location information of the evaluation water areas.

[0058] 6 is a flow chart showing a part of the procedure of the paint selection method in the second embodiment. The paint selection method in the second embodiment differs from the paint selection method in the first embodiment in that step P130 of the paint selection method in the first embodiment includes steps P132 to P136 described below. The other steps are the same as those in the paint selection method in the first embodiment, so detailed description thereof will be omitted.

[0059] In the step of identifying the paint to be used in the specific water area using the paint antifouling data and the location information of the specific water area (step P130), first, it is determined whether the location information of the specific water area is the same as any one of the location information of the multiple evaluated water areas (step P132). If it is determined in step P132 that they are the same (step P132: YES), the paint is identified using the paint antifouling data of the evaluated water area that is determined to be the same (step P134). If it is determined in step P132 that they are not the same (step P132: NO), the paint is identified using the paint antifouling data of the evaluated water area that is closest to the specific water area among the multiple evaluated water areas (step P136). This completes step P130. In the paint selection method of the fourth embodiment, price data may be used in addition to the paint antifouling data and the location information of the specific water area in step P130, as in the paint selection method of the second embodiment.

[0060] According to the paint selection system of the second embodiment described above, the paint antifouling data of the evaluation water area that is closest to the specific water area among the evaluation water areas included in the paint antifouling data is used, so that an appropriate paint can be selected even for a water area that is not included in the paint antifouling data. In other words, according to the paint selection system of the third embodiment, even if a water area where the antifouling properties of paint has not been evaluated is input as the specific water area, an appropriate paint can be selected.

[0061] C. Third embodiment The paint selection system of the third embodiment differs from the paint selection system 100 of the first embodiment in the specific form of the paint antifouling data stored in the storage unit, the form of the data received by the input unit, and the specific function of the identification unit. The rest of the configuration is the same as that of the paint selection system 100 of the first embodiment, so a detailed description thereof will be omitted.

[0062] The paint selection system of the third embodiment is used to select a paint to be applied to a ship used in water. The present inventors focused on the fact that different biological species are easily attached to different paints, and envisioned selecting a paint having an appropriate antifouling property for biological species living in the water area where the ship is used and applying it to the ship, and arrived at the present invention. In this embodiment, a certain water area where the target ship is used is called a "water area of ​​use". Specific examples of the water area of ​​use are not particularly limited, but may include, for example, a seaport where the ship is anchored and a sea route where the ship navigates. Note that the water area of ​​use is not limited to the sea, and may be a lake, a river, etc. The paint selection system of the third embodiment selects a paint having an appropriate antifouling property according to the ship used in the water area of ​​use. It is assumed that the paint to be selected is mainly applied to the outer wall surface of the ship's bottom, etc.

[0063] The memory unit provided in the paint selection system of the third embodiment stores paint antifouling data. In this embodiment, the paint antifouling data means data including a correspondence between the first biological species information and the antifouling properties of multiple paints. In this embodiment, the first biological species information means information on the biological species attached to a sample immersed in the evaluation water area. This sample is coated with paint in advance. The evaluation water area means a water area in which the antifouling properties of multiple paints have been evaluated in advance. Therefore, the first biological species information corresponds to information on the biological species that are likely to attach to each paint in the water area in which the antifouling properties of the paints have been evaluated. A detailed explanation of the first biological species information and the paint antifouling data will be given later.

[0064] The input unit of the paint selection system of the third embodiment accepts input data including second biological species information. In this embodiment, the second biological species information means information on biological species attached to a ship immersed in the water area of ​​use. Therefore, the second biological species information corresponds to information on biological species that are likely to attach to a ship in the water area of ​​use in which the ship is used. A detailed explanation of the second biological species information and the input data will be given later.

[0065] The specification unit of the paint selection system of the third embodiment specifies the paint to be applied to the ship using the paint antifouling data stored in the memory unit and the input data received by the input unit. Specifying the paint to be applied to the ship using the paint antifouling data and the input data corresponds to executing a paint selection program.

[0066] The first biological species information is created by analyzing organisms attached to a sample that is previously coated with paint and immersed in the evaluation water area. The first biological species information is not particularly limited, but may be, for example, information on a predetermined biological species, information on the composition of a biological species, or information including both the composition of a biological species and a predetermined biological species. The information on the predetermined biological species may be information on any one type of biological species, or information on any multiple types of biological species. More specifically, for example, if the biological species that should be noted as biological species attached to a ship are sea squirts, bryozoans, bivalves, barnacles, etc., it may be information only on sea squirts, information only on barnacles, etc., or information on a group of organisms including sea squirts and barnacles, etc. The information on the composition of the biological species is not particularly limited, but may be, for example, information on the diversity index of the biological composition, or information on the number of biological species, etc. The information including both the composition of a biological species and a predetermined biological species is not particularly limited, but may be, for example, information on the relative occurrence frequency of a certain biological species with respect to all biological species attached to the sample.

[0067] The method for acquiring the first biological species information, i.e., the method for creating the paint antifouling data, is the same as that of the first embodiment. The paint antifouling data in the third embodiment is created by identifying the correspondence between the first biological species information and the antifouling properties of each paint based on the acquired first biological species information. Note that the first biological species information may be information about a prokaryotic species, information about a eukaryotic species, or information about a prokaryotic species and a eukaryotic species.

[0068] The organisms analyzed in creating the paint antifouling data may differ for each type of target ship. That is, the organisms analyzed in creating the paint antifouling data may differ depending on the purpose of the antifouling properties. For example, the organisms analyzed may differ depending on the expected operating speed and operating frequency of the target ship. Also, the organisms analyzed may differ depending on, for example, the size of the target ship, the season in which the target ship particularly operates, the speed of ocean currents in the waters in which the target ship operates, etc. In this way, the first biological species information may be set arbitrarily depending on the purpose of the antifouling properties.

[0069] Fig. 7 is an explanatory diagram showing an example of paint antifouling data in the third embodiment. As described above, the paint antifouling data shown in Fig. 7 shows the correspondence between the first biological species information and the antifouling properties of each paint. In the paint antifouling data shown in Fig. 7, the name of a predetermined biological species is used as the first biological species information. More specifically, Fig. 7 shows the name of each biological species, such as species a, species b, and species c.

[0070] In the paint antifouling data shown in Fig. 7, the antifouling properties of the paints are shown by numerical values ​​that rank the antifouling properties of the paints evaluated in a plurality of evaluation water areas in order of the antifouling properties of each biological species. The antifouling properties of the paints for each biological species in the paint antifouling data are not limited to numerical values ​​that rank the antifouling properties of the paints as shown in Fig. 7, but may be shown by any parameter, such as the antifouling level of the paint or a numerical value indicating the antifouling properties of each paint. The antifouling level of the paint is not particularly limited, but may be set, for example, by setting the top three paints, etc. that are evaluated as having high antifouling properties for each biological species among the multiple paints evaluated in a plurality of evaluation water areas, to the highest level of level 5, etc., and setting the next three paints, etc., that are evaluated as having the highest antifouling properties after the top three paints, to level 4, etc.

[0071] FIG. 8 is an explanatory diagram showing another example of paint antifouling data. In the paint antifouling data shown in FIG. 8, a symbol indicating the composition of a biological species is used as an example of information on the composition of a biological species as the first biological species information. More specifically, in FIG. 8, symbols such as biological species composition a, biological species composition b, and biological species composition c are shown. Each biological species composition is not particularly limited, but may correspond to the composition of a biological species analyzed for each evaluation water area, or may be a symbol indicating the composition of a biological species in a plurality of evaluation water areas in which the biological species compositions are similar to each other. As the one "corresponding to the composition of a biological species analyzed for each evaluation water area", for example, the biological species composition a may be the biological species composition a in port a or a similar composition, the biological species composition b in port b or a similar composition, and the biological species composition c in port c may be the biological species composition c. In addition, the "symbol indicating the composition of a biological species in a plurality of evaluation water areas in which the biological species compositions are similar to each other" may be set based on, for example, the proportion of a specific plurality of biological species among all the analyzed biological species. More specifically, for example, a species composition a may be one in which the total content of ascidians, barnacles, and bryozoans is 90% or more, a species composition b may be one in which the total content is 70% or more but less than 90%, and a species composition c may be one in which the total content is 50% or more but less than 70%. It is preferable that "the compositions of species are similar to each other" be determined based on any index that indicates that the compositions of species are similar to each other, such as the Aitchison distance, the Bray-Curtis distance, the Unifrac distance, or the Jaccard distance, in the β-diversity of the composition of prokaryotes or eukaryotes.

[0072] In the paint antifouling data shown in Fig. 8, the antifouling properties of the paints are shown by numerical values ​​that rank the antifouling properties of multiple paints evaluated in multiple evaluation water areas in order of their antifouling properties for each biological species composition. The antifouling properties of the paints for each biological species composition in the paint antifouling data are not limited to numerical values ​​that rank the antifouling properties of multiple paints as shown in Fig. 8, and may be shown by any parameter, such as the antifouling level of the paint or a numerical value indicating the antifouling properties of each paint. The antifouling level of the paint is not particularly limited, and may be set, for example, by setting the top three paints, etc. that are evaluated as having high antifouling properties for each biological species composition among the multiple paints evaluated in the evaluation water area to the highest level of level 5, etc., and setting the next three paints, etc., that are evaluated as having the next highest antifouling properties after the top three paints, to level 4, etc. In addition, the antifouling level of paint for each biological species may be set, for example, by setting the highest level, such as level 5, for paints whose relative occurrence frequency or diversity index values ​​are within a specified range that are evaluated as having high antifouling properties among multiple paints evaluated in the evaluation water area, and setting level 4 for paints whose relative occurrence frequency or diversity index values ​​are within the next specified range.

[0073] The paint antifouling data in the third embodiment is not limited to tables such as those shown in Fig. 7 and Fig. 8, and may be composed of any data including a correspondence between the first biological species information and the antifouling properties of the paint obtained by the antifouling evaluation, such as a graph or a map. The paint antifouling data may also include any information such as the immersion period during which the sample was immersed in the evaluation water area. The number of first biological species information included in the paint antifouling data may be any number equal to or greater than 1.

[0074] The second biological species information and the input data will be described below. The second biological species information is desirably set as information in the same format as the above-mentioned first biological species information. For example, in an embodiment in which the first biological species information is information on a predetermined biological species, the second biological species information is desirably set as information on the predetermined biological species. More specifically, in a case in which the first biological species information is the name of a predetermined biological species as shown in FIG. 7, the second biological species information is desirably set as the name of a biological species. Also, in a case in which the first biological species information is information on the composition of a biological species, the second biological species information is desirably set as information on the composition of a biological species. More specifically, in a case in which the first biological species information is a symbol indicating the biological species composition as shown in FIG. 8, the second biological species information is desirably set as a symbol indicating the biological species composition.

[0075] The second biological species information can be obtained by analyzing organisms attached to a ship immersed in the water area where the ship is used. The period for immersing the ship in the water area is not particularly limited, and may be any period such as 3 days, 1 week, 2 weeks, or 4 weeks. The longer the period for immersing the ship, the closer the results to the organisms attached when the ship is actually operated can be obtained. Furthermore, the shorter the period for immersing the ship, the easier it is to obtain the second biological species information. The analysis of organisms attached to the ship can be performed by a method similar to the analysis method for organisms attached to a sample immersed in the evaluation water area as described above, such as a nucleic acid analysis method.

[0076] The input data may be the second biological species information itself, or may include any information in addition to the second biological species information, such as the immersion period during which the vessel was immersed in the water area of ​​use.

[0077] When the input unit of the paint selection system receives input of second biological species information, for example "Type a" as input data, the identification unit of the paint selection system uses the paint antifouling data and the input data "Type a" to identify a paint having appropriate antifouling properties for Type a. In the case of the paint antifouling data shown in FIG. 7, paint B is shown as the paint with the highest antifouling properties for Type a, so the identification unit identifies paint B as the paint to be applied to the ship. In this way, the identification unit identifies a paint having appropriate antifouling properties for biological species that are likely to attach to the ship in the waters where the ship will be used. The output unit then outputs identification information for the identified paint B.

[0078] When the input unit of the paint selection system receives input of second biological species information, for example "biological species composition c" as input data, the identification unit of the paint selection system uses the paint antifouling data as shown in FIG. 8 and the input data "biological species composition c" to identify a paint having appropriate antifouling properties for the biological species composition c. In the case of the paint antifouling data shown in FIG. 8, paint Y is shown as the paint with the highest antifouling properties for the biological species composition c, so the identification unit identifies paint Y as the paint to be applied to the ship. In this way, the identification unit identifies a paint having appropriate antifouling properties according to the biological species composition in the water area where the ship will be used. The output unit then outputs identification information for the identified paint Y.

[0079] When the input biological species composition as the second biological species information does not correspond to any of the biological species compositions as the first biological species information included in the paint antifouling data, the identification unit may identify the first biological species information having the most similar biological species composition. It is preferable that the "biological species composition is most similar" is determined based on any index that indicates that the biological species composition is most similar, such as the Aitchison distance, the Bray-Curtis distance, the Unifrac distance, or the Jaccard distance, in the β diversity of the composition of prokaryotes or eukaryotes.

[0080] In an embodiment in which the memory unit of the paint selection system stores price data as shown in FIG. 4, the identification unit may identify a paint to be used on the ship using the paint antifouling data, the price data, and the input data. When the input unit receives input of second biological species information, for example, "type b" as input data, the identification unit identifies a paint that has appropriate antifouling properties for type b and is low-priced using the paint antifouling data, the price data, and the input data "type b". When the paint antifouling data shown in FIG. 7 and the price data shown in FIG. 4 are used, paint A and paint D are shown as paints with the highest antifouling properties for type b, and the price data shows that paint D is cheaper than paint A. Therefore, the identification unit identifies paint D as the paint to be applied to the ship. In this way, the identification unit identifies a paint that has appropriate antifouling properties for biological species that are likely to attach to the ship in the waters in which the ship is used, and is low-priced. After that, the output unit outputs the identification information of the identified paint D.

[0081] 9 is a flowchart showing the steps of a paint selection method in the third embodiment. The paint selection method includes a step of acquiring second biological species information (step P210), a step of accepting input data including the second biological species information (step P220), a step of identifying a paint to be applied to the ship (step P230), and a step of outputting identification information of the identified paint (step P240).

[0082] In the paint selection method, paint antifouling data is prepared in advance prior to the step of acquiring second biological species information (step P210). The paint antifouling data is created by acquiring first biological species information, which is information on biological species attached to a sample, by analyzing organisms attached to a sample to which paint has been applied in advance and which has been immersed in an evaluation water area. The paint antifouling data includes a correspondence relationship between the acquired first biological species information and the antifouling properties of a plurality of paints. As described above, the second biological species information in step P210 is acquired by analyzing organisms attached to a ship to which paint is applied and which has been immersed in a use water area. In step P230, the paint to be applied to the ship is specified using the paint antifouling data and the input data. In addition to the paint antifouling data and the input data, the paint may be specified in step P230 using price data as described above.

[0083] The paint selection system in the third embodiment described above includes a storage unit in which paint antifouling data including a correspondence between first biological species information and the antifouling properties of multiple paints is stored, an input unit that accepts input data including second biological species information, which is information on biological species that adhere to a target ship in the water area of ​​use, and an identification unit that identifies a paint to be applied to the ship using the paint antifouling data and the input data. Therefore, a paint having an antifouling property appropriate for a biological species that is likely to adhere to the ship in the water area of ​​use where the ship is used can be selected. As a result, a paint having an antifouling property appropriate for the ship can be selected.

[0084] In addition, according to an embodiment in which the price data is stored in the storage unit and the identification unit identifies the paint to be applied to the vessel using the paint antifouling data, the price data, and the second biological species information, it is possible to select an appropriate paint that takes price into consideration. As a result, it is possible to select a paint that is excellent in antifouling properties and is economical depending on the vessel.

[0085] Furthermore, in an embodiment in which the first biological species information and the second biological species information include information on the composition of biological species, it is possible to select a paint having an appropriate antifouling property according to the biological species composition in the water area in which the ship is used. Furthermore, in an embodiment in which the first biological species information and the second biological species information include information on a predetermined biological species, it is possible to select a paint having an appropriate antifouling property for any biological species that should be noted as a biological species that may adhere to the ship.

[0086] According to an embodiment in which the first biological species information and the second biological species information are information on prokaryotic species, the paint antifouling data is created using prokaryotes, which have relatively uniform cell sizes, as an index, so that paints can be selected using the paint antifouling data, which has small analytical errors regarding antifouling properties and high evaluation accuracy of antifouling properties. According to an embodiment in which the first biological species information and the second biological species information are information on eukaryotic species, the antifouling properties are evaluated using eukaryotes as an index, so that paints can be selected using paint antifouling data showing direct results, as an index can be used for example for biological species that directly contribute to increased resistance when a ship is operated, such as large seaweeds. According to an embodiment in which the first biological species information and the second biological species information are information on prokaryotic species and eukaryotic species, paints can be selected using comprehensive paint antifouling data using prokaryotes and eukaryotes as indexes.

[0087] D. Fourth embodiment The paint selection system of the fourth embodiment differs from the paint selection system of the third embodiment in the specific aspects of the paint antifouling data and the input data. The other configurations are similar to those of the paint selection system of the third embodiment, so detailed description thereof will be omitted. The paint antifouling data stored in the memory unit provided in the paint selection system of the fourth embodiment further includes first speed information related to the operating speed of the ship. Moreover, the input data in the fourth embodiment further includes second speed information related to the operating speed of the ship.

[0088] The inventors of the present application found that different species of organisms attach to ships depending on their operating speed. Based on this knowledge, the paint selection system of the fourth embodiment selects paint with appropriate antifouling properties according to the operating speed of the target ship, i.e., the operating speed.

[0089] FIG. 10 is an explanatory diagram showing an example of paint antifouling data in the fourth embodiment. In the paint antifouling data shown in FIG. 10, the antifouling properties of the paint are shown taking into consideration the first speed information related to the operating speed of the ship. In the example shown in FIG. 10, a numerical value of a predetermined speed range is used as the first speed information. More specifically, a numerical value of a speed range such as less than 15 km / h, 15 km / h to less than 30 km / h, and 30 km / h or more is used. Note that the first speed information is not limited to such a numerical value of the speed range, and may be any information such as a level indicating the operating speed. In addition, in FIG. 10, the name of a predetermined biological species is used as the first biological species information, but information on the composition of the biological species may be used. In addition, in FIG. 10, a numerical value that ranks the antifouling properties of the paint in order of the evaluation of the antifouling properties, but the antifouling properties may be indicated by any parameter such as the antifouling level of the paint or a numerical value indicating the antifouling properties of each paint.

[0090] The paint antifouling data in the fourth embodiment can be created by immersing a sample to which paint has been applied in advance in the evaluation waters, traveling at multiple travel speeds for a certain period of time, and then analyzing the organisms attached to the sample. For example, the evaluation may be performed by attaching a panel 60 as shown in FIG. 2 to the bottom of a ship or a towing buoy, or by painting the bottom of a ship with multiple paints, or by using multiple ships to which a single paint is applied. The effect of the ship's travel speed may also be evaluated without using a ship. For example, the panel 60 may be attached to a rotating drum in contact with water and operated periodically to evaluate the effect of the ship's travel speed. Also, a device capable of flowing seawater at a predetermined speed using a screw or the like may be used, and the panel 60 or a test piece may be placed in the flow path.

[0091] The second speed information regarding the operating speed of the ship is desirably set as information in the same format as the above-mentioned first speed information. For example, in a mode in which the first speed information is a numerical value within a predetermined speed range, the second speed information is desirably set by a numerical value within the predetermined speed range as well.

[0092] The input data in the fourth embodiment may include second biological species information obtained by analyzing organisms attached to the ship after immersing the ship in the water area of ​​use and operating the ship for a certain period of time at the operating speed indicated by the second speed information. That is, the input data may include the second biological species information taking the second speed information into consideration. According to such an embodiment, it is possible to obtain a result close to the organisms attached when operating the ship at the speed actually used. The input data in the fourth embodiment may include the second biological species information, which is information on the organisms attached to the ship immersed in the water area of ​​use, and the second speed information, independently of each other. The input data in this embodiment is not particularly limited, and may include, for example, the second biological species information obtained by leaving the ship stationary in the water area of ​​use and analyzing the organisms attached to the ship after a certain period of time has passed, and information on the assumed operating speed of the ship.

[0093] According to the paint selection system of the fourth embodiment described above, the first speed information related to the operating speed of the ship is included in the paint antifouling data, and the second speed information related to the operating speed of the ship is included in the input data, so that it is possible to select a paint having an appropriate antifouling property according to the operating speed of the target ship. Therefore, it is possible to select a paint having an appropriate antifouling property according to the target ship, such as a tanker with a relatively slow operating speed, a container ship with a medium operating speed, or a high-speed passenger ship or escort ship with a relatively fast operating speed.

[0094] E. Fifth embodiment The paint selection system of the fifth embodiment differs from the paint selection system of the fourth embodiment in the specific aspects of the paint antifouling data and the input data. The other configurations are similar to those of the paint selection system of the fourth embodiment, so detailed description thereof will be omitted. The paint antifouling data stored in the memory unit provided in the paint selection system of the fifth embodiment includes first frequency information regarding the operating frequency of the ship instead of first speed information regarding the operating speed of the ship. Furthermore, the input data in the fifth embodiment includes second frequency information regarding the operating frequency of the ship instead of second speed information regarding the operating speed of the ship.

[0095] The inventors of the present application found that the species of organisms that attach to a ship may differ depending on the frequency of operation of the ship. Based on this knowledge, the paint selection system of the third embodiment selects a paint having appropriate antifouling properties according to the frequency of use of the target ship, i.e., the frequency of operation.

[0096] FIG. 11 is an explanatory diagram showing an example of paint antifouling data in the fifth embodiment. In the paint antifouling data shown in FIG. 11, the antifouling properties of the paint are shown taking into consideration the first frequency information on the frequency of ship operation. In the example shown in FIG. 11, the frequency of operation such as weekends only, weekdays only, and every day is shown as the first frequency information. The first frequency information is not particularly limited, and may be shown by a numerical value such as the number of days used per week or the continuous operation time, or may be any information such as a level indicating the frequency of operation. In addition, in FIG. 11, the name of a predetermined biological species is used as the first biological species information, but information on the composition of the biological species may be used. In addition, in FIG. 11, a numerical value indicating the order of antifouling evaluation is shown as the antifouling properties of the paint, but the antifouling properties may be shown by any parameter such as the antifouling level of the paint or a numerical value indicating the antifouling properties of each paint.

[0097] The paint antifouling data in the fifth embodiment can be created by immersing a sample to which paint has been applied in advance in the evaluation waters, operating the sample for a certain period of time at multiple operating frequencies, and then analyzing the organisms attached to the sample. For example, the evaluation may be performed by attaching a panel 60 as shown in Fig. 2 to the bottom of a ship, or by painting the bottom of a ship with multiple paints, or by using multiple ships to which a single paint is applied.

[0098] The second frequency information regarding the operation frequency of the ship is desirably set as information in the same format as the above-mentioned first frequency information. For example, in a mode in which the first frequency information is a level indicating the operation frequency, it is desirably set that the second frequency information is also a level indicating the operation frequency.

[0099] The input data in the fifth embodiment may include second biological species information obtained by analyzing organisms attached to the ship after immersing the ship in the water area of ​​use and operating the ship for a certain period of time at the operating frequency indicated by the second frequency information. That is, the input data may include the second biological species information taking the second frequency information into consideration. According to such an embodiment, it is possible to obtain a result close to the organisms attached when operating the ship at the frequency of actual use. The input data in the fifth embodiment may include the second biological species information, which is information on the organisms attached to the ship immersed in the water area of ​​use, and the second frequency information, independently of each other. The input data in this embodiment is not particularly limited, and may include, for example, the second biological species information obtained by leaving the ship stationary in the water area of ​​use and analyzing the organisms attached to the ship after a certain period of time has passed, and information on the expected operating frequency of the ship.

[0100] According to the paint selection system of the fifth embodiment described above, the first frequency information on the operation frequency of the vessel is included in the paint antifouling data, and the second frequency information on the operation frequency of the vessel is included in the input data, so that it is possible to select a paint having an antifouling property appropriate for the operation frequency of the target vessel. Therefore, it is possible to select a paint having an antifouling property appropriate for the target vessel, such as a leisure boat that operates only on weekends, a fishing boat that operates for a certain period of time only on weekdays, or a tanker that operates throughout the day and night.

[0101] F. Other Embodiments The configuration of the paint selection system in each of the above embodiments is merely an example and can be modified in various ways. For example, the paint antifouling data may further include first speed information related to the operating speed of the ship and first frequency information related to the operating frequency of the ship, and the input data may further include second speed information related to the operating speed of the ship and second frequency information related to the operating frequency of the ship. According to such an embodiment, a paint having more suitable antifouling properties can be selected according to the target ship.

[0102] G. Working Example The present invention will be described in more detail below with reference to examples, but the present invention is not limited to the following examples.

[0103] In order to create paint antifouling data, first, samples were prepared to which a number of paints were applied. In this example, eight panels of fiber-reinforced plastic plates were prepared. After applying a base paint to each fiber-reinforced plastic plate, 24 sections of 7.5 cm square were created, and 22 types of antifouling paints were applied to each section. In addition, as controls, a section to which a rust-preventive paint with no antifouling effect was applied (Ctrl-1: rust-preventive) and a section to which no antifouling paint was applied (Ctrl-2: no paint) were also prepared. All eight panels had the same configuration.

[0104] Next, the samples coated with each of the above-mentioned paints were immersed in the evaluation waters. The evaluation waters were Yonabaru Marina in Okinawa Prefecture and Ginowan Marina in Okinawa Prefecture. A total of four panels were moored at 1 m in the sea at the ports of these two different evaluation waters. The panels were taken out of the sea 1, 2, 4, and 6 weeks after being submerged, and the paint on the surface was scraped off using a melamine sponge, and immediately immersed in an inactivation solution (DNA / RNA Shield, manufactured by Zymo Research) and frozen. In each evaluation water, seawater was filtered through a filter with a pore size of 0.22 μm, and the filter was frozen and stored as a control (Seawater). The volume of seawater was 1 L.

[0105] Next, the organisms attached to each sample were analyzed. Specifically, the analysis was performed using a nucleic acid analysis method. Each of the frozen sample solutions was subjected to a bead crushing treatment, and then DNA was purified using a DNA extraction kit (ZymoBIOMICS-96 DNA Kit, manufactured by Zymo Research). Using the purified nucleic acid as a template, the V3-V4 variable region of 16S rRNA and the V7-V8 variable region of 18S rRNA were amplified by PCR, and the composition of the organisms attached to each sample and the control filter was analyzed using a next-generation sequencing method. The following primers were used as PCR primers for amplification. That is, the primers used for PCR for the V3-V4 variable region of 16S rRNA were the primer 341F shown in SEQ ID NO: 1: 5'-TCGTCGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG -3' and the primer 805R shown in SEQ ID NO: 2: 5'-GTTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC -3'. The primers used for PCR for the V7-V8 variable region of 18S rRNA were the primer F1183 shown in SEQ ID NO: 3: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAATTTGACTCAACACGGG -3' and the primer R1631 shown in SEQ ID NO: 4: 5'-GTTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTACAAAGGGCAGGGACG -3'. After purifying the PCR product, an index sequence for sample identification was added by PCR, and the DNA was purified. The base sequence of the obtained DNA was analyzed using next-generation sequencing. For the next-generation sequencing method in this example, MiSeq manufactured by Illumina was used. The V3-V4 variable region of 16S rRNA was used for the purpose of detecting prokaryotes, and the V7-V8 variable region of 18S rRNA was used for the purpose of detecting eukaryotes.

[0106] Then, using QIIME2, a bacterial flora analysis software, the taxonomic information of the organisms was obtained from the base sequences obtained by next-generation sequencing. Noise was removed using the DADA2 plug-in, and the taxonomic information was obtained by referencing the rRNA database (SILVA ver.138). After diluting the number of sequences to approximately 29,000 sequences for 16S rRNA genes and approximately 16,000 sequences for 18S rRNA per sample or seawater collected from each section, the composition of the attached organisms was analyzed.

[0107] Next, the antifouling properties of each paint were evaluated using the analysis results of the composition of the organisms, and paint antifouling property data was created that shows the correspondence between the location information of the evaluation water area and the antifouling properties of multiple paints, as used in the first and second embodiments. Similarly, the antifouling properties of each paint were evaluated using the analysis results of the composition of the organisms, and paint antifouling property data that shows the correspondence between the first biological species information and the antifouling properties of multiple paints, as used in the third to fifth embodiments, was created. An example of the antifouling property evaluation of each paint is shown below.

[0108] FIG. 12 is an explanatory diagram showing the amount of sea squirts (Class: Ascidiacea) and bryozoans (Class: Gymnolaemata) attached in Ginowan Marina. FIG. 13 is an explanatory diagram showing the amount of sea squirts and bryozoans attached in Yonabaru Marina. In FIG. 12 and FIG. 13, the species of organisms attached to each sample during the 6-week evaluation period are analyzed. The vertical axis of FIG. 12 and FIG. 13 shows the relative frequency of occurrence of sea squirts or bryozoans when the total amount of organisms attached to each sample is set to 1. From the results shown in FIG. 12 and FIG. 13, it was found that the amount of sea squirts attached varies greatly depending on the type of paint in both the evaluation water areas of Ginowan Marina and Yonabaru Marina. In addition, by comparing the results of the two evaluation water areas, it was found that the amount of sea squirts attached varies even with the same paint. In addition, it was found that the amount of bryozoans attached varies greatly in the evaluation water areas of the two locations. More specifically, while almost no bryozoan adhesion was observed at Ginowan Marina, the relative frequency of bryozoan appearance in the control samples that were not painted at Yonabaru Marina was close to 1, indicating that this is a water area where bryozoans are likely to adhere. Additionally, it was found that the amount of bryozoan adhesion varied depending on the type of paint at Yonabaru Marina. Based on these findings, it was found that at Yonabaru Marina, paints with less bryozoan adhesion can be evaluated as having higher antifouling properties.

[0109] The following paint antifouling data is assumed to be created from the results shown in Fig. 12 and Fig. 13. For example, in Ginowan Marina, the paint antifouling data used in the first and second embodiments may be ranked in order of antifouling properties, with the amount of sea squirts as an index, with paint F ranked first, paint D ranked second, paint C ranked third, paint A ranked fourth, and paint V and paint S ranked fifth. Paints F, D, C, and A may be ranked as level 5, which is the highest level of antifouling properties, and paints V, S, U, and O may be ranked as level 4. For example, in Yonabaru Marina, the paint I, E, and M may be ranked as level 5, which is the highest level of antifouling properties, and paints N, L, K, R, and G may be ranked as level 4, with the amount of bryozoans as an index.

[0110] In addition, as the paint antifouling data used in the above third to fifth embodiments, for example, as paints effective against sea squirts as the first biological species information, paints that reduced the amount of sea squirts attached at both marinas may be selected and ranked as follows: paint C is ranked first, paint A is ranked second, paint D is ranked third, paint F is ranked fourth, and paint O and paint S are ranked fifth. Paints C, A, D, and F may be ranked as level 5, which is the highest level of antifouling, and paints O, S, U, and V may be ranked as level 4. In addition, for example, as paints effective against bryozoans as the first biological species information, paints I, E, and M may be ranked as level 5, which is the highest level of antifouling, and paints N, L, K, R, and G may be ranked as level 4 in order of antifouling ability with reference to the test results at Yonabaru Marina.

[0111] The paint to be applied to the ship was selected using the paint antifouling data created. More specifically, biological fouling from a ship anchored at a specific port was collected and the biological species was analyzed using the same method as the above sample, and it was found that bryozoans were prioritized. Therefore, by inputting the input data "bryozoans" as the second biological species information, paint I, which is particularly inexpensive, was identified and output from among paints I, E, and M, which have a high antifouling effect against bryozoans as the first biological species information. In addition, biological fouling from a ship sailing a different route was collected and the biological species was analyzed using the same method as the above sample, and it was found that sea squirts were prioritized. Therefore, by inputting the input data "sea squirt" as the second biological species information, paint C, which has a high antifouling effect against sea squirts as the first biological species information, was identified and output.

[0112] FIG. 14 is an explanatory diagram showing a comparison of the Shannon diversity index obtained by the analysis of prokaryotes in Ginowan Marina for each sample. FIG. 15 is an explanatory diagram showing a comparison of the Shannon diversity index obtained by the analysis of prokaryotes in Yonabaru Marina for each sample. In FIG. 14 and FIG. 15, the diversity (α diversity) of prokaryotes attached to each sample is analyzed for each sample during the 6-week evaluation period. The lower the Shannon diversity index (Shannon index) value, the more effective the paint is against prokaryotes. For this reason, it was found that paint G, paint E, and paint J may be evaluated as having particularly high antifouling properties at Ginowan Marina. Similarly, it was found that paint S, paint N, and paint E may be evaluated as having particularly high antifouling properties at Yonabaru Marina. It was also found that paint G, paint E, and paint J may be evaluated as having particularly high antifouling properties for the biofouling composition at Ginowan Marina. Similarly, it was found that paints S, N and E could be evaluated as having particularly high antifouling properties against the biofouling composition at Yonabaru Marina.

[0113] The following paint antifouling data is assumed to be created from the results shown in Figures 14 and 15. For example, in Ginowan Marina, paints may be ranked in order of antifouling ability using the Shannon Diversity Index of prokaryotes as an index, with paint G ranked first, paint E ranked second, paint J ranked third, paint I ranked fourth, and paint L ranked fifth. Similarly, in Yonabaru Marina, paint S may be ranked in order of antifouling ability, with paint N ranked first, paint E ranked third, paint H ranked fourth, and paint G ranked fifth.

[0114] Furthermore, as the paint antifouling property data used in the above third to fifth embodiments, for example, the first biological species information on the biofouling composition of Ginowan Marina may be ranked in order of antifouling property, using the Shannon diversity index of prokaryotes as an index, with paint G in first place, paint E in second place, paint J in third place, paint I in fourth place, and paint L in fifth place. Similarly, the first biological species information on the biofouling composition of Yonabaru Marina may be ranked in order of antifouling property, with paint S in first place, paint N in second place, paint E in third place, paint H in fourth place, and paint G in fifth place.

[0115] The paint to be applied to the vessel was selected using the created paint antifouling data. More specifically, biofouling from a specific vessel was collected and the biological species were analyzed using the same method as for the above sample. When the input data of the biological species composition was input as the second biological species information based on the analysis results, it was identified as being very similar to the biological species composition in Ginowan Marina, and paint G, which has a high antifouling effect against the biological fouling composition in Ginowan Marina, was identified and output. In addition, biofouling from a vessel sailing on a different route was collected and the biological species were analyzed using the same method as for the above sample. When the input data of the biological species composition was input as the second biological species information based on the analysis results, it was identified as being very similar to the biological species composition in Yonabaru Marina, and paint S, which has a high antifouling effect against the biological fouling composition in Yonabaru Marina, was identified and output.

[0116] FIG. 16 is an explanatory diagram showing the transition of the Shannon diversity index and the number of observed sequence types obtained by the analysis of prokaryotes. In the four graphs shown in FIG. 16, the horizontal axis indicates the evaluation period, and the graph in the upper left of the figure shows the transition of the Shannon diversity index at Ginowan Marina, and the graph in the upper right of the figure shows the transition of the Shannon diversity index at Yonabaru Marina. In addition, the graph in the lower left of the figure shows the transition of the total number of sequence types observed at Ginowan Marina, and the graph in the lower right of the figure shows the transition of the total number of sequence types observed at Yonabaru Marina. From the results shown in FIG. 16, it can be seen that the diversity gradually increases as the evaluation period becomes longer, and the diversity index is similar between the evaluation periods of 4 weeks and 6 weeks. In addition, it was found that when prokaryotes were analyzed, the influence of the number of sequenced sequences is small, making it suitable for evaluating paints by diversity.

[0117] FIG. 17 is an explanatory diagram showing the transition of the ranking of the antifouling properties of the paints based on the results shown in FIG. 16. In the four graphs shown in FIG. 17, the horizontal axis indicates the evaluation period, the graph in the upper left of the figure shows the ranking based on the Shannon diversity index in Ginowan Marina, and the graph in the upper right of the figure shows the ranking based on the Shannon diversity index in Yonabaru Marina. In addition, the graph in the lower left of the figure shows the ranking based on the total number of species of sequences observed in Ginowan Marina, and the graph in the lower right of the figure shows the ranking based on the total number of species of sequences observed in Yonabaru Marina. From the results shown in FIG. 17, paint E and paint G tend to have lower diversity throughout the evaluation period compared to other paints, and therefore the rank of the antifouling properties of the paints was high. For this reason, it was found that paint E and paint G may have excellent antifouling properties in the evaluation waters of both Ginowan Marina and Yonabaru Marina. It was also found that paint E and paint G may have excellent antifouling properties for the biological species composition in the evaluation waters of both Ginowan Marina and Yonabaru Marina.

[0118] The following paint antifouling data is assumed to be created from the results shown in Figures 16 and 17. For example, in Ginowan Marina, the paints may be ranked in order of antifouling properties, using the number of types of sequences observed in the sixth week of the evaluation period as an index, with Paint J ranked first, Paint G ranked second, Paint E ranked third, Paint H ranked fourth, and Paint L ranked fifth. Similarly, in Yonabaru Marina, Paint Q may be ranked first, Paint N ranked second, Paint A ranked third, Paint H ranked fourth, and Paint G ranked fifth.

[0119] Furthermore, as the paint antifouling data used in the third to fifth embodiments, for example, the first biological species information on the biofouling composition of Ginowan Marina may be ranked in order of antifouling ability, using the number of sequence types observed in the sixth week of the evaluation period as an index, with paint J ranked first, paint G ranked second, paint E ranked third, paint H ranked fourth, and paint L ranked fifth. Similarly, the first biological species information on the biofouling composition of Yonabaru Marina may be ranked in order of antifouling ability, with paint Q ranked first, paint N ranked second, paint A ranked third, paint H ranked fourth, and paint G ranked fifth.

[0120] The paint to be applied to the vessel was selected using the paint antifouling data created. More specifically, a panel was installed on a specific vessel, and the biological species composition after one week of evaluation was examined using the above method. When the biological species composition after one week of evaluation as the second biological species information and the immersion period of "one week" were input, it was identified as being very similar to the biological species composition after one week at Ginowan Marina, and it was estimated that there would be a change in biological adhesion similar to that at Ginowan Marina. Therefore, paint G, which has the highest antifouling effect against the biological species composition after six weeks of evaluation at Ginowan Marina, was identified and output.

[0121] FIG. 18 is an explanatory diagram showing the evaluation results of eukaryotic β diversity in Ginowan Marina by PCA analysis of Aitchison distance. FIG. 19 is an explanatory diagram showing the evaluation results of eukaryotic β diversity in Yonabaru Marina by PCA analysis of Aitchison distance. In FIG. 18 and FIG. 19, the diversity between multiple samples is analyzed by analyzing the eukaryotic organisms attached to each sample during the 6-week evaluation period. According to this analysis, the greater the plot distance from the control sample, the more effective the paint is for eukaryotic organisms as a whole. Therefore, as shown in FIG. 18 and FIG. 19, it was found that the paint located in the range surrounded by the dashed line in each evaluation water area may be evaluated as having high antifouling properties. In addition, it was found that the paint located in the range surrounded by the dashed line in each evaluation water area may be evaluated as having high antifouling properties for the first biological species information regarding the biofouling composition of each evaluation water area.

[0122] The paint antifouling data created was used to select paints to be applied to vessels. More specifically, biofouling from a specific vessel was collected and analyzed for species using the same method as for the above sample. When data on the eukaryotic species composition was input as the second species information based on the analysis results, it was identified as being very similar to the species composition at Ginowan Marina, and paints E, H, and J with high antifouling effects against the biofouling composition at Ginowan Marina were identified and output.

[0123] In another example, a paint selected based on the results of the antifouling evaluation was applied to a ship, and after several months, the organisms attached to the ship were checked. The details of the test are described below.

[0124] In order to create paint antifouling data, first, samples were prepared to which multiple paints were applied. In this example, one panel of fiber-reinforced plastic plate was prepared. After applying a base paint to the fiber-reinforced plastic plate, 96 sections of 5 cm square were prepared, and 31 types of antifouling paints (A to Z and a to f) were applied to three randomly selected sections. In addition, three sections (Ctrl) to which no antifouling paint was applied were prepared as controls.

[0125] Next, a panel containing samples coated with each of the above-mentioned multiple paints was immersed in the evaluation waters. The evaluation waters used were Laguna Marina in Gamagori City, Aichi Prefecture. The panel was moored 1 m underwater and removed from the sea after 4 weeks. Figure 20 is an explanatory diagram showing the panel removed from the sea. After that, the adhesions on the paint surface were scraped off using a melamine sponge, and the panel was brought back to the laboratory after being refrigerated. The scraped-off attached organisms were then suspended in ultrapure water, and a portion of the suspension was immediately frozen and stored.

[0126] Next, the organisms attached to each sample were analyzed. Specifically, the analysis was performed using a nucleic acid analysis method. After each of the frozen and stored sample solutions was subjected to a bead crushing treatment, DNA was purified using a DNA extraction kit (DNeasy 96 Blood & Tissue Kit, manufactured by Qiagen). Using the purified DNA as a template, the V3-V4 variable region of 16S rRNA was amplified by PCR using the primers shown in SEQ ID NOs: 1 and 2. The obtained PCR product was then purified, and an index sequence for sample identification was added by PCR, and the DNA was purified. The base sequence of the obtained DNA was then sequenced using MiSeq manufactured by Illumina, and the composition of the prokaryotes attached to each sample was analyzed.

[0127] Then, the taxonomic information of prokaryotes was obtained from the base sequences obtained by next-generation sequencing using the bacterial flora analysis software QIIME2. Noise was removed using the DADA2 plug-in, and the taxonomic information was obtained by referencing the rRNA database (SILVA ver.138). After diluting the number of sequences to approximately 39,000 sequences per sample collected from each plot, the composition of attached organisms was analyzed.

[0128] FIG. 21 is an explanatory diagram showing the total number of sequences derived from prokaryotes detected in each sample. In FIG. 21, the horizontal axis shows samples coated with 31 types of antifouling paints and samples not coated with antifouling paints, and the vertical axis shows the total number of sequence variants derived from prokaryotes attached to the surface. In FIG. 21, the analysis results of three sections for each sample are shown as box plots. Based on the results of FIG. 21, paint G, which had the smallest total number of detected species, was selected as the best paint for Laguna Marina. In addition, paint W, which had a relatively large total number of detected species among paints commonly used as paints for ships, was selected as a paint with low effectiveness in Laguna Marina, that is, as a control paint for Laguna Marina.

[0129] Next, the antifouling effect of the selected paints was confirmed on an actual vessel. Paint G and Paint W were applied to the rear and front of the bottom of a center console boat (manufactured by Yamaha, 21 feet long) operated at Laguna Marina. The vessel was operated and lifted by a crane two months, four months, and six months after painting, and the degree of biofouling was visually confirmed.

[0130] FIG. 22 is an explanatory diagram showing the state of biofouling on a ship laid out six months after painting. The right half of the photograph shown in FIG. 22 shows the area where paint G was applied, and the left half of the photograph shows the area where paint W was applied. In the area where paint G, selected as the optimal paint, was applied, there was little barnacle adhesion two months after painting, four months after painting, and six months after painting. In other words, in the area where paint G was applied, barnacle adhesion was clearly suppressed. In contrast, in the area where paint W, selected as the control paint, was applied, there was a lot of barnacle adhesion. In other words, in the area where paint W was applied, barnacle adhesion was not suppressed. These results show that the optimal paint selected by DNA analysis is useful for preventing biofouling on the bottom of an actual ship located at the same location.

[0131] The present invention is not limited to the above-mentioned embodiment, and can be realized in various configurations without departing from the spirit of the present invention. For example, the technical features in the embodiments and examples corresponding to the technical features in each form described in the Summary of the Invention column can be appropriately replaced or combined in order to solve some or all of the above-mentioned problems or to achieve some or all of the above-mentioned effects. Furthermore, if a technical feature is not described as essential in this specification, it can be appropriately deleted. [Explanation of symbols]

[0132] 10... memory unit, 12... paint selection program, 14... paint antifouling data, 16... price data, 20... input unit, 30... identification unit, 40... output unit, 50... sample, 60... panel, 100... paint selection system

Claims

1. 1. A paint selection system for selecting a paint, comprising: A storage unit in which paint antifouling property data including a correspondence relationship between location information of the evaluation water area and the antifouling properties of a plurality of paints is stored; An input unit that accepts input of location information of a specific water area; An identification unit that identifies the paint to be used in the specific water area using the paint antifouling property data and the location information of the specific water area; an output unit that outputs identification information of the specified paint; Equipped with The paint antifouling data is The paint is applied to a sample in advance, and the sample is immersed in the evaluation water area, and the sample is prepared by analyzing organisms attached to the sample. Paint selection system.

2. 2. The paint selection system according to claim 1, The storage unit stores price data corresponding to each of the plurality of paints, The identification unit identifies the paint to be used in the specific water area using the paint antifouling property data, the price data, and the location information of the specific water area. Paint selection system.

3. In the paint selection system according to claim 1 or 2, The paint antifouling data includes a plurality of pieces of location information of the evaluation water area, The identification unit is determining whether the location information of the specific water area is the same as any one of the location information of the plurality of evaluation water areas; If it is determined that the paints are the same, the paint is identified based on the paint antifouling data in the evaluation water area determined to be the same; If it is determined that the paints are not the same, the paint is identified based on the paint antifouling data of the evaluation water area that is closest to the specific water area among the plurality of evaluation water areas. Paint selection system.

4. In the paint selection system according to claim 1 or 2, The organisms analyzed in the preparation of the paint antifouling data are prokaryotes. Paint selection system.

5. In the paint selection system according to claim 1 or 2, The organism analyzed in the preparation of the paint antifouling data is a eukaryote. Paint selection system.

6. In the paint selection system according to claim 1 or 2, The organisms analyzed in the preparation of the paint antifouling data are prokaryotes and eukaryotes; Paint selection system.

7. In the paint selection system according to claim 1 or 2, The paint is a paint used for ships. Paint selection system.

8. 1. A paint selection method for selecting a paint, comprising: A step of analyzing organisms attached to a sample to which the paint has been applied in advance and which has been immersed in an evaluation water area, thereby creating paint antifouling property data including a correspondence relationship between location information of the evaluation water area and the antifouling properties of a plurality of the paints; Receiving input of location information of a specific water area; A step of identifying the paint to be used in the specific water area using the paint antifouling data and the location information of the specific water area; outputting identification information of the identified paint; Including, How to choose paint.

9. 1. A paint selection system for selecting a paint for a marine vessel, comprising: A storage unit in which paint antifouling property data including a correspondence between first biological species information, which is information on biological species attached to a sample to which the paint has been applied in advance and which has been immersed in an evaluation water area, and the antifouling properties of a plurality of the paints is stored; an input unit that accepts input of input data including second biological species information, which is information on biological species attached to the vessel immersed in a water area in which the vessel is used; an identification unit that identifies the paint to be applied to the ship using the paint antifouling property data and the input data; an output unit that outputs identification information of the specified paint; Equipped with Paint selection system.

10. 10. The paint selection system according to claim 9, The storage unit stores price data corresponding to each of the plurality of paints, The identification unit identifies the paint to be applied to the ship using the paint antifouling property data, the price data, and the second biological species information. Paint selection system.

11. In the paint selection system according to claim 9 or 10, The first biological species information and the second biological species information include information regarding the composition of biological species. Paint selection system.

12. In the paint selection system according to claim 9 or 10, The first biological species information and the second biological species information include information on a predetermined biological species. Paint selection system.

13. In the paint selection system according to claim 9 or 10, The first biological species information and the second biological species information are information on prokaryotic species. Paint selection system.

14. In the paint selection system according to claim 9 or 10, The first biological species information and the second biological species information are information on eukaryotic species. Paint selection system.

15. In the paint selection system according to claim 9 or 10, The first biological species information and the second biological species information are information on a prokaryotic species and a eukaryotic species, Paint selection system.

16. In the paint selection system according to claim 9 or 10, The paint antifouling data further includes first speed information relating to a sailing speed of the vessel; The input data further includes second speed information relating to a sailing speed of the vessel. Paint selection system.

17. In the paint selection system according to claim 9 or 10, The paint antifouling data further includes first frequency information regarding a frequency of operation of the ship; The input data further includes second frequency information relating to an operation frequency of the vessel. Paint selection system.

18. 1. A paint selection method for selecting a paint for a marine vessel, comprising: acquiring second biological species information, which is information on the biological species attached to the ship, by analyzing the biological species attached to the ship to which the paint is applied and the ship is immersed in a water area in which the ship is used; receiving input data including the second biological species information; Identifying the paint to be applied to the ship using paint antifouling property data including a correspondence relationship between first biological species information and the antifouling properties of the paints, and the input data; outputting identification information of the identified paint; Including, The paint antifouling property data is created by acquiring the first biological species information, which is information on the biological species attached to the sample, by analyzing the biological species attached to the sample, which is a sample to which the paint has been applied in advance and which has been immersed in an evaluation water area. How to choose paint.

Images