Bordetella strains expressing serotype 3 fimbriae

Abstract

To provide a vaccine for preventing pertussis capable of reducing asymptomatic Bordetella infection, in particular, asymptomatic B. pertussis infection (asymptomatic colonization).SOLUTION: A vaccine comprises a live attenuated Bordetella strain engineered to stably produce serotype 3 fimbriae (Fim3), where the live attenuated Bordetella strain retains the ability to colonize a mammalian subject's lungs and induce a protective immune response against Bordetella infection.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 574,068, filed October 18, 2017.

[0002] Sequence Listing This application has been submitted electronically in ASCII format and contains a Sequence Listing, which is incorporated herein by reference in its entirety. The above ASCII copy, created on October 10, 2018, is designated 7056-0091_SL and is 1,833 bytes in size.

[0003] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT Not applicable.

[0004] The present invention relates generally to the fields of microbiology, immunology, vaccinology, seroepidemiology, biochemistry and medicine. More particularly, the present invention relates to live attenuated Bordetella strains engineered to express serotype 3 fimbriae and their use in vaccines. [Background technology]

[0005] Whooping cough (or pertussis) is a potentially life-threatening respiratory disease, particularly in young infants. According to the World Health Organization (WHO), its incidence is increasing in several countries, despite a global vaccination rate exceeding 85%. However, pertussis also affects adolescents and adults, but symptoms are typically atypical, leading to the disease often remaining undiagnosed in these age groups. Nevertheless, adolescents and adults can transmit the causative pathogen, Bordetella pertussis, to young infants before they are protected by the first series of vaccinations, even if they remain asymptomatic. Indeed, recent wavelet analysis of B. pertussis infections in the United States and the United Kingdom, coupled with phylodynamic analysis of clinical isolates, demonstrated that asymptomatic transmission is a major factor in recent pertussis resurgences. Furthermore, asymptomatic B. pertussis infection is not reassuring, as epidemiological evidence suggests that B. pertussis infection may be associated with autoimmune diseases such as celiac disease, multiple sclerosis, and even Alzheimer's disease.

[0006] Currently available whole-cell or acellular vaccines have been highly effective in reducing the incidence of pertussis after the first three vaccine doses. However, in contrast to previous infections with B. pertussis, they are much less effective at reducing asymptomatic colonization, as demonstrated in a recently established baboon model. Vaccinated baboons were protected from pertussis disease after experimental infection with B. pertussis, but, in contrast to convalescent baboons, were able to readily infect and transmit the organism to their littermates even in the absence of symptoms. These observations clearly illustrate the shortcomings of currently available vaccines, and new vaccines that protect against both disease and infection are needed.

[0007] Based on the observation that the best way to protect against B. pertussis colonization is previous infection, a live-attenuated vaccine that can be administered intranasally has been developed to mimic natural infection as closely as possible without eliciting disease. The vaccine strain, designated BPZE1, lacks the gene encoding dermonecrotic toxin, produces a genetically detoxified pertussis toxin, and tracheal cytotoxin production is deleted by replacing the B. pertussis ampG gene with the Escherichia coli ampG gene. BPZE1 has been shown to be safe in preclinical models, including severely immunocompromised mice, and to be genetically stable after serial passage in vitro and in vivo for at least 12 months. BPZE1 protected mice against B. pertussis challenge after a single intranasal administration by both protective CD4+ T cells and antibodies, and this protection was shown to be durable even after a single intranasal administration. BPZE1 has also recently been shown to reduce nasopharyngeal infections with B. pertussis in baboons by 99.992% compared to unvaccinated baboons. BPZE1 has now successfully completed a first-in-man Phase I clinical trial and has been found to be safe in adult humans, capable of transiently colonizing the human nasopharynx, and to induce immune responses to all test antigens in all colonized individuals.

[0008] B. pertussis produces two serologically distinct fimbriae composed of either Fim2 or Fim3 as the major pilus subunit. These fimbriae are involved in bacterial adherence to respiratory epithelial cells. BPZE1 produces only Fim2 but also hundreds of other antigens (e.g., pertussis toxin, FHA, and pertactin). BPZE1 has therefore been shown to induce significant protection against a wide variety of clinical B. pertussis isolates, including those that produce only Fim3. Summary of the Invention

[0009] Described herein is the development of BPZE1f3, a B. pertussis strain derived from BPZE1 that produces both serotype 2 fimbriae (Fim2) and serotype 3 fimbriae (Fim3), deposited on October 11, 2017, at the Collection Nationale de Cultures de Microorganismes (CNCM, Institut Pasteur, 25 rue du Docteur Roux, F-75724 Paris Cedex 15, France) under accession number CNCM I-5247. Given that BPZE1 produces hundreds of non-fimbrial antigens that could potentially be targeted by the immune response, it was not expected that adding a single novel antigen would have a significant effect on bacterial protection. Thus, surprisingly, vaccination with BPZE1f3 was found to significantly improve protection against a given clinical isolate that produces Fim3 but not Fim2.

[0010] In the studies described in the Examples section below, we used an intranasal mouse challenge model to test the protective potential of Fim2-producing BPZE1 and Fim2- and Fim3-producing BPZE1f3 to protect against clinical isolates of various serotypes. Both vaccine strains appeared to induce significant protection against all clinical isolates tested. However, BPZE1f3 provided significantly better protection than BPZE1 against clinical isolates producing only Fim3, confirming a degree of serospecific protection.

[0011] Numerous Fim2 and Fim3 subtypes have been identified. These include two Fim2 subtypes, Fim2-1 and Fim2-2, which differ from each other by a single amino acid difference. Fim2-1 has an arginine at position 174, whereas this is changed to a lysine in Fim2-2. Fim3 subtypes are encoded by six different alleles. Fim3-2 differs from Fim3-1 by a single amino acid substitution at position 87: alanine and glutamate for Fim3-1 and Fim3-2, respectively. Fim3-3 has a change from threonine in Fim3-1 to alanine in Fim3-3 in addition to the glutamate substitution at position 87. The fim3-4 allele differs from fim3-1 by only a single silent nucleotide polymorphism, while the other five alleles differ by three codons, each resulting in an amino acid change in the major pilus subunit. Given the slight sequence differences between the various subtypes, BPZE1f3 is likely to be protective against all of them.

[0012] To induce an immune response against pilus antigens, production of these antigens must be sufficiently stable in live B. pertussis vaccine strains. The stability of Fim2 and Fim3 production deserves special attention because phase variation from one serotype to another, particularly during infection, has been described and may be driven by vaccine pressure. This phase transition from high to low pilus production depends on the number of cytosines present in the C-string within the fim promoter region. The number of cytosines within the C-string may affect the distance between the -10 box of the fim promoter and the binding site of BvgA, a transcriptional activator required for expression of fim and other B. pertussis virulence genes. It has been known for many years that DNA regions with repeated base pair sequences, mostly within the C-string, are particularly prone to single-base additions or deletions. Because BPZE1f3 was constructed by adding a single C:G base pair in a stretch of 13C within the promoter region to enable fim3 expression, it was anticipated that fim3 expression would be unstable. Unexpectedly, however, after several passages of BPZE1f3 through mice, 100% of bacteria recovered after the first passage remained Fim3+ and Fim2+. During subsequent passages (up to three passages), nearly 90% of bacteria still expressed both fim3 and fim2, indicating that this was sufficiently stable to induce serotype-specific immunity, as confirmed by the protective effect of BPZE1f3 against clinical isolates that produced only Fim3.

[0013] Thus, described herein are live, attenuated Bordetella strains engineered to stably produce Fim3, which retain the ability to colonize the lungs of a mammalian subject and induce a protective immune response against Bordetella infection (e.g., the Bordetella strain designated BPZE1f3). The live, attenuated Bordetella strains can also stably produce Fim2. The live, attenuated Bordetella strains described herein can further be deleted for at least one (1, 2, or 3) of the following virulence factors: functional pertussis toxin (PTX), functional dermonecrotic toxin (DNT), and functional tracheal cytotoxin (TCT).

[0014] Further described herein is a vaccine comprising a live attenuated Bordetella strain engineered to stably produce Fim3 as described herein and a pharmaceutically acceptable carrier. The vaccine is administered to at least 1 x 10 6 (e.g., at least 1 × 10 6 , 5×10 6 Or 1 x 10 7 ) colony forming units (CFU) of the strain.

[0015] Further described herein is a method for protecting a mammalian subject (e.g., a human) from developing whooping cough, comprising administering to the mammalian subject a vaccine comprising a pharmaceutically acceptable carrier and a live, attenuated Bordetella strain engineered to stably produce Fim3, wherein the live, attenuated Bordetella strain retains the ability to colonize the lungs of the mammalian subject and to induce a protective immune response against Bordetella infection. [Means for solving the problem]

[0016] As used herein, a bacterial strain that "stably produces" an antigen is one that can be passaged at least once (e.g., 1, 2, 3, 4, 5 or more times) through a host animal without losing more than 50% (or 60, 70, 80, 90, 95, 97, 98, or 99%) of its expression. For example, an isolated Bordetella bacterial strain that has been engineered to stably produce Fim3 is one that has been genetically modified to express Fim3 and maintains at least 50% (e.g., 50, 60, 70, 80, 90, 95, 97, 98, or 99%) of its expression after being passaged through a single mouse, e.g., by the methods described in the Examples section below.

[0017] Reference to a "functional" virulence factor means that a bacterial strain has at least 50% of the enzymatic activity of that virulence factor compared to the wild-type version of that virulence factor. A bacterial strain "in which at least one virulence factor has been deleted" is a strain that has been engineered to express less than 70, 80, 90, 95, 96, 97, 98, or 99% of the enzymatic or functional activity of a virulence factor compared to the parent strain from which it is derived.

[0018] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patents, and patent applications mentioned herein are incorporated by reference in their entirety. In the case of conflict, the present specification, including definitions of terms, will control. Additionally, the specific embodiments discussed below are illustrative only and not intended to be limiting. [Brief explanation of the drawings]

[0019] [Figure 1]Figure 1A is a graph showing the production of Fim2 by BPZE1 (diamonds) and BPZE1f3 (squares), and Figure 1B is a graph showing the production of Fim3 by BPZE1 (diamonds) and BPZE1f3 (squares). [Figure 2] Figure 2A is a graph showing the in vitro growth of BPZE1 (diamonds) and BPZE1f3 (squares) in modified Stainer-Scholte medium, and Figure 2B is a graph showing the in vitro growth of BPZE1 (diamonds) and BPZE1f3 (squares) in synthetic Thijs medium. [Figure 3] FIG. 3 is a graph showing lung colonization in mice inoculated intranasally with 10 CFU of BPZE1 (black) or BPZE1f3 (gray), and the bacterial burden in the lungs was measured at the indicated time points. [Figure 4] Figure 4 is a series of graphs (4A–4E) showing BPZE1- and BPZE1f3-induced protection against clinical B. pertussis isolates. Mice received 10 CFU of either BPZE1 (black bars) or BPZE1f3 (gray bars) intranasally, or were left untreated (white bars). Four weeks after vaccination, mice were challenged with 10 CFU of 1617pF1 (A), 403pF1 (B), P134 (C), 1412pF1 (D), or 403pF3 (E). Three hours (left panel, D0) or seven days (right panel, D7) after challenge, bacterial burden in the lungs was measured and presented as the mean and standard deviation of CFU. Three mice (for D0) or five (for D7) mice were used per group. ***, p<0.001. [Figure 5]Figure 5 is a graph comparing BPZE1- and BPZE1f3-induced protection against B. parapertussis. Mice received 10 CFU of either BPZE1 (black bars) or BPZE1f3 (gray bars) intranasally, or were left untreated (white bars). Two months after vaccination, mice were challenged with 10 CFU of B. parapertussis. Three hours (left panel, D0) or seven days (right panel, D7) after challenge, bacterial burden in the lungs was measured and presented as the mean and standard deviation of CFU. Three mice (for D0) or five mice (for D7) were used per group. ***, p<0.001. [Figure 6] Figure 6 is a graph showing the stability of Fim2 and Fim3 production by BPZE1f3. BPZE1f3 was passaged three times in mice, and at each passage (P1 to P3), 94 colonies were analyzed by whole-cell ELISA for the presence of Fim2 (white bars) and Fim3 (black bars) using anti-Fim2 and anti-Fim3 monoclonal antibodies. DETAILED DESCRIPTION OF THE INVENTION

[0020] Described herein are Fim3-producing BPZE1 derivatives with sufficiently stable fim3 expression to provide improved protection against clinical B. pertussis isolates that produce only Fim3 in mice. Expression of fim3 in BPZE1f3 did not alter protective efficacy against Fim2+ strains, nor did it alter protective efficacy against strains that produce neither Fim2 nor Fim3. The embodiments described below exemplify representative examples of these methods. Nonetheless, from the description of these embodiments, other aspects of the invention can be made and / or practiced based on the description provided below.

[0021] General methodology The methods described herein encompass conventional microbiology, immunology, molecular biology, and medical techniques. Microbiological methods are described in Methods for General and Molecular Microbiology (3rd Ed), Reddy et al., ed., ASM Press. Immunological methods are generally known in the art and are described in methodology treatises such as, for example, Current Protocols in Immunology, Coligan et al., ed., John Wiley & Sons, New York. Molecular biology techniques are described in detail in treatises such as, for example, Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Sambrook et al., ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001; and Current Protocols in Molecular Biology, Ausubel et al., ed., Greene Publishing and Wiley-Interscience, New York. General methods of medical therapy are described in McPhee and Papadakis, Current Medical Diagnosis and Treatment 2010, 49th Edition, McGraw-Hill Medical, 2010; and Fauci et al., Harrison's Principles of Internal Medicine, 17th Edition, McGraw-Hill Professional, 2008.

[0022] Fim3-producing Bordetella strains Bordetella species lacking Fim3 expression (e.g., Bordetella pertussis, Bordetella parapertussis, and Bordetella bronchiseptica) can be genetically modified to produce Fim3 (e.g., Fim3-1, Fim3-2, Fim3-3, or Fim3-4) and otherwise attenuated as described below. These Fim3-producing bacteria can be used to treat and / or prevent symptomatic or asymptomatic respiratory infections caused by Bordetella species, as well as other conditions for which BPZEI has proven effective (e.g., allergies and asthma). Bordetella strains engineered to produce Fim3 can also be used to prevent the transmission of Bordetella infections. Attenuated Fim2 / Fim3-producing Bordetella pertussis is preferred for use in human subjects. Bordetella strains for use in generating Fim3-producing bacteria can be isolated from natural sources (e.g., colonized subjects) or obtained from various culture collections. Bordetella strains engineered to produce Fim3 can be generated by the methods described below.

[0023] Because insufficient attenuation of a pathogenic Bordetella strain can induce pathological infection in a subject, it is preferable that a Bordetella strain engineered to produce Fim3 have low levels of other virulence factors. On the other hand, to ensure that a Fim3-producing Bordetella strain can colonize a subject and exert a protective effect against respiratory inflammation, the strain must not be overly attenuated. Attenuation can be achieved by mutating the strain to reduce production of one or more (e.g., 1, 2, 3, 4, 5, or more) of the following: pertussis toxin (PTX), dermonecrotic toxin (DNT), tracheal cytotoxin (TCT), adenylate cyclase (AC), lipopolysaccharide (LPS), filamentous hemagglutinin (FHA), pertactin, or any BVG regulatory components. Methods for generating such mutants are described herein and in U.S. Patent No. 9,119,804 and U.S. Patent Application No. 15 / 472,436. In the experiments presented below, Bordetella strains were engineered to be deleted in the DNT and TCT, producing Fim3, which produces a genetically inactive PTX. The strains were also able to colonize the respiratory tract of subjects and induce a protective immune response in the subjects.

[0024] Preparation / Dose / Administration Bordetella strains engineered to produce Fim3 can be prepared as vaccines for administration to subjects. A suitable number of live bacteria is mixed with a pharmaceutically suitable excipient or carrier, such as phosphate-buffered saline, distilled water, an emulsion, such as an oil-in-water emulsion, various types of wetting agents, a sterile solution, or the like. In some cases, the vaccine can be lyophilized and then reconstituted before administration. For respiratory tract colonization, it is preferred to use a pharmaceutically suitable excipient or carrier compatible with mucosal (particularly nasal, bronchial, or pulmonary) administration. See Remington's Pharmaceutical Sciences, a standard textbook in this field and the USP / NF (United States Pharmacopeia / National Formulary).

[0025] When formulated for mucosal administration, each dose of vaccine contains a sufficient number of bacteria to cause colonization of the respiratory tract, e.g., approximately (i.e., ±50%) 5 x 10 bacteria, depending on the weight and age of the mammal receiving it. 3 ~5×10 9 For administration to a human subject, the dose may contain approximately 1 x 10 live Bordetella bacteria. 6 , 5×10 6 , 1×10 7 , 5×10 7 , 1×10 8 , 5×10 8 , 1×10 9 , 5×10 9 Or 1 x 10 10 The vaccine may comprise live Fim3-producing Bordetella bacteria. Doses may be administered on one or multiple occasions (2, 3, 4, 5, 6, 7, 8 or more) spaced 1, 2, 3, 4, 5, or 6 days apart, or 1, 2, 3, 4, 5, or 6 weeks apart, or 1, 2, 3, 4, 5, 6, or 12 months apart. Generally, a sufficient amount of vaccine is administered to produce a colonization and protective response. A booster dose is administered after the induced protective response has waned.

[0026] Methods for inducing an immune response to protect against pertussis - Patent Application 20070122999 The vaccines described herein can be administered to mammalian subjects (e.g., humans, human children or newborns, human adults, humans at high risk of developing complications from whooping cough, humans with lung disease, and humans who are or become immunosuppressed) by any suitable method that deposits the bacteria in the vaccine in the respiratory tract. For example, the vaccine can be administered by inhalation or intranasal introduction, e.g., by inhaler, syringe, injector, spray device, etc. 1×10 4 ~1×10 7 (e.g., 1×10 4 , 5×10 4 , 1×10 5 , 5×10 5 , 1×10 6 , 5×106 Or 1 x 10 7 Administration of a single dose of live bacteria (±10, 20, 30, 40, 50, 60, 70, 80, or 90%) is typically sufficient to induce protective immunity against developing a Bordetella infection, such as pertussis, although one or more (1, 2, 3, 4, or more) additional doses may be administered spaced four or more days apart (e.g., 4, 5, 6, or 7 days; or 1, 2, 3, 4, 5, 6, 7, or 8 weeks) until a sufficient protective immune response is developed. The development of a protective immune response can be assessed by methods known in the art, such as quantifying Bordetella-specific antibody titers and measuring Bordetella antigen-specific T cell responses (e.g., using an ELISPOT assay). If the vaccine-induced protective immune response has waned (e.g., 1, 2, 3, 4, 5, 10 or more years after the last vaccination), the subject can be re-administered the vaccine to boost the anti-Bordetella immune response. [Example]

[0027] Materials and Methods Culture conditions All B. pertussis strains were grown on Bordet Gengou (BG) agar containing 10% (v / v) sheep blood in modified Stainer Scholte (SS) medium under agitation as described (Imaizumi et al., Infect Immun 1983;41:1138-43) or in synthetic complete Thijs medium (Thalen et al., J Biotechnol 1999;75:147-59). The medium was supplemented with the appropriate antibiotic (100 μg / mL streptomycin or 10 μg / mL gentamicin for strains carrying pFUS2 BctA1).

[0028] Bacterial strains The B. pertussis strains BPSM and BPZE1 and Bordetella parapertussis used in this study have been described previously (Mielcarek et al., PLoS Pathog 2006;2:e65; Menozzi et al., Infect Immun 1994;62:769-78). B. pertussis strains B0403, B1412, B1617, and B0005 (strain 134 Pillmer) were obtained from the RIVM collection (Bilthoven, The Netherlands). For counterselection, some clinical isolates were electroporated with the pFUS2 BctA1 suicide plasmid to confer gentamicin resistance as described by Antoine et al. (J Mol Biol 2005;351:799-809). Gentamicin-resistant derivatives after electroporation were checked by PCR to verify the insertion site of the pFUS2 BctA1 vector into chromosomal DNA, and the levels of surface-exposed Fim2 and / or Fim3 were checked by ELISA, as described below. Strain P134S was obtained by selecting streptomycin derivatives of B. pertussis B0005. Strain P134S has a mutation in the fimC gene that results in the loss of fimbrial production, in addition to streptomycin resistance mediated by a mutation in the rpsl gene. Escherichia coli SM10 was used for the conjugation of various plasmid constructs into B. pertussis (Simon et al., Bio / Technology 1983;1:784-91).

[0029] Construction of Fim3-positive BPZE1 derivative BPZE1f3 To construct BPZE1f3, a 13C stretch located within the promoter region of the fim3 gene of BPZE1, 75 bp upstream of the fim3 ATG codon, was replaced with a 14C stretch to drive fim3 transcription. The entire fim3 locus, including the promoter region, was first deleted in the parent strain and then replaced with the fim3 locus with the 14C stretch. A 2265-bp PCR fragment encompassing this locus was amplified using the following oligonucleotides (SPfim3UP2: GAGCTCTTTACCGCGGCCGCCAGTTGTTCATCAATG and ASPfim3LO2: GGATCCATCATCGAGACCGACTGG) and cloned into the SacI and BamHI restriction sites of the pBluescript II SK+ plasmid (Addgene). From the resulting plasmid, a 904-bp fragment containing the entire locus was removed by SphI restriction to obtain pSKfim3UPLO. The 1351-bp SacI-BamHI fragment of pSKfim3UPLO was inserted into the SacI and BamHI sites of pJQ200mp18rpsL (Antoine, J. Mol. Biol. (2005) 351, 799-809). The recombinant plasmid was then used for double homologous recombination in BPZE1 using conjugation as previously described (Mielcarek et al., PLoS Pathog 2006;2:e65). Exconjugants were checked for deletion of the entire fim3 locus by PCR using the oligonucleotides SPfim3UP2 and ASPfim3LO2. Reintroduction of the entire fim3 locus with a 14C stretch into the promoter was performed as follows: A 911-bp synthetic gene encompassing the entire locus with a 14C stretch was synthesized by GeneArt® Gene Synthesis (ThermoFisher Scientific). The SphI sites at the beginning of the synthetic fragment were used to insert it into the SphI site of pSKfim3UPLO, giving rise to pSKfim3+. The correct orientation of the insert was checked by restriction.The 2256 bp SacI-BamHI fragment of this plasmid was carried into the same restriction sites of pJQ200mp18rpsL, resulting in pJQfim3+. This plasmid was used to perform double homologous recombination to obtain BPZE1f3. The recombinant strain was verified by PCR using the oligonucleotides SPfim3UP2 and ASPfim3LO2.

[0030] Analysis of Fim2 and Fim3 production B. pertussis strains were first inactivated by heating at 56°C for 30 minutes. The heat-inactivated strains were then coated into 96-well plates (Nunc MaxiSorp) at an optical density (OD) of 0.075 at 600 nm and incubated overnight at 37°C until the wells were dry. The wells were then blocked with 100 μL of PBS Tween 0.1% (PBST) containing 1% bovine serum albumin (BSA). Fim2 and Fim3 monoclonal antibodies (NIBSC, 04 / 154 and 04 / 156, respectively) were added at serial dilutions from 1 / 50 to 1 / 36450 (v / v) in PBST. After three washes, the plates were incubated with 100 μL of horseradish-peroxidase-conjugated goat anti-mouse IgG (Southern Biotech) in PBST. After five washes, the plate was incubated with 100 μL of HRP substrate TMB solution (Interchim) for 30 minutes at room temperature. The reaction was stopped by adding 50 μL of 1 M H3PO4. OD was measured at 450 nm using a Biokinetic EL / 340 microplate reader.

[0031] DNA sequencing PCR amplification of chromosomal DNA was performed using Phusion High-Fidelity DNA polymerase (Thermofisher) or KAPA HiFi DNA polymerase (Kapa Biosystems) according to the manufacturer's instructions. PCR fragments were purified using a QiaQuick PCR purification kit (Qiagen) and sequenced using the primers used for amplification. Primers ptxP Up and ptxP Low used for PCR amplification of ptxP have been previously described (Mooi et al., Emerg Infect Dis 2009;15:1206-13). Primers prn AF and prn AR used for partial PCR amplification of prn have been previously described (Mooi et al., Infect Immun 1998;66:670-5). Primers fim2 Up 5'-AGCTAGGGGTAGACCACGGA-3' and fim2 Low 5'-ATAACTCTTCTGGCGCCAAG-3' were used for amplification and sequencing of fim2. Primers fim3 Up 5′-CATGACGGCACCCCTCAGTA-3′ and fim3 Low 5′-TTCACGTACGAGGCGAGATA-3′ were used for amplification and sequencing of fim3 .

[0032] Mouse infection experiments BALB / c mice were obtained from Charles River (l'Abresle, France) and housed under specific pathogen-free conditions in the animal care facility of the Institut Pasteur de Lille. Six-week-old BALB / c mice were lightly sedated by intraperitoneal injection containing an anesthetic cocktail (ketamine + atropine + valium) as previously described (Mielcarek et al., PLoS Pathog 2006;2:e65), followed by 10 min. 6Intranasal (in) challenge with 20 μL of PBS containing colony-forming units (CFU) of B. pertussis BPZE1 or BPZE1f3 was performed. Three mice per group were euthanized at selected time points after in challenge, and their lungs were removed, homogenized in PBS, and plated in serial dilutions on BG blood agar. CFU were counted after incubation at 37°C for 3–4 days.

[0033] Mouse protection experiment Six-week-old BALB / c mice were treated with 10 5 Four weeks later, naive and vaccinated mice were vaccinated with 10 CFU of B. pertussis BPZE1 or BPZE1f3 in 20 μL of PBS. 6 Mice were challenged with CFU of B. pertussis BPSM, the indicated clinical B. pertussis isolates, or B. parapertussis. Lung colonization was determined 3 hours and 7 days later using 3 and 5 mice per group, respectively.

[0034] Stability of Fim3 and Fim2 production 10 in 20 μL PBS 6CFU of BPZE1f3 was administered to sedated mice. 14 days later, lungs were removed, homogenized, and plated on BG agar. Three to four days later, 94 individual colonies were inoculated into 96-well plates containing 100 μL of PBS per well. Control wells contained BPZE1 as a negative control and BPZE1f3 as a positive control. The amount of bacteria present in each well was determined by measuring the OD at 630 nm. After drying, the presence of Fim3 and Fim2 was assessed by whole-cell ELISA as described above. After a blocking step with 100 μL of PBST containing 1% BSA, bacteria were incubated with anti-Fim3 monoclonal antibody 04 / 156 or anti-Fim2 monoclonal antibody 04 / 154 at a dilution of 1 / 1350 in 100 μL of PBST for 1 hour. After washing and incubation with 100 μL of horseradish-peroxidase-conjugated goat anti-mouse IgG (Southern Biotech) in PBST, the presence of Fim3 or Fim2 was assessed using 100 μL of HRP substrate TMB solution (Interchim). The reaction was stopped by adding 50 μL of 1 M H3PO4. OD was measured at 450 nm using a Biokinetic EL / 340 microplate reader.

[0035] result Construction of BPZE1f3. To construct a BPZE1 derivative that produces Fim3, the fim3 gene was first deleted from BPZE1. The upstream and downstream flanking regions of fim3 were amplified by PCR using BPZE1 chromosomal DNA as a template and spliced ​​together into the non-replicating vector pJQ200mp18rpsL (Antoine, J. Mol. Biol. (2005) 351, 799-809). The fim3 gene of BPZE1 was then deleted by allelic exchange after conjugation with E. coli SM10 containing the recombinant plasmid. The resulting strain, BPZE1∆fim3, was used to reintegrate the fim3 gene into the original fim3 locus along with a functional promoter. The 13C stretch of the original promoter was replaced with a 14C stretch that allows fim3 expression, and it was inserted into pSKfim3UPLO along with the fim3 open reading frame. The resulting plasmid, pJQFim3+, was conjugated into BPZE1∆fim3 by conjugation with E. coli SM10:pJQFim3+, generating BPZE1f3.

[0036] The production of Fim2 and Fim3 in BPZE1f3 was analyzed by whole-cell ELISA using Fim2-specific and Fim3-specific monoclonal antibodies, respectively. As shown in Figure 1A, both BPZE1 and BPZE1f3 produced comparable amounts of Fim2. In contrast, Fim3 was only produced by BPZE1f3, and only background absorbance was detected using a Fim3-specific antibody on whole BPZE1 extracts (Figure 1B). Both strains grew equally well in Stainer-Scholte medium and synthetic Thijs medium (Figure 2), indicating that Fim3 production did not affect the growth characteristics of BPZE1f3.

[0037] Mouse colonization with BPZE1f3. To assess the potential role of Fim3 production by BPZE1f3 in murine airway colonization, adult mice were cultured for 10 days. 6Mice were infected with CFU of either BPZE1 or BPZE1f3, and three mice per group were euthanized to quantify the bacterial burden in their lungs at days 3, 7, 14, 21, and 28 postinfection. As shown in Figure 3, the ability to colonize mouse lungs was identical between the two strains at all time points analyzed, indicating that production of Fim3 neither enhances nor interferes with the ability of BPZE1 to colonize the mouse airways.

[0038] BPZE1- and BPZE1f3-mediated protection against clinical B. pertussis isolates. To test the relative protective effects of BPZE1 and BPZE1f3 against clinical isolates that differ in their production of Fim2 and Fim3, we 5 Intranasal immunization with 10 CFU of the vaccine strain was performed. 6 A suboptimal immunization protocol was used, with infection after 1 month with 10 CFU of the challenge strain. 6 CFU of the vaccine strain was used, and 10 6 The standard vaccination protocol, followed by infection with a CFU challenge strain, usually results in total clearance 7 days after challenge, and this protocol was therefore best suited to detect potential differences between vaccine lots.

[0039] The efficacy of the two vaccine strains was tested against four different clinical isolates from the B. pertussis culture collection at the RIVM (Bilthoven, The Netherlands). Five strains were characterized for Fim2 and Fim3 production as follows: 1617F1 (Fim2+Fim3-), 403pF1 (Fim2+Fim3-), P134 (Fim2-Fim3-), 1412pF1 (Fim2-Fim3+), and 403pF3 (Fim2+Fim3+). The genetic key characteristics of these strains are presented in Table I below. After vaccination and challenge, bacterial loads of the challenge strains were measured in the lungs 3 hours and 7 days after infection. [Table 1]

[0040] BPZE1 and BPZE1f3 protected equally well against 1617pF1, 403pF1, P134, and 403pF3, reducing bacterial load by 4 to 5 logs 7 days after infection compared to the bacterial load in unvaccinated mice (Figure 4). No statistically significant differences were observed between BPZE1- and BPZE1f3-vaccinated mice. However, when mice were challenged with 1412pF1, BPZE1f3, a strain that produces only Fim3 but not Fim2, appeared to provide significantly better protection than BPZE1 (Figure 4D). While BPZE1 vaccination resulted in a 4-log difference in bacterial load compared to unvaccinated mice, BPZE1f3 increased this protection to a 5-log difference. When CFU were measured 3 hours after challenge, no statistically significant reduction in bacterial load was observed between vaccinated and unvaccinated mice, indicating that all mice received the same challenge dose, as expected. These results demonstrate improved efficacy of BPZE1f3 compared to BPZE1 against strains producing Fim3 alone, while no improved protection was observed against strains producing Fim2 with or without Fim3 or strains that do not produce fimbriae.

[0041] BPZE1- and BPZE1f3-mediated protection against Bordetella parapertussis. The efficacy of BPZE1f3 against B. parapertussis was also tested. 6 CFU of the vaccine strain, followed by 10 6Mice were challenged with CFU of B. parapertussis. We have previously demonstrated that this protocol provides strong protection but does not result in total clearance 7 days after challenge (Mielcarek et al., PLoS Pathog 2006;2:e65). Seven days after B. parapertussis infection, both BPZE1- and BPZE1f3-vaccinated mice showed a significant reduction (between 4 and 5 logs) in bacterial burden in the lungs compared to unvaccinated mice (Figure 5). No statistical difference was observed between BPZE1- and BPZE1f3-vaccinated mice, indicating that Fim3 production does not provide an advantage, but is not detrimental, to protection against B. parapertussis infection.

[0042] Stability of Fim3 production by BPZE1f3. Since the only genetic difference between BPZE1 and BPZE1f3 is the amount of C in the C string of the fim3 promoter (13C in BPZE1 and 14C in BPZE1f3), and since C strings tend to cause phase variation in B. pertussis (Willems et al., EMBO J 1990;9:2803-9), the stability of production of both Fim3 and Fim2 by BPZE1f3 was assessed after in vivo passage of the vaccine strain in mice. 6Mice were infected with CFU of BPZE1f3, and bacteria present in the lungs 14 days postinfection were harvested and plated on BG agar. After growth, 94 individual colonies were inoculated into 96-well plates. Remaining colonies were harvested and administered to mice for the second passage, followed by a third passage two weeks later. At each passage, 94 individual colonies were inoculated into 96-well plates containing 100 μL of PBS per well. Control wells contained BPZE1 as a negative control and BPZE1f3 as a positive control. The amount of bacteria present in each well was determined by measuring the OD at 630 nm. After drying, the presence of Fim3 and Fim2 was assessed by whole-cell ELISA. 94 of the 94 clones were found to produce both Fim3 and Fim2 after the first passage. After the second passage, 97.9% of colonies produced Fim2 and 96.8% produced Fim3, and after the third passage the numbers were 87.23% and 97.9% for Fim3 and Fim2, respectively (Fig. 6), which showed only a 12.77% loss after three in vivo passages, indicating fairly stable fim3 expression.

[0043] Other embodiments While the present invention has been described in connection with its detailed description, it is to be understood that the above description is intended to be illustrative and not to limit the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. 1. A vaccine for preventing Bordetella infection, comprising: The vaccine comprises a pharmaceutically acceptable carrier and a live attenuated Bordetella strain that has been deleted for functional pertussis toxin (PTX) and engineered to stably produce Fim3 by increasing the number of cytosines in a cytosine stretch in the promoter region of the Fim3 gene, thereby increasing BvgA-mediated activation of transcription of the Fim3 gene; The live attenuated Bordetella strain retains the ability to colonize the lungs of a mammalian subject and induce a protective immune response against Bordetella infection, and the live attenuated Bordetella strain maintains at least 50% expression of Fim3 after being passaged at least once through the mammalian subject.

2. 2. The vaccine of claim 1, wherein the live attenuated Bordetella strain stably produces Fim2, and the live attenuated Bordetella strain maintains at least 50% of the expression of Fim2 after being passaged at least once through the mammalian subject.

3. 2. The vaccine of claim 1, wherein the live attenuated Bordetella strain is deleted for at least one virulence factor selected from the group consisting of a functional dermonecrotic toxin (DNT) and a functional tracheal cytotoxin (TCT).

4. 2. The vaccine of claim 1, wherein the live attenuated Bordetella strain is deleted for functional DNT and functional TCT.

5. 3. The vaccine of claim 2, wherein the live attenuated Bordetella strain is deleted for at least one virulence factor selected from the group consisting of a functional DNT and a functional TCT.

6. 3. The vaccine of claim 2, wherein the live attenuated Bordetella strain is deleted for functional DNT and functional TCT.

7. 10. The vaccine of claim 1, wherein the vaccine is at least 1 x 10 ６ A vaccine administered in a single dose containing colony forming units (CFU) of said strain.

8. 8. The vaccine of claim 7, wherein the single dosage form is formulated for intranasal administration.

Images