Method for producing ergothioneine

By culturing and genetically modifying microalgae from the Ideyukogome class, particularly Cyanidium and Galdieria, the method enhances ergothioneine production efficiency and yield, addressing the inefficiencies of conventional methods.

JP7873498B2Active Publication Date: 2026-06-12INTER UNIV RES INST RES ORG OF INFORMATION & SYST

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
INTER UNIV RES INST RES ORG OF INFORMATION & SYST
Filing Date
2022-04-13
Publication Date
2026-06-12

Smart Images

  • Figure 0007873498000006
    Figure 0007873498000006
  • Figure 0007873498000007
    Figure 0007873498000007
  • Figure 0007873498000008
    Figure 0007873498000008
Patent Text Reader

Abstract

An ergothioneine production method comprising: (a) a step for culturing an alga belonging to Cyanidiophyceae; (b) a step for collecting the alga belonging to Cyanidiophyceae from the culture liquid after the culture; and (c) a step for extracting ergothioneine from the collected alga belonging to Cyanidiophyceae. A polypeptide usable in the aforesaid production method; a polynucleotide encoding the polypeptide; and a vector and a cell containing the polynucleotide.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for producing ergothioneine. It also relates to a polypeptide usable for the production of ergothioneine, a polynucleotide encoding the polypeptide, and a vector and cells containing the polynucleotide. This application claims priority based on Japanese Patent Application No. 2021-067865, filed in Japan on April 13, 2021, and the contents of that application are incorporated herein by reference. [Background technology]

[0002] Ergothioneine is a sulfur-containing amino acid known to exhibit high antioxidant activity. Its antioxidant activity is extremely high, reportedly 7,000 times that of vitamin E. Ergothioneine has been reported to accumulate in epidermal cells and is thought to be involved in suppressing oxidative stress caused by ultraviolet radiation. Furthermore, ergothioneine is known to accumulate in the central nervous system, suggesting its potential effectiveness against neurodegenerative diseases.

[0003] Plants and animals cannot biosynthesize ergothioneine, but it is known that some bacteria and basidiomycetes can biosynthesize it. In particular, Pleurotus erythrosora, a type of basidiomycete, is known to have a remarkably high ergothioneine content (Patent Document 1). Methods for producing ergothioneine include extraction from basidiomycetes such as Pleurotus erythrosora (Patent Document 1), and culturing bacteria such as Mycobacterium (Patent Document 2).

[0004] On the other hand, microalgae have a higher carbon dioxide fixation capacity compared to land plants, and because they do not compete for habitat with agricultural products, some species are cultivated on a large scale and used industrially as animal feed, functional foods, and cosmetic ingredients. Spirulina and cynolino are known to contain ergothioneine, but the amount is not as high as in basidiomycetes (Non-Patent Literature 1). [Prior art documents] [Patent Documents]

[0005] [Patent Document 1] Patent No. 6799836 [Patent Document 2] Patent No. 6263672 [Non-patent literature]

[0006] [Non-Patent Document 1] Carolin Pfeiffer et al., Cyanobacteria produce high levels of ergothioneine. Food Chemistry. Volume 129, Issue 4, 15 December 2011, Pages 1766-1769. [Overview of the project] [Problems that the invention aims to solve]

[0007] Conventional methods for producing ergothioneine are time-consuming due to the cultivation of algae such as Pleurotus ostreatus, and are not very efficient. Therefore, a novel method for producing ergothioneine is needed. If microalgae can be used in the production of ergothioneine, it may be possible to produce it at a low cost.

[0008] Therefore, the present invention aims to provide a method for producing ergothioneine using microalgae. It also aims to provide a polypeptide usable for the production of ergothioneine, a polynucleotide encoding the polypeptide, and a vector and cells containing the polynucleotide. [Means for solving the problem]

[0009] The present invention includes the following embodiments. [1] A method for producing ergothioneine, comprising the step (a) of culturing algae belonging to the class Ideyukogome. [2] The method for producing ergothioneine according to [1], further comprising a step (b) of recovering the algae belonging to the genus Idyumyxa from the culture solution after the step (a). [3] The method for producing ergothioneine according to [2], further comprising a step (c) of extracting ergothioneine from the algae belonging to the genus Idyumyxa recovered in the step (b). [4] The method for producing ergothioneine according to any one of [1] to [3], wherein the algae belonging to the genus Idyumyxa in the step (a) is diploid. [5] The method for producing ergothioneine according to any one of [1] to [4], wherein the algae belonging to the genus Idyumyxa is genetically modified algae. [6] The method for producing ergothioneine according to [5], wherein the genetic modification is a genetic modification that increases the production amount of ergothioneine. [7] The method for producing ergothioneine according to [5] or [6], further comprising a step (i) of performing genetic modification on the haploid of the algae belonging to the genus Idyumyxa before the step (a). [8] The method for producing ergothioneine according to [7], further comprising a step (ii) of making the algae belonging to the genus Idyumyxa diploid between the step (i) and the step (a). [9] A polypeptide selected from the group consisting of the following (a1) to (c1): (a1) A polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6; (b1) A polypeptide comprising an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence set forth in SEQ ID NO: 6, and having histidine methyltransferase activity; and (c1) A polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 6, and having histidine methyltransferase activity.

[10] A polypeptide selected from the group consisting of the following (a2) to (c2): (a2) A polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 8; (b2) A polypeptide comprising an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence set forth in SEQ ID NO: 8, the polypeptide having 5-histidylcysteine sulfoxide synthase activity; and (c2) A polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 6, the polypeptide having 5-histidylcysteine sulfoxide synthase activity. A polynucleotide encoding the polypeptide according to

[11] [9]. A polynucleotide encoding the polypeptide according to

[12]

[10] . A vector comprising at least one polynucleotide selected from the group consisting of the polynucleotide according to

[13]

[11] and the polynucleotide according to

[12] . A cell comprising at least one polynucleotide selected from the group consisting of the polynucleotide according to

[14]

[11] and the polynucleotide according to

[12] . A method for producing ergothioneine, comprising the step of culturing the cell according to

[15]

[14] .

Advantages of the Invention

[0010] According to the present invention, a method for producing ergothioneine using microalgae is provided. Further, a polypeptide that can be used for the production of ergothioneine, a polynucleotide encoding the polypeptide, and a vector and a cell containing the polynucleotide are provided.

Brief Description of the Drawings

[0011] [Figure 1] A molecular phylogenetic tree of algae belonging to the class Ideugomontophyceae based on the chloroplast ribulose 1,5-bisphosphate carboxylase / oxygenase large subunit (rbcL) gene. The local bootstrap values (only values of 50 or more are shown, left) by the maximum likelihood method and the posterior probabilities (only values of 0.95 or more are shown, right) by the Bayesian method are shown near each branch. [Figure 2]The synthesis pathways of ergothioneine in Mycobacterium smegmatis and Neurospora crassa are shown (Borodina et al Nutr Res Rev. 2020 Dec; 33(2):190-217). [Figure 3] An example of an LC-MS chromatogram measuring ergothioneine content in algae belonging to the class Ideycogome is shown. The results for autotrophic culture of Galdieria sulphuraria SAG108.79 (diploid) are shown. [Figure 4] This document outlines the method for producing transformants of Cyanidium sp. HKN1 (haploid). In the transformants, the histidine methyltransferase-like gene (HSM gene) and the 5-histidylcysteine ​​sulfoxide synthase-like gene (HSS gene) were overexpressed. [Figure 5] This report shows the results of PCR amplification of the NS1 region in the wild-type (WT) and transformant (TF) strains of Cyanidium sp. HKN1 (haploid). PCR was performed using the NS1_F and NS1_R primer sets. [Figure 6] This chart shows the growth polarity of the wild-type (WT) and transformed (TF) Cyanidium sp. HKN1 (haploid) strains. The arrows indicate the sampling time for ergothioneine measurement. [Modes for carrying out the invention]

[0012] [Definition] The term "comprise" means that it may include components other than the component being studied. The term "consist of" means that it does not include components other than the component being studied. The term "consist essentially of" means that it does not include components other than the component being studied in a manner that performs a special function (such as a manner that completely negates the effect of the invention). In this specification, when "comprise" is used, it includes "consist of" and "consist essentially of" manners.

[0013] Proteins, peptides, polynucleotides (DNA, RNA), vectors, and cells may be isolated. “Isolated” means in their natural state or separated from other components. “Isolated” may be substantially free of other components. “Substantially free of other components” means that the content of other components in the isolated component is negligible. The content of other components in the isolated component may be, for example, 10% by mass or less, 5% by mass or less, 4% by mass or less, 3% by mass or less, 2% by mass or less, 1% by mass or less, 0.5% by mass or less, or 0.1% by mass or less. The proteins, peptides, polynucleotides (DNA, RNA), vectors, and cells described herein may be isolated proteins, isolated peptides, isolated polynucleotides (isolated DNA, isolated RNA), isolated vectors, and isolated cells.

[0014] The term "polynucleotide" refers to a nucleotide polymer in which nucleotides are linked by phosphodiester bonds. A "polynucleotide" may be DNA, RNA, or a combination of DNA and RNA. A "polynucleotide" may be a polymer of natural nucleotides, a polymer of natural nucleotides and non-natural nucleotides (analogs of natural nucleotides, nucleotides in which at least one of the base, sugar, and phosphate parts is modified (e.g., a phosphorothioate skeleton)), or a polymer of non-natural nucleotides. In this specification, the nucleotide sequences of "polynucleotides" are described using commonly accepted single-letter codes unless otherwise specified. Unless otherwise specified, the nucleotide sequences are described from the 5' end to the 3' end. In this specification, nucleotide residues constituting a "polynucleotide" may be simply described as adenine, thymine, cytosine, guanine, or uracil, or by their single-letter codes.

[0015] The terms "polypeptide," "peptide," and "protein" are interchangeable and refer to polymers of amino acids linked by amide bonds. A "polypeptide," "peptide," or "protein" may be a polymer of natural amino acids, a polymer of natural amino acids and non-natural amino acids (chemical analogs, modified derivatives, etc. of natural amino acids), or a polymer of non-natural amino acids. Unless otherwise specified, amino acid sequences are written using commonly accepted one-letter or three-letter codes. Unless otherwise specified, amino acid sequences are written from the N-terminus to the C-terminus.

[0016] "Functionally linked" means that the first nucleotide sequence is positioned close enough to the second nucleotide sequence that the first nucleotide sequence can influence the second nucleotide sequence or the region controlled by the second nucleotide sequence. For example, functionally linked to a promoter means that the gene is linked in such a way that it is expressed under the control of the promoter.

[0017] "A state in which expression is possible" means that the gene can be transcribed and translated within the cell into which it has been introduced.

[0018] An "expression vector" refers to a vector containing a target gene that is equipped with a system to enable the expression of the target gene within the cell into which it is introduced.

[0019] "A promoter being functional" means that, within the target cell, the promoter can express the gene functionally linked to it.

[0020] A "gene" is a polynucleotide that contains at least one open reading frame that codes for a specific protein. Genes can contain both exons and introns.

[0021] The sequence identity (or homology) between nucleotide sequences or amino acid sequences is determined by juxtaposing the two nucleotide sequences or amino acid sequences, inserting gaps in the regions corresponding to insertions and deletions so that the corresponding nucleotides or amino acids are most likely to match. The sequence identity is then calculated as the proportion of matching nucleotides or amino acids relative to the entire nucleotide sequence or amino acid sequence, excluding the gaps in the resulting alignment. The sequence identity between nucleotide sequences or amino acid sequences can be determined using various homology search software known in the art. For example, the sequence identity value of a nucleotide sequence can be obtained by calculation based on the alignment obtained by the known homology search software BLASTN, and the sequence identity value of an amino acid sequence can be obtained by calculation based on the alignment obtained by the known homology search software BLASTP.

[0022] "Stringent conditions" refer to conditions under which two polynucleotides with high sequence identity can specifically hybridize. Two polynucleotides with high sequence identity are those whose sequence identity is, for example, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more. Specific examples of stringent conditions include, for example, the conditions described in Molecular Cloning - A LABORATORY MANUAL THIRD EDITION (Sambrook et al., Cold Spring Harbor Laboratory Press). Stringent conditions include incubation at 42-70°C for several hours to overnight in a hybridization buffer consisting of 6×SSC (composition of 20×SSC: 3M sodium chloride, 0.3M citrate solution, pH 7.0), 5×Denhardt's solution (composition of 100×Denhardt's solution: 2% by mass bovine serum albumin, 2% by mass Ficol, 2% by mass polyvinylpyrrolidone), 0.5% by mass SDS, 0.1 mg / mL salmon sperm DNA, and 50% formamide. Washing buffers used after incubation include, for example, a 1×SSC solution containing 0.1% by mass SDS and a 0.1×SSC solution containing 0.1% by mass SDS.

[0023] The term "codon optimization" refers to replacing at least one codon in the original nucleotide sequence with a codon more frequently used in the target species, while maintaining the original amino acid sequence. Codon usage tables are readily available, for example, from the "Codon Usage Database" provided by the Kazusa DNA Research Institute (www.kazusa.or.jp / codon / ). For example, codons can be optimized using codon usage tables. Computer algorithms for codon optimization of specific sequences for expression in specific animal species are also publicly known. Computer algorithms for codon optimization are available, for example, from Gene Forge (Aptagen; Jacobus, PA).

[0024] [Manufacturing method for ergothioneine] In one embodiment, the present disclosure provides a method for producing ergothioneine. The method of production in this embodiment includes a step (a) of culturing algae belonging to the class Ideycogome.

[0025] <Process (a)> In step (a), algae belonging to the class Ideyukogome are cultured.

[0026] (Algae belonging to the class Ideyukogome) The Idycogomei class is taxonomically classified under the division Rhodophyta, specifically the class Cyanidiophyceae. Currently, the Idycogomei class includes three genera: Cyanidioschyzon, Cyanidium, and Galdieria. In the manufacturing method of this embodiment, any of the algae from the genera Cyanidioschyzon, Cyanidium, or Galdieria may be used.

[0027] Whether or not an alga belongs to the class Ideyukogomei can be determined, for example, by phylogenetic analysis using the nucleotide sequence of the 18S rRNA gene or the chloroplast rbcL gene. The phylogenetic analysis can be performed using known methods. Figure 1 is a molecular phylogenetic tree of algae belonging to the class Ideyukogomei based on the chloroplast rbcL gene. In the phylogenetic tree of Figure 1, the algae located at "Galdieria A", "Galdieria B", "Cyanidium (mesophilic)", "Cyanidium", and "Cyanidium G. maxima Galdieria-like Cyanidioschyzon" belong to the class Ideyukogomei. The algae used in the production method of this embodiment may be the algae shown in Figure 1. Alternatively, other algae that are classified into the class Ideyukogomei by phylogenetic analysis based on the chloroplast rbcL gene may be used.

[0028] An example of an alga belonging to the genus Cyanidioschyzon is Cyanidioschyzon merolae. Examples of algae belonging to the genus Cyanidium include Cyanidium caldarium and Cyanidium sp. Algae belonging to the genus Galdieria include Galdieria sulphuraria, Galdieria partita, Galdieria daedala, Galdieria maxima, and Galdieria phlegrea.

[0029] Algae belonging to the class Ideyukogomei may be isolated from acidic environments such as acidic hot springs, or obtained from culture collections. Examples of culture collections include the National Institute for Environmental Studies Microbial System Conservation Facility (16-2 Onogawa, Tsukuba, Ibaraki Prefecture, Japan), NITE Biological Resource Center (NRBC; 2-49-10 Nishihara, Shibuya-ku, Tokyo, Japan), GEORG-AUGUST-UNIVERSITY GOTTINGEN Culture Collection of Algae (SAG), and the American Type Culture Collection (ATCC; 10801 University Boulevard Manassas, VA 20110 USA).

[0030] Some algae belonging to the class Ideyukogome possess both diploid and haploid cell forms. Haploid cell forms arise from meiosis in diploid cell forms. It is thought that diploid cells are formed when two haploid cells join together.

[0031] Whether a cell is diploid or haploid can be determined by checking the copy number of the same gene locus. If the copy number of the same gene locus is 1, it is determined to be a haploid cell. It is also possible to determine whether an alga is diploid or haploid using next-generation sequencers. For example, whole genome sequence reads are obtained using a next-generation sequencer, these sequence reads are assembled, and then the sequence reads are mapped to the assembled sequence. In diploid algae, allele-specific nucleotide differences can be found in various regions of the genome, but in haploid algae, there is only one allele, so such regions cannot be found. Alternatively, cells may be stained with a nuclear staining reagent such as DAPI and compared to cells known to be haploid. Cells showing equivalent fluorescence intensity may be identified as haploid, and cells showing approximately twice the fluorescence intensity may be identified as diploid. Alternatively, cells may be stained with a nuclear staining reagent such as DAPI and compared to cells known to be diploid. Cells showing equivalent fluorescence intensity may be identified as diploid, and cells showing approximately half the fluorescence intensity may be identified as haploid.

[0032] In the manufacturing method of this embodiment, either haploid cells or diploid cells may be used. Diploid cells tend to have a higher ergothioneine content compared to haploid cells. Therefore, from the viewpoint of manufacturing efficiency, it is preferable to use diploid cells.

[0033] Examples of algae belonging to the Ideyukogome class that possess both diploid and haploid cell forms include the genera Gardelia and Cyanidium. Specific examples of algae belonging to the genus Galdieria include Galdieria sulphuraria (e.g., strain SAG108.79) and Galdieria partita (e.g., strain NBRC 102759). Specific examples of algae belonging to the genus Cyanidium include, for example, Cyanidium sp. YFU3 strain (FERM BP-22334) (hereinafter referred to as "YFU3 strain") and Cyanidium sp. HKN1 strain (FERM BP-22333) (hereinafter referred to as "HKN1 strain").

[0034] YFU3 strain is a single-celled red alga isolated from high-temperature acidic water of a hot spring in Yufu City, Oita Prefecture, Japan. YFU3 strain was deposited on May 30, 2017, under accession number FERM P-22334, with the Patent Organism Depository Center of the National Institute of Technology and Evaluation (2-5-8 Kazusa-Kamatari, Kisarazu City, Chiba Prefecture, Japan), and was transferred to international deposit on April 20, 2018, under accession number FERM BP-22334 (depositor: National Institute of Genetics, Research and Development Organization of Information and Systems; depositor address: 1111 Tanida, Mishima City, Shizuoka Prefecture, 411-8540). HKN1 strain is a single-celled red alga isolated from high-temperature acidic water of a hot spring in Hakone-machi, Ashigarashimo-gun, Kanagawa Prefecture, Japan. HKN1 strain was deposited with the Patent Organism Depository Center of the National Institute of Technology and Evaluation (NITE) on May 30, 2017, under accession number FERM P-22333, and was transferred to international deposit on April 20, 2018, under accession number FERM BP-22333 (depositor: National Institute of Genetics, Research and Development Organization of Information and Systems; depositor address: 1111 Tanida, Mishima-shi, Shizuoka Prefecture 411-8540).

[0035] One method for obtaining haploid cells from diploid cells is to culture the diploid cells for a certain period. For example, haploid cells can be obtained by culturing diploid cells until they reach a quiescent phase and then continuing the culture for an arbitrary period during the quiescent phase. Examples of periods for continuing the culture during the quiescent phase include 2-60 days, 3-40 days, or 5-35 days. The period from the start of culture to the quiescent phase varies depending on the type of algae and the culture conditions. Alternatively, cells can be collected from the culture medium during the quiescent phase, subcultured, and cultured for another 1-5 days. Haploid cells of algae belonging to the class Ideycogome are usually smaller in size and do not exhibit a strong cell wall compared to diploid cells. Therefore, haploid and diploid cells can be distinguished by optical microscopy. Haploid cells can be obtained by collecting and isolating haploid cells that appear in the culture medium using a Pasteur pipette or similar tool.

[0036] One method for obtaining diploid cells from haploid cells is to mix two or more types of haploid cells and culture them. Preferably, the two or more types of haploid cells are cells from the same type of alga, and more preferably, they are haploid cells from the same strain. For example, two haploid cells from the same strain may be divided and cultured separately, and then mixed. It is thought that by mixing and culturing two types of haploid cells, the two cells will conjugate and produce diploid cells. The culture period is not particularly limited and should be cultured until diploid cells appear. For example, the culture period may be 1 to 4 weeks. Alternatively, algal cells may be subplanted from the quiescent culture medium and cultured for a further 3 to 10 days. Alternatively, by culturing haploid cells under stress conditions for a long period, the haploid cells will self-diploidize, and diploid cells can be obtained. Diploid cells produced by the self-diploidization of haploid cells are thought to have similar properties to diploid cells produced by the conjugation of two haploid cells. As described above, diploid cells are larger in size and have stronger cell walls compared to haploid cells. Therefore, haploid and diploid cells can be distinguished by light microscopy. Diploid cells can be obtained by collecting and isolating diploid cells that appear in the culture medium using a Pasteur pipette or similar tool.

[0037] Algae belonging to the class Ideyukogome are not limited to those isolated from nature, but may also be those that have undergone mutations in naturally occurring Ideyukogome algae. Mutations may occur spontaneously or artificially. The method for artificially inducing mutations is not particularly limited, and known methods can be used. Examples of methods for artificially inducing mutations include chemical treatment with ultraviolet irradiation, radiation irradiation, nitrite, etc.; and genetic engineering methods such as gene introduction and genome editing.

[0038] Algae belonging to the class Ideyukogome may be genetically modified algae. Haploploid cells have only one set of genome, making them easy to genetically modify. Therefore, if algae belonging to the class Ideyukogome have both diploid and haploid cell forms, it is preferable to perform genetic modification in haploid cells.

[0039] The types of gene modifications are not particularly limited, but examples include gene modifications that increase the production of ergothioneine. Examples of gene modifications that increase the production of ergothioneine include gene modifications that increase the expression level of enzymes involved in ergothioneine biosynthesis, and gene modifications that suppress the expression level of enzymes involved in the degradation of ergothioneine.

[0040] Figure 2 shows the biosynthetic pathways of ergothioneine reported in the Gram-positive bacterium Mycobacterium smegmatis and the filamentous fungus Neurospora crassa (Borodina et al Nutr Res Rev. 2020 Dec;33(2):190-217). In Mycobacterium smegmatis, ergothioneine is synthesized from histidine via trimethylhistidine (hercinin), γ-glutamylhercinylcysteine ​​sulfoxide, and hercinylcysteine ​​sulfoxide (5-histidylcysteine ​​sulfoxide) by the enzymes EgtD, EgtB, EgtC, and EgtE. In Neurospora crassa, ergothioneine is synthesized from histidine via trimethylhistidine and hercinylcysteine ​​sulfoxide. In Neurospora crassa, an enzyme (Egt-1) that synthesizes hercinyl cysteine ​​sulfoxide from histidine has been reported, but an enzyme that synthesizes ergothioneine from hercinyl cysteine ​​sulfoxide has not been reported.

[0041] Algae belonging to the class Ideyukogome are eukaryotes and are therefore thought to possess an ergothioneine biosynthesis pathway similar to that of Neurospora crassa. Neurospora crassa Egt-1 (e.g., NCBI Reference Sequence: XM_951231.3: SEQ ID NO: 18) has a domain with methyltransferase activity and a domain with 5-histidylcysteine ​​sulfoxide synthase activity. The domain with methyltransferase activity (methyltransferase domain) catalyzes the reaction of adding a methyl group to histidine to synthesize trimethylhistidine, using S-adenosylmethionine (SAM) as a methyl group donor. The domain possessing 5-histidylcysteine ​​sulfoxide synthase activity (5-histidylcysteine ​​sulfoxide synthase domain) catalyzes the reaction of adding cysteine ​​to trimethylhistidine to synthesize hercinylcysteine ​​sulfoxide in the presence of iron (Fe(II)) and oxygen (O2).

[0042] Therefore, enzymes involved in ergothioneine biosynthesis include Egt-1 of Neurospora crassa; the methyltransferase domain of Egt-1; the 5-histidylcysteine ​​sulfoxide synthase domain of Egt-1; proteins having high homology to Egt-1 (e.g., 30% or more, 35% or more, or 40% or more) and possessing both methyltransferase activity and 5-histidylcysteine ​​sulfoxide synthase activity; proteins having high homology to the methyltransferase domain of Egt-1 (e.g., 30% or more, 35% or more, or 40% or more) and possessing methyltransferase activity; and proteins having high homology to the 5-histidylcysteine ​​sulfoxide synthase domain of Egt-1 (e.g., 30% or more, 35% or more, or 40% or more) and possessing 5-histidylcysteine ​​sulfoxide synthase activity. Hereinafter, Egt-1 of Neurospora crassa, the methyltransferase domain of Egt-1, and the 5-histidylcysteine ​​sulfoxide synthase domain of Egt-1 will be collectively referred to as "Egt-1, etc." Hereinafter, proteins that have high homology to Neurospora crassa Egt-1 and possess methyltransferase activity and 5-histidylcysteine ​​sulfoxide synthase activity; proteins that have high homology to the methyltransferase domain of Egt-1 and possess methyltransferase activity; and proteins that have high homology to the 5-histidylcysteine ​​sulfoxide synthase domain of Egt-1 and possess 5-histidylcysteine ​​sulfoxide synthase activity are collectively referred to as "Egt-1-like enzymes."

[0043] Genetic modifications that increase the expression level of enzymes involved in ergothioneine biosynthesis include introducing polynucleotides containing the coding sequence (CDS) of Egt-1 or an Egt-1-like enzyme into algae belonging to the class Ideyukogome in an expressible state. If algae belonging to the class Ideyukogome endogenously possess an Egt-1-like enzyme, genetic modifications that increase the amount of ergothioneine produced include increasing the expression level of the Egt-1-like enzyme. Examples of genetic modifications that increase the expression level of an Egt-1-like enzyme include introducing an Egt-1-like enzyme gene (e.g., a polynucleotide containing the CDS of an Egt-1-like enzyme) functionally linked to a highly expressive promoter; replacing the promoter of the Egt-1-like enzyme gene with a strongly expressive promoter; disrupting or suppressing the expression of an Egt-1-like enzyme gene repressor; introducing or promoting the expression of an Egt-1-like enzyme gene promoter, etc.

[0044] Egt-1-like enzymes from algae belonging to the class Ideyukogome can be identified based on their homology to the amino acid sequences of Egt-1 and other similar enzymes. For example, a homology search program such as BLAST can be used to perform a homology search on the amino acid sequences of proteins expressed by algae belonging to the class Ideyukogome, using the amino acid sequences of Egt-1 and other similar enzymes as the query sequence. As a result, proteins with high homology to the amino acid sequences of Egt-1 and other similar enzymes (e.g., 30% or more, 35% or more, or 40% or more) can be identified as Egt-1-like enzymes.

[0045] For example, Egt-1-like enzymes in C. merolae include the protein with the amino acid sequence described in SEQ ID NO: 2 (CMM184C) and the protein with the amino acid sequence described in SEQ ID NO: 4 (CMR147C). The protein in SEQ ID NO: 2 has high homology to the methyltransferase domain of Egt-1. Therefore, it is thought to have histidine-specific methyltransferase activity. The protein in SEQ ID NO: 4 has high homology to the 5-histidylcysteine ​​sulfoxide synthase domain of Egt-1. Therefore, it is thought to have 5-histidylcysteine ​​sulfoxide synthase activity. The coding sequence (CDS) of the protein in SEQ ID NO: 2 is shown in SEQ ID NO: 1. The genomic gene sequence of the protein in SEQ ID NO: 2 is the same as the CDS sequence because it does not contain introns. The coding sequence (CDS) of the protein in SEQ ID NO: 4 is shown in SEQ ID NO: 3. The genomic gene sequence of the protein in SEQ ID NO: 4 is the same as the CDS sequence because it does not contain introns.

[0046] For example, Egt-1-like enzymes in the HKN1 strain include the protein having the amino acid sequence described in SEQ ID NO: 6 and the protein having the amino acid sequence described in SEQ ID NO: 8. The protein of SEQ ID NO: 6 has high homology to the methyltransferase domain of Egt-1. Therefore, it is thought to have histidine-specific methyltransferase activity. The protein of SEQ ID NO: 8 has high homology to the 5-histidylcysteine ​​sulfoxide synthase domain of Egt-1. Therefore, it is thought to have 5-histidylcysteine ​​sulfoxide synthase activity. The coding sequence (CDS) of the protein of SEQ ID NO: 6 is shown in SEQ ID NO: 5. The genomic gene sequence of the protein of SEQ ID NO: 6 is the same as the CDS because it does not contain introns. The coding sequence (CDS) of the protein of SEQ ID NO: 8 is shown in SEQ ID NO: 7. The genomic gene sequence of the protein of SEQ ID NO: 8 is the same as the CDS because it does not contain introns.

[0047] For example, Egt-1-like enzymes in G. sulfuraria include the protein with the amino acid sequence described in SEQ ID NO: 11 (NCBI Reference Sequence: XP_005703833.1) and the protein with the amino acid sequence described in SEQ ID NO: 14 (NCBI Reference Sequence: XP_005706200.1). The protein of SEQ ID NO: 11 has high homology to the methyltransferase domain of Egt-1. Therefore, it is thought to have histidine-specific methyltransferase activity. The protein of SEQ ID NO: 14 has high homology to the 5-histidylcysteine ​​sulfoxide synthase domain of Egt-1. Therefore, it is thought to have 5-histidylcysteine ​​sulfoxide synthase activity. The genomic gene sequence and coding sequence (CDS) of the protein of SEQ ID NO: 11 are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively. The genomic gene sequence and coding sequence (CDS) of the protein of SEQ ID NO: 14 are shown in SEQ ID NO: 12 and SEQ ID NO: 13, respectively.

[0048] Hereinafter, proteins with high homology to the methyltransferase domain of Egt-1 will also be called "histidine methyltransferase-like proteins," and genes encoding histidine methyltransferase-like proteins will also be called "histidine methyltransferase-like genes." Proteins with high homology to the 5-histidylcysteine ​​sulfoxide synthase domain of Egt-1 will also be called "histidylcysteine ​​sulfoxide synthase-like proteins," and genes encoding histidylcysteine ​​sulfoxide synthase-like proteins will also be called "histidylcysteine ​​sulfoxide synthase-like genes."

[0049] When performing genetic modification to increase ergothioneine production in algae belonging to the class Ideyukogome, it is preferable to introduce either or both of the histidine methyltransferase-like gene and the histidylcysteine ​​sulfoxide synthase-like gene, and it is more preferable to introduce both the histidine methyltransferase-like gene and the histidylcysteine ​​sulfoxide synthase-like gene.

[0050] When introducing genes into algae belonging to the class Ideyukogome, the introduced gene is introduced into the cells in a state where it can be expressed. The introduced gene is introduced into the cells after being functionally linked to a promoter that can function in the target cells, for example. The promoter may be the promoter of the introduced gene, or it may be the promoter of another gene. When using the promoter of another gene, it is preferable that it is the promoter of the gene that is highly expressed in the target cells. Examples of such promoters include the APCC promoter, CPCC promoter, Catalase promoter, and EF1α promoter. The APCC (CMO250C) promoter of C. merolae (e.g., -600~-1; "-1" indicates the nucleotide immediately preceding the start codon) is shown in SEQ ID NO: 15. The CPCC (CMP166C) promoter of C. merolae is shown in SEQ ID NO: 16. The Catalase (CMI050C) promoter of C. merolae is shown in SEQ ID NO: 17. These C. merolae promoters can also be used in other algae belonging to the class Ideycogome. The APCC promoter of strain HKN1 is shown in SEQ ID NO: 19. The CPCC promoter of strain HKN1 is shown in SEQ ID NO: 21. The EF1α promoter of strain HKN1 is shown in SEQ ID NO: 20. These promoters of strain HKN1 can also be used in other algae belonging to the class Ideyukogome.

[0051] The transgene may be introduced into cells, for example, in the form of an expression vector. In addition to the transgene and promoter, the expression vector may include regulatory sequences (enhancers, poly(A) addition signals, terminators, 3'UTRs, etc.) and / or marker genes (drug resistance genes, fluorescent protein genes, nutrient requirement-related genes, etc.). Examples of terminators and 3'UTRs include β-tubulin terminators and 3'UTRs, α-tubulin terminators and 3'UTRs, and ubiquitin terminators and 3'UTRs. The type of expression vector is not particularly limited, and commonly used expression vectors can be appropriately selected and used. The vector may be linear or circular, and may be a non-viral vector such as a plasmid, a viral vector (e.g., a retroviral vector such as a lentiviral vector), or a transposon-mediated vector.

[0052] Among the algae belonging to the class Ideycogome, C. merolae is an alga that can be self-cloned (Fujiwara et al., PLoS One. 2013 Sep 5;8(9):e73608). "Self-cloning" refers to a genetic engineering technique that uses only (1) nucleic acids from an organism belonging to the same taxonomical species as the organism from which the cell originates, and (2) nucleic acids from an organism belonging to a species that exchanges nucleic acids with the taxonomical species to which the organism originates under natural conditions. Transformants produced by self-cloning are excluded from the list of genetically modified organisms under the Catalhena Protocol and can therefore be cultured in the field. Thus, genetic modification may be performed by self-cloning.

[0053] There are no particular limitations on the method of self-cloning in C. merolae, but one method is to use the URA5.3 gene (CMK046C) as a selection marker. C. merolae has a uracil-dependent mutant strain called C. merolae M4 (Minoda et al., Plant Cell Physiol. 2004 Jun;45(6):667-71.). C. merolae M4 has a mutation in the URA5.3 gene and cannot synthesize uracil. Therefore, C. merolae M4 cannot grow in a medium that does not contain uracil. Thus, self-cloning can be performed by using C. merolae M4 as the parent strain and using the wild-type URA5.3 gene as a selection marker. More specifically, an arbitrary set of C. merolae genes is ligated to the URA5.3 gene set of a wild-type C. merolae (e.g., strain 10D) and introduced into C. merolae M4. Subsequently, cells into which any gene set has been introduced can be obtained by culturing them in a medium that does not contain uracil. In the above, "gene set" means a combination of any promoter, the ORF of the target gene, and any 3'UTR. The 3'UTR is not particularly limited and may be the 3'UTR of the target gene or the 3'UTR of another gene. Commonly used 3'UTRs include the 3'UTR of β-tubulin, the 3'UTR of α-tubulin, and the 3'UTR of ubiquitin. The selection marker is not limited to the URA5.3 gene and may be other genes related to nutritional requirements.

[0054] As described above, when gene modification is performed using a nutrient requirement-related gene as a select marker, the gene modification can be performed again using the same nutrient requirement-related gene as a select marker by knocking out the nutrient requirement-related gene introduced into the algal cells. In other words, multiple self-cloning is possible. The method for knocking out the nutrient requirement-related gene introduced as a select marker is not particularly limited, and any known knockout technology can be used. Examples of knockout technologies include homologous recombination and gene editing technology. For example, in C. merolae, self-cloning can be performed using the URA5.3 gene (CMK046C) as a selection marker and the C. merolae M4 strain as the parent strain. Since untransformed cells cannot grow in uracil-free medium, transformants can be selected by culturing transformed cells in uracil-free medium. Furthermore, when performing self-cloning, the URA5.3 gene is knocked out using known knockout techniques such as homologous recombination. For example, the entire introduced URA5.3 gene may be deleted, the URA5.3 gene may be partially deleted, or a point mutation may be introduced into the URA5.3 gene. URA5.3 gene knockout strains can be selected by culturing them in a medium containing uracil and 5-fluorouracil (5-FOA). This is because in strains that normally express the URA5.3 gene, the gene product of the URA5.3 gene converts 5-FOA into toxic 5-fluorouracil. Using the URA5.3 knockout strain obtained in this way as the parent strain, self-cloning can be performed again using the URA5.3 gene as a selection marker. By repeating the same procedure, it is possible to perform self-cloning a desired number of times.

[0055] The method for introducing genes into algae belonging to the class Ideyukogome is not particularly limited, and known methods can be used. Examples of nucleic acid introduction methods include the polyethylene glycol (PEG) method, lipofection method, microinjection method, DEAE dextran method, gene gun method, electroporation method, and calcium phosphate method.

[0056] When introducing genes into algae belonging to the class Ideyukogome, the introduced nucleic acid may be inserted into the nuclear genome, chloroplast genome, or mitochondrial genome. When inserting the introduced nucleic acid into the genome, it may be inserted at a specific location in the genome or randomly. Methods for inserting introduced nucleic acids at specific locations in the genome include homologous recombination and genome editing. For example, since the entire genome sequence of C. merolae has been deciphered (Matsuzaki M et al., Nature. 2004 Apr 8;428(6983):653-7.), it is possible to insert introduced nucleic acids at desired locations on the genome. The insertion site of the introduced gene in C. merolae is not particularly limited, but for example, the region between CMD184C and CMD185C is one example. In algae belonging to the genus Cyanidium, for example, the insertion site of the introduced gene is the NS1 region (for example, the NSI region of strain HKN1 (SEQ ID NO: 29)).

[0057] (Cultivation of algae belonging to the class Ideyukogome) The method for culturing algae belonging to the class Ideyukogome is not particularly limited and can be done by known methods. Algae belonging to the class Ideyukogome can be cultivated, for example, using a culture medium for microalgae. The culture medium for microalgae is not particularly limited, but examples include inorganic salt culture media containing a nitrogen source, a phosphorus source, and trace elements (zinc, boron, cobalt, copper, manganese, molybdenum, iron, etc.). For example, ammonium salts, nitrates, and nitrites can be used as nitrogen sources, and phosphates can be used as phosphorus sources. Examples of such culture media include 2×Allen medium (Allen MB. Arch. Microbiol. 1959 32: 270-277.), M-Allen medium (Minoda A et al. Plant Cell Physiol. 2004 45: 667-71.), MA2 medium (Ohnuma M et al. Plant Cell Physiol. 2008 Jan;49(1):117-20.), and modified M-Allen medium. Liquid media are preferred.

[0058] Algae belonging to the class Ideycogome can grow autotrophically under light irradiation, or heterotrophically by utilizing carbon sources. Therefore, the culture medium may contain organic matter as a carbon source. Examples of carbon sources include monosaccharides such as glucose, fructose, and galactose; disaccharides such as sucrose, lactose, and maltose; polysaccharides such as starch; and peptides such as peptone, tryptone, and casamino acids. As a carbon source, glucose is preferred from the viewpoint of the growth efficiency of algae belonging to the class Ideyukogome. When glucose is used as a carbon source, examples of glucose concentrations in the culture medium include 0.01-10M, 0.01-5M, 0.01-3M, 0.01-1M, 0.01-0.5M, 0.05-10M, 0.05-5M, 0.05-3M, 0.05-1M, or 0.05-0.5M.

[0059] Algae belonging to the class Ideyukogome tend to increase ergothioneine production under salt stress conditions. Therefore, the culture medium may contain sodium chloride. If the culture medium contains sodium chloride, examples of sodium chloride concentrations in the medium include 0.1-10M, 0.1-5M, 0.1-3M, 0.1-1M, 0.1-0.5M, 0.3-10M, 0.3-5M, 0.3-3M, 0.3-1M, or 0.3-0.8M.

[0060] Ergothioneine possesses high antioxidant activity and is thought to contribute to the reduction of oxidative stress. Therefore, the amount of ergothioneine produced may increase under oxidative stress conditions. For this reason, the culture medium may contain substances that induce oxidative stress. Examples of substances that induce oxidative stress include substances that induce osmotic stress, such as salts, and peroxides.

[0061] Cultivating algae belonging to the class Ideyukogome under stress conditions tends to increase the production of nutrients including ergothioneine. Therefore, in one embodiment, the present invention also provides a method for increasing the nutrient content of algae belonging to the class Ideyukogome, which includes cultivating the algae belonging to the class Ideyukogome under stress conditions. Examples of the nutrients include ergothioneine. Examples of the stress conditions include salt stress and oxidative stress. Examples of salt stress conditions include cultivation in the presence of sodium chloride at the above-mentioned concentrations. Examples of oxidative stress conditions include cultivation in the presence of oxidative stress-inducing substances as described above. In one embodiment, the present invention also provides algae belonging to the class Ideyukogomei cultured under stress conditions. Algae belonging to the class Ideyukogomei cultured under stress conditions tend to have a higher content of nutrients, including ergothioneine, compared to those cultured under non-stress conditions. Examples of stress conditions are the same as those described above.

[0062] The culture medium may contain ergothioneine precursors in the ergothioneine biosynthesis pathway. The inclusion of ergothioneine precursors in the culture medium is expected to increase the amount of ergothioneine produced by algae belonging to the class Ideycogome. Examples of ergothioneine precursors include methionine, histidine, trimethylhistidine, and hercinylcysteine ​​sulfoxide.

[0063] The culture medium may contain a substance that inhibits the metabolism of ergothioneine. By containing a substance that inhibits the metabolism of ergothioneine in the culture medium, accumulation of ergothioneine can be expected. If reactive oxygen species are present, ergothioneine may be consumed to capture them. Therefore, the culture medium may contain antioxidants as other substances capable of capturing reactive oxygen species. Examples of antioxidants include ascorbic acid (vitamin C), tocopherols (vitamin E), polyphenols, flavonoids, glutathione, and astaxanthin.

[0064] The pH of the culture medium should be within the range in which algae belonging to the class Ideyukogomei can grow. For example, the pH of the culture medium can be pH 1 to 6, or pH 1 to 5. When cultivating algae belonging to the class Ideyukogomei outdoors, it is preferable to cultivate them under highly acidic conditions to prevent the growth of other organisms. In this case, the pH of the culture medium can be, for example, pH 1 to 3.

[0065] The culture temperature should be within the range in which algae belonging to the class Ideyukogomei can grow. For example, a culture temperature of 15 to 50°C is possible. A culture temperature of 20 to 50°C is preferable, and 30 to 50°C is more preferable, as it promotes good growth of algae belonging to the class Ideyukogomei. When cultivating algae belonging to the class Ideyukogomei outdoors, it is preferable to cultivate them at a high temperature to prevent the growth of other organisms. In this case, the culture temperature can be, for example, 35 to 50°C.

[0066] The CO2 conditions should be within the range in which algae belonging to the class Ideyukogomei can grow. For example, a CO2 concentration of 0.04 to 5% is possible. A CO2 concentration of 0.04 to 3% is preferable because it promotes good growth of algae belonging to the class Ideyukogomei. The CO2 conditions may also be the atmospheric CO2 concentration. Among the microalgae belonging to the class Ideyukogomei, the genus Gardelia has high tolerance for high CO2 concentrations and can grow even at 100% CO2. Therefore, if the algae belonging to the class Ideyukogomei is of the genus Gardelia, a CO2 concentration of 100% may be used.

[0067] The culture may be static, aerated, or shaken. If aerated culture is used, aeration conditions may include, for example, 1-4 L air / min or 1-3 L air / min. If shaken culture is used, a shaking speed may include, for example, 100-200 rpm.

[0068] Algae belonging to the class Ideyukogome may be propagated autotrophically or heterotrophically. When propagated autotrophically, algae belonging to the class Ideyukogome are cultured under light irradiation. When propagating autotrophically, the light intensity is, for example, 5 to 2000 μmol / m². 2 One example is s. Since the growth of algae belonging to the class Ideyukogome is favorable, the light intensity should be 5-1500 μmol / m². 2 s is preferred. When cultivating algae belonging to the class Ideyukogome outdoors, cultivation under sunlight is sufficient. When cultivating indoors, cultivation under continuous light is also possible, or a light-dark cycle (e.g., 10L:14D) may be provided.

[0069] To heterotrophically propagate algae belonging to the class Ideyukogome, they should be cultured in a medium containing an organic carbon source. Light conditions can be under light irradiation or in darkness. When cultured under light irradiation using a medium containing an organic carbon source, Ideyukogome algae undergo both autotrophic growth through photosynthesis and heterotrophic growth through carbon source assimilation. When cultured in darkness using a medium containing an organic carbon source, Ideyukogome algae undergo heterotrophic growth through carbon source assimilation only. When cultured under light irradiation using a medium without an organic carbon source (inorganic salt medium), Ideyukogome algae undergo autotrophic growth through photosynthesis only. Hereinafter, culturing in a medium without an organic carbon source (inorganic salt medium) under light irradiation will be referred to as "autotrophic culture." Culturing in a medium containing an organic carbon source under light irradiation will be referred to as "mixed trophic culture." Culturing in a medium containing an organic carbon source under darkness will be referred to as "heterotrophic culture."

[0070] When algae belonging to the class Ideycogome are cultured autotrophically, the intracellular content of ergothioneine is higher compared to mixed trophic and heterotrophic cultures. Therefore, from the viewpoint of intracellular ergothioneine content, autotrophic culture is preferable. When algae belonging to the class Ideycogome are cultured using mixed trophic or heterotrophic methods, their growth rate is faster compared to autotrophic culture. Therefore, even considering the intracellular content of ergothioneine, the same amount of ergothioneine can be obtained more quickly than in autotrophic culture. Thus, from the viewpoint of production time, mixed trophic or heterotrophic culture is preferable.

[0071] Algae belonging to the class Ideyukogome may undergo a pre-culture before the main culture to produce ergothioneine. The culture conditions for the pre-culture may be the same as or different from those for the main culture. The pre-culture can be, for example, an autotrophic culture. In this case, for example, the light conditions may be 5-1000 μmol / m². 2 The CO2 conditions can be set to 1-5% and the temperature to 30-50°C. Pre-culture may be performed by static culture.

[0072] Algae belonging to the class Ideyukogome may be cultured until the quiescent phase, or the culture may be terminated during the growth phase. Since cells in the quiescent phase contain more ergothioneine than cells in the growth phase, it is preferable to culture algae belonging to the class Ideyukogome until the quiescent phase.

[0073] <Optional process> The manufacturing method of this embodiment may include optional steps in addition to step (a). Optional steps include, for example, a step (b) of recovering algae belonging to the class Ideyukogome from the culture medium after culturing in step (a), and a step (c) of extracting ergothioneine from the algae belonging to the class Ideyukogome recovered in step (b). Furthermore, before step (a), there may be a step (i) of genetically modifying haploid algae belonging to the class Ideyukogome, and a step (ii) of diploid algae belonging to the class Ideyukogome.

[0074] (Step (b)) Step (b) is the process of recovering algae belonging to the class Ideyukogome from the culture medium after cultivation in step (a).

[0075] The method for recovering algae belonging to the class Ideyukogome from the culture medium is not particularly limited, and known methods can be used. Examples of methods for recovering algal cells include recovery by centrifugation and recovery by filtration. When recovering algal cells by centrifugation, suitable centrifugation conditions include, for example, 1000-5000 × g or 2000-4000 × g. The centrifugation time should be set appropriately according to the volume of culture medium. Suitable centrifugation times include, for example, 5-60 minutes, 5-30 minutes, or 5-20 minutes. When recovering algal cells by filtration, a filter with a pore size smaller than that of the algal cells belonging to the class Ideyukogome should be used. For example, a 0.45 μm filter can be used.

[0076] (Process (c)) Step (c) is the process of extracting ergothioneine from algae belonging to the class Ideyukogomei that were recovered in step (b).

[0077] The method for extracting ergothioneine from algae belonging to the class Ideucogomei is not particularly limited. One example of a method for extracting ergothioneine is solvent extraction. Solvent extraction can be performed, for example, by adding an extraction solvent to algae belonging to the class Ideucogomei, mixing them, and then removing the cell residue of the algae belonging to the class Ideucogomei. The extraction solvent is not particularly limited as long as it is capable of dissolving ergothioneine. Examples of extraction solvents include organic solvents such as methanol, ethanol, isopropanol, and acetone; aqueous organic solvents obtained by mixing these organic solvents with water; and water (e.g., hot water). Among these, methanol is preferred as the extraction solvent. Solvent extraction may also be performed after freeze-drying the cells of algae belonging to the class Ideucogomei. Performing solvent extraction on freeze-dried cells improves the extraction efficiency.

[0078] After adding an extraction solvent to algae belonging to the class Ideyukogome, cell disruption treatment may be performed to increase the extraction efficiency of ergothioneine. Examples of cell disruption treatments include sonication and heat treatment. After the extraction of ergothioneine, the cell residue of algae belonging to the class Ideyukogome may be removed. Examples of methods for removing the cell residue include centrifugation and filter filtration.

[0079] The extract may be further purified to remove ergothioneine. Examples of purification methods include, but are not limited to, salting out, dialysis, recrystallization, reprecipitation, solvent extraction, adsorption, concentration, filtration, gel filtration, ultrafiltration, and various chromatography methods (thin-layer chromatography, column chromatography, ion exchange chromatography, high-performance liquid chromatography, adsorption chromatography, etc.). These methods may be combined as appropriate to purify the ergothioneine.

[0080] (Step (i)) Step (i) is a process of genetically modifying haploid algae belonging to the class Ideyukogome. Step (i) can be performed before step (a).

[0081] When genetically modifying algae belonging to the class Ideyukogome, it is preferable to perform the modification on haploid cells. Since haploid cells have only one set of genome, genetic modification is easier than with diploid cells. Methods for producing haploid algae belonging to the class Ideyukogome include those listed in section "<Step (a)>" above. Methods for genetically modifying algae belonging to the class Ideyukogome include those listed in section "<Step (a)>" above. Examples of genetic modification include genetic modification that increases the production of ergothioneine.

[0082] (Step (ii)) Step (ii) is a process to diploidize algae belonging to the class Ideyukogome. Step (ii) can be performed after step (i) and before step (a).

[0083] Algae belonging to the class Ideyukogome tend to produce more ergothioneine in diploid cells than in haploid cells. Therefore, if haploid cells are genetically modified in step (i), it is preferable to convert them into diploid cells before culturing algae belonging to the class Ideyukogome. Methods for diploidizing algae belonging to the class Ideyukogome include those listed in section "<Step (a)>" above.

[0084] According to the manufacturing method of this embodiment, ergothioneine can be obtained by culturing algae belonging to the class Ideucogomei. Since algae belonging to the class Ideucogomei can grow under low pH and high temperature conditions where other organisms have difficulty growing, it is possible to cultivate them on a large scale outdoors. Furthermore, the cell content of ergothioneine can be increased to a level comparable to that of Pleurotus ostreatus in the algae belonging to the class Ideucogomei. Therefore, a reduction in the production cost of ergothioneine can be expected.

[0085] [Polypto In one embodiment, the present disclosure provides a polypeptide selected from the group consisting of (a1) to (c1) below (hereinafter also referred to as "HSM polypeptide"). (a1) A polypeptide comprising the amino acid sequence described in Sequence ID No. 6. (b1) A polypeptide comprising an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence described in Sequence ID No. 6, and having histidine methyltransferase activity. (c1) A polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence described in Sequence ID No. 6, and having histidine methyltransferase activity.

[0086] The polypeptide in (a1) is either the polypeptide consisting of the amino acid sequence described in SEQ ID NO: 6 (the polypeptide of SEQ ID NO: 6), or a polypeptide in which an amino acid sequence is added to either or both of the N-terminus and C-terminus of the polypeptide of SEQ ID NO: 6. The polypeptide of SEQ ID NO: 6 was discovered in the HKN1 strain as a histidine methyltransferase-like protein. When the polypeptide of SEQ ID NO: 6 was introduced into the HKN1 strain together with the polypeptide consisting of the amino acid sequence described in SEQ ID NO: 8 (the polypeptide of SEQ ID NO: 8), described later, it showed the effect of increasing the ergothioneine production of the HKN1 strain. Therefore, it is presumed that the polypeptide of SEQ ID NO: 6 has histidine methyltransferase activity and has the activity to catalyze the reaction of methylating histidine to produce trimethylhistidine.

[0087] The length of the amino acid sequence added to the N-terminus or C-terminus of the polypeptide of Sequence ID No. 6 is not particularly limited. Examples of the amino acid sequence to be added include the amino acid sequence of a peptide tag (FLAG tag, HA tag, 6×His tag, Myc tag, etc.) and the amino acid sequence of another protein. The size of the polypeptide (a1) is not particularly limited, but examples include a length of approximately 426 to 5000 amino acids. Examples of polypeptide sizes for (a1) include those with a length of 4000 amino acids or less, 3000 amino acids or less, 2000 amino acids or less, 1000 amino acids or less, 800 amino acids or less, 700 amino acids or less, 600 amino acids or less, 500 amino acids or less, and 450 amino acids or less.

[0088] The polypeptide of (b1) is a polypeptide consisting of an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence described in SEQ ID NO: 6, or a polypeptide in which an amino acid sequence is added to either or both of the N-terminus and C-terminus of the polypeptide. The amino acid sequence to be added is the same as that of (a1) above. The size of the polypeptide of (b1) is the same as that of the polypeptide of (a1).

[0089] Amino acid mutations may be deletions, substitutions, additions, or insertions, or combinations thereof. The number of mutated amino acids is not particularly limited, as long as the resulting polypeptide has histidine methyltransferase activity. Examples of the number of mutated amino acids include 1 to 80, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1, or 2.

[0090] The type and position of the mutated amino acid are not particularly limited. When the mutation is an amino acid substitution, for example, it may be a substitution with an amino acid that has similar side chain properties to the original amino acid. Such substitutions include conservative substitutions. Conservative substitutions are amino acid substitutions that have little effect on the function of the polypeptide. Amino acids can be classified, for example, by the type of side chain, into acidic amino acids (aspartic acid and glutamic acid), basic amino acids (lysine, arginine, histidine), neutral amino acids (amino acids with hydrocarbon chains (glycine, alanine, valine, leucine, isoleucine, proline), amino acids with hydroxyl groups (serine, threonine), amino acids containing sulfur (cysteine, methionine), amino acids with amide groups (asparagine, glutamine), amino acids with imino groups (proline), and amino acids with aromatic groups (phenylalanine, tyrosine, tryptophan)). Conservative substitutions include substitutions within these groups.

[0091] The polypeptide of (c1) is a polypeptide consisting of an amino acid sequence having 80% or more sequence identity with the amino acid sequence described in SEQ ID NO: 6, or a polypeptide in which an amino acid sequence is added to either the N-terminus or the C-terminus or both of the polypeptide. The amino acid sequence to be added is the same as that of (a1) above. The size of the polypeptide of (c1) is the same as that of the polypeptide of (a1).

[0092] Sequence identity is not particularly limited as long as it is 80% or higher. Examples of sequence identity include 85% or higher, 90% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, or 99% or higher.

[0093] Polypeptides (b1) and (c1) possess histidine transferase activity. Whether or not a polypeptide possesses histidine transferase activity can be confirmed by known methods. For example, one such method involves incubating histidine and a suitable methyl donor (such as S-adenosylmethionine (SAM)) in the presence of the polypeptide and confirming the formation of trimethylhistidine.

[0094] In one embodiment, the present disclosure provides a polypeptide selected from the group consisting of (a2) to (c2) below (hereinafter also referred to as "HSS polypeptide"). (a2) A polypeptide containing the amino acid sequence described in Sequence ID No. 8. (b2) A polypeptide comprising an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence described in Sequence ID No. 8, and having 5-histidylcysteine ​​sulfoxide synthase activity. (c2) A polypeptide comprising an amino acid sequence having 80% or more sequence identity with the amino acid sequence described in Sequence ID No. 8, and having 5-histidylcysteine ​​sulfoxide synthase activity.

[0095] The polypeptide in (a2) is either the polypeptide consisting of the amino acid sequence described in SEQ ID NO: 8 (the polypeptide of SEQ ID NO: 8), or a polypeptide in which an amino acid sequence is added to either or both of the N-terminus and C-terminus of the polypeptide of SEQ ID NO: 8. The polypeptide of SEQ ID NO: 8 was discovered in the HKN1 strain as a histidylcysteine ​​sulfoxide synthase-like protein. When the polypeptide of SEQ ID NO: 8 was introduced into the HKN1 strain along with the polypeptide of SEQ ID NO: 6 described above, it showed the effect of increasing the ergothioneine production of the HKN1 strain. Therefore, it is presumed that the polypeptide of SEQ ID NO: 8 has 5-histidylcysteine ​​sulfoxide synthase activity and has the activity to catalyze the reaction that produces 5-histidylcysteine ​​sulfoxide (hercinylcysteine ​​sulfoxide) from trimethylhistidine.

[0096] The length of the amino acid sequence added to the N-terminus or C-terminus of the polypeptide of Sequence ID No. 8 is not particularly limited. Examples of the amino acid sequence to be added include the amino acid sequence of a peptide tag (FLAG tag, HA tag, 6×His tag, Myc tag, etc.) and the amino acid sequence of another protein. The size of the polypeptide of (a2) is not particularly limited, but examples include a length of approximately 595 to 5000 amino acids. Examples of polypeptide sizes of (a2) include a length of 4000 amino acids or less, 3000 amino acids or less, 2000 amino acids or less, 1000 amino acids or less, 800 amino acids or less, 700 amino acids or less, 650 amino acids or less, and 600 amino acids or less.

[0097] The polypeptide of (b2) is a polypeptide consisting of an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence described in Sequence ID No. 8, or a polypeptide in which an amino acid sequence is added to either or both of the N-terminus and C-terminus of the polypeptide. Examples of the added amino acid sequence are the same as those of (a2) above. Examples of the size of the polypeptide of (b2) are the same as those of the polypeptide of (a2).

[0098] Amino acid mutations may be deletions, substitutions, additions, or insertions, or combinations thereof. The number of mutated amino acids is not particularly limited, as long as the resulting polypeptide has 5-histidylcysteine ​​sulfoxide synthase activity. Examples of the number of mutated amino acids include 1 to 80, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1, or 2. The type and position of the mutated amino acid are not particularly limited. Examples of amino acid substitutions include those described above.

[0099] The polypeptide of (c2) is a polypeptide consisting of an amino acid sequence having 80% or more sequence identity with the amino acid sequence described in Sequence ID No. 8, or a polypeptide in which an amino acid sequence is added to either the N-terminus and / or C-terminus of the polypeptide. Examples of the added amino acid sequence are the same as those of (a2) above. The size of the polypeptide of (c2) is the same as that of the polypeptide of (a2).

[0100] Sequence identity is not particularly limited as long as it is 80% or higher. Examples of sequence identity include 85% or higher, 90% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, or 99% or higher.

[0101] Polypeptides (b2) and (c2) possess 5-histidylcysteine ​​sulfoxide synthase activity. Whether or not a polypeptide possesses 5-histidylcysteine ​​sulfoxide synthase activity can be confirmed by known methods. For example, such a method involves incubating trimethylhistidine and cysteine ​​in the presence of a polypeptide and confirming the formation of 5-histidylcysteine ​​sulfoxide (hercinylcysteine ​​sulfoxide).

[0102] HSM polypeptides and HSS polypeptides can be used to produce ergothioneine from histidine.

[0103] [Polynucleotides] In one embodiment, the present disclosure provides a polynucleotide encoding an HSM polypeptide (hereinafter also referred to as "HSM polynucleotide").

[0104] Specific examples of HSM polynucleotides include (d1) to (g1) below. (d1) A polynucleotide containing the nucleotide sequence described in Sequence ID No. 5. (e1) A polynucleotide comprising the nucleotide sequence described in Sequence ID No. 5, wherein the polynucleotide includes a nucleotide sequence in which one or more nucleotides are mutated, and which encodes a polypeptide having histidine transferase activity. (f1) A polynucleotide comprising a nucleotide sequence having 80% or more sequence identity with a polynucleotide consisting of the nucleotide sequence described in Sequence ID No. 5, and encoding a polypeptide having histidine transferase activity. (g1) A polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of the nucleotide sequence described in Sequence ID No. 5, and which encodes a polypeptide having histidine transferase activity.

[0105] The polynucleotide of (d1) is a polynucleotide consisting of the nucleotide sequence described in SEQ ID NO: 5 (the polynucleotide of SEQ ID NO: 5), or a polynucleotide in which a nucleotide sequence is added to either or both of the 5' and 3' ends of the polynucleotide of SEQ ID NO: 5. The polynucleotide of SEQ ID NO: 5 is a polynucleotide that encodes the polypeptide of SEQ ID NO: 6. The nucleotide sequence to be added can be selected according to the amino acid sequence to be added to the polypeptide of SEQ ID NO: 6.

[0106] The polynucleotide of (e1) is a polynucleotide consisting of a nucleotide sequence in which one or more nucleotides are mutated in the nucleotide sequence described in Sequence ID No. 5, or a polynucleotide in which a nucleotide sequence is added to either or both of the 5' and 3' ends of the said polynucleotide. The nucleotide sequence to be added can be selected according to the amino acid sequence to be added to the polypeptide.

[0107] Nucleotide mutations may be deletions, substitutions, additions, or insertions, or combinations thereof. The number of nucleotides mutated is not particularly limited, as long as the polypeptide encoded by the resulting polynucleotide has histidine methyltransferase activity. Examples of the number of nucleotides mutated include 1 to 300, 1 to 200, 1 to 150, 1 to 120, 1 to 100, 1 to 80, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1, or 2.

[0108] The polynucleotide of (f1) is a polynucleotide consisting of a nucleotide sequence having 80% or more sequence identity with the nucleotide sequence described in Sequence ID No. 5, or a polynucleotide in which a nucleotide sequence is added to either or both of the 5' and 3' ends of the said polynucleotide. The added nucleotide sequence can be selected according to the amino acid sequence to be added to the polypeptide.

[0109] Sequence identity is not particularly limited as long as it is 80% or higher. Examples of sequence identity include 85% or higher, 90% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, or 99% or higher.

[0110] In one embodiment, the Disclosure provides a polynucleotide encoding an HSS polypeptide (hereinafter also referred to as "HSS polynucleotide").

[0111] Specific examples of HSS polynucleotides include (d2) to (g2) below. (d2) A polynucleotide containing the nucleotide sequence described in Sequence ID No. 7. (e2) A polynucleotide comprising the nucleotide sequence described in Sequence ID No. 7, wherein the polynucleotide includes a nucleotide sequence in which one or more nucleotides are mutated, and which encodes a polypeptide having 5-histidylcysteine ​​sulfoxide synthase activity. (f1) A polynucleotide comprising a nucleotide sequence described in Sequence ID No. 7 and a nucleotide sequence having 80% or more sequence identity, which encodes a polypeptide having 5-histidylcysteine ​​sulfoxide synthase activity. (g1) A polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of the nucleotide sequence described in Sequence ID No. 7, and which encodes a polypeptide having 5-histidylcysteine ​​sulfoxide synthase activity.

[0112] The polynucleotide of (d2) is a polynucleotide consisting of the nucleotide sequence described in SEQ ID NO: 7 (the polynucleotide of SEQ ID NO: 7), or a polynucleotide in which a nucleotide sequence is added to either or both of the 5' and 3' ends of the polynucleotide of SEQ ID NO: 7. The polynucleotide of SEQ ID NO: 7 is a polynucleotide that encodes the polypeptide of SEQ ID NO: 8. The nucleotide sequence to be added can be selected according to the amino acid sequence to be added to the polypeptide of SEQ ID NO: 8.

[0113] The polynucleotide of (e2) is a polynucleotide consisting of a nucleotide sequence in which one or more nucleotides are mutated in the nucleotide sequence described in Sequence ID No. 7, or a polynucleotide in which a nucleotide sequence is added to either or both of the 5' and 3' ends of the said polynucleotide. The nucleotide sequence to be added can be selected according to the amino acid sequence to be added to the polypeptide.

[0114] Nucleotide mutations may be deletions, substitutions, additions, or insertions, or combinations thereof. The number of nucleotides mutated is not particularly limited, as long as the polypeptide encoded by the resulting polynucleotide has 5-histidylcysteine ​​sulfoxide synthase activity. Examples of the number of nucleotides mutated include 1 to 300, 1 to 200, 1 to 170, 1 to 150, 1 to 120, 1 to 100, 1 to 80, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1, or 2.

[0115] The polynucleotide of (f1) is a polynucleotide consisting of a nucleotide sequence having 80% or more sequence identity with the nucleotide sequence described in Sequence ID No. 7, or a polynucleotide in which a nucleotide sequence is added to either or both of the 5' and 3' ends of the said polynucleotide. The added nucleotide sequence can be selected according to the amino acid sequence to be added to the polypeptide.

[0116] Sequence identity is not particularly limited as long as it is 80% or higher. Examples of sequence identity include 85% or higher, 90% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, or 99% or higher.

[0117] In the above, the degenerate codons used may be those with high codon usage frequency in the cells being used. For example, codon optimization may be performed depending on the type of cell being used. Nucleotide mutations may be silent mutations (gene mutations that do not change the amino acid sequence of the encoded protein).

[0118] HSM polynucleotides and HSS polynucleotides can be used to produce cells that produce ergothioneine, or cells with improved ergothioneine production capacity.

[0119] [vector] In one embodiment, the present disclosure provides a vector comprising at least one polynucleotide selected from the group consisting of HSM polynucleotides and HSS polynucleotides.

[0120] The vector of this embodiment may contain only one of HSM polynucleotides and HSS polynucleotides, or it may contain both HSM polynucleotides and HSS polynucleotides.

[0121] The vector may contain other sequences in addition to the HSM polynucleotide and / or HSS polynucleotide. Examples of other sequences are the same as those described above. The vector may also be an expression vector. Examples of such vectors are the same as those described above.

[0122] HSM polynucleotides and / or HSS polynucleotides may be functionally ligated to a promoter capable of functioning in the target molecule. Examples of promoters are those described above. If the vector contains both HSM polynucleotides and HSS polynucleotides, the promoter and terminator may be the same or different. From the viewpoint of avoiding unintended homologous recombination, it is preferable to use different promoters and terminators for HSM polynucleotides and HSS polynucleotides, respectively.

[0123] The vector of this embodiment can be used for the production of cells that produce ergothioneine, or for the production of cells with improved ergothioneine production capacity, and so on.

[0124] [cell] In one embodiment, the present disclosure provides a cell comprising at least one polynucleotide selected from the group consisting of HSM polynucleotides and HSS polynucleotides.

[0125] The cells of this embodiment may contain only HSM polynucleotides and HSS polynucleotides, or both HSM polynucleotides and HSS polynucleotides. It is preferable that the cells of this embodiment contain both HSM polynucleotides and HSS polynucleotides.

[0126] The type of cell is not particularly limited. Examples of cells include, but are not limited to, those of bacteria (E. coli, Bacillus subtilis, etc.), fungi (yeast, etc.), algae (Ideycogome algae, etc.), insects (silkworms, etc.), plants, and mammals. For example, the cells of algae belonging to the Ideycogome class can be cited.

[0127] The cells of this embodiment can be produced by introducing a vector containing HSM polynucleotides and / or HSS polynucleotides into the cells. The same method as described above can be used for introducing the vector.

[0128] The cells of this embodiment preferably contain HSM polynucleotides and / or HSS polynucleotides in an expressible state. By containing HSM polynucleotides and / or HSS polynucleotides in an expressible state, HSM polypeptides and / or HSS polypeptides are expressed from these polynucleotides. The expressed HSM and / or HSS polypeptides catalyze the reaction to synthesize ergothioneine from histidine. As a result, the cells become able to synthesize ergothioneine. Alternatively, if the cells have the ability to produce ergothioneine, their ergothioneine production ability is improved.

[0129] In one embodiment, the present disclosure provides a method for producing ergothioneine, comprising the step of culturing cells containing at least one polynucleotide selected from the group consisting of HSM polynucleotides and HSS polynucleotides.

[0130] The culture method can be appropriately selected depending on the type of cell. If the cells are algal cells belonging to the class Ideyukogome, they can be cultured in the same manner as described above. The manufacturing method of this embodiment may further include steps such as a step to collect the cells and a step to extract ergothioneine from the cells. [Examples]

[0131] The present invention will be described below with reference to examples, but the present invention is not limited to the following examples.

[0132] Example 1: [Preparation of culture medium] (MA medium) M-Allen medium (MA medium) with the composition shown in Table 1 was prepared. Specifically, the medium components other than A2 Fe stock were mixed, the pH was adjusted to 2.0 with sulfuric acid, and then sterilized by autoclaving. After autoclaving, 4 mL of filter-sterilized A2 Fe stock was added to prepare the MA medium. Tables 2 and 3 show the compositions of the A2 trace element and A2 Fe stock, respectively.

[0133] [Table 1]

[0134] [Table 2]

[0135] [Table 3]

[0136] (MA + 0.1M glucose medium) Glucose was added to MA medium to a final concentration of 0.1 M to prepare MA + 0.1 M glucose medium.

[0137] (MA + 0.3M NaCl medium) NaCl was added to MA medium to a final concentration of 0.3M to prepare MA+0.3M NaCl medium.

[0138] (MA + 0.6M NaCl medium) NaCl was added to MA medium to a final concentration of 0.6 M to prepare MA + 0.6 M NaCl medium.

[0139] (MA + 0.1M glucose, 0.6M NaCl medium) Glucose and NaCl were added to MA medium to achieve final concentrations of 0.1M and 0.6M, respectively, to prepare MA + 0.1M glucose, 0.6M NaCl medium.

[0140] [Culture method] <Autotrophic culture> (preculture) Algae belonging to the class Ideyukogome were cultured statically in a CO2 incubator using MA medium. The culture conditions were: light conditions 60 μmol / m² 2 The conditions were continuous light (s), temperature 40°C, and CO2 concentration 2%.

[0141] (main culture) Algae belonging to the class Ideyukogome were cultured in a gas-phase incubator using 1 L of MA medium. After culturing for 2-3 weeks, cells were harvested by centrifugation (3,000 × g, 10 minutes). The culture conditions were 200 μmol / m² under light conditions. 2 The conditions were: continuous light (s), temperature 40°C, and ventilation 2 L ambient air / min.

[0142] <Mixed trophic culture> (preculture) Algae belonging to the class Ideyukogome were cultured statically in a CO2 incubator using MA medium. The culture conditions were: light conditions 60 μmol / m² 2 The conditions were continuous light (s), temperature 40°C, and CO2 concentration 2%.

[0143] (main culture) Using 1 L of MA + 0.1 M glucose medium, axenic culture of algae belonging to the genus Ideococcus was carried out in a gas-phase incubator. After culturing for 4 days, cells were harvested by centrifugation (3,000×g, 10 minutes). The culture conditions were light condition 200 μmol / m 2 ·s (continuous light), temperature condition 40 °C, and aeration condition 2 L ambient air / min.

[0144] <Heterotrophic culture> (Pre-culture) Using MA medium, algae belonging to the genus Ideococcus were statically cultured in a CO2 incubator. The culture conditions were light condition 60 μmol / m 2 ·s (continuous light), temperature condition 40 °C, and CO2 concentration 2%.

[0145] (Axenic culture) Using 1 L of MA + 0.1 M glucose medium, axenic culture of algae belonging to the genus Ideococcus was carried out in a gas-phase incubator. After culturing for 4 days, cells were harvested by centrifugation (3,000×g, 10 minutes). The culture conditions were under darkness, temperature condition 40 °C, and aeration condition 2 L ambient air / min.

[0146] <Autotrophic culture under salt stress conditions> (Pre-culture) Using MA + 0.3 M NaCl medium, algae belonging to the genus Ideococcus were statically cultured in a CO2 incubator. The culture conditions were light condition 60 μmol / m 2 ·s (continuous light), temperature condition 40 °C, and CO2 concentration 2%.

[0147] (Axenic culture) Using 1 L of MA + 0.6 M NaCl medium, axenic culture of algae belonging to the genus Ideococcus was carried out in a gas-phase incubator. After culturing for 2 - 3 weeks, cells were harvested by centrifugation (3,000×g, 10 minutes). The culture conditions were light condition 200 μmol / m 2The conditions were: continuous light (s), temperature 40°C, and ventilation 2 L ambient air / min.

[0148] <Mixed nutrient culture under salt stress conditions> (preculture) Algae belonging to the class Ideyukogome were cultured statically in a CO2 incubator using MA+0.3M NaCl medium. The culture conditions were: light conditions 60 μmol / m² 2 The conditions were continuous light (s), temperature 40°C, and CO2 concentration 2%.

[0149] (main culture) Algae belonging to the class Ideyukogome were cultured in a gas-phase incubator using 1 L of MA + 0.1 M glucose, 0.6 M NaCl medium. After 4 days of culture, cells were harvested by centrifugation (3,000 × g, 10 minutes). The culture conditions were 200 μmol / m² under light conditions. 2 The conditions were: continuous light (s), temperature 40°C, and ventilation 2 L ambient air / min.

[0150] [Method for quantifying ergothioneine] Cells were collected from the culture medium and freeze-dried. 100 mg of freeze-dried cells were mixed with 10 mL of methanol. After sonication for 30 minutes, the mixture was filtered through a membrane filter (0.45 μm). The filtrate was used as a sample for liquid chromatography-mass spectrometry (LC-MS). The quantification of ergothioneine was commissioned to the Materials Science and Technology Promotion Foundation.

[0151] <Measurement conditions> (Liquid chromatography: LC) Equipment: Prominence System UFLC (manufactured by Shimadzu Corporation) Column: ZORBAX Rx-SIL (150mm x 2.1mm, 5.0μm) Column temperature: 40℃ Mobile phase: 5 mM ammonium acetate + 85% acetonitrile aqueous solution Flow rate: 0.4mL / min Injection volume: 5μL

[0152] (Mass spectrometry: MS) Equipment: QTRAP4500 (manufactured by AB Sciex) Ionization method: Electrospray Ionization (ESI) Q1 / Q3: Ergothioneine 230.1 / 127.0 Ergothioneine-d9 239.1 / 127.0

[0153] [Measurement of ergothioneine content in algae belonging to the class Ideycogome] Each alga belonging to the class Ideyukogome was cultured using the culture method shown in Table 4, and cells were collected. The ergothioneine (EGT) content of the collected cells was measured and is shown in Table 4 as "EGT amount / wet weight (100g)". In addition, the ergothioneine content per dry weight was calculated by dividing the EGT amount / wet weight (100g) by the value of (dry weight of cells / wet weight of cells). This is also shown in Table 4 as "EGT amount / dry weight (100g)".

[0154] In Table 4, each description of an alga refers to the following algae. Cyanidium(2N):Cyanidium sp. HKN1(diploid) Cyanidium(N): Cyanidium sp. HKN1 (haploid) Galdieria (2N): Galdieria sulphuraria SAG108.79 (diploid) Galdieria (N): Galdieria sulphuraria SAG108.79 (haploid)

[0155] In Table 4, "Autotrophic culture + salt" indicates autotrophic culture under salt stress conditions. "Mixed trophic culture + salt" indicates mixed trophic culture under salt stress conditions.

[0156] [Table 4]

[0157] Figure 3 shows an example of an LC-MS chromatogram measuring ergothioneine content. Figure 3 shows the results for autotrophic cultured Galdieria sulphuraria SAG108.79 (diploid).

[0158] As shown in Table 4, all algae were found to contain ergothioneine at high concentrations. The ergothioneine content was higher in diploid algae than in haploid algae. In a comparison of culture methods, autotrophic culture resulted in a higher ergothioneine content than mixed trophic culture or heterotrophic culture. However, mixed trophic and heterotrophic cultures showed faster growth rates compared to autotrophic culture. Therefore, it is considered that the yield per unit of culture time is higher in mixed trophic and heterotrophic cultures than in autotrophic cultures. Furthermore, culturing under salt stress conditions (0.3M NaCl) tended to increase ergothioneine content compared to culturing under non-salt stress conditions (0M NaCl). This result suggests that culturing under stress conditions such as salt stress improves ergothioneine content.

[0159] Example 2: [Preparation of transformed organisms] Histidine methyltransferase-like gene (HSM gene; SEQ ID NO: 5) and 5-histidylcysteine ​​sulfoxide synthase-like gene (HSS gene; SEQ ID NO: 7) were introduced into Cyanidium sp. HKN1 (haploid) to create transformants that overexpress the HSM and HSS genes (see Figure 4). The HSM and HSS genes were cloned from Cyanidium sp. HKN1.

[0160] (Donor DNA creation) Figure 4 shows the donor DNA construct. The neutral site (NS1) was selected as the genomic region of Cyanidium sp. HKN1 (haploid) into which the HSS and HSM genes were introduced. Using the genomic DNA extracted from Cyanidium sp. HKN1 (haploid) as a template, DNA fragments of the NS1 region were amplified using the following primers (NS1_F, NS1_R; lowercase letters indicate homologous sequences with the vector, and uppercase letters indicate sequences of the NS1 region).

[0161] NS1_F:cggtacccggggatcACCATCCAAAGAGCAGGAATGCGG(Sequence ID 27) NS1_R:cgactctagaggatcATTAGCTCGCTGGTTGAAACCAAACG(Sequence ID 28)

[0162] The obtained DNA fragments were cloned into the pUC19 plasmid, and the HSS gene set [P APCC (Sequence ID 19)-HSS(Sequence ID 7)-T β―tubulin (Sequence ID 22)], CAT Marker Set [P EF1α (Sequence ID 20)-Tp of POP (Sequence ID 25)-CAT (Sequence ID 26)-T UBQ (Sequence ID 23)], HSM gene set [P CPCC (SEQ ID NO: 21)-HSM(SEQ ID NO: 5)-T α―tubulin (Sequence ID 24) was inserted. The abbreviations above indicate the following:

[0163] P APCC APCC promoter for Cyanidium sp. HKN1. HSS: The HSS gene of Cyanidium sp. HKN1. T β―tubulin : A β-tubular lin terminator of Cyanidium sp. HKN1. P EF1α : EF1α promoter of Cyanidium sp. HKN1. Tp of POP: Transit peptide (Tp) of plant organelle DNA polymerase (POP) CAT: Chloramphenicol antitransferase gene. T UBQ : The ubiquitin terminator of Cyanidium sp. HKN1. P CPCC :CPCC promoter for Cyanidium sp. HKN1. HSM: The HSM gene of Cyanidium sp. HKN1. T α―tubulin : Alpha-tube lin terminator for Cyanidium sp. HKN1.

[0164] E. coli was transformed with the obtained plasmid and grown, after which the plasmid was extracted. The obtained plasmid was used as a template for PCR amplification using the following primers (puc19_F, puc19_R). The resulting DNA fragment was used as donor DNA.

[0165] puc19_F:gctgcaaggcgattaagttgggtaacgccagggttttccc(Sequence ID 32) puc19_R:ttatgcttccggctcgtatgttgtgtggaattgtgagcgg(Sequence ID 33)

[0166] Sequence ID 29 shows the NS1 region and the 200 bp upstream and downstream of it. Sequence ID 30 shows the NS1 region used as the 5' homology arm of the donor DNA. Sequence ID 31 shows the NS1 region used as the 3' homology arm of the donor DNA.

[0167] (transformation) DNA was introduced into Cyanidium sp. HKN1 (haploid) by PEG. Cyanidium sp. HKN1 (haploid) was OD 750 Algae were inoculated into 50 mL of MA medium (pH 2.0) so that the pH was 0.5. The cells were cultured for 4-5 days at 42°C under a light-dark cycle (12 L / 12 D) (aerated culture, 300 mL air / min). The cultured cells were harvested and OD (Oral Discharge). 750The cells were suspended in MA medium (pH 2.0) to a concentration of 500 to prepare a cell suspension.

[0168] 67.5 μL of MA2 medium containing 30% (v / v) PEG was mixed with 45 μL of donor DNA (~500 ng / μL; dissolved in distilled water). 12.5 μL of cell suspension was then added and mixed by inversion. The mixed suspension was transferred to 10 mL of modified MA medium (pH 1.2) and cultured for 2 days under the same conditions as above. The cells were then harvested and inoculated into chloramphenicol-containing modified MA medium (pH 1.0, chloramphenicol 100 μg / mL), and cultured under the same conditions as above. The cultured cells were harvested and used as transformants (TFs).

[0169] Using genomic DNA extracted from the obtained transformants (TF) and wild-type strains (WT) as templates, PCR amplification was performed using the primers (NS1_F, NS1_R) described above. The results of electrophoresis of the PCR amplification products are shown in Figure 5. In the transformants (TF), DNA fragments larger in size were amplified than in the wild-type strains (WT). The size of these amplified DNA fragments matched the size of the donor DNA. From these results, it was confirmed that donor DNA was inserted into the NS1 region of the transformants (TF).

[0170] [Ergothioneine production] Cyanidium sp. HKN1 (haploid) (WT) and Cyanidium sp. HKN1 (haploid) transformants (TF) were autotrophically cultured using the same method as described above. Cells were harvested from the culture medium one week (proliferation phase) and three weeks (stationary phase) after the start of the culture. The ergothioneine content of the harvested cells was measured using the same method as described above. The results are shown in Table 5.

[0171] The algae listed in Table 5 are the following: Cyanidium(N) WT: Wild strain of Cyanidium sp. HKN1 (haploid). Cyanidium(N) TF: A transformant of Cyanidium sp. HKN1 (haploid).

[0172] [Table 5]

[0173] In transformed cells (TF), ergothioneine production was significantly increased compared to wild-type cells (WT). Stationary-phase cells had a higher ergothioneine content than proliferating-phase cells. These results confirmed that the HSM and HSS genes introduced into the transformed cells (TF) are involved in ergothioneine production. Based on sequence homology with Egt-1, the HSM and HSS genes were presumed to be histidine methyltransferase and 5-histidylcysteine ​​sulfoxide synthase genes, respectively.

[0174] The growth curve in this culture is shown in Figure 6. In Figure 6, the arrows indicate the timing of cell sampling. There was no difference in growth rate between transformants (TF) and wild-type cells (WT). This result indicates that overproduction of ergothioneine does not affect the growth rate. As shown in Table 5, the ergothioneine content is higher in cells in the stationary phase. Therefore, it is considered preferable to recover ergothioneine from algal cells after they have grown to the stationary phase. [Industrial applicability]

[0175] The present invention provides a method for producing ergothioneine using microalgae. It also provides a polypeptide usable for the production of ergothioneine, a polynucleotide encoding the polypeptide, and a vector and cells containing the polynucleotide. While preferred embodiments of the present invention have been described and illustrated above, it should be understood that these are illustrative and not limiting. Additions, omissions, substitutions, and other modifications can be made without departing from the spirit or scope of the invention. Therefore, the present invention is not limited by the foregoing description but is limited only by the scope of the appended claims.

Claims

1. A method for producing ergothioneine, comprising the step (a) of culturing algae belonging to the class Ideyukogome.

2. A method for producing ergothioneine according to claim 1, further comprising the step (b) of recovering algae belonging to the class Ideyukogome from the culture solution after the step (a).

3. A method for producing ergothioneine according to claim 2, further comprising the step (c) of extracting ergothioneine from algae belonging to the class Ideyukogome recovered in step (b) above.

4. A method for producing ergothioneine according to any one of claims 1 to 3, wherein the algae belonging to the class Ideyukogome in step (a) is diploid.

5. A method for producing ergothioneine according to any one of claims 1 to 3, wherein the algae belonging to the class Ideyukogome is a genetically modified alga.

6. The method for producing ergothioneine according to claim 5, wherein the gene modification is a gene modification that increases the amount of ergothioneine produced.

7. A method for producing ergothioneine according to claim 5, further comprising step (i) of performing genetic modification on a haploid alga belonging to the class Ideyukogome before step (a).

8. A method for producing ergothioneine according to claim 7, further comprising a step (ii) between step (i) and step (a) of diploidizing the algae belonging to the class Ideyukogome.