Method for producing cardiomyocytes
A method using T112 in a culture medium efficiently differentiates cardiac fibroblasts into cardiomyocytes without genetic manipulation, addressing the complexity of existing methods and ensuring high-quality cardiomyocyte production.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- JAPAN ADVANCED ANIMAL MEDICAL RES INST CO LTD
- Filing Date
- 2025-07-02
- Publication Date
- 2026-06-26
Smart Images

Figure 0007881021000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method for producing cardiomyocytes.
Background Art
[0002] Heart diseases greatly reduce the QOL of patients and are often fatal. Although life extension can be achieved by medical treatment and surgical treatment, once the cardiac function has declined, it cannot be restored. It is known that cardiomyocytes are involved in cardiac function and that their recovery ability is low.
[0003] In recent years, the development of direct conversion technology using the patient's own somatic cells has attracted attention, and its application to regenerative medicine without going through a pluripotent state is expected. For example, in Patent Document 1, a method for comprehensively identifying a group of transcription factors necessary for inducing differentiation of source cells such as cardiac fibroblasts into target cells such as fetal cardiomyocytes has been reported.
Prior Art Documents
Patent Documents
[0004]
Patent Document 1
Summary of the Invention
Problems to be Solved by the Invention
[0005] However, the method reported in Patent Document 1 employs a technique involving genetic manipulation such as introduction of transcription factors, and such techniques are complicated in operation and management.
Means for Solving the Problems
[0006] The present invention provides a differentiation induction method that does not involve gene introduction into cardiac fibroblasts and does not become complicated in operation and management.
[0007] Examples of the present invention include the following. [1] A method for producing cardiomyocytes, characterized by culturing mammalian cardiac fibroblasts in a medium containing T112 and inducing differentiation into cardiomyocytes. [2] The method for producing cardiomyocytes according to [1] above, wherein the culture medium contains 3 μM or more of T112. [3] The method for producing cardiomyocytes according to [1] or [2] above, wherein the culture medium contains 15 μM or less of T112. [4] A method for producing cardiomyocytes according to any one of the above [1] to [3], wherein the differentiation induction is carried out without introducing genes into cardiac fibroblasts. [5] A method for producing cardiomyocytes according to any one of the above [1] to [4], wherein the culture medium substantially does not contain vascular trophic factors. [6] The method for producing cardiomyocytes according to any one of the above items [1] to [5], wherein the mammal is a human or a companion animal. [7] A method for producing cardiomyocytes according to any one of the above [1] to [6], wherein the cardiac fibroblasts are cultured for a period of 1 day to 10 days.
[0008] [8] A culture medium composition for use in inducing differentiation of mammalian cardiac fibroblasts into cardiomyocytes, characterized by containing T112. [9] A differentiation induction kit comprising the culture medium composition described in [8] above. [Effects of the Invention]
[0009] According to the present invention, cardiac fibroblasts can be differentiated into cardiomyocytes without genetic manipulation. [Brief explanation of the drawing]
[0010] [Figure 1A] This graph shows the expression levels of cardiac markers for each culture period in the presence of T112 in the example. [Figure 1B] This graph shows the expression levels of cardiac markers for each culture period in the comparative example. [Figure 2] This graph shows the changes in cardiac marker expression due to differences in T112 concentration. [Figure 3] This graph shows a comparison of cardiac marker expression levels using the conventional method and the method of this embodiment. [Modes for carrying out the invention]
[0011] The following describes this embodiment in detail. Unless otherwise specified, the meanings of the terms used herein are as defined below.
[0012] Unless otherwise specified, the concentrations and numerical ranges described herein encompass a technical range including a rounding error of ±1 significant figure. For example, the description "0.1 to 50 μM" can be interpreted as technically equivalent to a range of approximately "0.09 to 55 μM." Similarly, "5 μM" may be used within a variable range experimentally including approximately 4.5 to 5.4 μM.
[0013] In this embodiment, "cardiac fibroblasts" refer to fibroblasts derived from mammalian myocardial tissue, which are mainly involved in the production of extracellular matrix components such as collagen. Preferably, cells derived from humans and companion animals (dogs, cats, etc.) are used. "Cardiac fibroblasts" are not particularly limited as long as they are fibroblasts present in myocardial tissue. For example, fibroblasts derived from the left ventricle, right ventricle, atrium, epicardium, endocardium, myocardial interstitial tissue, etc. Cell lines, cryopreserved cells, or cells temporarily cultured in vitro may also be used.
[0014] In this embodiment, "mammal" refers to all animals belonging to the class Mammalia, including domestic animals, companion animals, wild animals, etc. that include humans. In this embodiment, mainly myocardial tissue derived from mammals is used as the starting material for cardiac fibroblasts. This "mammal" includes, but is not limited to, the following species: humans, dogs, cats, rodents such as rats and mice, and domestic and large animals such as pigs, monkeys, and cows. Therefore, the expression "derived from mammals" is a taxonomic description of the origin of cells or tissues, and the technical scope of this embodiment is applicable to all of the animal species exemplified above. With such a configuration, the manufacturing method of this embodiment is suitable not only for human medicine but also for application to the veterinary field targeting companion animals and the like.
[0015] In this embodiment, "companion animal" includes animal species so-called "pet" or "companion animal". Specifically, the following animal species are exemplified as representative examples, but are not limited thereto: pet animals such as dogs, cats, rabbits, ferrets, hamsters, and guinea pigs.
[0016] The "differentiation induction medium" used in this embodiment is a culture environment used when inducing the differentiation of cardiac fibroblasts into cardiomyocytes. Basically, a standard cell culture medium such as DMEM is used. In addition, if necessary, it is not prohibited to add auxiliary components such as buffers (HEPES), antibiotics (penicillin, streptomycin, etc.), amino acids, and vitamins.
[0017] In this embodiment, "cardiomyocyte" is a muscle cell having a contractile function, and is identified as a cardiomyocyte by the expression of molecular markers (e.g., MYL4, etc.). When the expression of the cardiomyocyte marker gene is confirmed for a cell by the real-time RT-PCR method, the cell is determined to be a cardiomyocyte.
[0018] In this embodiment, the "cardiomyocyte marker" means a gene, protein, or combination thereof that is specifically or selectively expressed in cardiomyocytes. Examples include, but are not limited to, MYL4, TNNT2, NKX2.5, GATA4, ACTC1, etc. It is also possible to relatively evaluate the expression levels by combining multiple markers.
[0019] "T112" is a small molecule compound having an agonistic effect on estrogen-related receptor γ (ERRγ). T112 acts on the intracellular transcriptional regulatory network. T112 induces fibroblasts to differentiate into cardiomyocytes, particularly by inducing the expression of metabolic and cardiomyocyte-specific genes. It is preferable to use a commercially available product or a chemically synthesized product, but derivatives or analogs having equivalent activity may also be used. Also, T112 is included in the scope of this embodiment as long as it exhibits an equivalent differentiation-inducing effect for derivative compounds that are structurally or functionally similar to it. If the inducing activity of T112 is clear, derivatives, prodrugs, salts, ester forms, etc. that are modified while retaining the inducing effect are also included. The concentration of T112 used in this embodiment may be 0.1 μM, 0.5 μM, 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, 11 μM, 12 μM, 13 μM, 14 μM, 15 μM, 16 μM, 17 μM, 18 μM, 19 μM, 20 μM, 30 μM, 40 μM or 50 μM or more. Also, the concentration of T112 may be any concentration within the range between the above values. The concentration of T112 used in this embodiment may be in the range of 0.1 to 50 μM, preferably 1 to 20 μM, more preferably 2 to 15 μM, even more preferably 3 to 15 μM, and most preferably 5 to 10 μM. Such concentration conditions are expected to induce more efficient differentiation into cardiomyocytes.
[0020] In this embodiment, the culture period required for differentiation induction is preferably in the range of 12 hours to 13 days, more preferably in the range of 1 day to 12 days, more preferably in the range of 3 days to 10 days, and most preferably in the range of 5 days to 10 days. The culture period can be appropriately adjusted depending on the cell tumor used, T112 concentration, or culture conditions. By using such culture period conditions, more efficient differentiation induction into cardiomyocytes can be expected.
[0021] In this embodiment, "differentiation induction" refers to a series of processes that transform undifferentiated or differentiated cells into cells possessing the characteristic morphology, gene expression, and function of cardiomyocytes. "Differentiation induction" does not necessarily mean converting 100% of the cells into complete cardiomyocytes; it also includes cases where cells exhibiting at least the expression of cardiomyocyte markers and morphological changes are included in "differentiation induction" in this embodiment. The differentiation induction method according to this embodiment can be carried out by static culture using standard cell culture vessels (e.g., 6-well plates, 24-well plates, etc.), but is not limited thereto. The method of this embodiment can also be carried out in scale-upable culture formats, and culture systems that can be used for industrial and clinical applications such as the following are possible: bioreactors, culture bags, closed systems. Thus, the differentiation induction method of cardiomyocytes according to this embodiment can be applied as a culture technology applicable to the manufacturing processes of regenerative medicine, cell therapy drugs, or therapeutic cell preparations.
[0022] In this embodiment, "vascular trophic factors" refers to endogenous or exogenous physiologically active substances involved in inducing and promoting the differentiation, maturation, or angiogenesis processes of vascular endothelial cells or surrounding cells. These factors include growth factors, cytokines, peptide hormones, or synthetic compounds that mimic these functions.
[0023] In this embodiment, "substantially absent" means that the target component is present at a concentration below which it does not significantly affect the predetermined effects, particularly cellular responses such as cell differentiation and functional maturation. Specifically, this means that the component is not intentionally added to the culture medium, and its presence is experimentally below the detection limit, or its concentration is at a level where the stimulating effect on cells is negligible. For example, in the case of vascular trophic factors such as "vascular endothelial growth factor" and "fibroblast growth factor," this means setting conditions to achieve cell differentiation through the action of T112 alone, without adding these as cofactors for differentiation induction. This configuration, which substantially does not contain vascular trophic factors, ensures uniformity of quality between manufacturing batches.
[0024] In this embodiment, "no gene introduction" means that no exogenous nucleic acids (e.g., mRNA, plasmids, viral vectors, etc.) are introduced into cardiac fibroblasts. Therefore, the induction method in this embodiment is distinct from iPS cell induction methods and transcription factor introduction methods. However, spontaneous expression changes that occur during normal culture, or epigenetic changes caused by compounds, are not considered "gene introduction."
[0025] In this embodiment, "not applying mechanical stimulation" means not applying artificial physical stimuli to the cells, such as shear stress, stretching, or periodic deformation, and this includes static culture or culture under normal convection conditions.
[0026] In this embodiment, the "differentiation induction kit" refers to a product form that provides reagents or culture medium compositions for differentiating mammalian-derived cardiac fibroblasts into cardiomyocytes in a specific combination. The kit according to this embodiment may include the following components: cardiac fibroblasts, differentiation induction culture medium composition (culture medium or concentrate containing T112 at a predetermined concentration), basal culture medium (e.g., DMEM, α-MEM, etc.), dilution buffer or serum-free diluent, culture instructions or instructions for use (protocol), control components (T112-free product, positive control, etc.), containers (sterile vials, tubes, petri dishes, flasks, plastic bags, etc.), and quality control reagents. The differentiation induction kit from mammalian-derived cardiac fibroblasts to cardiomyocytes according to this embodiment allows for the simple and efficient production of cardiomyocytes.
[0027] In this embodiment, "culture medium composition" refers to a liquid and / or lyophilized culture medium additive containing T112, which is used to induce differentiation of mammalian cardiac fibroblasts into cardiomyocytes. This is intended to allow users to easily prepare a differentiation induction medium by adding it to a basal culture medium. This culture medium composition may contain some or all of the following components: T112, buffering components (e.g., HEPES, phosphates), preservatives or cryoprotectants (e.g., glycerol, trehalose, etc., in the case of liquid-stable forms). These compositions are added in predetermined amounts to a basal culture medium (e.g., DMEM, α-MEM, RPMI, etc.) at the time of use and can be used under conditions that do not include serum or additive factors as needed. This composition can also be sold individually or provided as a component of a differentiation induction kit.
[0028] The resulting cardiomyocytes can be used for a variety of applications, including the creation of cardiac disease models, drug safety evaluation and toxicity screening, cell material for transplantation, and electrophysiological analysis.
[0029] T112 can be used alone, or it may be used in combination with other known cell differentiation-modulating compounds. For example, T112 may be combined with histone deacetylase (HDAC) inhibitors, GSK-3 inhibitors, Wnt signaling modulators, BMP family proteins, etc.
[0030] In this embodiment, a cell composition is provided that includes cardiomyocytes induced by culturing mammalian-derived cardiac fibroblasts in a culture medium containing T112. This cell composition is obtained by a manufacturing method that does not involve gene transfer using exogenous nucleic acids. This makes it possible to induce differentiation of cardiac fibroblasts into cardiomyocytes without performing genetic manipulation.
[0031] The cell composition preferably exhibits the expression of one or more cardiomyocyte-related genes, such as MYL4, TNNT2, NKX2.5, GATA4, ACTN2, and TNNI3, as an indicator of differentiation into the cardiomyocyte. The expression of these genes can be quantitatively evaluated by real-time RT-PCR.
[0032] In the cell composition, it is preferable that cells expressing these cardiac markers constitute at least 10% of the total, more preferably 30% or more, even more preferably 50% or more, and most preferably 70% or more.
[0033] Furthermore, the cardiomyocytes or cell composition of this embodiment may possess indicators of morphological or physiological maturity. Specifically, the formation of intercellular adhesion structures similar to adhesion plaques or intercalations, periodic fluctuations in calcium ion concentration, observation of pulsatile motion, and responsiveness to electrical stimulation can be confirmed. In addition, the expression of structural and conduction system markers such as actinin (α-actinin), connexin 43, and MLC2v can also serve as indicators of functional maturity.
[0034] Based on these evaluations of functional maturation, the cardiomyocytes or cell populations of this embodiment may be defined hierarchically according to their differentiation stage, ranging from an immature progenitor cell-like stage to a highly mature cardiomyocyte-like stage. [Examples]
[0035] The present invention will be described below with reference to examples, but the present invention is not limited to the following examples.
[0036] 1. Creation of cardiac fibroblasts First, cardiac fibroblasts were produced from heart tissue obtained from beagle dogs. Specifically, 5g of the collected heart tissue was first stored in physiological saline.
[0037] Next, the cardiac tissue was transferred to a culture dish and, while immersed in DMEM containing 1% penicillin and streptomycin, was finely chopped into 5mm squares using a sterile scalpel blade and attached to the bottom of the culture dish. The tissue was then cultured for 7 days in DMEM containing 10% FBS, 1% penicillin, and streptomycin, in a carbon dioxide culture device adjusted to 37°C, 5% CO2, and 95% air.
[0038] After 7 days of culture, a large number of cardiac fibroblasts were observed migrating around the tissue fragment. This confirmed that cardiac fibroblasts had been successfully obtained.
[0039] The culture medium was changed every 2-3 days, and subculturing was performed after 21 days. Specifically, the cells were washed with 5 mL of PBS. After washing, the cells were treated with 2 mL of trypsin-EDTA at 37°C for 2 minutes. The treated cells were collected and centrifuged at 300 g for 1 minute at room temperature. 5x10 5 Cells were seeded in 10-cmdish and cultured in DMEM supplemented with 10% FBS, 1% penicillin, and streptomycin in a carbon dioxide culture incubator adjusted to 37°C, 5% CO2, and 95% air. Subculture was then performed once a week for a total of 10 subcultures.
[0040] 2. Preparation of differentiation induction medium T112 (Selleck) was added to 10 mL of DMEM (WAKO) to achieve final concentrations of 0 μM (control), 2 μM, 5 μM, and 10 μM, as shown in Table 1, to prepare a differentiation induction medium for cardiomyocytes (Comparative Example 1, Examples 1-4). HPRT mRNA expression levels were measured as a control.
[0041] [Table 1]
[0042] 3. Differentiation induction from cardiac fibroblasts to cardiomyocytes Created in "1." cardiac fibroblasts The cells were washed with 5 mL of PBS. After washing, the cells were treated with 2 mL of trypsin-EDTA at 37°C for 2 minutes. The treated cells were harvested and centrifuged at 300 g for 1 minute at room temperature. 3.0 × 10 5 Seeds were seeded into a 6-well plate so that there were cells per well, and then incubated for 24 hours in a carbon dioxide culture incubator adjusted to 37°C, 5% CO2, and 95% air.
[0043] The cultured cells were washed with 1 mL of PBS. The washed cells were then cultured in 1 mL of DMEM for 24 hours.
[0044] The cultured cells were washed with 1 mL of PBS. The washed cells were then cultured for 5 days in a carbon dioxide incubator adjusted to 37°C, 5% CO2, and 95% air in the gas phase, using 1 mL of the differentiation induction medium prepared in "2.". The culture medium was not changed.
[0045] As a comparative example, cardiac fibroblasts prepared in "1." were genetically modified with a pSB transposon vector expressing GATA4, MEF2C, and TBX5. All other conditions were the same. (Comparative Example 2)
[0046] 4. Confirmation of mRNA expression of cardiomyocyte markers For the cells differentiated in "3." (culture days 0, 1, 5, 7, and 14), total RNA was recovered using 1 mL of Trizole. The expression of cardiomyocyte marker (MYL4) mRNA was confirmed by real-time RT-PCR using the primers shown below. canine MYL4 F: GCCAATCTTGCAGCACATCTC R: AGCTCAGCACCCATAACTGTCC canine HRTP(House keeping gene) F: GGAGCATAATCCAAAGATGGTCAA R: TCAGGTTTATAGCCAACACTTCGAG
[0047] 5.Results Figure 1A is a graph showing the expression levels of cardiac markers at different culture days in the presence of T112 in the example. Specifically, it shows the mRNA expression level of the cardiac cell marker MYL4 in cells (cell number = 3) cultured using differentiation induction medium containing 10 μM T112. The figure shows data for day 1 (1d), day 5 (5d), and day 14 (14d) after the start of culture. Figure 1B is a graph showing the expression levels of cardiac markers at different culture days in the comparative example. Specifically, it is a graph showing the mRNA expression level of the cardiac cell marker MYL4 in cells (cell number = 3) cultured under control conditions (without T112). Similar to Figure 1A, Figure 1B shows data for day 0 (0d), day 1 (1d), day 5 (5d), and day 14 (14d) after the start of culture. Figure 2 is a graph showing the changes in cardiac marker expression due to differences in T112 concentration. Specifically, it is a graph showing the expression level of cardiac cell marker MYL4 mRNA in cells (cell number = 3) cultured for 1 day in differentiation induction medium containing T112 at concentrations of 0 μM, 2 μM, 5 μM, 10 μM, and 20 μM. Figure 3 is a graph showing a comparison of cardiac marker expression levels between the conventional method and the method of this embodiment. Specifically, the expression levels of cardiomyocyte markers after culturing cardiomyocytes differentiated by the conventional method (GATA4 / MEF2C / TBX5 expression induction) and cardiomyocytes differentiated by this embodiment (using a medium containing 10 μM T112) for 5 days are shown. Figures 1A, 1B, 2, and 3 show the relative expression levels of the cardiomyocyte marker (MYL4) mRNA to the HPRT mRNA expression level of 1.0.
[0048] Figure 1A shows that the expression of cardiomyocyte marker mRNA was increased on both day 1 and day 5 of culture. Figure 1B shows that when cultured under control conditions (without T112), mRNA expression levels were relatively lower on day 1 and day 5 of culture compared to Figure 1A. This clearly demonstrates that there are differences in differentiation induction depending on the presence or absence of T112. Figure 2 shows that MYL4 mRNA expression was increased in cells cultured in media containing 10 μM and 20 μM T112 compared to cells cultured in media containing 0 μM, 2 μM, and 5 μM T112. Furthermore, since no significant difference was observed between 10 μM and 20 μM, a T112 concentration of 10 μM is considered appropriate. Figure 2 shows that the expression of the cardiac marker (MYL4) in cardiomyocytes differentiated using a medium containing 10 μM T112 was significantly increased compared to the conventional method.
[0049] From the above, it was demonstrated that cardiomyocytes can be produced by culturing mammalian-derived cardiac fibroblasts in a culture medium that contains a cardiomyocyte differentiation inducer but is substantially free of trophic factors. [Industrial applicability]
[0050] According to the manufacturing method and kit of this embodiment, cardiomyocytes can be produced simply and efficiently.
Claims
1. Mammalian-derived cardiac fibroblasts are cultured in a medium containing 3 μM to 15 μM of T112, and differentiated into cardiomyocytes without introducing genes into the cardiac fibroblasts. A method for producing cardiomyocytes, including the following.
2. The culture medium substantially contains no vascular trophic factors. A method for producing cardiomyocytes according to claim 1.
3. The aforementioned mammal is a human or a companion animal. A method for producing cardiomyocytes according to claim 1.
4. The cardiac fibroblasts are cultured for a period of 1 to 10 days. A method for producing cardiomyocytes according to any one of claims 1 to 3.
5. A culture medium composition used when inducing differentiation of mammalian cardiac fibroblasts into cardiomyocytes without introducing genes into the cardiac fibroblasts, Contains T112 in a concentration of 3 μM to 15 μM. Culture medium composition.
6. A differentiation induction kit comprising the culture medium composition described in claim 5.
Citation Information
Patent Citations
JP2024120546A
US20220160893A1
JP2019500061A