Detection of recombinase polymerase amplification using a dual hapten probe
The dual hapten probe-based RPA composition simplifies nucleic acid detection on a lateral flow strip, addressing the complexity of existing RPA methods by enabling direct detection without dilution, facilitating rapid and sensitive results in non-laboratory settings.
Patent Information
- Application Number
- JP2023217713
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2017-09-14
- Filing Date
- 2023-12-25
- Publication Date
- 2026-07-03
- Estimated Expiration
- 2038-09-14
Smart Images

Figure 0007884496000013 
Figure 0007884496000014 
Figure 0007884496000015
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims the interests of U.S. Provisional Patent Application No. 62 / 558,705, filed on 14 September 2017, entitled “Detection of Recombinase Polymerase Amplification Using a Dual Hapten Probe,” which is incorporated herein by reference in its entirety.
[0002] This disclosure relates to a method and composition for detecting a target nucleic acid sequence using a dual hapten probe. More specifically, this disclosure relates to a method and composition for detecting a target nucleic acid sequence using recombinase polymerase amplification (RPA) and a dual hapten probe. In some cases, the detection is performed on a lateral flow strip. [Background technology]
[0003] Certain isothermal amplification methods can amplify target nucleic acids from trace levels to very detectable levels in just a few minutes. Such isothermal methods, such as recombinase polymerase amplification (RPA), can enable users to detect specific sequences in minute quantities, facilitating point-of-care testing and improving the convenience and speed of diagnosis.
[0004] RPA has been shown to be suitable for use in non-laboratory settings, with reported sensitivities equivalent to PCR-based diagnostics and real-time detection of target DNA. However, these assays are still better suited for use in laboratory settings or with suitcase lab equipment. Therefore, several groups have developed lateral flow assays for situations where only qualitative data is required. Lateral flow tests are relatively easy to perform, suitable for untrained individuals / home use, and do not require expensive equipment, making them a preferred format for use in resource-constrained environments. However, lateral flow technology still requires numerous steps, including a dilution step before lateral flow analysis. Simplification of the use of RPA amplification and lateral flow detection by reducing the number of required steps is still needed. This improvement would be beneficial for the manufacture of consumables for RPA lateral flow assays, enabling simplification of the test equipment and thus reducing the cost of consumables, making such assays more suitable for out-of-laboratory use. [Overview of the Initiative] [Problems that the invention aims to solve]
[0005] This disclosure is at least in part based on the discovery that the RPA of target nucleic acid sequences can be accurately and efficiently detected on a lateral flow strip without a dilution step using a dual hapten probe. In consideration of this discovery, RPA compositions and methods for detecting the presence or absence of target nucleic acids using a dual hapten probe are provided herein. These target nucleic acid sequences may be used for the diagnosis of disease or disorder.
[0006] In one embodiment, the present disclosure features a recombinase polymerase amplification composition comprising, consisting of, or essentially comprising a crowding agent; an oligonucleotide probe having a double hapten leaving group; and a nuclease enzyme. In another embodiment, the present disclosure features a recombinase polymerase amplification composition for use in lateral flow analysis of a target nucleic acid present in a sample, wherein dilution of the amplification mixture before separation of the amplification product on a lateral flow test strip is unnecessary, and the composition comprises, consisting of, or essentially comprising a crowding agent; an oligonucleotide probe having a double hapten leaving group; and a nuclease enzyme.
[0007] In some embodiments of all embodiments, the crowding agent of the compositions and methods described herein comprises, consists of, or is essentially composed of polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyvinylpyrrolidone (PVP), Ficol, or dextran. In some embodiments of all embodiments, the crowding agent has a molecular weight of at least 1 kDa, at least 2 kDa, at least 3 kDa, at least 4 kDa, at least 5 kDa, at least 6 kDa, at least 8 kDa, or at least 10 kDa. In some embodiments of all embodiments, the crowding agent is present in the composition at a concentration of at least 15% v / v, at least 12% v / v, at least 10% v / v, at least 8% v / v, at least 6% v / v, at least 5% v / v, at least 4% v / v, or at least 3% v / v. In some embodiments of all embodiments, the crowding agent has a viscosity profile of 5 mPa / s or less, 4 mPa / s or less, 3 mPa / s or less, 2 mPa / s or less, or 1 mPa / s or less at 20°C. In some embodiments of all embodiments, the crowding agent is PEG and has a viscosity of 3 mPa / s or less at 20°C. In some embodiments of all embodiments, the crowding agent is PEG having a molecular weight of 3 kDa and the PEG is at a concentration of 6.5% v / v.
[0008] In some embodiments of all embodiments, the oligonucleotide probes of the compositions and methods described herein comprise a dR-O-[C]n nucleotide lacking a base to which a leaving group is bound to the oligonucleotide. In some embodiments of all embodiments, the oligonucleotide probe having a double hapten releases a double hapten leaving group when cleaved by formamidepyrimidine DNA glycosylase when hybridized to a complementary nucleotide sequence. In some embodiments of all embodiments, the double hapten leaving group comprises, consists of, or is essentially composed of, two immunogenic groups having different epitopes. In some embodiments of all embodiments, the immunogenic group comprises, consists of, or is essentially composed of, a fluorescent group, an enzyme or a fragment thereof, a peptide or a fragment thereof, or biotin. In some embodiments of all embodiments, the immunogenic group is selected from the group comprising biotin, fluorescein, digoxigenin, or dinitrophenyl.
[0009] In some embodiments of all aspects, the nuclease of the compositions and methods described herein is formamidepyrimidine DNA glycosylase.
[0010] In another embodiment, this disclosure is, [ka] (In the formula, R is either OH or -NH(CH2)6OH) The composition is characterized by containing, consisting of, or essentially consisting of.
[0011] In another embodiment, this disclosure is, [ka] (In the formula, R is either OH or -NH(CH2)6OH) The composition is characterized by containing, consisting of, or essentially consisting of.
[0012] In another aspect, the present disclosure includes[, consists of, or consists essentially of, a composition:] [Chemical Formula] (where DMTr is dimethoxytrityl) characterized by a composition that includes, consists of, or consists essentially of these.
[0013] In another aspect, the present disclosure includes[, consists of, or consists essentially of, a composition:] [Chemical Formula] (where DMTr is dimethoxytrityl) characterized by a composition that includes, consists of, or consists essentially of these.
[0014] In another aspect, the present disclosure includes[, consists of, or consists essentially of, a composition:] [Chemical Formula] (where hapten 1 and hapten 2 are immunogenic groups described herein; Z is selected from (i) the C1’ of a deoxyribose or ribose ring lacking a base in each RNA or DNA oligonucleotide, where the anomeric carbon atom has a β configuration; (ii) a phosphoramidite compound configured to bind to a DNA or RNA oligonucleotide, and where Z is a DNA or RNA phosphoramidite, the reactive groups of hapten 1 and hapten 2 may optionally be protected with pivaloyl, tert-butylbenzoyl, acyl, benzoyl, or isobutyryl; R represents hydrogen or linear or branched C1-C6 alkyl; X1, X2, and X4 are linking groups and may independently be absent or may be linear or branched C1-C12 alkyl optionally interrupted by one or more -O-, -C(=O)-, or -NR- groups; X3 is linear or branched C1-C6 alkyl; X5 is linear or branched C1-C12 alkyl optionally interrupted by one or more -O-, -C(=O)-, or -NR- groups) The composition is characterized by containing, consisting of, or essentially consisting of.
[0015] In some embodiments, the oligonucleotide probe is cleavable by an exonuclease, and the oligonucleotide releases a double hapten leaving group upon cleavage. In some embodiments, the exonuclease is exonuclease III. In some embodiments, the oligonucleotide probe has the structural formula 5'X(n) a L(n) b H(n) c The oligonucleotide probe has B3' (wherein n is a nucleotide, a, b and c are integers, X is a 5' hexyl or hapten, H is a THF residue, B is a C3 spacer, and L is a branching modifier containing multiple haptens). In some embodiments, the hapten is, for example, DNP and biotin, but other haptens (e.g., FAM) may be used. In some embodiments, the oligonucleotide probe includes phosphorothioate bonds between haptens. In some embodiments, a and c are at least 15 nucleotides. In some embodiments, b is zero. In some embodiments, a is about 15 and c is about 30. In some embodiments, the oligonucleotide probe is complementary to the target nucleic acid. In some embodiments, L is replaced with a cytosine nucleotide.
[0016] In another embodiment, the present disclosure features a device comprising, comprising, or essentially comprising a lateral flow strip, comprising: a sample application area; a reagent area located downstream of the sample application area and in fluid communication with it, comprising a dry RPA reagent composition for amplifying a target nucleic acid, a binder specific to the amplified target nucleic acid product, and a detection molecule; at least one test area located downstream of the reagent area and in fluid communication with it, comprising an immobilization capture molecule specific to the amplified target nucleic acid product; and a control area located downstream of the test area. In some embodiments, the device provides continuous (e.g., simultaneous) RPA and detection. In some embodiments, the device comprises a heavy weight absorption pad in the test area.
[0017] In some embodiments of all embodiments, the dried RPA reagent composition comprises a crowding agent, a recombinase, a polymerase, a nuclease, a double hapten probe, and a detection molecule. In some embodiments of all embodiments, the double hapten probe comprises a conjugate of biotin and carboxyfluorescein (FAM), or biotin and dinitrophenyl (DNP). In some embodiments of all embodiments, the immobilized capture molecule specific to the amplified target nucleic acid is selected from the group consisting of an anti-FAM capture molecule or an anti-DNP capture molecule. In some embodiments of all embodiments, the anti-FAM or anti-DNP is independently selected from the group consisting of a polyclonal antibody, a monoclonal antibody, and functional binding fragments thereof, including FAB, ScFv, Fv, or DAB. In some embodiments of all embodiments, the detection molecule is selected from the group consisting of a gold sol, a silver sol, a latex sol, cellulose nanobeads or carbon nanostrings, and an anti-biotin capture molecule.
[0018] In some embodiments of all aspects, the control region includes a binding region that demonstrates the precise operation of the lateral flow strip. In some embodiments of all aspects, the control region includes an anti-mouse antibody capture line.
[0019] In another embodiment, the Disclosure features a method for detecting an amplified product, comprising: contacting a sample suspected to contain a target nucleic acid of interest with an RPA reagent for amplifying the target nucleic acid, an oligonucleotide probe comprising a nucleic acid sequence complementary to the target nucleic acid and a covalently bonded double hapten leaving group, and a nuclease; amplifying the target nucleic acid to produce a target nucleic acid product; and detecting the target nucleic acid product by detecting a free double hapten moiety cleaved from the oligonucleotide probe hybridized to the target nucleic acid, or a method essentially derived therefrom.
[0020] In some embodiments of all embodiments, the RPA reagent is located in the sample application area of the lateral flow strip. In some embodiments of all embodiments, when the sample and the RPA reagent come into contact, nucleic acid amplification occurs on the lateral flow strip to form a nucleic acid amplification mixture. In some embodiments of all embodiments, nucleic acid amplification occurs on the lateral flow strip without dilution or addition of any other liquid to the RPA mixture. In some embodiments, the RPA reaction and detection are simultaneous.
[0021] In some embodiments of all embodiments, the double hapten portion cleaved from the oligonucleotide probe is selectively captured in a test region of the lateral flow located downstream of the sample application region. In some embodiments of all embodiments, the oligonucleotide probe containing a covalently bound double hapten is not selectively captured in the test region of the lateral flow strip. In some embodiments of all embodiments, the lateral flow strip includes, consists of, or is essentially composed of, a test region and a control region, where the test region includes, consists of, or is essentially composed of, a binding pair member for the capture of the double hapten cleaved from the oligonucleotide, and the control region includes a binding pair member for internal control. In some embodiments of all embodiments, the control region includes, consists of, or is essentially composed of, an anti-mouse antibody or a fragment thereof. In some embodiments of all embodiments, the test region includes, consists of, or is essentially composed of, an anti-DNP capture molecule or an anti-FAM capture molecule. In some embodiments of all embodiments, the anti-FAM capture molecule is selected from the group consisting of monoclonal antibodies, polyclonal antibodies and functionally binding fragments thereof. In some embodiments of all aspects, the anti-DNP capture molecule is selected from the group consisting of monoclonal antibodies, polyclonal antibodies, or functionally binding fragments thereof.
[0022] In some embodiments of all aspects, detecting the amplified product involves, or consists of, or essentially consists of, capturing a double hapten leaving group in a test area and labeling the captured double hapten leaving group with a detection molecule. In some embodiments of all aspects, the detection molecule is selected from the group consisting of gold sol, silver sol, latex sol, cellulose nanobeads, and carbon nanostrings.
[0023] In another embodiment, the Disclosure features a method comprising, or essentially comprising, applying a sample suspected to contain a target nucleic acid to a lateral flow strip; contacting the sample with an RPA reagent mixture for amplifying the target nucleic acid dried on the reagent area of the lateral flow strip; and detecting the amplified product, if present, on the test area of the lateral flow strip.
[0024] In some embodiments of all aspects, a sample suspected of containing the target nucleic acid is applied to the application area of the lateral flow strip. In some embodiments of all aspects, the RPA reagent mixture comprises, consists of, or essentially consists of, a crowding agent, a recombinase, a polymerase, a nuclease, and a double hapten oligonucleotide probe.
[0025] In some embodiments of all embodiments, the crowding agent is selected from the group consisting of polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyvinylpyrrolidone (PVP), Ficol, and dextran. In some embodiments of all embodiments, the crowding agent has a molecular weight of at least 1 kDa, at least 2 kDa, at least 3 kDa, at least 4 kDa, at least 5 kDa, at least 6 kDa, at least 8 kDa, or at least 10 kDa. In some embodiments of all embodiments, the crowding agent is present in the mixture at a final concentration of at least 15% v / v, at least 12% v / v, at least 10% v / v, at least 8% v / v, at least 6% v / v, at least 5% v / v, at least 4% v / v, or at least 3% v / v. In some embodiments of all embodiments, the crowding agent has a viscosity profile of 5 mPa / s or less, 4 mPa / s or less, 3 mPa / s or less, 2 mPa / s or less, or 1 mPa / s or less at 20°C. In some embodiments of all embodiments, the crowding agent is PEG, having a viscosity of 3 mPa / s or less at 20°C. In some embodiments of all embodiments, the crowding agent is PEG containing a molecular weight of 3 kDa, where PEG is at a final concentration of 6.5% v / v.
[0026] In some embodiments of all aspects, if present, detecting the amplification product involves, consisting of, or essentially consisting of detecting the cleaved double hapten portion from the oligonucleotide probe hybridized to the amplification product. In some embodiments of all aspects, dilution of the RPA mixture is not required before detection of the amplification product.
[0027] As used in this disclosure, the terms “one or more” or “at least one” refer to one, two, three, four, five, six, seven, eight, nine, ten or more compounds.
[0028] As used herein, “sample” refers to a biological substance isolated from its environment (animal, blood or tissue derived from cells, or conditioned medium derived from tissue cultures) and suspected of containing, or known to contain, the analyte or other desired substance. A sample may also be, for example, a partially purified fraction of tissue or body fluid from a subject having a particular disease or condition. A reference sample may be a “normal” sample from a donor without the disease or condition. A reference sample may also be derived from an untreated donor or a cell culture that has not been treated with an activator (e.g., untreated or vehicle-only) or not been exposed to conditions that induce a disease condition. A reference sample may also be obtained at “point zero” before the cells are brought into contact with the agent being tested.
[0029] The section headings used herein are for structural purposes only and should never be interpreted as limiting the subject matter. If the definitions of terms in the incorporated references appear to differ from those provided in this instruction, the definitions provided in this instruction shall prevail. It will be recognized that “approximately” is implied before measured values such as temperature, concentration, and time considered herein, assuming that small and non-substantial deviations are within the scope of this instruction. In this application, unless otherwise specifically indicated, the use of the singular form includes the use of the plural form. Also, “comprise,” “comprises,” “comprising,” “contain,” “contains,” “containing,” “include,” “includes,” and “including” are not intended to be limiting. It should be understood that the prior general descriptions and the following detailed descriptions are merely illustrative and descriptive and do not limit the disclosure. As used herein, the articles “a, an” refer to one or more than one (i.e., at least one) of the grammatical objects of the article. For example, “one element” means one element or more than one element.
[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this disclosure belongs. Methods and materials are described herein for use in this disclosure, and other suitable methods and materials known in the art may also be used. Materials, methods and examples are illustrative and not intended to limit. All publications, patent applications, patents, sequences, database entries and other references referenced herein are incorporated by reference in their entirety. In case of any conflict, this specification, including definitions, shall prevail.
[0031] Details of one or more embodiments of this disclosure are described in the accompanying drawings and the following description. Other features, purposes, and advantages of this disclosure will be apparent from the description and drawings, as well as from the claims. [Brief explanation of the drawing]
[0032] [Figure 1i-iii] An exemplary RPA reaction method using a small amount of double hapten analyte for undiluted detection on a lateral flow strip is shown. Figure 1i) is an image showing the formation of a 3kDa PEG-inducible coacervate and the localization of FAM-labeled nucleic acid to the coacervate in a pseudo-RPA reaction. Figure 1ii) is a diagram showing the structural formulas of exemplary double hapten analytes according to this disclosure, showing the structural formulas of biotin-FAM, biotin-DNP, and general labels for post-synthesis binding to amino-modified probe oligonucleotides. Figure 1iii) is an image showing the detection of double-labeled oligonucleotides, biotin-FAM double-labeled (R=OH), and biotin-FAM Fpg probes, either diluted or undiluted with electrophoresis buffer, in a pseudo-RPA reaction. [Figure 2i-iii]This disclosure shows the direct analysis of RPA on a lateral flow strip using a dual hapten Fpg probe. Figure 2i) is a schematic diagram showing the release of amplified analytes from RPA coacervates and their subsequent detection on a lateral flow strip. Figure 2ii) is an image of a prototype assay for undiluted RPA detection. Figure 2iii) is an image of a dry conjugate format test strip incorporating flow control. [Figure 3i-iii] This shows a reduction in false-positive signals due to probe optimization. Figure 3i) shows an image of an exemplary lateral flow assay, where nonspecific signals may be Fpg-dependent. Figure 3ii) shows the hairpin and autodimer structures of an exemplary Fpg bihapten probe (labeled "Probe 1" or "rs1207445"). Figure 3iii) shows an image of amplification containing an exemplary Fpg bihapten probe with a reduced secondary structure, and the exemplary Fpg bihapten probe shows a reduced false-positive signal when analyzed on a lateral flow. [Figure 4] Images of undiluted RPA detection of rs1207445 (genomic DNA) and Campylobacter jejuni (PCR product) template DNA are shown. [Figure 5i-ii] Figure 5i) shows the TwistAmp Fpg fluorescence data for the rfbEO157 assay. Four reactions containing NTC (red), 10 (yellow), 100 (green), and 1000 (blue) were performed in a series. The fluorescence reactions were compared to the prototype direct lateral flow assay. Figure 5ii) shows a comparison of TwistAmp Fpg for fliCH7 with each Fpg dual hapten probe assay. [Figure 6] This image shows a "continuous flow" lateral flow strip analysis. [Figure 7] This image shows the lateral flow analysis of the TwistAmp Nfo assay against Salmonella InvA target. [Figure 8] This figure shows the mechanism for limited detection of double-labeled amplicons when performed undiluted on a lateral flow strip. [Figure 9] This outlines the detection of undiluted Exo RPA LF. [Figure 10] This shows undiluted Fpg versus Exo RPA LF. [Figure 11] This demonstrates simultaneous amplification / detection using Exo LF. [Figure 12] An exemplary continuous flow apparatus is shown. [Modes for carrying out the invention]
[0033] This disclosure is, at least in part, based on the discovery that the RPA of a target nucleic acid sequence can be accurately and efficiently detected on a lateral flow strip without a dilution step using a dual hapten probe. For this purpose, an RPA composition for detecting the presence or absence of a target nucleic acid using a dual hapten probe is provided herein. Also for this purpose, this application discloses a method for detecting a target nucleic acid sequence on a lateral flow strip using a dual hapten probe.
[0034] This disclosure describes RPA compositions and methods for detecting target nucleic acid sequences on a lateral flow strip using a dual hapten probe, but those skilled in the art will recognize that the disclosed methods and compositions may be suitable for other nucleic acid amplification methods known in the art (e.g., isothermal nucleic acid amplification methods).
[0035] Rapid, cost-effective, and highly sensitive detection of nucleic acids can improve current practices used in pathogen detection and food testing in infectious disease diagnosis. Furthermore, reducing assay complexity would allow nucleic acid amplification tests to be deployed in resource-constrained household scenarios.
[0036] A novel RPA Fpg (formamidepyrimidine DNA glycosylase) probe chemistry has been developed, enabling lateral flow detection of amplified products in undiluted RPA reactions. To overcome the viscous nature of the RPA reaction, a new type of double hapten labeling was developed for the Fpg RPA probe. An exemplary assay is based on an existing Fpg fluorescence assay (rs1207445 human genome locus and Campylobacter jejuni 16S rRNA) and modified for use in the novel double hapten probe chemistry. The double hapten probe technology disclosed herein is subsequently applied to E. coli O157:H7 (rfb O157 and fliC H7 The development of two novel singleplex assays for serotyping the genes of O157:H7 was applied. These genetic markers are expected to identify morphologies of E. coli O157:H7 that other NAATs might miss due to the complex genetic features of O157:H7. The objective was to develop a one-step "sample-in / result-out" nucleic acid lateral flow immunoassay (NALFIA) and consumables for multiplex testing of O157:H7 for use in food hygiene testing. Furthermore, the versatility of the novel dual hapten probe chemistry means that this technique can be easily applied to a wide range of target species, enabling the development of non-laboratory assays.
[0037] In the following examples, a novel nucleic acid lateral flow chemistry was applied to two genetic markers: a human genome target (rs1207445), Campylobacter jejuni 16S rDNA, and the important food pathogen Escherichia coli O157:H7. All four assays have analytical sensitivity to 10–100 copies of DNA per amplification reaction. Furthermore, the assays require fewer hands-on steps compared to existing RPA Nfo lateral flow assay methods.
[0038] The data demonstrated that the detection of amplified target nucleic acids could be performed simultaneously with RPA ("continuous flow"). This allows for reduced test time (approximately 30 minutes from sample to result). The simplified workflow means that continuous flow chemistry can be easily adapted to cost-effective, disposable consumables, making it ideal for use in non-laboratory environments such as point-of-care (e.g., using the apparatus shown in Figure 12 or other instruments).
[0039] In some cases, the dual-labeled oligonucleotide probes described herein include an oligonucleotide bound to a bifunctional structure (e.g., a double hapten leaving group). The bifunctional structure may include two parts, for example, two haptens, where one hapten is the first member of a first binding pair and the second hapten is the first member of a second binding pair. The probe is configured such that, upon binding to a target nucleic acid, the bifunctional structure is cleaved from the oligonucleotide, releasing the bifunctional structure. This released bifunctional structure (e.g., free double-labeled) can then be detected by several methods, including, for example, on a lateral flow strip.
[0040] "Member of a binding pair" means one of the first and second parts, the first and second parts having a specific binding affinity to each other. Suitable binding pairs for use in this disclosure include, but are not limited to, antigens / antibodies (e.g., digoxigenin / anti-digoxigenin, dinitrophenyl (DNP) / anti-DNP, dansyl-X / anti-dansyl, fluorescein / anti-fluorescein, Lucifer Yellow / anti-Lucifer Yellow, peptide / anti-peptide, ligand / receptor and rhodamine / anti-rhodamine), biotin / avidin (or biotin / streptavidin) and calmodulin-binding protein (CBP) / calmodulin. Other suitable binding pairs include polypeptides, such as FLAG peptide (DYKDDDDK) [Hopp et al., BioTechnology, 6:1204 1210 (1988)]; KT3 epitope peptide (Martin et al., Science 255:192 194 (1992)); tubulin epitope peptide (Skinner et al., J. Biol. Chem 266:15163 15166 (1991); and T7 gene 10 protein peptide tag (Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87:6393 6397 (1990)) and antibodies against them. Generally, in preferred embodiments, smaller binding partners act as detectable labels because steric conditions may be important.
[0041] Nucleic acids (e.g., polynucleotides) suitable for amplification in relation to the method of the present invention include double-stranded and single-stranded nucleic acid molecules, such as DNA and RNA molecules. Polynucleotides may originate from genomes, chromosomes, plasmids, mitochondria, cells, and viral nucleic acids. For double-stranded polynucleotides, amplification may be of one strand or both strands.
[0042] As described herein, RPA uses an enzyme known as a recombinase that can pair oligonucleotide primers with homologous sequences in a template double-stranded nucleic acid. In this way, DNA synthesis is directed to a specified site in the template double-stranded nucleic acid. Using sequence-specific (e.g., gene-specific) primers, an exponential amplification reaction is initiated when the template nucleic acid is present. The reaction proceeds rapidly, and the sequence present in the template double-stranded nucleic acid is specifically amplified within minutes from just a few copies of the template nucleic acid to a detectable level of amplification product. The RPA method is disclosed, for example, in U.S. Patent Nos. 7,270,981, 7,399,590, 7,666,598, 7,435,561, U.S. Patent Application Publication 2009 / 0029421, and International Publication 2010 / 141940, all of which are incorporated herein by reference.
[0043] The compositions disclosed herein may contain a set of primers for amplifying a target nucleic acid sequence. The primers may consist of sequences complementary to the target nucleic acid sequence or sequences that differ from the target nucleic acid sequence at one or more positions. As described herein, the amplified product of an RPA having primers that differ from the target nucleic acid sequence at one or more positions may differ from the target sequence at one or more positions. The amplified product of the RPA reaction described herein may contain the target sequence.
[0044] A pair of primers can amplify a target nucleic acid sequence, or they can introduce a sequence that differs from the target nucleic acid sequence at one or more positions. This introduced sequence may consist of the target nucleic acid sequence. The first primer may be complementary to the target nucleic acid sequence. The second primer may consist of a first portion that is complementary to the target nucleic acid sequence and a second portion that differs from the target nucleic acid sequence at one or more positions. When the two primers amplify the nucleic acid sequence, the second primer incorporates one or more different positions into the amplified product. This amplified region differs from the target nucleic acid sequence at one or more positions and may consist of the target nucleic acid sequence. In some cases, the amplified region is identical to the target nucleic acid sequence.
[0045] The terms “First” and “Second” are used in this disclosure only in their relative sense. Unless otherwise specified, these terms will be understood to be used merely for convenience in the description of one or more embodiments. The terms “First” and “Second” are used solely to distinguish one element from another, and the scope of rights to the disclosed technology should not be limited by these terms. For example, the first element may be referred to as the second element, and similarly, the second element may be referred to as the first element.
[0046] The RPA compositions disclosed herein contain recombinases that may originate from prokaryotes, viruses, or eukaryotes. Exemplary recombinases include RecA and UvsX (e.g., RecA or UvsX proteins obtained from any species), as well as their fragments or variants, and combinations thereof. RecA and UvsX proteins can be obtained from any species. RecA and UvsX fragments or variant proteins can also be produced using available RecA and UvsX proteins and nucleic acid sequences, as well as molecular biology techniques (e.g., see the variant of UvsX described in U.S. Patent No. 8,071,308). Exemplary UVsX proteins include those derived from myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, vibriophage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. Additional exemplary recombinase proteins include the archaeal RADA and RADB proteins, as well as the eukaryotic (e.g., plant, mammalian, and fungal) Rad51 proteins (e.g., RAD51, RAD51B, RAD51C, RAD51D, DMC1, XRCC2, XRCC3, and recA) (see, for example, Lin et al., Proc. Natl. Acad. Sci. USA 103:10328~10333, 2006).
[0047] In any method of this disclosure, the recombinase (e.g., UvsX) may be a mutant or hybrid recombinase. In some embodiments, the mutant UvsX is Rb69UvsX having at least one mutation in the Rb69UvsX amino acid sequence, where the mutation is selected from the group consisting of (a) a non-histidine amino acid at position 64, serine at position 64, the addition of one or more glutamic acid residues at the C-terminus, the addition of one or more aspartic acid residues at the C-terminus, and combinations thereof. In other embodiments, the mutant UvsX is T6UvsX having at least one mutant in the T6UvsX amino acid sequence, where the mutation is selected from the group consisting of (a) a non-histidine amino acid at position 66; (b) serine at position 66; (c) the addition of one or more glutamic acid residues at the C-terminus; (d) the addition of one or more aspartic acid residues at the C-terminus; and (e) combinations thereof. When using a hybrid recombinase protein, the hybrid protein may be, for example, a UvsX protein containing at least one region with amino acid sequences derived from a different UvsX species. This region may be, for example, the DNA-binding loop-2 region of UvsX.
[0048] The DNA polymerases disclosed herein may be eukaryotic or prokaryotic polymerases. Examples of eukaryotic polymerases include Pol-α, Pol-β, Pol-δ, Pol-ε and their variants or fragments, or combinations thereof. Examples of prokaryotic polymerases include Escherichia coli DNA polymerase I (e.g., the Kranow fragment), bacteriophage T4 gp43 DNA polymerase, Bacillus stearothermophilus polymerase I large fragment, Phi-29 DNA polymerase, T7 DNA polymerase, Bacillus subtilis PolI, Staphylococcus aureus PolI, Escherichia coli DNA polymerase I, Escherichia coli DNA polymerase II, Escherichia coli DNA polymerase III, Escherichia coli DNA polymerase IV, Escherichia coli DNA polymerase V, and their variants or fragments, or combinations thereof. In some embodiments, the DNA polymerases lack 3'-5' exonuclease activity. In some embodiments, the DNA polymerase has strand substitution properties and is, for example, a large fragment of a PolI or PolV eukaryotic polymerase.
[0049] In some embodiments, one or more probes (e.g., molecular beacon probes) are double-labeled with detectable labels that may be immunogenic. In some cases, the detectable labels are haptens. The two haptens on the probe may be the same or they may be different. In some cases, one of the detectable labels is a member of a binding pair. Probes described herein may be labeled with haptens, enzymes, enzyme substrates, coenzymes, enzyme inhibitors, fluorophores, quenchers, chromosomes, magnetic particles or beads, redox-sensitive moieties (e.g., electrochemically active moieties), luminescence markers, radioisotopes (including radionucleotides), and members of binding pairs. More specific examples include fluorescein, phycobiliproteins, tetraethylrhodamine, and β-galactosidase. Possible binding pairs include biotin / streptavidin, biotin / avidin, biotin / neutraavidin, biotin / captoavidin, epitope / antibody, protein A / immunoglobulin, protein G / immunoglobulin, protein L / immunoglobulin, GST / glutathione, His tag / metal (e.g., nickel, cobalt, or copper), antigen / antibody, FLAG / M1 antibody, maltose-binding protein / maltose, calmodulin-binding protein / calmodulin, enzyme / enzyme substrate, receptor / ligand binding pairs, as well as analogs and variants of binding pairs.
[0050] As used herein, the term "hapten" refers to an immunogenic small molecule that specifically reacts with a binding pair, such as an antibody produced against it. Examples of haptens for use in the methods provided herein include digoxigenin, fluorescein, dinitrophenyl, glutathione, and biotin. Haptens described herein may also include, for example, an immunogenic group. In some cases, the immunogenic group includes a fluorescent group, its enzyme or fragment, its peptide or fragment, or biotin. In some cases, the immunogenic group is selected from a list including biotin, fluorescein, digoxigenin, or dinitrophenyl.
[0051] As used herein, the terms "fluorescent label" and "phosphor" are interchangeable and refer to any substance that, when irradiated with radiation of various wavelengths (excitation wavelengths), emits electromagnetic energy at a specific wavelength (emission wavelength), and is intended to include chemical or biochemical molecules or fragments thereof that can specifically interact or react with the analyte of interest in a sample to generate one or more optical signals.
[0052] Typical fluorescent materials for use in the methods provided herein include, for example, FAM, (tetramethylrhodamine)Texas Red (trademark), green fluorescent protein, blue fluorescent protein, red fluorescent protein, fluorescein, fluorescein-5-isothiocyanate (FITC), and cyanine dyes (Cy3, Cy3.5, Cy5, Cy5).5, Cy7), Body Peel Dye (Invitrogen) and / or Alexa Fluor Dye (Invitrogen), Dansil, Dansil Chloride (DNS-C1), 5-(iodoacetamida)fluorescein (5-IAF), 6-Acryloyl-2-dimethylaminonaphthalene (Acrylodan), 7-Nitrobenzo-2-oxa-1,3-diazole-4-yl chloride (NBD-C1), Ethidium Bromide, Lucifer Yellow, Rhodamine Dye (5-Carboxyrhodamine 6G Hydrochloride, Lisamin Rhodamine B Sulfonyl Chloride, Rhodamine-B-Isothiocyanate (RITC), Rhodamine 800), Tetramethylrhodamine 5-(and 6-)Isothiocyanate (TRITC), Texas Naphthalamine sulfonic acid, including but not limited to Red (trademark), sulfonyl chloride, 1-anilinonaphthalene-8-sulfonic acid (ANS) and 6-(p-toluidinyl)naphthalene-2-sulfonic acid (TNS), antroyl fatty acid, DPH, parinaric acid, TMA-DPH, fluorenyl fatty acid, fluorescein-phosphatidylethanolamine, Texas red-phosphatidylethanolamine, pyrenyl-phosphatidylcholine, fluorenyl-phosphotidylcholine, merocyanine 540, naphthyl styryl, 3,3'-dipropyl thiadicarbocyanine (diS-C3-(5)), 4-(p-dipentylaminostyryl)-1-methylpyridinium (di-5-ASP), Cy-3 iodoacetamide, Cy-5-N-hydroxysuccinimide, Cy-7-isothiocyanate, IR-125, thiazole Examples include orange, azure B, Nile blue, Al phthalocyanine, oxacin 1,4',6-diamidino-2-phenylindole (DAPI), Hoechst 33342, TOTO, acridine orange, ethidium homodimer, N(ethoxycarbonylmethyl)-6-methoxyquinolinium (MQAE), Fura-2, calcium green, carboxy SNARF-6, BAPTA, coumarin, phytofluose, coronene, and metal ligand complexes.
[0053] It should be noted that fluorescent quenchers can also be considered detectable labels. For example, a fluorescent quencher can be brought into contact with a fluorescent dye, and the amount of quenching can be detected.
[0054] The embodiments described herein may also include agents or nucleases capable of cleaving specific target nucleic acid sequences. As used herein, “nuclease” refers to an enzyme capable of catalyzing the hydrolysis of nucleic acids and cleaving phosphodiester bonds between nucleotide subunits of nucleic acids. A “restriction nuclease” is a nuclease that targets and cleaves a nucleic acid molecule at or near a specific recognition nucleotide sequence known as a restriction site. Nucleases can be further classified into endonucleases (i.e., enzymes that cleave phosphodiester bonds within polynucleotide chains) and exonucleases (i.e., enzymes that act by cleaving polynucleotide chains one by one from the ends (exo)), although some enzymes may be classified as both. Nucleases may be naturally occurring restriction endonucleases or synthetic endonucleases.
[0055] In some cases, the double hapten probes described herein are configured such that when the oligonucleotide probe hybridizes to a complementary nucleotide sequence, it is cleaved by formamidepyrimidine DNA glycosylase ("fpg") to release a double hapten leaving group (e.g., double-labeled). In some cases, the nuclease is formamidepyrimidine DNA glycosylase.
[0056] In some embodiments, hapten probes (e.g., double haptens or higher-order haptens) that can be cleaved by exonucleases (e.g., ExoIII) are provided herein. In some embodiments, oligonucleotide probes have the structural formula 5'X(n) a L(n) b H(n) cThe oligonucleotide probe has B3' (wherein n is a nucleotide, a, b and c are integers, X is a 5' hexyl or hapten, H is a THF residue, B is a C3 spacer, and L is a branching modifier containing multiple haptens). In some embodiments, the hapten is, for example, DNP and biotin, but other haptens may be used (e.g., FAM). In some embodiments, the oligonucleotide probe includes a phosphorothioate bond between haptens. In some embodiments, a and c are 1 to 50 nucleotides, and b is 0 to 50 nucleotides. In some embodiments, a and c are at least 15 nucleotides. In some embodiments, b is zero. In some embodiments, a is about 15 and c is about 30. In some embodiments, the oligonucleotide probe is complementary to the target nucleic acid. In some embodiments, L is replaced with a cytosine nucleotide. Further details of the probe are described in Example 16 below.
[0057] In an RPA reaction containing the target amplicon, ExoIII cleaves the debasic H residue of the probe, and subsequent 3'-5' digestion by ExoIII releases a mononucleotide L (5'-phosphate and 3'-OH) labeled with two distinct haptens. This double-hapten-labeled mononucleotide freely exits the RPA coacervate and interacts with antibodies on the visualization particle and LF strip test lines.
[0058] Furthermore, one or more single-stranded DNA-binding proteins may be used to stabilize nucleic acids during various exchange reactions that proceed during the reaction. One or more single-stranded DNA-binding proteins may be derived from or obtained from any species, e.g., prokaryotes, viruses, or eukaryotic species. Non-limiting exemplary single-stranded DNA-binding proteins include those derived from Escherichia coli SSB and myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, vibriophage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. Further examples of single-stranded DNA-binding proteins include A. dennitrificans Alide_2047, Burkholderia tyrandensis BthaB_33951, Prevotella parensis HMPREF9144_0124, and eukaryotic single-stranded DNA-binding protein replication protein A.
[0059] Any of the methods of this disclosure may be carried out in the presence of a crowding agent. In some embodiments, the crowding agent may include one or more of polyethylene glycol, polyethylene oxide, polyvinyl alcohol, polystyrene, Ficol, dextran, poly(vinylpyrrolidone) (PVP), and albumin. In some embodiments, the crowding agent has a molecular weight of less than 200,000 Da. Furthermore, the crowding agent may be present, for example, in an amount of about 0.5% to about 15% by weight per volume (w / v). In some cases, the crowding agent is PEG.
[0060] In some cases, the crowding agent has a molecular weight of at least 1 kDa, at least 2 kDa, at least 3 kDa, at least 4 kDa, at least 5 kDa, at least 6 kDa, at least 8 kDa, or at least 10 kDa.
[0061] In some embodiments, the crowding agent is present in the composition at a concentration of at least 15% v / v, at least 12% v / v, at least 10% v / v, at least 8% v / v, at least 6% v / v, at least 5% v / v, at least 4% v / v, or at least 3% v / v.
[0062] In some cases, the crowding agent has a viscosity profile of 5 mPa / s or less, 4 mPa / s or less, 3 mPa / s or less, 2 mPa / s or less, or 1 mPa / s or less at 20°C.
[0063] In some cases, the crowding agent is PEG with a molecular weight of 3 kDa and a final concentration of 6.5%. In some cases, the crowding agent is PEG, and the viscosity at 20°C is 3 mPa / s or less.
[0064] When using recombinase-loaded proteins, these proteins may be of prokaryotic, viral, or eukaryotic origin. Exemplary recombinase-loaded proteins include E. coli RecO, E. coli RecR, UvsY, and their variants or fragments, or combinations thereof. Exemplary UvsY proteins include those derived from myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, vibriophage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. In any of the methods of this disclosure, the recombinase loading agent may be derived from a myovirid phage. Myovirid phages may be, for example, T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, vibriophage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, or phage LZ2.
[0065] Furthermore, any of the methods of this disclosure may be performed with a blocked primer. A blocked primer is a primer that cannot be extended by polymerase. When using a blocked primer, an unblocking agent may be used to unblock the primer and enable extension. The unblocking agent may be an endonuclease or exonuclease that can cleave the blocking group from the primer. Exemplary unblocking agents include E. coli exonuclease III and E. coli endonuclease IV.
[0066] The methods of this disclosure include the detection of a target nucleic acid sequence in which the target nucleic acid may contain a restriction endonuclease or a native cleavage site for a nuclease. Furthermore, cleavage sites may be introduced into the target nucleic acid sequence by amplifying the target nucleic acid sequence with primers different at one or more positions. The introduction of artificial cleavage sites, or cleavage sites not found in the target nucleic acid sequence, may be used to detect the presence of SNPs in or within the target nucleic acid sequence.
[0067] The methods described herein may also be carried out in parallel using various restriction endonucleases or nucleases described herein. Detection of the amplified product may be carried out in parallel, and the amplification rate may be compared with that of a reference sample. The methods described herein may be used for the detection of target sequences or for sequence genotyping.
[0068] In some embodiments, monitoring the increase in nucleic acid amplification products may include determining the number or proportion of amplification products in the reaction mixture over time, or determining the number or proportion of double labels, such as double haptens or free double haptens / labels.
[0069] In some embodiments, the double hapten is visually detectable. In some embodiments, the double hapten label is detected using fluorescence, phase-contrast microscopy, emission detection, spectral (color) detection, magnetic detection, radioisotope detection, and / or electrochemical detection. Those skilled in the art will recognize that any technique known in the art for measuring the amount of nucleic acid amplification product in a mixture can be used to detect the amplification product and monitor its increase over time. In some parts of the RPA method described herein, a detectable label can be used to monitor the progress of the RPA reaction (generation of amplification product).
[0070] The methods and compositions disclosed herein can be used, for example, to detect target nucleic acid sequences. The disclosure can also identify mutant alleles containing SNPs compared to wild-type alleles. In some cases, these SNPs may be associated with specific disease conditions or diagnoses (e.g., the diagnosis of sickle cell anemia, or a tumor or cancer), or with drug resistance or sensitivity. The isothermal amplification reaction methods and compositions described herein enable rapid detection of target sequences and / or related polymorphisms.
[0071] Examples Example 1: Lateral flow strip material and manufacturing We purchased the reagents and chemicals for the buffering agent from Fisher or Sigma.
[0072] Lateral flow strips were prepared using Prima40 nitrocellulose (GE), adhesive backing card (HF000MC100, Millipore), and CF5 absorbent pad material (GE), unless otherwise specified. For continuous flow experiments, additional wicking pad materials tested included CF6 (GE) and Grade 320 concentrated cellulose (Ahlstrom). DNP (MAB2223, Millipore) and anti-FAM (MIF2902, Thermo Fisher) monoclonal antibodies, as well as anti-mouse polyclonal antibody (A16162, Novex), were prepared and dispensed according to the manufacturer's instructions by replacing the storage buffer with 10 mM sodium phosphate pH 7.4 + 0.005% Triton X100 using an Amicon Ultra10k MWCO centrifuge and concentrator. The purified antibody was spotted onto pre-cut strips (0.5 μg / strip) or dispensed onto a membrane at a rate of 1 μg / cm using a Biodot ZX1010 dispensing platform. The membranes or dot strips were dried in a forced-air oven at 40°C for 1 hour, and then stacked.
[0073] Unless otherwise specified, the strip laminates were prepared by laminating a 300mm x 25mm anti-FAM / anti-DNP film on the same plane as one of the long sides of a backing card (pre-cut to 300mm x 45mm). Next, a 300mm x 22mm strip of CF5 absorbent material was laminated on the same plane as the top edge of the backing card, with the wicking pad overlapping the film by 2mm. The laminated card was then cut into 5mm x 45mm strips using a Biodot CM5000 guillotine. The cut strips were stored in a desiccator at room temperature before use.
[0074] When using conjugate pads, the gold conjugate was centrifuged at 9000 × g for 20 minutes to exchange the buffer, the supernatant was removed, and the gold was reconstituted to its original volume in 50 mM borax, 10% sucrose, 1% casein, and 0.5% Brij-35. The conjugate was sprayed onto a glass fiber strip (GFDX103000, Millipore) at a rate of 3 μl / cm using a Biodot ZX1010 dispenser. The gold conjugate pads were then dried at 40°C for 2 hours and then laminated.
[0075] Example 2: Conjugation of antibiotin to 20nm gold colloid Monoclonal antibiotin (ab201341, Abcam) was prepared and conjugated using the AbPure BSA Removal Kit (Innova Biosciences) according to the manufacturer's instructions. The purified antibiotin was conjugated to gold using the InnovaCoat Gold 20nm Kit (Innova Biosciences) similarly according to the manufacturer's instructions, except that the antibiotin was present at 0.5 mg / ml during the conjugation process. The antibiotin gold was typically added directly to the RPA reaction, except when sprayed onto the conjugation pad as described above.
[0076] Example 3: Labeling of oligonucleotides and probes Oligonucleotide primers and unlabeled Fpg lateral flow probes were obtained from Eurogentec. Unlabeled probes with amino modification at the debasement dR site and C3 spacer modification at the 3' end were purchased. All fluorescent Fpg probes were obtained from LGC Biosearch.
[0077] Example 4: Synthesis and oligolabeling of double hapten labels I purchased Fmoc-Lys(Mtt)-Wang resin from Merck. I purchased a qualitative ninhydrin test kit from Anaspec. I purchased dichloromethane (DCM), peptide synthesis grade N,N-dimethylformamide (DMF), (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PyBOP), N-methylmorpholine (NMM), piperidine, D-biotin, triisopropylsilane (TIS), 5(6)-carboxyfluorescein, methanol, formic acid, acetonitrile, diethyl ether, triethylamine (TEA) for HPLC, acetic acid, NaHCO3, NaOH, 2,4-dinitrofluorobenzene, and N,N,N',N'-tetramethyl-O-(N-succinimidyl)uronium tetrafluoroborate (TSTU) from Fisher Scientific. Trifluoroacetic acid (TFA), N,N'-dichlorohexylcarbodiimide (DCC), N-hydroxysuccinimide (NHS), N-DNP-L-Lys, 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), N,N-diisopropylethylamine (DiPEA), triethylamine for LCMS (TEA), and water for LCMS were purchased from Sigma-Aldrich. Dimethyl sulfoxide (DMSO) was purchased from AppliChem. HCl and acetone were purchased from VWR. Millipore water was used for synthesis and desalting. HPLC-grade water was used for HPLC purification. A NAP-10 size exclusion (SE) column was purchased from GE. N-hydroxysuccinimide biotin (biotin-OSu) was purchased from Iris Biotech.
[0078] LCMS analysis was performed on an Agilent 1200 LC system equipped with an Agilent 6410B triple quadrupole ESI-MS. In all LC methods, an Agilent Eclipse Plus C18, 3.5 μm, 3.0×150 mm column was used at room temperature. All cited yields are based on absorbance at 254 nm. LC solvents: A = water + 0.1% formic acid; B = acetonitrile + 0.1% formic acid; C = 200 mM HFIP, 4 mM TEA aqueous solution; D = methanol. LC methods: 1 (solvents A and B) = 5 - 95% B over 25 minutes, then 95% B for 5 minutes; 2 (solvents C and D) = 20% D over 3 minutes, then 20 - 30% D over 5 minutes, 30 - 50% D over 7 minutes, then 50 - 60% D over 5 minutes, then 60 - 80% D over 1 minute, then 80% D over 1 minute.
[0079] RP-HPLC purification of the labeled oligonucleotides was performed on an Agilent 1100 / 1200 LC system equipped with a fraction collector and a Phenomenex Clarity 10μ Origo-RP250×4.6 mm column equipped with an Oligo-RP guard cartridge (AJO-8135, Phenomenex). LC solvent A = methanol; B = 5% v / v acetonitrile in 50 mM TEAA, pH 7.4. LC method for purification: 5% B over 5 minutes; 5 - 50% B over 35 minutes; 50 - 60% B over 5 minutes. Chromatograms were recorded at either 254 nm and 494 nm (Bio-FAM labeling) or 360 nm (Bio-DNP labeling).
[0080] The final labeled oligonucleotides were quantified at 260 nm using a Thermo-Fisher NanoDrop2000, and for Bio-FAM labeling ε260 =20960M -1 cm -1 was assumed, and for Bio-DNP labeling ε260This was ignored. NMR analysis was performed using an Oxford 400MHz magnet equipped with a Bruker Avance console. d6-DMSO (99.9% atomic D) was purchased from Sigma-Aldrich.
[0081] Example 5: Solid-phase synthesis of Bio-FAM double hapten labeling (D-)Bio-(L-)Lys(5(6)FAM)-OH was synthesized starting from Fmoc-Lys(Mtt)-Wang resin using standard solid-phase synthesis techniques (WCChan and PDWhite, In Fmoc Solid Phase Peptide Synthesis, WCChan and PDWhite, Oxford University Press, Oxford, 2000, ch.3, pp. 41-76). Specifically, the resin (0.25 g, 0.57 mmol / g load) was expanded in DCM for 1 hour, and a small sample was tested to confirm the absence of free amines (qualitative nihydrin test). The Fmoc protecting group was removed using 20% v / v piperidine in DMF (2 × 6 mins), and the resin was washed with DMF (3 times) followed by DCM (3 times). The presence of free amines was then confirmed by a qualitative nihydrin test. D-biotin (3 equivalents) was activated with PyBOP (3 equivalents) and NMM (5 equivalents) in DMF (4.3 mL) for 4 minutes under sonication, and then reacted with the resin at 60°C for 38 minutes. The resin was then washed with DMF (3 times) and DCM (3 times). After confirming the absence of free amines by nihydrin testing of the resin sample, it was deprotected with 1% v / v TFA and 5% v / v TIS in DCM for 30 minutes (2 times), and then washed with DMF (3 times) and DCM (3 times). The nihydrin test of the resin sample showed free amines. 5(6)-carboxyfluorescein (3 equivalents) was activated with PyBOP (3 equivalents) and NMM (5 equivalents) in DMF (4.3 mL) for 10 seconds, and then reacted with the resin at 60°C for 38 minutes. The resin was then washed with DMF (3 times) and DCM (3 times). The resin was treated with 20% v / v piperidine in DMF (2 × 10 mins) to cleave the fluorescein dimer, and then washed with DMF (3 times), DCM (3 times), and then MeOH (3 times). The washed resin was dried and stored overnight in a refrigerator (approximately 5°C). To obtain free labeling, the resin was expanded in DCM (2 hours), and then approximately half of the expanded resin was cleaved in 2.5 mL of 90 / 2.5 / 2.5 v / v / v TFA / TIS / H2O at room temperature for 2 hours, and washed with TFA (2 × 1 mL).The combined cutting mixture and TFA washing solution were vacuum-dried in a glass RB flask, then transferred to a 5 mL Eppendorf tube containing DCM washing solution, air was removed with Ar(g), and ice-cold diethyl ether (4.5 mL) was added to precipitate the yellow solid, which was then pelletized by centrifugation. The supernatant was discarded, and the pellet was centrifuged and washed with diethyl ether (2 × 4.5 mL). 30 mg (yield 58%) of yellow solid was obtained. LC-MS of the product (Method 1) showed good purity (90%, t. R 11.85 min);ESI-MS(pos.m / z):731.3(100%, [M+H] + The results were shown. A 2.05 mM DMSO solution of the free label was prepared and further diluted with water for a lateral flow test using the free Bio-FAM label.
[0082] Example 6: Conjugation of Bio-FAM label to an amino-modified FPG probe Bio-FAM double-labeled (5 mg, 6.8 μmol) was activated with DCC (2.1 mg, 10 μmol) and NHS (1.2 mg, 10 μmol) in the dark for 3 hours. The reaction mixture sample was then diluted with methanol and analyzed by LC-MS (Method 1), which showed the presence of Bio-FAM NHS ester in a yield of 21%. R 12.97 min; ESI-MS(pos.m / z):828.8(9%, [M+H] + ). After 3.5 hours of reaction, 10 μL of the activated mixture was added to a mixture of water (20 μL) and amino-modified probe oligo (rs1207445) at approximately 1 mM in 1 M pH9 NaHCO3 aqueous solution (10 μL). The labeled mixture was vortexed, sonicated for 10 minutes, vortexed again, and then left overnight at room temperature in the dark. The mixture was then desalted by NAP-10 SE column and RP-HPLC (target t R The solution was purified using 29.78 min), the target fraction was vacuum concentrated, desalted with NAP-10SE, and further vacuum concentrated to obtain 190 μL of a 13.4 μM target Bio-FAM labeled oligo solution (yield 25%). The labeled oligo was characterized by LC-MS (by Method 2); purity 94%. tRAt 11.58 min, ESI-MS (negative): calculated value 11584.4, measured value 11584.4. UV-Vis characterization (Thermo-Fisher NanoDrop2000) showed absorption peaks at 259 and 496 nm, consistent with FAM-labeled DNA oligos.
[0083] Example 7: Solution-phase synthesis of Bio-DNP bihapten-labeled materials (D-)Bio-(L-)Lys(DNP)-OH was synthesized using standard solid-phase synthesis techniques as described above for Bio-FAM labeling, with 2,4-dinitrofluorobenzene (3 equivalents) and DiPEA (4 equivalents) in DMF (4.3 mL) to incorporate the DNP moiety instead of FAM. However, an improved solution-phase synthesis was developed as described herein. Specifically, biotin-OSu (602 μmol, 1.05 equivalents) and N-DNP-L-Lys (1 equivalent) were suspended in DMF (5.7 mL) and DiPEA (0.25 mL), sonicated for 30 minutes to obtain a clear solution, and then stirred at room temperature. After 2 hours, a precipitate was observed in the reaction mixture, which was stirred overnight at room temperature, filtered (twice, on Whatman No. 1 filter paper), washed with acetone (10 mL) and diethyl ether (130 mL), and a yellow solid (244 mg) was recovered. The second harvest of the yellow solid (30 mg) was obtained by combining it with the organic washing solution, adding an additional diethyl ether (100 mL), filtering as described above, and washing with a further diethyl ether (100 mL). Both harvests of the target-labeled DiPEA salt were combined and dissolved in 0.5 M NaOH aqueous solution (5 mL) to obtain a concentrated orange-yellow solution. Then, 1 M HCl aqueous solution (5 mL) was added to precipitate the carboxylic acid target as a yellow solid. After cooling the mixture on ice, the solid was collected by suction filtration (twice, using Whatman No. 1 filter paper) and washed with ice-cold 1 M HCl aqueous solution (2 × 25 mL), then H2O (2 × 25 mL), then diethyl ether (650 mL). The washing solution was discarded, and the yellow solid was vacuum-dried to obtain the target in good yield (0.41 mmol, 72%). LCMS (Method 1) purity 97%, t R13.71 min, ESI-MS(pos.m / z):539.2(18%, [M+H] + ); 1H NMR (400 MHz, d6-DMSO) δ H 12.51(brs, 1H, OH), 8.88(d, 1H, J=5.8Hz, NH-Ar), 8.86(d, 1H, J=2.7Hz, Ar-H3), 8.25(dd, 1H, J=9.7, 2.6Hz, Ar-H5), 8.0 5(d, 1H, J=7.8Hz, NHC(O)CH2), 7.22(d, 1H, J=9.7Hz, Ar-H6), 6.38(d, 2H, J=16.2Hz, NHC(O)NH), 4.29(dd, 1H, J=7.5, 5.0 Hz, CH(CH2)S), 4.20~4.10(m, 2H, CHCO2H, NHCHCH(R)S), 3.52~3.43(m, 2H, CH2NHAr), 3.10~3.06(m, 1H, NHCHCH(R)S), 2. 80(dd, 1H, J=12.4, 5.0Hz, CH(H)S), 2.56(d, 1H, J=12.4Hz, CH(H)S), 2.11(t, 2H, NHC(O)CH2), 1.78~1.25(m, 12H, 6xCH2).
[0084] Example 8: Conjugation of Bio-DNP label to amino-modified FPG probe Bio-DNP double-labeled (10 mg, 18.6 μmol) was activated with TSTU (8.4 mg, 27.9 μmol) and DiPEA (9.7 μL, 27.9 μmol) for 8 minutes. The reaction mixture sample was then diluted with acetonitrile and analyzed by LC-MS (Method 1), which showed the presence of Bio-DNP NHS ester in 19% yield. R 15.09 min; ES-MS(pos.m / z):636.3(9%, [M+H] + ). After 1.5 hours of reaction, 10 μL of the activated mixture was added to a mixture of amino-modified probe oligo (rs1207445) at approximately 1 mM in 20 μL of water and 10 μL of 1 M pH9 NaHCO3 aqueous solution. The labeled mixture was vortexed, sonicated for 10 minutes, and then left overnight at room temperature in the dark. The mixture was then desalted using a NAP-10 SE column and subjected to RP-HPLC (target t RThe solution was purified by (31.10 min), the target fraction was vacuum concentrated, desalted with NAP-10SE, and further vacuum concentrated to obtain 470 μL of a 7.1 μM target Bio-DNP labeled oligo solution (yield 17%). The labeled oligo was characterized by LC-MS (Method 2); purity 90%, t R 10.48 minutes, ESI-MS (negative): Calculated value 11392.4, Measured value 11392.2.
[0085] Example 9: RPA conditions All RPA reactions were incubated at 40°C for 20 minutes unless otherwise specified. Each RPA formulation (Fpg) for lateral flow contained 420 nM appropriate forward and reverse primers, 120 nM double hapten Fpg probe, 50 mM Tris-acetic acid pH 8.3, 100 mM KOAc, 5 mM DTT, 1 × creatine kinase, 30 μg Gp32, 30 μg UvsX, 7 μg UvsY, 6.5% 3 kDa PEG, 5.7% trehalose, 8.6 μg DNA polymerase I (Staphylococcus aureus), 9.48 μg Fpg, 1 × E-mix, 1.8 mM dNTP, and 0.5% Brij-35. Reactions were initiated by adding a mixture containing an appropriate template and Mg(OAc)2 (final concentration 22.5 mM) to a final volume of 100 μl.
[0086] The Nfo RPA reaction preparation was the same as Fpg except for Gp32 (28 μg / reaction) and polymerase (12.8 μg / reaction). Furthermore, Fpg was replaced with Nfo (endonuclease IV; 4.6 μg / reaction).
[0087] The fluorescent Fpg reaction was performed using a commercially available TwistAmp Fpg kit in a T8 instrument (Axxin) according to the manufacturer's instructions. The reaction was incubated at 40°C for 20 minutes.
[0088] Example 10: Lateral flow strip detection Unless otherwise specified, 1.5 μl of antibiotin gold was added directly to the completed RPA reaction, and the lateral flow strip was added. The strip was wicked for 20 minutes, then dried at room temperature for 10 minutes. The absorbent pad and glass fiber conjugate pad (if applicable) were removed, and the strip was scanned.
[0089] Dilution detection on PCRD strips (Abingdon Health) was performed by diluting 5 μl of amplicon in 70 μl of PCRD extraction buffer. The total 75 μl was processed in a PCRD instrument according to the manufacturer's instructions.
[0090] Example 11: Undiluted detection of novel analytes on a lateral flow strip To date, detection of RPA products in lateral flow instruments has been performed using commercially available NALFIA strips, such as Milenia Hybridetect strips, Abingdon Health PCRD strips, and UStar instruments, in combination with TwistAmp Nfo chemistry. This generates a double-hapten labeled amplicon containing each label bound to a single-stranded nucleic acid, which hybridizes to form a double-hapten label detectable by sandwich lateral flow immunoassay. While this technique performs comparably to fluorescent probe-based methods in terms of sensitivity and specificity, end-users must first dilute the highly viscous amplicon to allow for label migration along the assay strip and thus successful determination of the amplification product on such lateral flow strips (Figure 8). Figure 8 shows a diagram illustrating the mechanism for limited detection of a double-labeled amplicon when performed undiluted on a lateral flow strip. The TwistAmp Nfo reaction involves a 3'-block hapten-labeled probe (containing an internal tetrahydrofuran (THF) residue), a hapten-labeled reverse primer, and endonuclease IV (Nfo). In this test, the probe is typically labeled with biotin, and the reverse primer is labeled with either DNP or FAM. Upon amplification, the biotin-labeled probe binds to the newly synthesized DNP / FAM-labeled chain. Once the probe is bound, Nfo cleaves the 5' phosphodiester bond of the THF residue (Step 1). The cleaved probe then acts as a primer for a chain-displacing polymerase that effectively extends the probe, removing the 3' block (Step 2). A series of rounds of RPA thus produces a double-hapten-labeled amplicon (Step 3). However, unless the reaction is diluted, a large portion of the analyte remains trapped in the RPA coacervate (Step 4), making it largely unusable for binding in the test line and likely resulting in false-negative / weak true-positive test line signals.
[0091] This disclosure provides a means for end-users to perform lateral flow measurement in a small number of hands-on steps, particularly without requiring a dilution step for good direct lateral flow separation from RPA amplicon mixtures (direct detection).
[0092] Initially, direct analysis of RPA without dilution on a lateral flow instrument was unsuccessful. The high concentration of 35 kDa PEG used in standard RPA amplification mixtures resulted in a reaction that was too viscous for adequate wicking, meaning a significant portion of the gold colloid aggregated at the proximal end of the strip. This disclosure provides an improved RPA mixture designed to mitigate the effects observed when using 35 kDa PEG. The modified RPA mixture utilizes low molecular weight PEG (6.5% 3 kDa PEG) and 0.5% v / v Brij-35 as crowding agents, which significantly improves the transfer of gold colloid from the nitrocellulose membrane. Commercially available TwistAmp Nfo chemistry (containing 35 kDa PEG) allows for some detection of amplicons when properly diluted with electrophoresis buffer on existing lateral flow assay strips, either commercially available or in-house manufactured. However, when low MW PEG (6.5% 3 kDa PEG) Nfo RPA was performed undiluted on the strip, there was little detection of a signal at the test spot in the RPA reaction containing 1000 copies of template versus NTC (Figure 7).
[0093] Lateral flow analysis of the TwistAmp Nfo assay against Salmonella InvA target is shown in Figure 7. The TwistAmp Nfo reaction (NTC and 1000 copies of template DNA per reaction; the TwistAmp Nfo reaction contains 35 kDa PEG). RPA was analyzed after dilution to 1 / 50 in electrophoresis buffer on commercially available lateral flow strips (PCRD, left panel) and in-house manufactured anti-FAM strips (center panel). In parallel, the 3 kDa PEG RPA reaction was analyzed undiluted on anti-FAM strips from the same batch (right panel).
[0094] To determine whether double hapten labeling is more suitable for direct, undiluted detection on lateral flow strips, three analytes were analyzed on strips after spiked into a sham RPA reaction containing all RPA components in TBST (0-120 nM) or 6.5% 3 kDa PEG. The three analytes were: 1) 28-mer oligonucleotides labeled at the 5' and 3' ends with FAM and biotin, respectively, used to stimulate hapten-labeled amplicons; 2) a novel Bio-FAM double hapten probe; and 3) an Fpg probe with a debasic dR group labeled with Bio-FAM double hapten. Importantly, all three analytes were detected to a similar degree when spiked into buffer, and a positive signal was observed at the lowest concentration of analyte tested (approximately 1 nM). When detection was performed undiluted against the spiked sham RPA, strips run in the absence of the analytes showed some weak, nonspecific signals. Weak signals were also observed for analytes up to 120 nM for double-labeled oligonucleotides and double hapten Fpg probes. However, significant stimulation of the test line signal for negative samples was observed only for free double hapten analytes (Figure 1iii). These data are consistent with the hypothesis that small labels can be used for undiluted detection of RPA products on lateral flow strips, but labeled nucleic acid labels (released from existing commercial Nfo RPA reactions) are not readily detectable due to the localization of such bulky probes within the RPA coacervate, which limits the availability of detection of such labels on lateral flow strips.
[0095] Example 12: Direct detection of RPA on a lateral flow strip To use a double hapten analyte for RPA detection, it is necessary to effectively capture the label until amplification occurs. Therefore, an Fpg probe targeting the rs1207445 target, having an internal amino-modified dR debase site, was purchased so that it could be conjugated to the double hapten label (rs1207445 probe 1). During RPA, the probe hybridizes to the amplicon, at which point the Fpg cleaves the debase site at the 5' and 3' of the dR group by βδ removal (Figure 2i, step 1), releasing the double hapten label (Figure 2i, step 2). Due to its small size, the double hapten analyte can freely escape from the RPA coacervate (Figure 2i, step 3), and thus it can be detected by sandwich immunoassay on a lateral flow strip (Figure 2i, step 4). Importantly, the untreated probe (which could theoretically be detectable as it binds to both haptens) may be trapped in the RPA coacervate, making it virtually undetectable in the RPA reaction where amplification does not occur. This effect is illustrated by the fact that a pure probe spiked in a sham RPA reaction is less detectable than a free-labeled probe (Figure 1iii).
[0096] To obtain proof in principle that an Fpg bihapten probe can be used for direct endpoint detection of RPA on a lateral flow strip, four low-MW PEG RPA reactions were performed in series with 10, 100, and 1000 copies / reaction human gDNA (and NTCs) containing the rs1207445 bihapten probe (probe 1). 1.5 μl of anti-biotin gold was added, and the strips were dropped into the amplicon / gold mixture. Some nonspecific signals were observed in the NTC reactions, but slight stimulation of the test line signal was observed in 2 / 4 of the RPA replicas containing 10 copies of the template. Strong stimulation of the test line signal against the NTC was observed in all reactions containing ≥100 copies of gDNA per reaction (Figure 2ii). These preliminary data indicate that a novel Fpg probe chemistry enables undiluted detection of RPA products on a lateral flow strip.
[0097] Many commercially available NALFIA strips incorporate the detection conjugate onto the strip by drying the colloid within the conjugate pad. Furthermore, most strips also include a flow control line, which acts to ensure the strip is effectively wicked. To determine whether a strip was manufactured for direct detection of RPA incorporating these features, a glass fiber conjugate pad containing an anti-DNP test line, an anti-mouse flow control line (to which any conjugate bypassing the test line can be bound), and dried anti-biotin gold colloid was laid on the strip. The rs1207445 assay was then performed in or without 1000 copies of human gDNA, and after the reaction was complete, the strip was dropped directly onto RPA. In all cases, effective flow was observed, as evidenced by the strong signal from the flow control line. Some weak nonspecific signals were observed in the anti-DNP test line with negative amplification, as previously observed, but a significant stimulation of the test line signal was observed with positive amplification compared to template-free amplification (Figure 2iii).
[0098] In summary, these data indicate that the novel dual Fpg hapten probe can be used for direct, undiluted detection of RPA products on lateral flow strips.
[0099] Example 13: Effect of probe design on false positive signals in negative RPA reactions Nonspecific signals can be visually observed in some negative reactions. However, if a digital reader (such devices are commonly used in commercially available lateral flow assays) is used, the instrumentation can be configured to subtract background signals using image analysis algorithms. When assay test strips are used in resource-constrained environments, it may be necessary to visualize the assay strips, in which case the ability to minimize nonspecific signals on the test line is desirable to reduce the possibility of users misinterpreting the results.
[0100] When lateral flow strips are analyzed using a strip reader, the fact that nonspecific signals are observed in negative reactions is not necessarily a problem, as this can subtract background signals in any analysis. However, when strips are used in resource-constrained environments, it is desirable to be able to visualize the strips, and in this case, nonspecific signals on the test line are less desirable. Therefore, to determine whether the noise is due to the direct binding of oligonucleotide probes to the test line or as a result of abnormal processing of the probes by Fpg enzymes, the cause of false positive signals was determined by performing a low-MW PEG Fpg RPA reaction of rs1207445 in the presence or absence of Fpg. In the presence of Fpg, rs1207445 RPA showed a false positive signal during the NTC reaction, and stimulation of the test line signal was shown in the reaction containing 1000 copies of human genomic DNA template. Reactions performed in the absence of Fpg showed a significantly reduced nonspecific signal in the NTC reaction (and no amplification in the reaction containing 1000 copies of template DNA), suggesting that the rs1207445 double hapten probe was abnormally processed, resulting in a false-positive signal (Figure 3i). In some cases, some nonspecific signal may remain in the absence of Fpg, and this signal can be effectively eliminated by membrane blocking.
[0101] To determine the cause of the Fpg-dependent nonspecific signal, the rs1207445 double hapten probe sequence was analyzed for hairpin, primer / probe, and probe / probe dimer using NetPrimer (available at http: / / wwwpremierbiosoft.com / netprinter) or the OligoAnalyser 3.1 program (IDT; available at https: / / eu.idtdna.com / calc / analyzer). These analyses showed that the probe could form a weak hairpin structure (ΔG = -7.9 kcal / mol) and a strong self-dimer (ΔG = -14.19 kcal / mol). In both cases, the dR group (highlighted in red in Figure 3ii) is located in the double-stranded region and can therefore act as a substrate for the Fpg enzyme, providing a compelling explanation for the presence of Fpg-dependent noise in the NTC RPA reaction.
[0102] Two new rs1207445 probes were designed: 1) Probe 1mod - This probe has the same sequence and forms the same structure as probe 1, except that the debase site is located outside the putative double-stranded region and should not be treated with Fpg; 2) Probe 2 - This bihapten probe is designed to hybridize to a different region within the rs1207445 amplicon. This probe exhibits reduced hairpin (ΔG = -2.07 kcal / mol) and autodimer (ΔG = -8.05 kcal / mol) compared to probe 1 and probe 1mod. Furthermore, the dR group is located outside the double-stranded region and should not act as a substrate for Fpg (Figures 3ii and 3iii).
[0103] To determine whether the improved probe design could reduce nonspecific signals in negative amplification while maintaining the ability to detect RPA in positive amplification, NTC and positive (containing 1000 copies of human gDNA) RPA reactions were detected undiluted on lateral flow strips in the presence of three probes. All positive reactions showed significant stimulation of the test line signal above the negative amplification, suggesting that RPA performed as expected (Figure 3iii). Probe rs1207445 showed the largest background signal in negative amplification. Nonspecific signals were barely detectable in negative amplification containing probe 1mod and were not visible in reactions containing probe 2 (Figure 3iii). Therefore, nonspecific signals in negative amplification can be effectively reduced or eliminated by designing probes that do not form secondary structures, self-dimers, or cross-dimers, or reduce the likelihood of such formation. In some cases, these structures are unavoidable, and the debasement site must be located outside any double-stranded region.
[0104] Example 14: Direct detection of RPA on lateral flow—analytical sensitivity and applicability to other targets Further demonstration of the Fpg dual hapten probe for direct detection of RPA was provided. The rs1207445 assay was first compared with another existing in-house assay for Campylobacter jejuni. The C. jejuni assay utilized a previously designed primer targeted against 16S rRNA, with the only modification being the replacement of the existing Fpg probe sequence with a novel dual hapten-labeled probe designed for direct lateral flow detection.
[0105] In both examples, low-MW PEG RPAs were performed in 4-strand configurations, and the reactions contained 10, 100, or 1000 copies of appropriate template DNA (human gDNA and synthetic 16S C. jejuni rDNA templates for rs1207445 and Campylobacter assays, respectively). The RPA products were then analyzed undiluted on anti-DNP lateral flow strips. In the improved rs1207445 assay (using rs1207445 probe 2), no signal was observed on the test line in the NTC reaction. The test line was weak but present in all RPAs containing 10 copies of template DNA (shown as green contours in Figure 4i, more evident at the strip ends), and a good signal was observed on the test strips of all RPA reactions containing ≥100 copies of human gDNA (Figure 4i).
[0106] In the C. Jejuni assay, a weak false-negative signal was present in all NTCs (it should be noted that this probe was not redesigned for lateral flow, which indicates some trace secondary structure and autodimerization). However, a very strong test line signal was observed in all amplifications containing ≥10 copies of template DNA (Figure 4ii).
[0107] In summary, these data suggest that lateral flow strip detection is limited only by the success of the amplification reaction. The same improved RPA chemistry used for direct detection lateral flow assays was employed in both cases. Furthermore, the data indicate that the improved Fpg probe chemistry can be applied to a wide range of RPA methods for the detection of target nucleic acids. Such improved techniques are readily applicable to many potential targets, and analytical sensitivity is expected to be comparable to other commercially available NAAT assay formats. Some false-positive signals were observed in the C. Jejuni assay, but such observations are expected to be mitigated through a process of carefully selecting the probe nucleotide sequence to minimize the possibility of autodimer / secondary structure formation, as was observed with the modified probe used in the assay against rs1207445.
[0108] Further demonstration of improved direct detection lateral flow technology was provided. Novel RPA primers and probes were prepared for the detection of E. coli O157:H7. Such assays can be used in food testing and have potential for use in rapid disease diagnosis using stool samples. Serum marker genes (rfb) representing highly conserved regions in all strains of E. coli O157:H7 were identified. O157 ) and (fliC H7 We developed an RPA lateral flow assay that can be used to identify ). The newly developed RPA assay was initially designed as a singleplex test, leaving room for biochemical multiplexing of the test at some point in the future (such probes can be detected independently at different capture lines on the lateral flow test strip, using Fpg probes labeled with Bio-DNP and Bio-FAM double hapten labels, respectively).
[0109] A preliminary screening of all primer / probe combinations against E. coli serotypes was performed using the TwistAmp Fpg fluorescence probe assay (containing 5.5% 35kDa PEG) with an isothermal T8 instrument, with the intention of discovering primer / probe combinations that exhibit analytical sensitivity of approximately 10 copies per reaction in rapid amplification kinetics (start time <6 minutes for 10 copies, with high maximum fluorescence). Probes that showed optimal performance in the fluorescence assay were then modified and used as bihapten Fpg probes with low MW PEG RPA for use in direct assay lateral flow (primers were the same for both the fluorescence assay and the lateral flow assay).
[0110] Figure 5i) shows a novel RFB assay for direct, undiluted detection of low MW PEG RPA reactions on a lateral flow strip. O157A comparison of the fluorescence Fpg assay (35kDa PEG) is shown. The fluorescence probe assay (using 35kDa PEG) showed a signal exceeding the NTC baseline (red) in all replicates with 10 copies of template DNA (quantified synthetic DNA). As expected, all reactions containing 100 copies (green) and 1000 copies (blue) were positive, and the onset time and maximum fluorescence correlated well with the amount of template DNA per reaction. In the direct lateral flow assay, a positive test line signal was observed in 3 out of 4 replicates with 10 copies of template DNA (all replicates containing ≥100 copies of template were strongly positive). No visible false-positive signals were observed in the NTC, further demonstrating that good probe design can eliminate such artificial products (as the same strip chemistry used in the rs1207445 assay was also used for E. coli detection).
[0111] Figure 5ii) shows the comparison of fliC with the direct lateral flow method. H7 The performance of the fluorescent probe singleplex is demonstrated. Again, the fluorescent probe assay showed strong amplification for 10 copies (yellow) in all replicates tested, and the maximum fluorescence and onset time correlated well with the amount of quantified synthetic DNA template copies present in the reaction. In the Fpg double hapten lateral flow assay, weak signals were observed in 3 out of 4 replicates with 10 copies, and a stronger signal was observed in one replicate. A very weak false-positive signal was observed in the fliC H7 This was observed in all NTCs for the assay. However, such nonspecific signals could be eliminated by further repeatable probe design and the use of blocking reagents, as previously shown.
[0112] These data demonstrate the versatility of the novel bihapten Fpg probe chemistry, showing that susceptibility assays can be designed relatively easily for important pathogens and achieve comparable assay susceptibility to existing commercially available fluorescence Fpg assays.
[0113] Example 15: Improved and easy-to-use FPG dual hapten lateral flow assay - "continuous flow" Direct, undiluted detection of RPA products reduces the complexity of assay consumables, thereby simplifying the test procedure for end-users while simultaneously lowering manufacturing costs. This disclosure can reduce the test time from approximately 40 minutes using the Fpg bihapten lateral flow RPA assay to 30 minutes or less, depending on the required assay sensitivity.
[0114] Feasibility studies demonstrated the advantages of having a lateral flow assay strip present in the RPA reaction throughout the amplification cycle. The reaction volume was increased from 100 μl to 200 μl to match the fact that significant amplification occurs after the mixture has moved along the strip. Initially, an anti-biotin gold colloid label was added directly to the RPA reaction mixture before amplification to prevent the conjugate from being released from the pad before amplicon accumulation. Various heavy weight wicking pad materials (control material: CF5, medium weight cellulose fiber; experimental material: CF6 and Grade 320, heavy weight cellulose) were evaluated to increase the reaction volume that could be processed on the strip. The assay strip was laminated with adhesive cover tape to help prevent the wicking pad from detaching from the apparatus as the RPA assay progressed.
[0115] Proof of concept was established using a 200 μl lyophilized RPA pellet for use in a lateral flow assay (3 kDa PEG) with an rs1207445Fpg double hapten (Bio-DNP) assay. The pellet was hydrated in a buffer container containing either 0 or 5000 copies of template DNA plus 1.5 μl of anti-biotin gold colloid, and anti-DNP strips were hydrated with wicking made from CF5 (control), CF6, or Grade 320 heavy pads. All reaction mixtures were immediately added to each lateral flow strip and incubated at 40°C for 30 minutes.
[0116] In Figure 6, strips made from the absorbent pad material shown were incubated in an RPA reaction during amplification. The data shown pertain to the rs1207445 double hapten Fpg assay, comparing the NTC reaction with one containing 5000 copies of template DNA.
[0117] In the control (CF5) strip, very strong false-positive signals were observed in all NTC reactions, and only slight stimulation of the test line signal was observed with 5000 copies of input template DNA (Figure 6i, top panel). However, while the CF6 strip produced some false-positive signals (weaker than in the control strip), the false-positive response was effectively eliminated when using the Grade 320 strip. This is expected to be due to the larger bed volume of the Grade 320 material, which may have improved capillary action compared to the CF5 or CF6 material. The analyte may flow more easily through the Grade 320 material-based strip compared to the CF5 strip, thereby reducing the time available for nonspecific interactions to occur. Furthermore, significant stimulation of the test line signal was observed in amplifications containing template DNA (Figure 6, bottom panel).
[0118] Example 16: Exoprobe Design This embodiment demonstrates an exemplary probe design for an exonuclease III (exo) cleavable probe. An exemplary probe structure is shown below. The following sequence is an exemplary probe. The sequence is designed to be complementary to the amplified target DNA. 5'-XAAATTTCTACTTTTGGCCAGTTCTACAATTTGTTLHATATCACATGGATGTB-3'(Sequence ID 1) So X = 5' hexyl H=THF residue B=C3 spacer (blocks 3'-5' nuclease digestion) L=DNP TEG and biotin hexyl branching modifier; phosphorothioate (PS) bonds between the DNP TEG and biotin hexyl moieties can be used to ensure the stability of the internal hapten bond.
[0119] Design the probe so that a 3' block B (e.g., a C3 spacer, e.g., propanol) prevents unwanted nuclease digestion of the probe. Incorporate the branching modifier L to the 5' side of the debasalized THF residue H. In the example above, L is immediately 5' of H, but it is possible to extend L further from H in the 5' direction. The THF residue is located approximately 30 nt upstream and approximately 15 nt downstream of the complementary sequence.
[0120] L represents a modified cytosine (C) nucleobase, and therefore must replace the C residue in the probe sequence. L has the following structure: [ka] It is incorporated into solid-phase oligo synthesis using a commercially available phosphoramidite (LGC LINK (Teddington, UK) model number 2150) that has the properties of [unclear].
[0121] This phosphoramidite is incorporated during the normal solid-phase DNA oligo synthesis process. The 5'-OH of the oligo is deprotected (the DMTr protecting group is removed), then capped with a 5' block X (e.g., C6, e.g., hexyl), and then the levulinoyl protecting group attached to the extracyclic amine of the modified cytosine shown above is removed. This frees the hydroxyl group, allowing for further branching and extension of the cytosine nucleobase containing other phosphoramidites. Amidites incorporating haptens, such as DNP TEG (upper part below, LGC LINK part number 2549) followed by biotin ("Bio") hexyl (lower part below, LGC LINK part number 2109), generate probes double-labeled with haptens using branching modifier L. [ka]
[0122] In an RPA reaction containing the target amplicon, ExoIII cleaves the debasic residue H of the probe, and subsequent 3'-5' digestion by ExoIII releases a mononucleotide L (having a 5'-phosphate and 3'-OH) labeled with two distinct haptens. This double-hapten-labeled mononucleotide freely exits the RPA coacervate and interacts with antibodies on the visualization particle and LF strip test lines.
[0123] The described exoprobe design allows for the modular incorporation of various haptens at branch site L using commercially available phosphoramidites. Bio / DNP, Bio / FAM, and FAM / DNP labeling at L are all possible, and the order of hapten binding to the cytosine nucleo base at L can also be freely changed. Finally, if a third distinct hapten is desired for binding and sorting the untreated probe, the hapten (e.g., DNP / FAM / BIO) can be used as the probe's 5'-cap X instead of hexyl, for example. When the DNP-TEG phosphoramidite shown above is used as the 5'-cap, an additional deprotection and capping step is used to remove the DMTr group and block the resulting 5'-OH with hexyl, for example.
[0124] Figure 9 shows exemplary structures of Exo probes and their applications. The left panel shows a comparison of Fpg probe analytes and Exo probe analytes. The Exo probe has a DNP TEG and a biotin hexyl-labeled levulinoyl dC branching modifier located one nucleotide upstream of a tetrahydrofuran residue. The right panel shows the intended mechanism of how the analytes are generated in RPA. When the probe binds to the complementary strand of the amplicon, Exo is cleaved with THF and then scraped using 3' exonuclease activity, releasing biotin / DNP-labeled cytosine, which is then detected on the strip (using anti-DNP test lines and anti-biotin gold colloid or other nanoparticles).
[0125] Reactive preparation In short, the Exo LF RPA reaction is incubated at 40°C for 20 minutes. Each RPA formulation for lateral flow (Exo) contains appropriate forward and reverse primers of 420 nM, a 120 nM double hapten Exo probe, 50 mM Tris-acetic acid pH 8.3, 100 mM KOAc, 5 mM DTT, 1 × creatine kinase, 30 μg Gp32, 30 μg UvsX, 7 μg UvsY, 6.5% 3 kDa PEG, 5.7% trehalose, 8.6 μg DNA polymerase I (Staphylococcus aureus), 10 μg exonuclease III, 50 mM phosphocreatine, 2.5 mM ATP, 1.8 mM dNTP, and 0.5% Brij-35. The reaction is initiated by adding a suitable template and a mixture containing Mg(OAc)2 (final concentration 22.5 mM) to a final volume of 100 μl.
[0126] Continuous Flow - One-Stage RPA Lateral Flow The high sensitivity of Exo LF probe chemistry enables its use in a "continuous flow" system where RPA nucleic acid amplification and strip detection are performed simultaneously, reducing the time to results by approximately 5 minutes from template addition (20-30 minutes with optimal sensitivity for low input DNA copy numbers). To make this possible, the lateral flow strip must be able to process more analytes than the undiluted RPA LF system alone. This can be achieved by using a heavy-weight absorption pad material (e.g., Grade 320 cotton linter (Ahlstrom)) over the CF5 material used in endpoint detection strips. This material not only allows more analytes to flow on the strip, but it also appears to increase the flow rate, thereby reducing nonspecific signals compared to other pad types. The strip also incorporates a cover tape, which helps reduce peeling, a common issue when using heavy-weight absorption pads.
[0127] Aside from reducing the time to results, the overall advantages of a continuous flow system are: 1) no processing / dilution is required for amplification reactions (reducing contamination risk and simplifying potential consumable fluids), and 2) consumable fluids are reduced (essentially the consumables are the heating chambers for RPA that come into direct contact with the Terral flow strips).
[0128] Figure 10 shows data using the undiluted Exo LF chemistry described above in two E. coli assays compared to the Fpg assay described in the above examples (numbers indicate input DNA copy number; NTC = no template control). Again, the strips were added after amplification. The Exo assay showed higher sensitivity and a stronger test line signal. The signal occurred earlier than with the Fpg chemistry. Furthermore, it was much improved compared to the Fpg setting, although some false-positive signals remained.
[0129] Figure 11 shows simultaneous amplification / detection using Exo probe chemistry. Simultaneous amplification and detection have the advantages of faster results time (20-30 minutes) and simplified consumable design. The data in Figure 10 shows a comparison between endpoint detection and continuous flow. Similar susceptibility is observed between the two. False positive signals are stronger in continuous flow, which may be due to the presence of cover tape.
[0130] Figure 12 shows an exemplary apparatus for use in a one-step RPA lateral flow. The apparatus has a reaction chamber for assay reagents and a strip chamber for detection during amplification. In the apparatus shown in Figure 12, a channel exists between the reaction chamber and the strip chamber, which allows flow between the two chambers. In some embodiments, the chamber holds a lyophilized pellet containing the RPA components. Amplification is initiated by adding template DNA and buffer and placing the chamber on a heating block at 40°C. In some embodiments, the chamber holds a magnetic stirring rod for mixing. Amplification occurs as the reaction progresses through the strip, and a test line signal is generated.
[0131] Other Embodiments While this disclosure is described in detail, it should be understood that the foregoing description is illustrative and does not limit the scope of this disclosure as defined by the attached claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. (i) 【Chemistry 1】 or (ii) 【Chemistry 2】 (In the formula, R is OH or -NH(CH) 2 ) 6 (OH) A composition containing the following:
2. (i) 【Transformation 3】 or (ii) 【Chemistry 4】 (In the formula, DMTr is dimethoxytrityl) A composition containing the following: 【Request Item 3】 【Chemistry 5】 (In the formula, Z is selected from (i) the Cl' of the debasal ribose or deoxyribose ring in each RNA or DNA oligonucleotide, having a β configuration at the anomeric carbon atom; and (ii) a phosphoramidite compound configured to bind to a DNA or RNA oligonucleotide. And if Z is a DNA or RNA phosphoramidite, the reactive groups of hapten 1 and hapten 2 may be protected with pivaloyl, tert-butylbenzoyl, acyl, benzoyl, or isobutyryl. R represents hydrogen, or a linear or branched C1-C6 alkyl group. X1, X2, and X4 are absent. X3 is a linear C4 alkyl group, X5 is a linear C6 alkyl-NH- group, Hapten1 and Hapten2 each contain different conjugated immunogenic groups selected from biotin, fluorescein, and dinitrophenyl, respectively. composition.