Automated nested recombinase polymerase amplification

The automated system with nested RPA amplification and integrated pumps efficiently detects multiple pathogens like influenza A and B viruses, addressing the inefficiencies of existing methods by enabling rapid and accessible point-of-care testing.

JP7867767B2Active Publication Date: 2026-06-01ABBOTT DIAGNOSTICS SCARBOROUGH INC
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2021064771
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-03-04
Filing Date
2021-04-06
Publication Date
2026-06-01
Estimated Expiration
2037-03-03

AI Technical Summary

Technical Problem

Existing nucleic acid amplification methods are not fully automated and efficient for rapid detection of trace polynucleotide sequences, particularly for point-of-care testing of pathogens like influenza viruses.

Method used

A fully automated system comprising a sample module, microfluidic nucleic acid amplification device, and analyzer that performs nested recombinase polymerase amplification (RPA) with integrated pumps and microfluidic channels, allowing selective movement of liquids for multiple rounds of amplification and detection using optical or electrochemical means.

Benefits of technology

Enables rapid and efficient detection of multiple target sequences, such as influenza A and B viruses, within 30 minutes, facilitating point-of-care testing and improving diagnostic accessibility and speed.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007867767000006
    Figure 0007867767000006
  • Figure 0007867767000007
    Figure 0007867767000007
  • Figure 0007867767000008
    Figure 0007867767000008
Patent Text Reader

Abstract

To provide a system which includes a sample module, a microfluidic nucleic acid amplification device and an analyzer and facilitates fully automated nested recombinase polymerase amplification (RPA) on a sample delivered to the nucleic acid amplification device via the sample module.SOLUTION: A diagnostic card includes: a card body that includes a first reaction chamber to perform a first nucleic acid amplification and one or more second reaction chambers to perform a second nucleic acid amplification; a passage for supplying a sample fluid to the first reaction chamber; one or more detection chambers in fluidic connection with the one or more second reaction chambers; and a detection module coupled with each detection chamber.SELECTED DRAWING: Figure 19A
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference of related cases This application claims priority to U.S. Patent Application No. 62 / 303, 934, titled "Automated Nested Recombinase Polymerase Amplification," filed on 4 March 2016, which is incorporated herein by reference in its entirety.

[0002] Description of government rights This invention was government-supported under HHSO100201400011C, authorized by the U.S. Department of Health and Human Services. The government has specific rights to this invention.

[0003] Technical field The present invention relates to an influenza assay system, more particularly to a system comprising a sample module, a microfluidic nucleic acid amplification device, and an analyzer, which facilitates fully automated nested recombinase polymerase amplification (RPA) in a sample delivered to the nucleic acid amplification device via the sample module. [Background technology]

[0004] background Trace detection of polynucleotide sequences can play a crucial role in the detection of pathogens and genetic diseases, helping to develop treatment prescriptions tailored to specific infections or genotypes. Certain isothermal nucleic acid amplification methods can rapidly amplify target polynucleotide sequences from trace amounts to highly detectable levels. Such isothermal methods, such as recombinase polymerase amplification (RPA) or nicking and extension amplification (NEAR), enable users to detect trace amounts of specific sequences, facilitating point-of-care testing and increasing the accessibility and speed of diagnostics. [Overview of the Initiative]

[0005] The nucleic acid amplification device disclosed herein is configured to include a row of microfluidic channels interconnecting first and second reaction chambers with a detection chamber. An integrated pump module is also provided to allow selective movement of the liquid through the device at appropriate times. A first reaction chamber is provided to produce the first round of RPA, resulting in amplification of the target polynucleotide sequence of interest. After the first round of RPA, the sample liquid is mixed with a specific RPA primer and moved to the second reaction chamber. During the second amplification, the sequence completely contained in the first reaction product is amplified to produce a second reaction product, which is then detected. Detection can be achieved using optical or electrochemical means.

[0006] The product mixture obtained from the first round of RPA may be separated into multiple streams and passed through reagent containers, and the product mixture may be mixed with the same or different RPA primers before being introduced into multiple second reaction chambers. In this configuration, the nucleic acid amplification device may be used to detect more than one target (e.g., influenza A virus and influenza B virus). In some cases, one of the second reaction chambers may be used as a control.

[0007] A first general embodiment involves adding a sample to a microfluidic device and amplifying a target polynucleotide sequence in the sample. Amplifying the target polynucleotide sequence involves performing a first round of amplification on the sample to produce a first amplification product, and then performing a second round of amplification on the first amplification product to produce a second amplification product. The second amplification product contains a smaller sequence that is entirely contained within the first amplification product produced during the first round of amplification.

[0008] Implementation of the first general embodiment may include one or more of the following features:

[0009] Some embodiments include detecting a second amplification product.

[0010] In some embodiments, detecting the second amplification product may involve labeling the second amplification product with a first oligonucleotide conjugated to a fluorophore and a quencher to obtain a labeled second amplification product, cleaving the quencher from the labeled second amplification product, and optically detecting the signal emanating from the fluorophore, where the detectable signal is an indicator of the presence of the second amplification product. Cleaving the quencher may be carried out using a nuclease. The nuclease may target double-stranded DNA. In some cases, the nuclease is formamidepyrimidine-DNA glycosylase.

[0011] In some embodiments, detecting the second amplification product involves labeling the second amplification product with a first oligonucleotide conjugated to a redox moiety to obtain a labeled second amplification product, cleaving the redox moiety from the labeled second amplification product, and electrochemically detecting the signal resulting from the cleaved redox moiety, where the detectable signal is an indicator of the presence of the second amplification product. The redox moiety is generally selected from the group consisting of phenothiazine, phenoxazine, ferrocene, ferricyanide, ruthenium(III), osmium(II), anthraquinone, phenazine, and derivatives thereof. Cleaving the redox moiety can be carried out using a nuclease. The nuclease may target double-stranded DNA. In some cases, the nuclease is formamidepyrimidine-DNA glycosylase.

[0012] Some embodiments include performing a third round of amplification on the second amplification product to obtain a third amplification product and detecting the third amplification product, wherein the third amplification product comprises a smaller sequence that is entirely contained within the second amplification product produced during the second round of amplification.

[0013] Samples can be obtained from animals. For example, samples can be obtained from animal blood, sputum, mucus, saliva, tears, or urine. In some cases, samples can be obtained from humans.

[0014] The target nucleic acid may contain a target polynucleotide sequence. In some embodiments, the target nucleic acid is obtained from an animal pathogen. The animal pathogen may be a single-stranded DNA virus, a double-stranded DNA virus, or a single-stranded RNA virus. The animal pathogen may be a bacterium. The target nucleic acid may be double-stranded DNA, single-stranded DNA, or RNA. In some cases, the target nucleic acid is selected from the group consisting of genomic DNA, plasmid DNA, viral DNA, mitochondrial DNA, cDNA, synthetic double-stranded DNA, and synthetic single-stranded DNA. The target nucleic acid may be viral DNA or viral RNA. In certain examples, the animal pathogen is influenza A virus or influenza B virus.

[0015] In some embodiments, two or more target polynucleotide sequences in the sample are amplified. In one example, a target polynucleotide sequence containing the influenza A gene sequence and a target polynucleotide sequence containing the influenza B gene sequence are amplified.

[0016] In some embodiments, two or more amplification products are detected. In certain embodiments, a second amplification product containing the influenza A gene sequence and a second amplification product containing the influenza B gene sequence are detected.

[0017] In a second general embodiment, the diagnostic card includes a card body. The card body includes a first reaction chamber, one or more second reaction chambers, a passage for supplying a sample fluid to the first reaction chamber, one or more detection chambers fluid-connected to one or more second reaction chambers, and a detection module connected to each detection chamber. The first reaction chamber is configured to perform first nucleic acid amplification on the sample fluid in the reaction chamber to produce a first amplification product. Each second reaction chamber is configured to perform second nucleic acid amplification on the first amplification product to produce a second amplification product.

[0018] Implementation of the second general embodiment may include one or more of the following features:

[0019] In some embodiments, the detection module is an optical module such as a fluorescence detector. The fluorescence detector may include a single light pipe that sends illumination light to one or more detection chambers, and another light pipe that receives light reflected from each detection chamber.

[0020] In some embodiments, the detection module is an electrode module. The detection module may include a series of conductive paths that terminate in electrodes for each detection chamber. The device may include additional conductive paths and electrodes to detect the position of the fluid throughout the microfluidic card.

[0021] In some embodiments, the amplification includes a recombinase polymerase amplification (RPA) reaction.

[0022] In some embodiments, the diagnostic card includes mixing means, a pump, and connection ports for connecting to a sample module. The first reaction chamber may be coupled to a heater. The first reaction chamber may include mixing means or may be coupled to mixing means. In some cases, the first reaction chamber contains a reagent. The reagent may include an RPA reagent. The RPA reagent may be lyophilized.

[0023] In some embodiments, each second reaction chamber contains a reagent. The reagent may include an RPA reagent. The RPA reagent may be lyophilized.

[0024] In some embodiments, the sample fluid is obtained from an animal. The sample can be obtained from the animal's blood, sputum, mucus, saliva, tears, or urine. In some cases, the sample fluid is a sample obtained from a human. The sample fluid can contain a target nucleic acid. The target nucleic acid can be obtained from an animal pathogen. The animal pathogen can be a single-stranded DNA virus, a double-stranded DNA virus, or a single-stranded RNA virus. In some cases, the animal pathogen is a bacterium. The target nucleic acid can be double-stranded DNA, single-stranded DNA, or RNA. In certain examples, the target nucleic acid is selected from the group consisting of genomic DNA, plasmid DNA, viral DNA, mitochondrial DNA, cDNA, synthetic double-stranded DNA, and synthetic single-stranded DNA. The target nucleic acid can be viral DNA or viral RNA. The animal pathogen can be an influenza A virus or an influenza B virus.

[0025] In some embodiments, the second amplification product is produced within 30 minutes, within 15 minutes, within 10 minutes, or within 5 minutes after delivery of the sample fluid to the diagnostic card. The diagnostic card is generally disposable.

[0026] In some embodiments, the diagnostic card includes additional reaction chambers, each configured to perform an additional round of nucleic acid amplification reaction to generate an additional amplification product, whereby the amplification product obtained from each successive n + 1 round of amplification is a smaller sequence that is fully contained within the amplification product of the previous n rounds of amplification.

[0027] A third general aspect includes a reader configured to receive the diagnostic card of the second general aspect. The reader includes a detector configured to detect the presence of the second amplification product within the second reaction chamber.

[0028] A fourth general embodiment includes a nucleic acid amplification device. The nucleic acid amplification device includes a first reaction chamber fluidly connected to a first inlet and a first outlet, a second reaction chamber fluidly connected to a second inlet and a second outlet, a detection chamber, a first pump, a second pump, and a third pump. The first inlet is fluidly connected to the first reaction chamber via the first pump, and the first outlet is fluidly connected to the first reaction chamber. The first reaction chamber is fluidly connected to the second reaction chamber via the second pump, and the second outlet is fluidly connected to the second reaction chamber. The second inlet is fluidly connected to the second reaction chamber via the third pump.

[0029] The fourth general embodiment of implementation may include one or more of the following features:

[0030] In some embodiments, the nucleic acid amplification device is a microfluidic device. The first reaction chamber generally contains reagents. In some cases, the first reaction chamber contains a catalyst. The catalyst may contain magnesium.

[0031] In some embodiments, the nucleic acid amplification device includes a reagent reservoir, and a second and a third pump are fluidly connected to each second chamber via a first reagent reservoir. The second and third pumps are fluidly connected to each second reaction chamber via a first and a second reagent reservoir. In some cases, the first and second reagent reservoirs are in series. The first reagent reservoir may contain an oligomer. The second reagent reservoir may contain magnesium.

[0032] In some embodiments, each second reaction chamber is a detection chamber. A portion of each detection chamber is optically transparent. In some cases, electrodes are connected to each detection chamber. In one example, three electrodes are connected to each detection chamber.

[0033] In some embodiments, the nucleic acid amplification device includes a fluid detection region. A first pump and a first reaction chamber may be connected via a first detection region. A second pump and a second reaction chamber may be connected via a second detection region. A third pump and a second reaction chamber may be connected via a third detection region. A third pump and a first reaction chamber may be connected via a fourth detection region. In some cases, a portion of each detection region is optically transparent. The fluid detection chamber may be connected to each detection region.

[0034] In some embodiments, the nucleic acid amplification device includes a heater connected to a first reaction chamber. The first reaction chamber may include a stirrer. In certain embodiments, a first pump is configured to supply the sample delivered to the nucleic acid amplification device via a first inlet to the first reaction chamber. Second and third pumps may be configured to mix reagents delivered to the nucleic acid amplification device body with the product from the first reaction chamber via a second inlet to produce a reactant mixture. The second and third pumps may be configured to supply a portion of the reactant mixture to each of the second reaction chambers.

[0035] Other features and advantages of the present invention will become apparent from the following detailed description and figures, and from the claims. [Brief explanation of the drawing]

[0036] [Figure 1] This figure shows the components of a system for performing fully automated nested RPA on a sample delivered to a nucleic acid amplification device via a sample module. [Figure 2] This diagram shows an alternative workflow to the system shown in Figure 1. [Figure 3] This figure shows a perspective view of the receptor module portion of the sample module. [Figure 4] This figure shows a perspective view of the transport module portion of the sample module. [Figure 5]This diagram shows the workflow for adding a sample to a sample module that has connected receiver modules and transport modules. [Figure 6] This diagram shows the workflow for adding a sample to a sample module that has separate receptor modules and transport modules. [Figure 7] This figure shows a perspective view of a hinged sample module. [Figure 8] This is a diagram showing an alternative sample module. [Figure 9] This figure shows the workflow for adding samples to the sample modules shown in Figures 8A and 8B. [Figure 10] This figure shows an exploded view of a microfluidic nucleic acid amplification device for optical probe detection. [Figure 11] Figure 10 shows the functional components of a microfluidic nucleic acid amplification device. [Figure 12] This figure shows an exploded view of a microfluidic nucleic acid amplification device for electrochemical probe detection. [Figure 13] Figure 12 shows a top-view perspective of the intermediate layer of the microfluidic nucleic acid amplification device. [Figure 14] Figure 12 shows a top perspective view through the sensor layer of the microfluidic nucleic acid amplification device. [Figure 15] This figure shows a perspective view of a nucleic acid amplification device inserted into an analytical instrument. [Figure 16] This is a perspective view of an optical analysis device. [Figure 17] This figure shows a detailed view of the optical pipe in the optical analysis apparatus shown in Figure 16. [Figure 18] This figure shows the excitation and emission coordinate systems for the optical analyzer shown in Figure 16. [Figure 19A] This figure shows the results of nested RPA amplification as described herein. [Figure 19B] This figure shows the results of nested RPA amplification as described herein. [Figure 19C] This figure shows the results of nested RPA amplification as described herein. [Figure 19D] This figure shows the results of nested RPA amplification as described herein. [Modes for carrying out the invention]

[0037] Figures 1A-1D show the components of system 100 for performing fully automated nested RPA on a sample added to a microfluidic nucleic acid amplification device. Figure 1A shows the sample module 102, which includes a receptor module 104 and a transport module 106. Figure 1B shows the microfluidic nucleic acid amplification device 110. As shown in Figure 1C, the sample module 102 and the nucleic acid amplification device 108 are connected to form a nucleic acid amplification assembly 110. Figure 1D shows system 100, which includes the nucleic acid amplification assembly 110, which is inserted into an analyzer 112 for evaluating the presence of target nucleic acids in the sample added from the sample module 102 to the nucleic acid amplification device 108.

[0038] System 100 is used to assess the presence of a target nucleic acid in a sample that is added to the receptor module 104 of the sample module 102. The receptor module 104 and transport module 106 of the sample module 102, as well as the nucleic acid amplification device 108, contain reagents necessary to perform the first round of RPA, followed by a second round of RPA to amplify the target nucleic acid if it is present in the sample. By connecting the sample module 102 and the nucleic acid amplification device 108, a flow path is created between the sample module and the nucleic acid amplification device, allowing the RPA reaction mixture to be delivered to the nucleic acid amplification device. In some cases, system 100 is used to assess the presence of two or more target nucleic acids in a sample. In one example, system 100 is used to assess the presence of influenza A virus and influenza B virus in a sample. In a particular example, the sample module 102 and the nucleic acid amplification device 108 are configured to perform three or more rounds of nested RPA.

[0039] Figures 2A-2E show an alternative workflow to system 100. As shown in Figure 2A, the nucleic acid amplification device 108 is inserted into the analyzer 112. In Figure 2B, the sample module 102 is advanced toward the nucleic acid amplification device 108 in the analyzer. The positioning shape of the contact surface of the analyzer 112 restricts the sample module 102 in two dimensions before connection, mating the sample module and the nucleic acid amplification device 108 to form a passage for fluid to pass from the sample module to the nucleic acid amplification device and vice versa. Figure 2C shows the nucleic acid amplification assembly 110 in the analyzer 112. By connecting the sample module 102 to the nucleic acid amplification device 108, the flow of reactants from the sample module to the nucleic acid amplification device can be initiated, thereby initiating the evaluation of the presence of the target nucleic acid in the sample. Once the evaluation is complete, as shown in Figure 2D, the positioning shape of the analyzer 112 can be re-engaged to release the nucleic acid amplification assembly 110. Figure 2E shows the nucleic acid amplification assembly 110 after being released from the analyzer 112. The nucleic acid amplification assembly 110 can be disposed of after being released from the analyzer 112.

[0040] Figures 3A and 3B show perspective views of embodiments of the receptor module 104 of the sample module 102. Figure 3A shows a perspective view of the receptor module 104, which has a chamber 300 for receiving a sample containing a reagent, or both. The receptor module 104 also includes a positioning shape 302 for aligning the receptor module with the transport module 106. Figure 3B shows a rear perspective view of Figure 3A, showing the outer surface of the bottom 304 of the chamber 300.

[0041] Figures 4A and 4B show perspective views of embodiments of a transfer module 106 configured to be coupled with a receiver module 104. Figure 4A shows a perspective view of the transfer module 106 having chambers 400, each chamber having an inlet 402 and an outlet 404. The transfer module 106 also includes a positioning shape 406 for aligning the transfer module with the receiver module 104. Figure 4B shows a rear perspective view of Figure 4A, showing the bottom 408, as well as the outer surfaces of the inlets 402 and 404 of the chambers 400.

[0042] Figures 5A–5G illustrate the workflow for adding a sample to a sample module 500 having a coupled receptor module 502 and a transport module 504. As shown in Figure 5A, the sample module 500 may be supplied in a sealed pouch 506. The sealed pouch 506 may be a foil pouch. Figure 5B shows the sample module 500 after being removed from the pouch 506, with the hinge 508 opened to expose the sealing seals 510 and 512 of the receptor module 502 and the transport module 504, respectively.

[0043] As shown in Figure 5C, the seal 510 can be removed from the receiver module 502 to expose the sample module 514 and the blank chamber 516. The sample chamber 514 and the blank chamber 516 typically contain a liquid medium such as a buffer solution. A sample (e.g., body fluid) can be delivered to the sample chamber 514 via a device 518 (e.g., a cotton swab), thereby introducing the sample into the liquid medium in the sample chamber 514. The blank chamber 516 can be covered with a occlusion component 520 to prevent the insertion of a sample into the blank chamber. Gaskets 522 and 524 may be positioned around the outside of the sample chamber 514 and the blank chamber 516, respectively, to facilitate the formation of a seal between the receiver module 502 and the transfer module 504 after a sample has been added to the sample chamber 514. A positioning shape 526 on the receiver module 502 is configured to mate with a corresponding positioning shape on the transfer module 504.

[0044] As shown in Figures 5D and 5E, the seal 512 may be removed from the transfer module 504 to expose the sample module 528 and the blank chamber 530. Retaining components 532 and 534 are positioned in the sample chamber 528 and the blank chamber 530, respectively, and may hold solid reagents in the sample chamber, the blank chamber, or both. In one example, retaining component 532 holds a reagent pellet in the sample chamber 528. The reagent pellet may contain oligomers for the RPA reaction. In some cases, the pellet is a lyophilized pellet. The blank chamber 530 may be free of solid reagents. Retaining components 532 and 534 generally define openings such as holes. In some cases, retaining components 532 and 534 are frit. The frit is chosen to facilitate the transfer of fluid from the receiver module 502 to the transfer module 504. In one example, retaining components 532 and 534 are hydrophilic frit. The transfer module 504 includes a positioning shape 536 configured to fit with the positioning shape 526 of the receiver module 502.

[0045] After the seal 512 is removed from the transfer module 504, the transfer module can be rotated around the hinge 508 and secured to the receptor module 502, as shown in Figure 5F, and the retaining components 532 and 534 hold the reagent present in the sample chamber 528 and blank chamber 530, respectively. When the receptor module 502 and the transfer module 504 are pressed against each other, the positioning shapes 526 and 536 lock into place, as shown in Figure 5G, with the gasket 522 sealing both the sample chambers 514 and 528 and the gasket 524 sealing both the blank chambers 516 and 530. When the sample module 502 is rotated as shown, with the transfer module 504 on top of the receptor module 502, the liquid medium in the sample chamber 514 and blank chamber 516 remains in the receptor module and does not flow towards the sample chamber 528 and blank chamber 530 in the transfer module 504, respectively, before inversion occurs. Positioning shapes 526 and 536 may be configured to irreversibly seal the receiver module 502 and the transfer module 504, so that the sample module 500 cannot be opened unintentionally.

[0046] Before binding the sample module 500 to the nucleic acid amplification device, the sample module is inverted to cause the liquid medium in the receptor module 502 to move toward the transfer module 504, thereby hydrating the solid reagent in the transfer module and preparing a hydrated reaction mixture. In one example, lyophilized RPA reagent in the transfer module generates a hydrated reaction mixture.

[0047] Figures 6A–6H show an alternative workflow for adding a sample to a sample module 600 having a separate receptor module 602 and a transfer module 604. As shown in Figure 6A, the receptor module 602 and the transfer module 604 may be supplied in separate sealed pouches 606, 606', respectively. The sealed pouch 606 may be a foil pouch.

[0048] Figure 6B shows the transfer module 604 after being removed from the sealed pouch 606'. The transfer module 604 is sealed with a seal 612. Figure 6C shows the receptor module 602 after being removed from the pouch 606'. The receptor module 602 is sealed with a seal 610. After the seal 610 is removed from the transfer module 602, the sample chamber 614 and blank chamber 616 are exposed, as shown in Figure 6D. The sample chamber 614 and blank chamber 616 typically contain a liquid medium such as a buffer solution. A sample (e.g., body fluid) may be delivered to the sample chamber 614 via a device 618 (e.g., a cotton swab), thereby introducing the sample into the liquid medium in the sample chamber. The blank chamber 616 may be covered with an occlusion component 620 to prevent the insertion of a sample into the blank chamber. Gaskets 622 and 624 may be positioned around the outside of the sample chamber 614 and blank chamber 616, respectively, to facilitate the formation of a seal between the receiver module 602 and the transfer module 604. A positioning shape 626 on the receiver module 602 is configured to mate with a corresponding positioning shape on the transfer module 604.

[0049] As shown in Figure 6E, the seal 612 can be removed from the transfer module 604. The seal 612 is removed from the transfer module 604, exposing the sample chamber and blank chamber (not shown). Retaining components (not shown) are positioned in the sample chamber and blank chamber, respectively, and may hold solid reagents in the sample chamber, the blank chamber, or both. In one example, the solid reagent contains oligomers for the RPA reaction. In some cases, the solid reagent is a lyophilized pellet. The blank chamber may be free of solid reagents. The retaining components generally define openings such as holes. In some cases, the retaining components are frit. The frit is selected to facilitate the transfer of fluid from the receiver module 602 to the transfer module 604. In one example, the retaining components are hydrophilic frit. The transfer module 602 includes a positioning shape 636 configured to fit with the positioning shape 626 of the receiver module 602.

[0050] After removing seal 612 from transfer module 604, the transfer module can be inverted so that positioning shapes 626 and 636 are aligned, as shown in Figure 6F. During this inversion, the retaining components in transfer module 604 hold the reagents present in the sample chamber and blank chamber of the transfer module. When the receptor module 602 and transfer module 604 are pressed against each other, as shown in Figure 6G, the positioning shapes 626 and 636 interlock, with gasket 622 sealing both the sample chamber of the receptor module and the transfer module, and gasket 624 sealing both the blank chamber of the receptor module and the transfer module. With transfer module 604 above receptor module 602 as shown in Figure 6G, the liquid medium in sample chamber 614 and blank chamber 616 remains in the receptor module and does not flow into the sample chamber and blank chamber of the transfer module, respectively. Positioning shapes 626 and 636 can be configured to irreversibly seal the receiver module 602 and the transport module 604, as shown in Figure 6H, so that the sample module 600 cannot be opened unintentionally.

[0051] Before binding the sample module 600 to the nucleic acid amplification device, the sample module may be inverted to induce movement of the liquid medium in the receptor module 602 toward the transfer module 604, thereby hydrating the solid reagent in the transfer module and preparing a hydrated reaction mixture. In one example, lyophilized RPA reagent in the transfer module is hydrated to produce a hydrated reaction mixture.

[0052] Figure 7 is a perspective view of the sample module 500. The transport module 500 may be packed by a seal 700 that covers a portion of the transport module configured to connect with a nucleic acid amplification device. The seal 700 may be a foil seal with an opaque surface to cover the openings of the inlets 702 and 704 and the outlets 706 and 708. The seal 700 may hold the hydration reaction mixture in the sample module 500 when inverted. In some cases, the seal 700 is removed from the sample module 500, the nucleic acid amplification device is connected with the sample device, and the sample module 500 is inverted only after it has been sealed with the nucleic acid amplification device. The inlets 702 and 704 and the outlets 706 and 708 may have tapered ends (i.e., low-profile Luer connectors) configured to be inserted into the nucleic acid amplification device. In some cases, gaskets 710, 712, 714, and 716 may be placed at the inlets 702, 704, 706, and 708, respectively, to form an airtight seal with the nucleic acid amplification device.

[0053] Figures 8A and 8B show alternative embodiments of the sample module. Figure 8A is a perspective view of the sample module 800, which includes a receiver module 802 and a transport module 804. Figure 8B is a cross-sectional perspective view of the sample module 800. As shown in Figure 8B, the receiver module 802 defines a sample chamber 806 having an opening 808. The sample chamber 806 holds a liquid medium 810, which may be a buffer solution. The receiver module 802 includes an inlet 812 and an outlet 814. The receiver module 802 also includes a positioning shape 816 configured to interlock with the positioning shape of the transport module 804.

[0054] The transfer module 804 includes a housing 818 that defines an opening 822 having an extension 820 configured to receive the sample chamber 806 of the receiver module 802. A ram 824 is located in the housing and has an extension 820 located on an arm 826 of the ram. The arm 826 is located within a spring 828, which is held in a loaded position having a locking / unlocking 830. A porous component 832 is located between the ram 824 and the opening 822. The porous component 832 contains a solid reagent (e.g., lyophilized RPA reagent). A positioning shape 834 is configured to interlock with a positioning shape 816 of the receiver module 802, and a gasket 836 forms a seal between the receiver module and the transfer module 804. As shown, the receiver module 802 is sealed within the opening 822 of the transfer module 804. The positioning shapes 816 and 834 interlock to seal the receiver module 802 and the transfer module 804 via the gasket 836. Positioning shapes 816 and 834 may be configured to irreversibly seal the receiver module 802 and the transport module 804, so that the sample module 800 cannot be opened unintentionally.

[0055] Figures 9A–9E illustrate the workflow for adding a sample to the sample module 800. In Figure 9A, the seal 900 is removed from the receptor module 802. In Figure 9B, the sample is added to the liquid medium 810 in the sample chamber 806 of the receptor module 802 through the opening 808. In Figure 9C, the transfer module 804 is advanced toward the receptor module 802, and the positioning shapes 816 and 834 are locked into place. After the receptor module 802 is sealed to the transfer module 804 via the gasket 836, a force is applied to the engagement / disengagement 830, which can release the spring-loaded ram 824 as shown in Figure 9D. When the spring-loaded ram 824 is released, the porous component 832 advances through the opening 822, and the solid reagent in the porous component is hydrated in the liquid medium 810 of the receptor module 802. Figure 9E shows a sealed sample module 800 with a stopped ram 824 in the receptor module 802, pushing the solid reagent porous component 832 into the liquid medium 810. The sealed sample module 800 can be coupled with a nucleic acid amplification device to assess the presence of target nucleic acids in a sample added to the receptor module 802.

[0056] Figure 10 shows an exploded view of a nucleic acid amplification device 1000 for optical detection. The nucleic acid amplification device 1000 is a stacked microfluidic device and includes a top layer 1002, an intermediate layer 1004, and a base layer 1006. The base layer 1006 may contain more than one component. As shown, the base layer 1006 includes two components 1008 and 1010.

[0057] The intermediate layer 1004 includes inlets 1012 and 1014 and outlets 1016 and 1018, which are connected to the outlets and inlets of the sample module, respectively. The intermediate layer 1004 typically contains reagents such as RPA reagents. As shown in Figure 10, the first reaction chamber 1020 contains a solid reagent 1022 (e.g., Mg in the form of magnesium acetate). 2+The intermediate layer 1004 contains reagent reservoirs 1024 and 1026, and solid reagents 1028 and 1030. In one example, solid reagent 1028 contains a dried (e.g., lyophilized) oligomer, and solid reagent 1030 contains Mg 2+ (For example, in the form of magnesium acetate). The second reaction chamber 1032 can also function as a detection chamber in which the target nucleic acid is detected by an analyzer via an optical signal. The second reaction chamber 1032 has an optically transparent cover, and the fluorescence signal produced when the fluorophores and quencher are separated by the exonuclease can be detected by an optical sensor of an analyzer configured to insert a nucleic acid amplification device. The positioning shape 1036 aligns the nucleic acid amplification device 1000 with the analyzer.

[0058] The intermediate layer 1004 also includes flow detection chambers 1034, each having a transparent cover through which the presence of fluid is optically monitored by the analyzer to detect the liquid flow. The analyzer, configured to receive a nucleic acid amplification device 1000, includes a light source directed to each of the configured flow detection chambers. The analyzer is configured to detect the presence of liquid in each flow detection chamber (e.g., by light scattering). Detection of liquid in the flow detection chamber can trigger various operations (e.g., starting or ending pumping), and the analyzer's controller may be configured to perform various parameters (e.g., pumping time, reaction time, mixing time, flow time) based on the detection of liquid in the flow detection chamber, and reagents are added in predetermined volumes and reacted for predetermined times.

[0059] The nucleic acid amplification device 1000 may include additional features such as pumps and microfluidic pathways not shown in Figure 10. One or more of the pumps may be peristaltic pumps or syringe pumps. The pumps may selectively drive reagents from the sample module and the first reaction chamber 1020 to the second reaction chamber 1032 based on elapsed time or fluid flow rate through a flow detection chamber detected by an optical sensor in an optical analyzer, and meter the fractions as needed.

[0060] The operation of the nucleic acid amplification device 1000 with a sample module will be described in reference to Figure 11. When the sample module is connected to the nucleic acid amplification device 1000, the outlet of the sample module is connected to the inlets 1012 and 1014 of the nucleic acid amplification device, and the inlet of the sample module is connected to the outlets 1016 and 1018 of the nucleic acid amplification device. The reagents of the sample module flow into the inlets 1012 and 1014 of the nucleic acid amplification device 1000 via the outlet of the sample module, and the fluid (e.g., gas, liquid, or both) transferred from the nucleic acid amplification module flows into the inlets of the sample module via the outlets 1016 and 1018 of the nucleic acid amplification module.

[0061] More specifically, the sample and buffer flow from the sample chamber of the receptor module through the outlet to the inlet 1012 in order to hydrate the RPA reagent (e.g., dry oligomer) in the sample chamber of the transfer module. The first pump 1040 propels this first reaction mixture through the first flow detection chamber 1042.

[0062] From the flow detection chamber, the first reaction mixture is drawn by the first pump through the mixing chamber 1044 to the second flow detection chamber 1046 and flows into the first reaction chamber 1020. The first reaction chamber 1020 contains the RPA reagent 1022 (e.g., Mg in the form of magnesium acetate). 2+) is included and connected to a heater and a mixing device. The mixing device may exist as a magnetic mixing device 1048. After sufficient mixing time, the first pump 1040 advances the product produced in the first reaction chamber 1020 to the third flow detection chamber 1050. From the third flow detection chamber 1050, air and a portion of the first RPA reaction product from the first reaction chamber flow towards the sample module via the outlet 1016.

[0063] A fraction of the product from the first reaction chamber 1020 is drawn out by the second pump 1054 from branch 1052 and flows toward the fourth flow detection chamber 1056. The third pump 1058 draws the reagent for the second RPA reaction (e.g., buffer) from the blank chamber of the transfer module via the outlet of the transfer module to the inlet 1014 of the nucleic acid amplification device 1000 and passes it through the fifth flow detection chamber 1060. The fourth flow detection chamber 1056 and the fifth flow detection chamber 1060 merge at a Y-junction 1062 and mix a selected amount of the product from the first RPA reaction with the reagent for the second RPA reaction. This mixture is pumped by the second pump 1054 and the third pump 1058 through the first series 1064 and second series 1066 of the mixing components. After passing through the mixing components 1066, the mixture is branched at junction 1068 and again at junction 1070 to produce four flows of the reaction mixture. Each liquid stream contains the reaction mixture reagent 1028 (for example, Mg in the form of magnesium acetate). 2+ The mixture flows through a first reagent reservoir 1024 having a mixing cylinder 1072 configured to mix with the reagent 1030. From the first reagent reservoir 1024, each mixture flows through a second reagent reservoir 1026 containing reagent 1030. Reagent 1030 in the second reagent reservoir 1026 may be the same or different. In one example, at least two of the reagents 1030 contain different RPA primers for a specific target of interest, such as influenza A virus and influenza B virus.

[0064] From the second reagent reservoir 1026, the third pump 1058 moves the mixture through the mixing component 1074 to the second reaction chamber 1032. Second amplification occurs in the second reaction chamber 1032. The second reaction chamber 1032 can also function as a detection chamber. In the nucleic acid amplification device 1000, the second reaction chamber 1032 has an optically transparent cover, and the fluorescence signal produced when the fluorophores and quencher are separated by the exonuclease can be optically detected in an analyzer configured to insert the nucleic acid amplification device, such as the analyzer described in relation to Figures 15-18.

[0065] Figure 12 shows an exploded view of the nucleic acid amplification device 1200 for electrochemical detection. The nucleic acid amplification device 1200 is a stacked microfluidic device and includes a sensor layer 1201, a top layer 1202, an intermediate layer 1204, and a base layer 1006. The base layer 1206 may contain more than one component. As shown, the base layer 1206 includes two components 1208 and 1210.

[0066] The intermediate layer 1204 includes inlets 1212 and 1214 and outlets 1216 and 1218, which are connected to the outlets and inlets of the sample module, respectively. The intermediate layer 1204 typically contains reagents such as RPA reagents. As shown in Figure 12, the first reaction chamber 1220 contains a solid reagent 1222 (e.g., Mg in the form of magnesium acetate). 2+ ) includes. A stirrer 1223 may be embedded in the solid reagent 1222. In one example, the stirrer is a magnetic pack. The second reaction chamber 1232 may also function as a detection chamber, having an opening 1225 in the top layer 1202 to bring the liquid in the reaction chamber into contact with the electrode on the back surface of the sensor layer 1201. The intermediate layer 1204 also includes a flow detection chamber 1234, in which the presence of fluid is electrically monitored by an electrode in the sensor layer 1201 superimposed on the opening in the top layer 1202, and the liquid flowing through the flow detection chamber comes into contact with the electrode. The positioning shape 1236 aligns the nucleic acid amplification device 1200 to the analyzer.

[0067] The nucleic acid amplification device 1200 may include additional features such as pumps and microfluidic pathways not shown in Figure 12. One or more pumps may be peristaltic pumps or syringe pumps. The pumps may selectively drive reagents from the sample module and the first reaction chamber 1220 to the second reaction chamber 1232 based on the elapsed time or fluid flow rate through a flow detection chamber detected by a sensor in an electrical analyzer, and meter the fractions as needed.

[0068] The operation of the nucleic acid amplification device 1200 with a sample module is described in relation to Figure 13, which shows a top perspective view of the intermediate layer. When the sample module is connected to the nucleic acid amplification device 1200, the outlet of the sample module is connected to the inlets 1212 and 1214 of the nucleic acid amplification device, and the inlet of the sample module is connected to the outlets 1216 and 1218 of the nucleic acid amplification device. Reagents from the sample module flow into the inlets 1212 and 1214 of the nucleic acid amplification device 1200 via the outlet of the sample module, and fluids (e.g., gas, liquid, or both) transferred from the nucleic acid amplification module flow into the inlets of the sample module via the outlets 1216 and 1218 of the nucleic acid amplification module.

[0069] More specifically, the sample and buffer flow from the sample chamber of the receptor module through the outlet to the inlet 1212 in order to hydrate the RPA reagent (e.g., dry oligomer) in the sample chamber of the transfer module. The first pump 1240 propels this first reaction mixture through the flow detection chamber 1242 to the first pump, through the mixing chamber 1244 to the second flow detection chamber 1246, and into the first reaction chamber 1220. The first reaction chamber 1220 contains the RPA reagent 1222 (e.g., Mg in the form of magnesium acetate). 2+) is included and connected to a heater and a mixing device. The mixing device may exist as a magnetic mixing device 1248. After sufficient mixing time, the first pump 1240 advances the product produced in the first reaction chamber 1220 to the third flow detection chamber 1250. From the third flow detection chamber 1250, air and a portion of the first RPA reaction product from the first reaction chamber flow towards the sample module via the outlet 1216.

[0070] A fraction of the product from the first reaction chamber 1220 is drawn out by the second pump 1254 from branch 1252 and flows toward the fourth flow detection chamber 1256. The third pump 1258 draws the reagent for the second RPA reaction (e.g., buffer) from the blank chamber of the transport module via the outlet of the transport module to the inlet 1214 of the nucleic acid amplification device 1200 and passes it through the fifth flow detection chamber 1260. The fourth flow detection chamber 1256 and the fifth flow detection chamber 1260 merge at a Y-junction 1262 and mix a selected amount of the product from the first RPA reaction with the reagent for the second RPA reaction. This mixture is pumped by the second pump 1254 and the third pump 1258 through the first series 1264 and second series 1266 of the mixing components. After passing through the mixing components 1266, the mixture is branched at junction 1268 and again at junction 1270 to produce four flows of the reaction mixture. Each liquid stream contains the reaction mixture reagent 1228 (e.g., Mg in the form of magnesium acetate). 2+ The mixture flows through a first reagent reservoir 1224 having a mixing cylinder 1272 configured to mix with the reagent 1230. From the first reagent reservoir 1224, each mixture flows through a second reagent reservoir 1226 containing reagent 1230. Reagent 1230 in the second reagent reservoir 1226 may be the same or different. In one example, at least two of the reagents 1230 contain different RPA primers for a specific target of interest, such as influenza A virus and influenza B virus.

[0071] From the second reagent reservoir 1226, the third pump 1258 moves the mixture through the mixing component 1274 to the second reaction chamber 1232. Second amplification occurs in the second reaction chamber 1232. The second reaction chamber 1232 can also function as a detection chamber. In the nucleic acid amplification device 1200, the liquid in the second reaction chamber 1232 comes into contact with the electrode on the back of the sensor layer 1201, and electrons resulting from the oxidation of the redox-active compound being cleaved from the RPA probe, which is labeled with the redox-active compound as reported in US No. 62 / 300,242, are detected by an analyzer configured to insert the nucleic acid amplification device.

[0072] Figure 14 shows a top perspective view of a nucleic acid amplification device 1200 having electrodes in a sensor layer 1201 superimposed on openings in the top layer 1202 and the intermediate layer 1204. The electrodes are located on the back side of the sensor layer 1201 and are in contact with the flow sensor detectors 1246, 1250, 1256, and 1260, as well as the liquid in the reaction chamber 1232. In one example, the sensing electrode and the conduction path electrically connecting the sensing electrode to the terminal electrically connected to the analyzer can be formed by placing a first conduction layer in the sensor layer. In another example, the first conduction layer can be placed on top of a second conduction layer in the sensor layer. The electrodes can be electrically isolated by masking the conduction layer and placing a dielectric layer in the exposed area. In one example, the first conductive material contains carbon. In another example, the second conductive material contains silver. As used herein, “place” includes printing methods such as screen printing. When the silver layer is placed beneath the carbon layer, the resulting conduction path generally has lower resistance than a conduction path formed using carbon alone. In both examples, electrochemical measurements are performed on the carbon surface.

[0073] Flow sensor detectors 1246 and 1250 are each electrically connected to two liquid sensing electrodes. In flow sensor detector 1246, liquid sensing electrodes 1400 and 1402 are electrically connected to wirings 1404 and 1406, and electrically connected to connectors 1408 and 1410, respectively. Flow sensor detectors 1256 and 1260 are each electrically connected to four liquid sensing electrodes. In flow sensor detector 1260, liquid sensing electrodes 1412 and 1414 are electrically connected to wirings 1420 and 1422, and electrically connected to connectors 1428 and 1430, respectively, while electrodes 1416 and 1418 are electrically connected to wirings 1424 and 1426, and electrically connected to connectors 1432 and 1434, respectively. Each detection chamber 1232 is connected to three measuring electrodes, including a reference electrode 1436, a working electrode 1438, and a counter electrode 1440, each electrode being electrically connected to a connector via wiring. The wiring may be a conductive path containing a conductive material (e.g., silver). The connection is configured to engage with the terminal in the analytical instrument.

[0074] Liquid sensing electrodes operate on the principle of conductivity. That is, when a voltage is applied through the terminals and the fluid comes into contact with the sensing electrodes in each chamber, a current flows through the liquid, and the analyzer detects the current. For measuring electrodes, a potential is applied between the counter electrode and the working electrode, and a reference electrode acts to ensure that the applied potential is as expected. When operated in current measurement mode, the current flows in proportion to the concentration of electroactive species in contact with the working electrode (electrons are effectively accepted or donated depending on whether oxidation or reduction of the target species occurs at a specific potential). In differential pulse voltameometry mode, the potential is varied from one voltage to another, and the resulting recorded currents result in rises to peaks and / or troughs as a result of oxidation or reduction of electroactive species.

[0075] Figure 15 shows a nucleic acid amplification system 1500, which includes a nucleic acid amplification device 1502 inserted into an analyzer 1504. The nucleic acid amplification device 1502 and the analyzer may be configured for optical or electrochemical detection of RPA products. In some cases, insertion of the nucleic acid amplification device into the analyzer initiates the assessment of the presence of the target nucleic acid in the sample added to the nucleic acid amplification device. In other examples, subsequent connection of a sample module to the nucleic acid amplification device initiates the assessment of the presence of the target nucleic acid in the sample. In yet another example, the assessment of the presence of the target nucleic acid in the sample added to the nucleic acid amplification device is initiated by the user after insertion of the nucleic acid amplification device or assembly into the analyzer.

[0076] As shown in Figure 16, the nucleic acid amplification device 1502 and the analyzer 1504 are configured for the optical detection of RPA products. In particular, the analyzer 1504 is configured to detect fluorescence from a fluorescent probe bound to the RPA product in the detection chamber of the nucleic acid amplification device 1502. The analyzer 1504 includes a light source, an excitation light guide 1600 corresponding to each light source, an emission light guide corresponding to each emission light guide 1602, and a photodetector. The light source is typically a photo-emitting diode (LED) and is selected to achieve good compatibility between the LED emission peak and the absorption of the target fluorescent label. The analyzer 1504 incorporates a sloping geometry to enable fluorescence measurements from multiple reaction cells using a single light source emission filter.

[0077] Figure 17 shows an enlarged view of a portion of Figure 16. As shown in Figure 17, the analyzer 1504 includes four light sources, enabling fluorescence measurements from four detection chambers 1700 in the nucleic acid amplification device 1502. An excitation light guide 1600 directs light from the light source to the detection chamber 1700, and an emission light guide 1602 directs fluorescence emission from the detection chamber through an optical filter to a common photodiode. The four measurement channels are distinguished by time-division multiplexing of the four light sources. Each excitation light guide 1600 is configured to direct incident light from one of the light sources to a target in a plane, with the angle between the incident light and the plane being between 30° and 60° (e.g., 40°), and each emission light guide 1602 is configured to direct emitted light from the target to the photodetector, with the angle between the emitted lights being between 40° and 60° (e.g., 30°). The analyzer 1504 generally includes a first lens and a second lens corresponding to each light source, and each has a corresponding excitation light guide configured to adjust the light sent from the corresponding light source through the first lens and direct the adjusted light at an angle to the second lens via total internal reflection.

[0078] Figures 18A-18C show the inclined shape of the analyzer 1504. The angles shown in Figures 18A-18C are illustrative and selected for ease of explanation; however, these angles may be modified in embodiments of the analyzer 1500. As shown in Figure 18A, the axis of rotation is oriented at 45° with respect to the line connecting to the center of the reaction chamber 1700. This configuration facilitates avoiding positional collisions between the excitation light guide and the emission light guide. Figure 18B shows the optical excitation axis at 30° relative to the detection chamber surface reference (rotated in the x-plane around the y-axis). Figure 18C shows the optical emission axis at 40° relative to the detection chamber surface reference (rotated in the yz-plane around the orthogonal axis of rotation, i.e., around the x-axis). The center of rotation is below the reference liquid surface position (e.g., 0.1-1 mm below). Other combinations of inclination angles are shown in Table 1 below. The maximum bending angle in the excitation light guide and emission light guide is generally 45° or less. [Table 1]

[0079] The analyzer 1504 includes a controller that is operationally coupled to a light source and a photodetector. The controller initiates the generation of incident light by the light source and begins collecting the light emitted from the detection chamber. The analyzer 1504 generally includes a single photodetector and a single emission filter operationally positioned between the emission light guide and the photodetector, but in some embodiments, one or more additional photodetectors, emission filters, or both may be present.

[0080] While the devices and methods described herein are described as applications of recombinase polymerase amplification (RPA) technology, other isothermal techniques for amplifying and detecting target nucleic acids can also be performed with the devices described herein, such as nicking and extension amplification (NEAR) technology. The RPA amplification and detection methods for RPA amplification products described herein are reported in detail in U.S. Patents 7,399,590, 8,580,507, 7,270,981, 7,399,590, 7,666,598, 7,435,561, 9,469,867, 9,057,097, 8,071,308, 8,637,253, and 8,062,850. The NEAR method is reported in U.S. Patent Application Publications 2009 / 0081670 and 2009 / 0017453. Each of the aforementioned references is incorporated by reference in its entirety herein and is considered to be part of this disclosure.

[0081] As described herein, RPA uses enzymes known as recombinases that can pair oligonucleotide primers with homologous sequences in a template double-stranded nucleic acid. RPA introduces a recombinase for inserting two primers into the double-stranded DNA along with the template, a single-stranded DNA-binding protein to stabilize the substituted strand of DNA and prevent primer substitution, and a strand-displacement polymerase to extend the primers bound to the template DNA. In this method, DNA synthesis is directed to a predetermined site in the template double-stranded nucleic acid. Using two or more sequence-specific (e.g., gene-specific) primers, an exponential amplification reaction is initiated when a template nucleic acid is present. The reaction proceeds rapidly, resulting in specific amplification of sequences present in the template double-stranded nucleic acid, from just a few copies of the template nucleic acid to a detectable amount of amplification product within minutes. The RPA process proceeds under isothermal conditions at physiological temperatures (e.g., 37–42°C). The RPA method is disclosed, for example, in US7,270,981, US7,399,590, US7,666,598, US7,435,561, US2009 / 0029421, and WO2010 / 141940, all of which are incorporated herein by reference.

[0082] RPA incorporates components of cellular DNA replication and repair mechanisms, establishing a “dynamic” recombination environment with sufficient speed for both loading and unloading recombinases, maintaining high levels of recombination activity achieved in the presence of specific packing agents. RPA combines sensitivity, specificity, and almost all other features of PCR, but without the need for thermocycling, offering remarkable speed and robustness to temperature unset. RPA has advantages due to the possibility of using a wide variety of nucleic acid processing enzymes, such as known repair endonucleases not used by other processes due to the need for heat-resistant equivalents, inadequate regulation without accessory proteins like single-strand DNA binding proteins, or at least a partial need for a combination of these.

[0083] In short, RPA involves the following steps: First, a recombinase agent is brought into contact with the first and second nucleic acid primers to form the first and second nuclear protein primers. Second, the first and second nuclear protein primers are brought into contact with a double-stranded target sequence to form a first double-stranded structure on the first portion of the first strand and a double-stranded structure on the second portion of the second strand, and the 3' ends of the first and second nucleic acid primers are brought into contact with each other using a predetermined template DNA molecule. Third, the 3' ends of the first and second nuclear protein primers are extended by DNA polymerase to produce the first and second double-stranded nucleic acids, as well as the first and second substitution strands of the nucleic acids. Steps two and three are repeated until the desired amplification is reached.

[0084] This disclosure also provides a method for implementing nested RPA within a microfluidic cartridge or device. In nested RPA, a first region of nucleic acid is amplified by the RPA to form a first amplified region. Then, a second region of nucleic acid, which is entirely within the first amplified region, is amplified using the RPA to form a second amplified region. This process can be repeated multiple times. For example, a third region of nucleic acid, which is entirely within the second region, can be amplified by the RPA from the second amplified region.

[0085] The RPA reagents disclosed herein may include a set of primers that amplify a target nucleic acid sequence. The primers may be complementary to the target nucleic acid sequence or may contain nucleic acids that differ from the target nucleic acid sequence at one or more positions. As described herein, the amplification product of RPA with primers that differ from the target nucleic acid sequence at one or more positions may differ from the target sequence at one or more positions. The amplification product of the RPA reaction described herein may contain a target cleavage sequence.

[0086] RPA primer sets can amplify a target nucleic acid sequence or introduce sequences that differ from the target nucleic acid sequence at one or more positions. These introduced sequences may consist of target cleavage sequences. The first primer may be complementary to the target nucleic acid sequence. The second primer may contain a first portion complementary to the target nucleic acid sequence and a second portion that differs from the target nucleic acid sequence at one or more positions. When the two primers amplify the nucleic acid sequence, the second primer incorporates one or more different positions into the amplification product. This amplified region differs from the target nucleic acid sequence at one or more positions and may consist of target cleavage sequences.

[0087] The RPA compositions disclosed herein comprise recombinases and may be derived from prokaryotes, viruses, or eukaryotes. Exemplary recombinases include RecA and UvsX (e.g., RecA or UvsX proteins obtained from either species), and their fragments or variants, as well as combinations thereof. RecA and UvsX proteins can be obtained from either species. RecA and UvsX fragments or variant proteins can also be produced using available RecA and UvsS proteins and nucleic acid sequences, as well as molecular biology techniques (e.g., see the variant of UvsX described in U.S. Patent No. 8,071,308). Exemplary UVsX proteins include those derived from the Myoviridae family, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, Cyanophage P-SSM2, Cyanophage PSSM4, Cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibriophage nt-1, phi-1, Rb16, Rb43, Phage 31, Phage 44RR2.8t, Rb49, Phage Rb3, and Phage LZ2. Additional exemplary recombinase proteins include the archaeal RADA and RADB proteins, as well as the eukaryotic (e.g., plant, mammalian, and fungal) Rad51 proteins (e.g., RAD51, RAD51B, RAD51C, RAD51D, DMC1, XRCC2, XRCC3, and recA) (see, for example, Lin et al., Proc. Natl. Acad. Sci. USA 103:10328-10333, 2006).

[0088] In any of the processes of this disclosure, the recombinase (e.g., UvsX) may be a mutant or hybrid recombinase. In some embodiments, the mutant UvsX is Rb69 UvsX having at least one mutation in the Rb69 UvsX amino acid sequence, where the mutation is selected from the group consisting of a non-histidine amino acid at position 64, serine at position 64, addition of one or more glutamic acid residues at the C-terminus, addition of one or more aspartic acid residues at the C-terminus, and combinations thereof. In other embodiments, the mutant UvsX is T6 UvsX having at least one mutation in the T6 UvsX amino acid sequence, where the mutation is selected from the group consisting of (a) a non-histidine amino acid at position 66, (b) serine at position 66, (c) addition of one or more glutamic acid residues at the C-terminus, (d) addition of one or more aspartic acid residues at the C-terminus, and (e) combinations thereof. When a hybrid recombinase protein is used, the hybrid protein may be, for example, a UvsX protein containing at least one region with an amine acid sequence derived from a different UvsX species. The region may be, for example, the DNA-binding loop-2 region of UvsX.

[0089] The DNA polymerases disclosed herein may be eukaryotic or prokaryotic polymerases. Examples of eukaryotic polymerases include pol-alpha, pol-beta, pol-delta, pol-epsilon, and their variants or fragments, or combinations thereof. Examples of prokaryotic polymerases include Escherichia coli DNA polymerase I (e.g., Klenow fragment), bacteriophage T4 gp43 DNA polymerase, Bacillus stearothermophilus polymerase I large fragment, Phi-29 DNA polymerase, T7 DNA polymerase, Bacillus subtilis Pol I, Staphylococcus aureus Pol I, Escherichia coli DNA polymerase I, Escherichia coli DNA polymerase II, Escherichia coli polymerase III, Escherichia coli DNA polymerase IV, Escherichia coli DNA polymerase V, and their variants or fragments, or combinations thereof. In some embodiments, the DNA polymerase lacks 3'-5' exonuclease activity. In some embodiments, the DNA polymerase has strand substitution properties, for example, a large fragment of a prokaryotic polymerase of class pol I or pol V.

[0090] Furthermore, one or more single-stranded DNA-binding proteins can be used to stabilize nucleic acids during various exchange reactions that proceed during the reaction. One or more single-stranded DNA-binding proteins can be derived from or obtained from any species, e.g., prokaryotes, viruses, or eukaryotic species. Non-limiting examples of single-stranded DNA-binding proteins include those derived from Escherichia coli SSB and myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, vibriophage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. Examples of additional single-stranded DNA-binding proteins include A. dennitrificans Alide_2047, Burkholderia tyrandensis BthaB_33951, Prevotella parens HMPREF9144_0124, and eukaryotic single-stranded DNA-binding protein replication protein A.

[0091] Any of the RPA processes of this disclosure may be carried out in the presence of a condenser. In some embodiments, the condenser may comprise one or more of polyethylene glycol, polyethylene oxide, polyvinyl alcohol, polystyrene, Ficol, dextran, poly(vinylpyrrolidone) (PVP), Triton-X, and albumin. In some embodiments, the condenser has a molecular weight of less than 200,000 daltons. In some embodiments of any of the embodiments described herein, the composition comprises a condenser selected from the group consisting of polyethylene glycol (PEG) (e.g., PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compounds having molecular weights between 15,000 and 20,000 daltons, or combinations thereof), dextran, polyvinyl alcohol, polyvinylpyrrolidone, Triton-X, and Ficol. In some embodiments, the condensing agent is present in the reaction mixture at a concentration of 1 to 15% by weight or volume of the reaction mixture, for example, between any two concentration values ​​selected from 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, 6.0%, 6.5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11.0%, 11.5%, 12.0%, 12.5%, 13.0%, 13.5%, 14.0%, 14.5%, and 15.0%.

[0092] When recombinase-containing proteins are used, they may be of prokaryotic, viral, or eukaryotic origin. Exemplary recombinase-containing proteins include E. coli RecO, E. coli RecR, UvsY, and their variants or fragments, or combinations thereof. Exemplary UvsY proteins include those derived from myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, vibriophage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. In any of the processes of this disclosure, the recombinase-containing agent may be derived from a myovirid phage. Myovirid phages may be, for example, T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, vibriophage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, or phage LZ2.

[0093] Amplification methods suitable for use in the methods of the present invention include amplification methods carried out without exposing the polynucleotide to a temperature sufficient to denature the double-stranded polynucleotide during amplification. For example, amplification of polynucleotides may be carried out without exposing the polynucleotide to a temperature exceeding about 90°C, about 80°C, about 70°C, or about 60°C during amplification. In embodiments, amplification of polynucleotides is carried out without exposing the polynucleotide to conditions sufficient to denature the double-stranded polynucleotide during amplification. For example, amplification may be carried out without exposing the polynucleotide to physical, chemical, or thermal conditions sufficient to denature the double-stranded polynucleotide during amplification.

[0094] Amplification methods suitable for use in the methods of the present invention include amplification methods that are carried out without first exposing the polynucleotide to a temperature sufficient to denature the double-stranded polynucleotide present in the sample. For example, amplification of the polynucleotide can be carried out without first exposing the polynucleotide to a temperature of about 90 °C, about 80 °C, about 70 °C, about 60 °C, or above about 55 °C. In some embodiments, the polynucleotide and / or the amplicon is detected at such elevated temperatures without first exposing the polynucleotide thereto. In some embodiments, amplification of the polynucleotide is carried out without first exposing the polynucleotide to conditions sufficient to denature the double-stranded polynucleotide present in the sample. For example, amplification can be carried out without first exposing the polynucleotide to physical, chemical, or temperature conditions sufficient to denature the double-stranded polynucleotide present in the sample.

[0095] Amplification methods suitable for use in the methods of the present invention include amplification methods that begin with the step of mixing the polynucleotide with reagents sufficient to effect amplification and that are carried out for a total time (T) that ends when amplification has proceeded to an amount sufficient to permit qualitative or quantitative measurement of the polynucleotide or the amplicon. In any of such embodiments, the total time T can be within about 45 minutes, within about 30 minutes, within about 20 minutes, or within about 15 minutes.

[0096] Amplification of the polynucleotide includes, for example, amplifying the polynucleotide at least about 10 6 -fold, at least about 10 7 -fold, at least about 10 8 -fold, at least about 10 9 -fold, at least about 10 10 -fold, at least about 10 11 -fold, or at least about 10 12 -fold. Such amplification can be carried out within the time T.

[0097] Amplification methods suitable for use in the methods of the present invention include “real-time” or “quantitative” polynucleotide amplification methods known to those skilled in the art. Such methods can measure amplification dynamics by detecting the accumulation of polynucleotide amplification products after each amplification cycle in real time as the reaction proceeds. Real-time methods are quantitative because the time (e.g., number of cycles) to reach a specific threshold concentration of the product being amplified is directly related to the first copy number of the target polynucleotide. According to some embodiments, the amplification reaction is monitored by electrochemical detection using oligonucleotide probes described herein.

[0098] example Example 1: Nested RPA amplification Figures 19A–19D show the analytical results obtained using the method for performing nested RPA with a microfluidic card as described herein. The results demonstrate the ability of the nested RPA assay to distinguish between samples with different known targets. Samples were obtained from suppliers of influenza-positive and influenza-negative sample materials. A series of measurements were performed on a total of 90 samples, of which 30 were found to be positive for influenza A (InfA), 10 were found to be positive for influenza B (InfB), and 50 were found to be negative (not containing influenza A or B). Each sample was added to a single assay device, and measurements were obtained from each of the four detection chambers of the assay card.

[0099] In each experiment shown in Figures 19A–19D, the detection of the reaction product was performed using a fluorescently labeled probe. Detection of the RPA reagent by labeled probes, as previously described, generally involves at least one probe with a detectable label for detecting the target to be amplified, if a target is present. The probe may contain fluorescence and a quencher, and if an amplified reaction product is present, it is separated by nuclease cleavage when the probe hybridizes with a complementary polynucleotide sequence. Similar results (not shown) were obtained in 90 samples regarding the identification of whether a sample was influenza A positive, influenza B positive, or a negative control when the sample was tested with an electrochemically labeled probe.

[0100] Tables 2A-2D show the combined results of both fluorescence and electrochemical probe measurements. Each table includes comparative measurements performed using standard commercially available qPCR assays conducted by the influenza sample material suppliers. qPCR was performed by the sample material suppliers upon sample acquisition, and the results were used to classify the samples as positive or negative, and similarly as fluA or fluB. The classified samples were properly stored and supplied in viral transport medium (VTM). There was no apparent effect of VTM on the implementation of RPA. [Table 2] [Table 3] [Table 4] [Table 5]

[0101] The nucleic acid sequence of influenza A is known to change frequently from year to year, so the RPA assay was developed to incorporate two different primer and probe sets that are directed to different nucleotide regions to maximize the likelihood of a sample positively identifying influenza A.

[0102] The primers and assays used in the RPA assays described herein are shown below as SEQ ID NO. 1-21. During the first round of nested amplification, the first primer sequence was used to contact the entire sample in the first reaction chamber to perform the first amplification. The first amplification product was then used to contact the second primer and probe in a separate second reaction chamber to specifically amplify each target species using InfA PA, InfA PB2, InfB PA, and IC to produce a signal if FluA or fluB was present in the patient sample. When probes were used for fluorescence measurements, they were designed to be cleaved by nuclease exonuclease III (Exo), while probes used electrochemically were designed to be used with nuclease 8-oxoguanine DNA glycosylase (fpg). Examples of suitable electrochemical probes are described in concurrently pending application PCT / US2017 / 019446, filed on 24 February 2017, which is incorporated herein by reference in its entirety. InfA[PA] First Amplification Primer >FluAPAR111 TGCATGTGTGAGGAAGGAGTTGAACCAAG*A (SEQ ID NO.1) >FluAPAF523 AAATTGCTTCTCATTGTTCAGGCACTTAGGG*A(SEQ ID NO.2) InfA[PB2] First Amplification Primer >FluAPB2F201 GAACTGAGTAACCTTGCAAARGGGGAAAAGG*C (SEQ ID NO.3) >FluAPB2F218 GAACTGAGTAACCTTGCAAAAGGGGAAAAAG*C(SEQ ID NO.4) >FluAPB2R103 AYTAATTGATGGCCATCCGAATTCTTTTGGTCGCT*G (SEQ ID NO.5) InfB[PA] First Amplification Primer >FluBPAF44 AAGGATTGGCTGATGATTACTTTTGGAAAAAGAAA*G(SEQ ID NO.6) >FluBPAR42 TAATTCAGCCTGAAGTTCTGTGAGTCTGCTTAG*C (SEQ ID NO.7) Xcon first amplification primer >XConF7 AATCATGAACCTCATGGCATCTTCCCTCGCCGC*C(SEQ ID NO.8) >XConR6 ACAATGCAATCATATGCTTCTGCTATGTTAAGC*G(SEQ ID NO.9) InfA[PA] Second Amplification Primer >FLUPAF507ii AACCTGGGACCTTTTGATCTTGGGGGCTATAT*G(SEQ ID NO.10) >FLUAPAR106ii ATGTGTTAGGAAGGAGTTGAACCAAGAAGCAT*T(SEQ ID NO.11) InfA[PA]Exoprobe >FluAPAExoP12dFAM F=dT-FAM, H=THF (debase site mimetic), Q=dT-BHQ-1, 3'=block C3 spacer GAACCAAGATGCATTRAGCAAAACCCAGGGAFHAQTAATCAGGCACTC(SEQ ID NO.12) InfA[PB2] Second Amplification Primer >FluAPB2F403 AATGTGCTAATYGGGCAAGGAGACGTGGTGTTG*G(SEQ ID NO.13) >FluAPB2R703 GGCCATCCGAATTCTTTTGGTCGCTGTCTGG*C(SEQ ID NO.14) InfA[PB2]Exo Probe >FluAPB2ExoP2 F=dT-FAM, H=THF (debase site mimetic), Q=dT-BHQ-1, 3'=block C3 spacer CGAATTCTTTTGGTCGCTGTCTGGCTGTCAGTAAGFHQGCTAGAGTCCCG(SEQ ID NO.15) InfB[PA] Second Amplification Primer >MSFBPA_F6+1-2 GGAAAAAGAAAGAAAAGCTGGGAAATAGCATG*G(SEQ ID NO.16) >MSFBPA_R6+1 GCTTAGCACTCTCCCTTTCCCTTCCTCATCCAAT*G(SEQ ID NO.17) InfB[PA]Exo Probe >MSFBPAx1 F=dT-FAM, H=THF (debase site mimetic), Q=dT-BHQ-1, 3'=block C3 spacer ACTGATGATATTCAGCTACAATCAAGACFAHQCGTTAAGTAATGAA(SEQ ID NO.18) Xcon Second Amplification Primer >XConR13 TTCCAGTCAGTCCTAGTCAGAAACGGTCCTTAGAC*G (SEQ ID NO.19) >APOBEXTF GCCAGGTTTATAGCACACTTGTCACCTA*C(SEQ ID NO.20) Xcon ExoProbe >APOB1FAM F=dT-FAM, H=THF (debase site mimetic), Q=dT-BHQ-1, 3'=block C3 spacer GCCAGGTTTATAGCACACTTGTCACCTACAQTHCFGATTGGTGGACTCT(SEQ ID NO.21)

[0103] Figure 19A shows the results obtained when 90 samples were exposed to InfA PA RPA primers and probes. The results show that the InfA PA primers detected 24 out of 30 InfA-positive samples, while InfB or negative samples did not show a reaction with the InfA PA primers. Figure 19B shows that all InfA samples showed a positive reaction when exposed to InfA PB2 primers and probes, while InfB and negative samples showed no reaction with either the InfA PB2 primers or probes. Figure 19C shows that all InfB samples showed a positive reaction when exposed to InfB PA primers and probes, while neither InfA nor negative control samples showed a reaction. Figure 19D shows that no samples showed a positive signal when the negative control primer (Xcon) and probe were used.

[0104] In each of Figures 19A–19D, the dashed line represents the baseline threshold, determined to be 3 standard deviations higher than the maximum negative result. The data demonstrate the ability of the assay scheme described herein to successfully measure the presence of influenza A-positive samples, with the use of a combination of RPA primers and probes for the InfA PA and InfA PB2 regions resulting in 100% identification of the samples.

[0105] Other Embodiments Many embodiments of the present invention have been described. However, it will be understood that various modifications can be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the claims set forth below.

Claims

1. (i) A first reaction chamber fluidly connected to a first inlet and a first outlet, the first reaction chamber configured to perform first nucleic acid amplification on the sample fluid in the first reaction chamber to produce a first amplification product, and (ii) One or more second reaction chambers fluidly connected to the second inlet and second outlet, wherein each second reaction chamber is configured to perform second nucleic acid amplification on the first amplification product to produce a second amplification product. A card body including, where the first nucleic acid amplification and / or second nucleic acid amplification includes a recombinase polymerase amplification (RPA) reaction. A passage for supplying the sample fluid to the first reaction chamber, One or more detection chambers are fluidly connected to the one or more second reaction chambers and detect the liquid flow, and A detection module that detects liquid flow is connected to each detection chamber that detects liquid flow. A diagnostic device including, The first inlet is fluidly connected to the first reaction chamber via a first pump configured to supply the sample delivered to the diagnostic device through the first inlet to the first reaction chamber. The first reaction chamber is fluidly connected to the second reaction chamber via a second pump. The second inlet is fluidly connected to the second reaction chamber via a third pump. Diagnostic apparatus, wherein the second pump and the third pump are configured to mix a reagent delivered to the apparatus via the second inlet with the product from the first reaction chamber to produce a reaction mixture, and to supply a portion of the reaction mixture to each of the second reaction chambers.

2. The diagnostic apparatus according to claim 1, wherein the detection module is an optical module.

3. The diagnostic apparatus according to claim 1, wherein the detection module is a fluorescence detector.

4. The diagnostic apparatus according to claim 3, wherein the fluorescence detector includes a single optical pipe for directing illumination light to one or more detection chambers, and individual optical pipes for receiving light reflected from each detection chamber.

5. The diagnostic device according to claim 1, wherein the detection module is an electrode module.

6. The diagnostic apparatus according to claim 5, wherein the detection module includes a series of wires connecting electrodes for each detection chamber to a coupling that engages with a terminal in the analyzer.

7. The diagnostic device according to claim 5, wherein the electrode module includes additional wiring and electrodes to detect the position of the liquid throughout the entire microfluidic device.

8. The diagnostic apparatus according to claim 1, further comprising a mixing means.

9. The diagnostic apparatus according to claim 1, wherein the first reaction chamber is coupled with a heater.

10. The diagnostic apparatus according to claim 1, wherein the first reaction chamber includes a mixing means or is coupled with a mixing means.

11. The diagnostic apparatus according to claim 1, wherein each second reaction chamber contains a reagent.

12. The diagnostic apparatus according to claim 11, wherein the reagent includes an RPA reagent.

13. The diagnostic apparatus according to claim 12, wherein the RPA reagent is freeze-dried.

14. The diagnostic apparatus according to claim 1, wherein the first reaction chamber contains a reagent.

15. The diagnostic device according to claim 14, wherein the reagent includes an RPA reagent.

16. The diagnostic apparatus according to claim 15, wherein the RPA reagent is freeze-dried.

17. The diagnostic apparatus according to claim 1, wherein the sample fluid is a sample obtained from an animal.

18. The diagnostic device according to claim 17, wherein the sample obtained from the animal is obtained from the animal's blood, sputum, mucus, saliva, tears, or urine.

19. The diagnostic apparatus according to claim 17, wherein the sample fluid is a sample obtained from a human.

20. The diagnostic apparatus according to claim 1, wherein the sample fluid contains a target nucleic acid.

21. The diagnostic device according to claim 20, wherein the target nucleic acid is obtained from an animal pathogen.

22. The diagnostic device according to claim 21, wherein the animal pathogen is a single-stranded DNA virus, a double-stranded DNA virus, or a single-stranded RNA virus.

23. The diagnostic device according to claim 21, wherein the animal pathogen is a bacterium.

24. The diagnostic device according to claim 20, wherein the target nucleic acid is double-stranded DNA, single-stranded DNA, or RNA.

25. The diagnostic device according to claim 20, wherein the target nucleic acid is selected from the group consisting of genomic DNA, plasmid DNA, viral DNA, mitochondrial DNA, cDNA, synthetic double-stranded DNA, and synthetic single-stranded DNA.

26. The diagnostic device according to claim 20, wherein the target nucleic acid is viral DNA or viral RNA.

27. The diagnostic device according to claim 21, wherein the animal pathogen is influenza A virus or influenza B virus.

28. The diagnostic apparatus according to claim 1, wherein the second amplification product is produced within 30 minutes, 15 minutes, 10 minutes, or 5 minutes after the sample fluid is delivered to the diagnostic apparatus.

29. The diagnostic device according to claim 1, wherein the diagnostic device is disposable.

30. The diagnostic apparatus according to claim 1, further comprising additional reaction chambers, each of which carries out an additional round of nucleic acid amplification to produce additional amplification products, wherein the amplification products obtained from each consecutive n+1 rounds of amplification are smaller sequences that are completely contained within the amplification product of the previous nth round.

Citation Information

Patent Citations

  • human 5-ht7 receptor promoter sequence

    JP2005535300A

  • Systems and methods for heating, cooling and thermal cycling on microfluidic devices

    JP2006527369A

  • Recombinase polymerase amplification

    JP2008188020A

  • All-in-one nucleic acid assay

    JP2009529883A

  • Filamentous fungi with reduced ptrB activity for modified protein production

    JP2012509082A