Thionizing solution

JPWO2024024873A5Pending Publication Date: 2026-06-24
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Filing Date
2023-07-27
Publication Date
2026-06-24

Smart Images

  • Figure 2024024873000001
    Figure 2024024873000001
  • Figure 2024024873000002
    Figure 2024024873000002
  • Figure 2024024873000003
    Figure 2024024873000003
Patent Text Reader

Abstract

The present invention provides a thionizing solution having high stability that contains a compound represented by formula (3) as a thionizing agent and a method for producing a nucleic acid molecule by the amidite method using the thionizing solution. The present invention also provides a composition containing an aromatic heterocyclic compound represented by formula (1) [in the formula, X1 to X5 each independently are the same or different and represent a hydrogen atom, etc.], an aromatic hydrocarbon compound represented by formula (2) (in the formula, Y1 to Y6 each independently are the same or different and represent a hydrogen atom, a C1-C5 alkyl group, or a halogen atom.), and a thionizing agent represented by formula (3).
Need to check novelty before this filing date? Find Prior Art

Description

Thiotropic Solution

[0001] This patent application claims priority under the Paris Convention to and the benefit of Japanese Patent Application No. 2022-120815 (filed July 28, 2022), the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to a highly stable thiolated solution and a method for producing a nucleic acid molecule by the amidite method using the thiolated solution.

[0003] In recent years, there has been growing interest in the application of nucleic acid molecules in the medical field, including, for example, antisense nucleic acids, aptamers, ribozymes, siRNAs, and nucleic acids that induce genome editing, such as gRNAs.

[0004] Nucleic acid molecules can be synthesized by solid-phase synthesis, which uses nucleoside phosphoramidites (hereinafter also referred to as "amidites") as raw materials. In the solid-phase synthesis of nucleic acid molecules using amidites, it is known that the phosphite triester produced by the coupling reaction is converted into a phosphodiester bond or a phosphorothioate bond using an oxidizing solution or a thiolating solution. Examples of thionating agents commonly used in the thionating solution include phenylacetyl disulfide (PADS), 3-amino-1,2,4-dithiazole-5-thione (ADTT), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), and [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DTD) (Non-Patent Document 1). As mentioned above, the thionating agent is usually used in the reaction in a solution state. However, among the thionating agents, those represented by the formula (3) ADTT, a thiolation agent represented by the formula (I), is not very stable in solution (composition). Therefore, a stable thiolation solution containing ADTT has been desired.

[0005] Current protocols in nuclear acid chemistry 46.1 (2011) 4.1

[0006] An object of the present invention is to provide a highly stable thiolation solution containing a compound represented by formula (3) (i.e., ADTT) as a thiolation agent, and a method for producing a nucleic acid molecule by the amidite method using the thiolation solution.

[0007] As a result of extensive research aimed at achieving the above-mentioned object, the present inventors have discovered that a thiolated solution containing a compound represented by formula (3), an aromatic heterocyclic compound, and an aromatic hydrocarbon compound has high stability. The present invention provides a highly stable thiolated solution characterized by containing a compound represented by formula (3), an aromatic heterocyclic compound, and an aromatic hydrocarbon compound. The present invention also provides an efficient method for producing nucleic acid molecules using the thiolated solution.

[0008] The present invention includes, but is not limited to, the following embodiments: 1. Formula (1): [In the formula, X 1 ~X 5 and each independently represent a hydrogen atom or a C1 to C5 alkyl group, which may be the same or different.], an aromatic heterocyclic compound represented by formula (2): [In the formula, Y 1 ~Y 6 and each independently represent a hydrogen atom, a C1 to C5 alkyl group, or a halogen atom, which may be the same or different.] and an aromatic hydrocarbon compound represented by formula (3): A composition comprising a thionating agent represented by the formula: 2. The composition according to [1], wherein the aromatic heterocyclic compound is pyridine, 2-methylpyridine, 3-methylpyridine, 4-methylpyridine, 2,6-lutidine, 3,4-lutidine, 3,5-lutidine, 2,3-lutidine, 2,4-lutidine, or 2,5-lutidine. 3. The composition according to [1], wherein the aromatic heterocyclic compound is pyridine or 2,6-lutidine. 4. The composition according to any one of [1] to [3], wherein the aromatic hydrocarbon compound is benzene, toluene, o-xylene, m-xylene, p-xylene, chlorobenzene, o-dichlorobenzene, m-dichlorobenzene, or p-dichlorobenzene. 5. The composition according to any one of [1] to [4], wherein the aromatic hydrocarbon compound is toluene, o-xylene, or o-dichlorobenzene. 6.

[0023] The composition according to any one of [1] to [5], wherein the aromatic heterocyclic compound is pyridine. 7. The composition according to any one of [1] to [6], wherein the aromatic hydrocarbon compound is toluene. 8. The composition according to any one of [1] to [7], wherein the volume ratio of the aromatic heterocyclic compound to the aromatic hydrocarbon compound is 1:99 to 99:1. 9. The composition according to any one of [1] to [7], wherein the volume ratio of the aromatic heterocyclic compound to the aromatic hydrocarbon compound is 1:4 to 4:1. 10. The composition according to any one of [1] to [7], wherein the volume ratio of the aromatic heterocyclic compound to the aromatic hydrocarbon compound is 2:1 to 1:2. 11. The composition according to any one of [1] to

[10] , wherein the concentration of the thionating agent represented by formula (3) in the composition is 0.001 to 0.3 M. 12. 13. A method for producing a nucleic acid molecule by the amidite method, comprising converting a phosphite triester bond into a thiophosphoric acid triester bond using the composition according to any one of [1] to

[11] . [In the formula, G 1 and G 2 are each independently the same or different and represent a hydroxyl-protecting group; arepresents a nucleobase which may be protected by a protecting group, R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, an OQ' group, or an NQ' group, Q' represents an alkylene group or a carbonyl group bonded to the 4'-position carbon atom of ribose, and the bond marked with * indicates the bonding position to the 3'-terminal nucleotide unit. ], by contacting the composition according to any one of [1] to

[12] with a precursor having a phosphite triester bond represented by formula (5): 14. A method for producing a nucleic acid molecule, comprising a step of converting a precursor having a thiophosphate triester bond represented by formula (6): [In the formula, G 1 represents a protecting group for a hydroxyl group, 2 are each independently the same or different and represent a hydroxyl-protecting group; a are each independently the same or different and represent a nucleobase which may be protected with a protecting group, R are each independently the same or different and represent a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, OQ' group, or NQ' group, Q' are each independently the same or different and represent an alkylene group or carbonyl group bonded to the carbon atom at the 4'-position of ribose, Y are each independently the same or different and represent an oxygen atom or a sulfur atom, n represents an integer of 1 or more and 300 or less, when X represents an OZ group, W represents an OV group and V represents a protecting group for a hydroxyl group, or when X represents an R group, W represents an OZ group, and Z represents a group having a structure consisting of a solid phase support and a linking group. [wherein the symbols have the same meanings as defined above.] 15. The method for producing a nucleic acid molecule according to

[13] , wherein the precursor having a phosphite triester bond is a nucleic acid compound represented by formula (8): [In the formula, G 1 represents a protecting group for a hydroxyl group, 2are each independently the same or different and represent a hydroxyl-protecting group; a are each independently the same or different and represent a nucleobase which may be protected with a protecting group, R are each independently the same or different and represent a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, OQ' group, or NQ' group, Q' are each independently the same or different and represent an alkylene group or carbonyl group bonded to the carbon atom at the 4'-position of ribose, Y are each independently the same or different and represent an oxygen atom or a sulfur atom, n represents an integer of 1 or more and 300 or less, when X represents an OZ group, W represents an OV group and V represents a protecting group for a hydroxyl group, or when X represents an R group, W represents an OZ group, and Z represents a group having a structure consisting of a solid phase support and a linking group.] [wherein the symbols have the same meanings as above]. 15. The method for producing a nucleic acid molecule according to

[13] or

[14] , wherein the nucleic acid molecule is a nucleic acid compound represented by the formula:

[0009] The present invention provides a highly stable thiolated solution and a method for producing nucleic acid molecules by the amidite method using the thiolated solution. The present invention is expected to improve the stability of the thiolated solution. Furthermore, the present invention is expected to improve the purity of the produced nucleic acid molecules.

[0010] FIG. 1 is a diagram showing a scheme (Scheme A) of steps (1) to (6) of the production method of the present invention.

[0011] The thiolated solution of the present invention is represented by the formula (1): [In the formula, X 1 ~X 5 and each independently represent a hydrogen atom or a C1 to C5 alkyl group, which may be the same or different.], an aromatic heterocyclic compound represented by formula (2): [In the formula, Y 1 ~Y 6 and each independently represent a hydrogen atom, a C1 to C5 alkyl group, or a halogen atom, which may be the same or different.] and an aromatic hydrocarbon compound represented by formula (3): The present invention relates to a composition comprising a thiolating agent represented by the formula:

[0012] A composition containing an aromatic heterocyclic compound, an aromatic hydrocarbon compound, and a compound represented by formula (3) used as a thiolating agent (the compound is named "3-amino-1,2,4-dithiazole-5-thione" (hereinafter abbreviated as "ADTT" in this specification)) is described.

[0013] The composition can be used as a thionating agent herein and is also referred to as a "thionating solution."

[0014] Examples of aromatic heterocyclic compounds used in the composition of the present invention include, but are not limited to, pyridine, 2-methylpyridine, 3-methylpyridine, 4-methylpyridine, 2,6-lutidine, 3,4-lutidine, 3,5-lutidine, 2,3-lutidine, 2,4-lutidine, and 2,5-lutidine. The aromatic heterocyclic compound is preferably pyridine or 2,6-lutidine, and more preferably pyridine.

[0015] Examples of aromatic hydrocarbon compounds include, but are not limited to, benzene, toluene, o-xylene, m-xylene, p-xylene, monochlorobenzene, o-dichlorobenzene, m-dichlorobenzene, and p-dichlorobenzene. Preferred examples of the aromatic hydrocarbon compound include toluene, o-xylene, and o-dichlorobenzene, and more preferred examples include toluene.

[0016] The volume ratio of the aromatic heterocyclic compound to the aromatic hydrocarbon compound contained in the composition of the present invention can be any ratio. Examples include compositions in which the volume ratio of the aromatic heterocyclic compound to the aromatic hydrocarbon compound is 9:1, 4:1, 2:1, 1:1, 1:2, 1:4, or 1:9, and the volume ratio is preferably 1 to 99:1 to 99, more preferably 20 to 80:20 to 80 (i.e., 1:4 to 4:1), and even more preferably 40 to 80:40 to 80 (i.e., 1:2 to 2:1).

[0017] The concentration of the compound represented by formula (3) contained in the composition of the present invention is usually 0.001 M to 0.3 M, but is not particularly limited as long as it is a concentration effective for synthesizing a nucleic acid molecule, and is preferably 0.001 M to 0.2 M, more preferably 0.003 M to 0.1 M, and even more preferably 0.005 M to 0.05 M.

[0018] The water content of the composition of the present invention is usually 0.001 to 0.2% by weight, preferably 0.001 to 0.1% by weight, and more preferably 0.001 to 0.05% by weight.

[0019] The method for analyzing the compound represented by formula (3) contained in the thiolated solution will be described below. The method is carried out by analyzing a predetermined amount of a sample of the thiolated solution by high performance liquid chromatography (HPLC).

[0020] Analysis of the compound represented by formula (3) by HPLC is usually carried out using an ODS column. The mobile phase is, for example, a gradient of an aqueous ammonium acetate solution as mobile phase A and an aqueous ammonium acetate-methanol mixture as mobile phase B. The UV detection wavelength is typically 285 nm.

[0021] Next, a method for producing a nucleic acid molecule by the amidite method will be described, which comprises a step of contacting a thiolated solution containing an aromatic heterocyclic compound and an aromatic hydrocarbon compound with a precursor having a phosphite triester bond.

[0022] An example of a precursor having a phosphite triester bond is a nucleic acid compound represented by formula (4). [wherein the symbols have the same meanings as defined above.] The nucleic acid compound produced by contacting the thiolation solution is exemplified by the nucleic acid compound represented by formula (5). [In the formulas, the symbols have the same meanings as above.] In formulas (4) and (5), when R represents an OQ' group or an NQ' group, and Q' represents an alkylene group or a carbonyl group bonded to the carbon atom at the 4'-position of ribose, specific examples of the structure include LNA-1 to LNA-7 of the following formula (10): Formula (10): (In the formula, B a represents an optionally protected nucleic acid base, and R' represents a hydrogen atom or a methyl group.

[0023] Examples of nucleotide units contained in the nucleic acid molecules used in the present invention include, but are not limited to, DNA, RNA, 2'-O-Me, 2'-F, 2'-O-MOE (2'-O-methoxyethyl), UNA, morpholino nucleic acid, and LNA.

[0024] More specifically, the group represented by Z, which is composed of a solid phase carrier and a linking moiety connecting the solid phase carrier and the oxygen atom of the hydroxyl group at the 2'- or 3'-position of ribose at the 3'-end of a nucleic acid oligomer (also referred to as an "oligonucleotide"), includes a structure represented by the following formula (11): In formula (11), Sp represents a spacer. Examples of the spacer (Sp) include those having the structural formula shown in formula (12) below.

[0025]

[0026] The linker may have, for example, a structure shown in the following formula (13), or a structure in which the structure of formula (13) does not have a hexamethyleneamino group portion and an aminopropyl group is bonded to Si. Alternatively, the linker may have a structure shown in the following formula (14). (In the formula, A may be any of a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include a methoxy group and an ethoxy group. Examples of alkyl groups include a methyl group, an ethyl group, an isopropyl group, and an n-propyl group. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the support.) Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG) and zeolite. Examples of organic resin supports include supports made of polystyrene.

[0027] The step of contacting the thiolation solution can be carried out under air atmosphere, but is preferably carried out under an inert gas (for example, nitrogen, argon) atmosphere.

[0028] A method for synthesizing a nucleic acid molecule by solid-phase synthesis, which includes the step of contacting a thiolation solution, typically includes the following steps: (1) a step of deprotecting the 5'-hydroxyl group of a hydroxyl-protected nucleoside bound to a solid-phase support via a linker, (2) a step of coupling the 5'-hydroxyl group produced in the above step with an amidite to obtain a phosphite triester compound, (3) a step of oxidizing the phosphite triester produced in the above step to convert it into a phosphate triester to produce an extended nucleic acid molecule, or a step of converting it into a thiophosphate triester by reacting it with a thiolation solution, provided that the step of converting it into a thiophosphate triester by reacting it with a thiolation solution is included at least once, and (4) a step of synthesizing a nucleic acid molecule on a solid-phase support by repeating a series of reaction cycles consisting of the steps (1) to (3), i.e., a step of deprotecting the 5'-hydroxyl group of the produced nucleic acid molecule, a step of coupling the 5'-hydroxyl group with an amidite compound, and a step of oxidizing the produced phosphite triester, any number of times. (5) a step of subjecting the nucleic acid molecule on the solid support produced in step (4) to a step of excising and deprotecting it to release it from the solid support, thereby producing a nucleic acid molecule from which the protecting groups have been removed, and (6) a step of deprotecting the protecting group of the hydroxyl group at the 2'-position or the 3'-position of the 3'-end of the ribose constituting the nucleic acid molecule. However, the method for synthesizing a nucleic acid molecule may include, following step (2) or (3), a step of capping the hydroxyl group at the 5'-position that has not undergone the coupling reaction with the amidite, and a capping step may be added between any of the steps in the series of reaction cycles constituting step (4).

[0029] More specifically, the step (5) involves subjecting the nucleic acid molecule on the solid support produced in step (4) to the following steps (5-1) and (5-2) in this order. The step (5-1) reaction may be performed arbitrarily, and the step (5-2) reaction may be performed using the method described in Japanese Patent No. 4705716. As a result, a nucleic acid molecule from which a protecting group has been removed from the nucleic acid molecule released from the solid support, or a nucleic acid molecule in which the hydroxyl group at the 5'-end is protected, can be produced. (5-1) A reaction to deprotect the protecting group of the hydroxyl group at the 5'-end of the nucleic acid molecule; (5-2) A reaction to cleave and release the nucleic acid molecule from the solid support, and a reaction to deprotect the protecting groups of the nucleic acid bases.

[0030] More specifically, the step (6) is carried out by subjecting the nucleic acid molecule obtained in step (5), which has been released from the solid phase support and from which the protecting groups have been removed, to the deprotection reaction in the following step (6): (6) A reaction for deprotecting the protecting group of the hydroxyl group at the 2'-position or the 3'-position of the 3'-end of the ribose constituting the nucleic acid molecule.

[0031] The scheme of steps (1) to (6) is shown in Scheme A of Figure 1. In the synthesis of nucleic acid compounds by the amidite method in steps (1) to (5), except for the thiolation step related to the present invention in step (1) or step (5) in the scheme of Figure 1, the nucleic acid elongation reaction can be carried out by repeating each step of the deprotection step and the condensation step according to a generally known method (for example, the method described in the above-mentioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Each step will be explained below. The thiolation reaction in step (3) or step (4) shown in Figure 1 is carried out using the above-mentioned thiolation solution. Among the substituents in the chemical formula in Scheme A, G 1 , G 2 , B a The definitions of R and G are as defined above. 3 , G 4 , G 5 , B cThe definitions of R and R' are as described below. Furthermore, in the chemical formula of Scheme A, Y's are each independently the same or different and represent an oxygen atom or a sulfur atom, X represents an R group or an OZ group, wherein Z is as defined above, W represents an OZ group when X represents an R group, wherein Z is as defined above, or W represents an OV group when X represents an OZ group, wherein V represents a protecting group for a hydroxyl group, W may also contain a group derived from a W group (e.g., a residue cleaved from a solid phase support, a deprotected group, etc.), X may also contain a group derived from an X group (e.g., a residue cleaved from a solid phase support, a deprotected group, etc.), n represents an integer of 1 or more and 300 or less, and m represents an integer of 1 or more and 300 or less.

[0032] G 1 There are no particular limitations on the protecting group, so long as it can function as a protecting group, and a wide range of known protecting groups used in amidite compounds can be used.

[0033] G 1 is preferably the following group: (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent hydrogen or an alkoxy group.

[0034] R 1 , R 2 and R 3 Preferably, one of the groups is hydrogen and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group.

[0035] G 2 There are no particular limitations on the protecting group G as long as it can function as a protecting group, and a wide range of known protecting groups used in amidite compounds can be used. 2Examples of the alkyl group include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di-, or trialkylsilyl group, and a mono-, di-, or trialkylsilyloxyalkyl group, which may be substituted with one or more electron-withdrawing groups.

[0036] G 2 is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and is preferably a cyano group.

[0037] G 2 Particularly preferred as the alkyl group is a 2-cyanoethyl group (a group represented by the following formula).

[0038] G 3 is two G 3 may be bonded to each other to form a cyclic structure. 3 Preferably, both of the groups are isopropyl groups.

[0039] The R 1 , R 2 , R 3 , G 2 , G 3 The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and n-hexyl. The alkyl group moiety constituting the alkoxy group in the definition of the substituent has the same definition as the alkyl group herein.

[0040] As used herein, the term "nucleobase" refers to a group having a natural or non-natural nucleobase backbone, and also encompasses modified forms of the natural or non-natural nucleobase backbone.

[0041] B a The nucleobase that may be protected with a protecting group represented by the formula (I) is not particularly limited. Examples of the nucleobase include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleobase may also be substituted with a substituent. Examples of such substituents include halogen atoms such as fluoro, chloro, bromo, and iodo groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents.

[0042] When a nucleic acid base has an amino group at the exocyclic position, the protecting group for the amino group is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene, as well as combinations of two or more of these protecting groups.

[0043] B a More specifically, examples of the nucleic acid base represented by the formula (I) include the following structures:

[0044] (In the above formula, R 4represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group; R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group; R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group; R 7 represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, and R 9 represents a dimethylaminomethylene group.

[0045] In the method of the present invention, the amidite can be used in its free state or in its salt state. Examples of amidite salts include, but are not limited to, base addition salts and acid addition salts. Specific examples of base addition salts include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specific examples of acid addition salts include salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. The amidite compounds also include salts, hydrates, solvates, crystalline polymorphs, and other forms.

[0046] When R represents a protected hydroxyl group, the protecting group may be any that can be used in the amidite method, such as a 2'-tert-butyldimethylsilyl (TBDMS) group, a 2'-bis(2-acetoxyethoxy)methyl (ACE) group, a 2'-(triisopropylsilyloxy)methyl (TOM) group, a 2'-(2-cyanoethoxy)ethyl (CEE) group, a 2'-(2-cyanoethoxy)methyl (CEM) group (WO 2006 / 022323), a 2'-para-tolylsulfonylethoxymethyl (TEM) group, a 2'-EMM group (WO 2013 / 027843), or those described in WO 2019 / 208571 can be used. Of these ribonucleoside (RNA) 2'-protecting groups, the protecting group represented by formula (15) is exemplified as a preferred protecting group. More preferably, E W An example of such a protecting group is a protecting group represented by formula (16) having a cyano group as the electron-withdrawing group. (wherein q represents an integer of 1 to 5; R a and R b are the same or different and each represent a methyl group, an ethyl group, or a hydrogen atom, the bond marked with an asterisk (**) is attached to the oxygen of a protected hydroxyl group, and E W represents an electron-withdrawing group.)

[0047] The protecting group represented by formula (16) can be synthesized, for example, as described in International Publication Nos. 2013 / 027843 and 2019 / 208571, and an amidite having such a protecting group can be used to produce a nucleic acid molecule. For the nucleic acid elongation reaction, an amidite represented by formula (3) shown in Scheme A in Figure 1 is used.

[0048] (Nucleic acid extension reaction) In this specification, the term "nucleic acid extension reaction" refers to a reaction in which a nucleic acid molecule is extended by sequentially linking nucleotides via phosphodiester bonds. The nucleic acid extension reaction can be carried out according to the procedure of the general amidite method (phosphoramidite method). The nucleic acid extension reaction may be carried out using an automatic nucleic acid synthesizer that employs the amidite method.

[0049] The chain length of the nucleic acid oligomer may be, for example, 20 mers or more, 40 mers or more, 50 mers or more, 60 mers or more, 80 mers or more, 100 mers or more, 200 mers or more, 2 to 300 mers, 2 to 250 mers, 2 to 200 mers, 10 to 300 mers, 10 to 250 mers, 10 to 200 mers, 10 to 150 mers, 15 to 300 mers, 15 to 250 mers, 15 to 200 mers, 15 to 150 mers, or 15 to 110 mers.

[0050] The 5'-deprotection step of step (1) is a step of deprotecting the protecting group of the 5'-hydroxyl group at the end of the RNA strand supported on the solid phase support. Common protecting groups include the 4,4'-dimethoxytrityl group (DMTr group), the 4-monomethoxytrityl group, and the 4,4',4"-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0051] The condensation step of step (2) is a reaction in which a nucleoside amidite represented by the following formula (3) shown in Scheme A of Figure 1 is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected in the deprotection step. The amidite compound represented by formula (3) is used as the amidite used in nucleic acid elongation. Other usable amidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, and the like. The nucleoside amidite used has its 5' hydroxyl group protected with a protecting group (e.g., a DMTr group). The condensation step can be carried out using an activator that activates the nucleoside amidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0052] The nucleoside amidite (hereinafter referred to as amidite) represented by formula (3) in Scheme A of Figure 1 is as follows: (In the formula, G 1 , G 2 , G 3 , B a and R is as defined above.

[0053] After the condensation step, any unreacted 5' hydroxyl groups may be capped, if desired, using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0054] The oxidation step (3) is a step of converting the phosphite group formed in the condensation step into a phosphate group or a thiophosphate group. This step is a reaction of converting trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting the oxidizing agent with an oligonucleic acid derivative supported on a solid phase support. When converting a phosphite group into a phosphate group, for example, iodine can be used as the "oxidizing agent." The oxidizing agent can be prepared to a concentration of 0.005 to 2 M. Water can be used as the oxygen source for oxidation, and pyridine, N-methylimidazole (NMI), N-methylmorpholine, or triethylamine can be used as the base to promote the reaction. Furthermore, the solvent is not particularly limited as long as it does not participate in the reaction, and acetonitrile, tetrahydrofuran (THF), or a mixture of these in any ratio can also be used. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is usually 1 minute to 30 minutes. The amount of the reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, per mol of the compound supported on the solid phase carrier.

[0055] When converting a phosphite triester group to a thiophosphate group, the composition of the present invention is used as a "thiolating agent" that acts as an oxidizing agent. The concentration of the compound represented by formula (3) contained in the composition of the present invention is typically 0.001 M to 0.3 M, but is not particularly limited as long as it is a concentration effective for synthesizing nucleic acid molecules. It is preferably 0.001 M to 0.2 M, more preferably 0.003 M to 0.1 M, and even more preferably 0.005 M to 0.05 M. The volume ratio of the aromatic heterocyclic compound to the aromatic hydrocarbon compound contained in the composition of the present invention can be any ratio. Examples include compositions in which the volume ratio of the aromatic heterocyclic compound to the aromatic hydrocarbon compound is 9:1, 4:1, 2:1, 1:1, 1:2, 1:4, or 1:9, preferably 1 to 99:1 to 99, more preferably 20 to 80:20 to 80 (i.e., 1:4 to 4:1), and even more preferably 40 to 80:40 to 80 (i.e., 1:2 to 2:1). The water content of the composition of the present invention is usually 0.001% by weight to 0.2% by weight, preferably 0.001% by weight to 0.1% by weight, and more preferably 0.001% by weight to 0.05% by weight. The oxidation step including the thiolation step may be carried out after the capping operation, or conversely, the capping operation may be carried out after the oxidation step, and this order is not limited.

[0056] In step (5), after the synthesis of a nucleic acid having a desired sequence is completed, the phosphate protecting group is deprotected by the action of an amine compound to deprotect the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine, which is described in Japanese Patent No. 4705716.

[0057] The protecting group for the 5' hydroxyl group of the nucleoside introduced at the end of elongation may be used for column purification using the 5' protecting group as a tag after cleavage from the solid phase support and deprotection of the protecting group as described below, and the protecting group for the 5' hydroxyl group may be deprotected after column purification.

[0058] In step (5), the nucleic acid oligomer elongated to a desired chain length on the solid phase support is cleaved from the solid phase support usually using concentrated aqueous ammonia as a cleavage agent.

[0059] Furthermore, the oligonucleotide chain is cleaved from the solid support and recovered using ammonia or an amine compound, etc. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0060] In step (6), the protecting group on the 2- or 3-hydroxyl group of the ribose of the nucleic acid compound (6) cleaved from the solid support can be removed according to the methods described in WO 2006 / 022323, WO 2013 / 027843, or WO 2019 / 208571 to obtain a deprotected nucleic acid oligomer (7).

[0061] Nucleotides and amidites in which the R group in formula (4) is a substituent other than a hydroxyl group can be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO 2001 / 053528, JP 2014-221817 A, and known methods cited therein. Furthermore, they can be produced using commercially available products in accordance with the methods described in the Examples below or by methods with appropriate modifications to these methods.

[0062] Nucleic acid molecules that can be produced using the production method of the present invention include, but are not limited to, nucleic acid molecules in which the nucleosides contained therein are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, or 2'-F, and LNA. Examples of various nucleosides include those described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558. Preferably, the nucleic acid molecule produced by the method of the present invention is RNA.

[0063] Typical examples of nucleic acid molecules that can be used in the production method of the present invention include, but are not limited to, the following examples in addition to those described in the Examples. In the following explanations of sequences, U represents uridine (ST.25 format), C represents cytidine, A represents adenosine, and G represents guanosine.

[0064] Examples of nucleic acid molecules include those having the following sequences (A) and (B) described in WO 2019 / 060442. Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (based on the ST.25 format) (5'-ATGGAATmACTCTTGGTTmACdTdT-3' (based on the ST.26 format)) (Antisense) (SEQ ID NO: 1) 21 mer Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (based on the ST.25 format) (5'-GTmAACmCmAAGAGTmATmTmCmCmATmdTdT-3' (based on the ST.26 format)) (Sense) (SEQ ID NO: 2) 21 mer In sequences (A) and (B), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Cm represents 2'-O-methylcytidine, and dT represents thymidine. Unless otherwise specified, the abbreviations in the sequences herein apply to both the ST.25 format and the ST.26 format.

[0065] An example is the nucleic acid molecule described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is a nucleic acid molecule having the following sequence (C): Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (based on the ST.25 format) (5'-AGAGCCAGCCTTCTTATTGTTTTAGAGCTATGCTGT-3' (based on the ST.26 format)) (SEQ ID NO: 3) 36mer

[0066] An example is a nucleic acid molecule having the following sequence (D) described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (D): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (based on the ST.25 format) (5'-ACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3' (based on the ST.26 format)) (SEQ ID NO: 4) 67mer

[0067] An example is a nucleic acid molecule having the following sequence (E) described in JP-A No. 2015-523856, page 173: Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (based on the ST.25 format) (5'-GTTTTCCCTTTTCAAAGAAATCTCCTGGGCACCTATCTTCTTAGGTGCCCTCCCTTGTTTAAACCTGACCAGTTAACCGGCTGGTTAGGTTTT-3' (based on the ST.26 format)) (SEQ ID NO: 5) 94mer

[0068] Examples include the nucleic acid molecules described in JP-A-2017-537626. Typical examples include nucleic acid molecules having the following sequences (F), (G), (H), and (I).Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (based on ST.25 format) (5'-AGTCCTCATCTCCCTCAAGCGTTTTAGAGCTAGTAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (based on ST.26 format)) (SEQ ID NO: 6) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-GCAGATGTAGTGTTTCCACAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 7) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 8) 113mer In sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine.Sequence (I): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (based on ST.25 format) (5'-AmsGmsTmsCCTCATCTCCCTCAAGCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (based on ST.26 format)) (SEQ ID NO: 9) 113mer In sequence (I), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification.

[0069] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0070] Measurement Methods First, the various measurement methods used in the following tests are shown below. Oligonucleotide purity was measured using HPLC. The HPLC measurement conditions are shown in Tables 1 and 2 below. (Measurement Method 1: Measurement of Oligonucleotide Purity)

[0071] (Measurement Method 2: Measurement of Oligonucleotide Purity)

[0072] (Measurement method 3: Measurement of residual rate of ADTT) ADTT in the thiolated solution was measured using HPLC. The HPLC measurement conditions are shown in Table 3 below.

[0073] Preparation of thiolated solutions The thiolated solutions used in the following Examples 15 to 19 were prepared as described in Examples 1 to 4, respectively. The residual ADTT rates after storing the prepared thiolated solutions at 50°C for 6 days are shown in Table 5. The residual ADTT rates were calculated based on the peak area value of ADTT contained in the thiolated solutions immediately after preparation.

[0074] Example 1: 37.5 mg of commercially available ADTT was added to 12.2 g of pyridine and 10.8 g of toluene to dissolve the ADTT, preparing a thiolated solution. This solution was stored at 50°C for 6 days, and the ADTT residual rate was measured using the method described in Measurement Method 3 above. The residual rate was found to be 96%. The results are shown in Table 4. The solution after storage at 50°C for 6 days was used in Examples 15 and 19.

[0075] Comparative Example 1: 12.2 g of pyridine and 9.8 g of acetonitrile were added to 37.5 mg of commercially available ADTT to dissolve the ADTT, preparing a thiolated solution. This solution was stored at 50°C for 6 days, and the residual ADTT rate was measured using the method described in Measurement Method 3 above. The residual rate was found to be 28%. The results are shown in Table 4. The solution after storage at 50°C for 6 days was used in Comparative Example 2.

[0076] Example 2 A thiolated solution was prepared by adding 12.2 g of pyridine and 16.3 g of o-dichlorobenzene to 37.5 mg of commercially available ADTT and dissolving the ADTT. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was found to be 91%. The results are shown in Table 4. The solution after storage at 50°C for 6 days was used in Example 16.

[0077] Example 3: 12.2 g of pyridine and 11.0 g of o-xylene were added to 37.5 mg of commercially available ADTT, and the ADTT was dissolved to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was found to be 98%. The results are shown in Table 4. The solution after storage at 50°C for 6 days was used in Example 17.

[0078] Example 4: 11.5 g of 2,6-lutidine and 10.8 g of toluene were added to 37.5 mg of commercially available ADTT, and the ADTT was dissolved to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was found to be 93%. The results are shown in Table 4. The solution after storage at 50°C for 6 days was used in Example 18.

[0079] Example 5: 37.5 mg of commercially available ADTT was added to 19.6 g of pyridine and 4.3 g of toluene to dissolve the ADTT, preparing a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was found to be 88%. The results are shown in Table 5.

[0080] Example 6: 37.5 mg of commercially available ADTT was dissolved in 16.3 g of pyridine and 7.2 g of toluene to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was 94%. The results are shown in Table 5.

[0081] Example 7: 37.5 mg of commercially available ADTT was dissolved in 12.2 g of pyridine and 10.8 g of toluene to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was 96%. The results are shown in Table 5.

[0082] Example 8: 37.5 mg of commercially available ADTT was dissolved in 8.2 g of pyridine and 14.3 g of toluene to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was 99%. The results are shown in Table 5.

[0083] Example 9: 37.5 mg of commercially available ADTT was dissolved in 4.9 g of pyridine and 17.3 g of toluene to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was found to be 100%. The results are shown in Table 5.

[0084] Example 10: 375 mg of commercially available ADTT was dissolved in 12.2 g of pyridine and 10.8 g of toluene to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was found to be 72%. The results are shown in Table 6.

[0085] Example 11: 188 mg of commercially available ADTT was dissolved in 12.2 g of pyridine and 10.8 g of toluene to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was found to be 75%. The results are shown in Table 6.

[0086] Example 12: 94.2 mg of commercially available ADTT was dissolved in 12.2 g of pyridine and 10.8 g of toluene to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was found to be 90%. The results are shown in Table 6.

[0087] Example 13: 37.9 mg of commercially available ADTT was dissolved in 12.2 g of pyridine and 10.8 g of toluene to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was 98%. The results are shown in Table 6.

[0088] Example 14: 18.6 mg of commercially available ADTT was dissolved in 12.2 g of pyridine and 10.8 g of toluene to prepare a thiolated solution. This solution was stored at 50°C for 6 days, and the residual rate of ADTT was measured using the method described in Measurement Method 3 above. The residual rate was found to be 100%. The results are shown in Table 6.

[0089] <Solid-phase synthesis of oligonucleotide 2-mer> Sequence (J): 5'-UmsUm-3' (ST.25 format) (5'-TmsTm-3' (ST.26 format)) (SEQ ID NO: J) In sequence (J), "Ums" at the 5'-terminus is represented by the upper partial structure separated by a wavy line in formula (A1) below. "Um" at the 3'-terminus is represented by the lower partial structure separated by a wavy line in formula (A2) below.

[0090] <Solid-phase synthesis of 100-mer oligonucleotide> Sequence (K): 5'-AmsCmsUmsCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (based on ST.25 format) (5'-AmsCmsTmsCAATTTGTAAAAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (based on ST.26 format)) (SEQ ID NO: 10) 100-mer In sequence (K), "A" is represented by the partial structure separated by the wavy lines in the following formula (A3). "C" is represented by the partial structure separated by the wavy lines in the following formula (A4). "G" is represented by the partial structure separated by wavy lines in the following formula (A5). "U" is represented by the partial structure separated by wavy lines in the following formula (A6). "Ams" is represented by the partial structure separated by wavy lines in the following formula (A7). "Cms" is represented by the partial structure separated by wavy lines in the following formula (A8). "Ums" is represented by the partial structure separated by wavy lines in the following formula (A9). Note that "Ams" at the 5'-end is represented by the upper partial structure separated by a wavy line in the following formula (A10). Furthermore, "U" at the 3'-end is represented by the lower partial structure separated by a wavy line in the following formula (A11).

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101] For the synthesis, 2'-OMe amidite and PMM amidite described in WO 2019 / 208571 were used, where PMM is an abbreviation for (((1-cyanopropan-2-yl)oxy)methoxy)methyl group.

[0102] The 2'-OMe uridine derivative (A12) and the uridine derivative (A13) described in the following examples and comparative examples refer to compounds represented by the following structural formula: The circle illustrated in the following structural formula is a schematic representation of CPG.

[0103]

[0104]

[0105] Example 15 Using Controlled Pore Glass (CPG) carrying 1.0 μmol of a 2'-OMe uridine derivative and 2'-OMe uridine amidite, an oligonucleotide consisting of SEQ ID NO: J (Sequence (J)) was automatically synthesized from the 3' to the 5' end using an NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The automated synthesis procedure consisted of first loading a 3% dichloroacetic acid toluene solution into the CPG to deprotect the trityl protecting group at the 5' position. Next, loading the 2'-OMe uridine amidite and 5-benzylmercapto-1H-tetrazole as a condensing agent into the CPG to allow a coupling reaction to proceed with the hydroxyl group at the 5' position. Next, 100 μL of the thiolation solution prepared in Example 1 was added, and the mixture was allowed to stand for 16 minutes to convert the phosphite triester to a thiophosphate triester. Next, the protecting group (DMTr group) of the 2'-OMe uridine at the 5' end was deprotected with a 3% dichloroacetic acid toluene solution, and the oligonucleotide of SEQ ID NO: 12 was synthesized on the CPG support. Then, 1.5 mL of 28% aqueous ammonia and 0.5 mL of ethanol were poured into the CPG support carrying 1.0 μmol of oligonucleotide. The resulting mixture was incubated at 40°C for 4 hours to liberate the nucleic acid molecules from the solid support, and the solvent was then removed by concentration. The resulting crude product was dissolved in water, and the purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, resulting in a purity of 58%. The results are shown in Table 7.

[0106] Comparative Example 2: Nucleic acid molecules were obtained in the same manner as in Example 15, except that the thiolation solution prepared in Comparative Example 1 was used instead. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the purity of the crude product was found to be 23%. The results are shown in Table 7.

[0107] (Example 16) Nucleic acid molecules were obtained in the same manner as in Example 15, except that the thiolation solution prepared in Example 2 was used instead. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the purity of the crude product was found to be 52%. The results are shown in Table 7.

[0108] Example 17 Nucleic acid molecules were obtained in the same manner as in Example 15, except that the thiolation solution prepared in Example 3 was used instead. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the purity of the crude product was found to be 52%. The results are shown in Table 7.

[0109] Example 18: Nucleic acid molecules were obtained in the same manner as in Example 15, except that the thiolation solution prepared in Example 4 was used instead. The purity of the oligonucleotide was measured using the method described in Measurement Method 1 above, and the purity of the crude product was found to be 55%. The results are shown in Table 7.

[0110] Example 19 Using Controlled Pore Glass (CPG) carrying 1.0 μmol of a uridine derivative, 2'-OMe amidite, and PMM amidite, an oligonucleotide consisting of SEQ ID NO: 10 (sequence (K)) was automatically synthesized from the 3' to the 5' end using an NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The automated synthesis procedure was as follows: first, a 3% dichloroacetic acid toluene solution was fed to the CPG, and the trityl protecting group at the 5' position was deprotected. Next, 2'-OMe amidite or PMM amidite and 5-benzylmercapto-1H-tetrazole as a condensing agent were fed to the CPG, and a coupling reaction with the hydroxyl group at the 5' position was carried out. Next, the thiolation solution prepared in Example 1 was added to convert the phosphite triester to a thiophosphate triester, or the oxidation solution was added to convert the phosphite triester to a phosphate triester. Subsequently, a 0.1 M phenoxyacetic anhydride acetonitrile solution and a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap reaction sites where coupling did not proceed. These steps were repeated a total of 99 times to synthesize the oligonucleotide of SEQ ID NO: 13 on the CPG support. The trityl protecting group at the 5' position was then deprotected with a 3% dichloroacetic acid toluene solution. Subsequently, 1.5 mL of 28% aqueous ammonia and 0.5 mL of ethanol were added to the CPG support carrying 1.0 μmol of oligonucleotide, and the mixture was incubated at 40°C for 4 hours to release the nucleic acid molecules from the solid support, after which the solvent was removed by concentration. Next, the free oligonucleotide was dissolved in 1.0 mL of dimethyl sulfoxide, and then 13.5 μL of nitromethane and a stir bar were added. Then, 2.0 mL of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) that had been dehydrated using molecular sieves 4A was added at 30°C while stirring with a stirrer. The resulting mixture was kept warm for 5 hours to deprotect the protecting group of the 2'-hydroxyl group. The oligonucleotide was obtained by precipitation. The resulting crude product was dissolved in water, and the purity of the oligonucleotide was measured using the method described in Measurement Method 3 above. The purity of the crude product was 40%. The results are shown in Table 8.

[0111]

[0112] The results in Tables 4 to 6 above show that Examples 1 to 14, which used the thiolated solution of the present invention, showed a higher ADTT residual rate than the thiolated solution of Comparative Example 1. The results in Tables 7 and 8 above show that Examples 15 to 19, which used the thiolated solution of the present invention, yielded nucleic acid molecules with higher purity than when the thiolated solution of Comparative Example 2 was used.

[0113] The present invention provides a highly stable thiolation solution containing a compound represented by formula (3) (i.e., ADTT) as a thiolation agent, and a method for producing nucleic acid molecules by the amidite method using the thiolation solution. The present invention is expected to improve the stability of the thiolation solution. Furthermore, the present invention is expected to improve the purity of the produced nucleic acid molecules.

[0114] SEQ ID NOs: 1 to 10 in the sequence listing represent the base sequences of the oligonucleotides produced according to the production method of the present invention.

Claims

1. Formula (1): 【Chemistry 1】 [In the formula, X 1 ~X 5 Each of these independently represents a hydrogen atom or a C1-C5 alkyl group, either identical or distinct. Aromatic heterocyclic compounds represented by formula (2): 【Chemistry 2】 [In the formula, Y 1 ~Y 6 Each of these independently represents a hydrogen atom, a C1-C5 alkyl group, or a halogen atom, either identical or distinct in nature. Aromatic hydrocarbon compounds represented by, and formula (3): 【Transformation 3】 A composition containing a thioting agent indicated by [the specified symbol].

2. The composition according to claim 1, wherein the aromatic heterocyclic compound is pyridine, 2-methylpyridine, 3-methylpyridine, 4-methylpyridine, 2,6-lutidine, 3,4-lutidine, 3,5-lutidine, 2,3-lutidine, 2,4-lutidine, or 2,5-lutidine.

3. The composition according to claim 1, wherein the aromatic heterocyclic compound is pyridine or 2,6-lutidine.

4. The composition according to claim 1, wherein the aromatic hydrocarbon compound is benzene, toluene, o-xylene, m-xylene, p-xylene, chlorobenzene, o-dichlorobenzene, m-dichlorobenzene, or p-dichlorobenzene.

5. The composition according to claim 1, wherein the aromatic hydrocarbon compound is toluene, o-xylene, or o-dichlorobenzene.

6. The composition according to claim 1, wherein the aromatic heterocyclic compound is pyridine.

7. The composition according to claim 1, wherein the aromatic hydrocarbon compound is toluene.

8. The composition according to claim 1, wherein the volume ratio of the aromatic heterocyclic compound and the aromatic hydrocarbon compound is 1:99 to 99:

1.

9. The composition according to claim 1, wherein the volume ratio of the aromatic heterocyclic compound and the aromatic hydrocarbon compound is 1:4 to 4:

1.

10. The composition according to claim 1, wherein the volume ratio of the aromatic heterocyclic compound and the aromatic hydrocarbon compound is 2:1 to 1:

2.

11. The composition according to claim 1, wherein the concentration of the thiolating agent represented by formula (3) in the composition is 0.001 to 0.3 M.

12. A method for producing nucleic acid molecules by the amidite method, comprising the step of converting a phosphite triester bond to a thiophosphate triester bond using the composition described in claim 1.

13. Formula (4): 【Chemistry 4】 [During the ceremony, G 1 and G 2 Each of these independently, identically or distinctly, represents a protecting group for a hydroxyl group. B a This represents a nucleic acid base that may be protected by a protecting group. R represents a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, OQ' group, or NQ' group. Q' represents an alkylene or carbonyl group bonded to the carbon atom at the 4' position of ribose, and, * indicates the binding position to the nucleotide unit at the 3' end. A precursor having a phosphite triester bond represented by formula (5) is contacted with the composition according to any one of claims 1 to 11, and formula (5): 【Transformation 5】 [In the formula, the symbols have the same meaning as above.] A method for producing nucleic acid molecules, comprising the step of converting them into nucleic acid compounds having a thiophosphate triester bond as shown.

14. The precursor having the phosphite triester bond is given by formula (6): 【Transformation 6】 [During the ceremony, G 1 This represents a protecting group for hydroxyl groups, G 2 each independently represents the same or different protecting group for a hydroxyl group, B a Each of these independently represents a nucleic acid base that may be protected by a protecting group, either identical or distinct. Each R independently represents a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, OQ' group, or NQ' group, either identical or distinct. Q' represents an alkylene group or carbonyl group that is bonded to the carbon atom at the 4' position of ribose, independently, either identically or distinctly. Each Y independently represents either the same or different oxygen or sulfur atom. n represents any integer between 1 and 300, When X represents an OZ group, W represents an OV group, V represents a hydroxyl protecting group, or, When X represents an R group, W represents an OZ group, and, Z represents a group having a structure consisting of a solid support and a linking group. A compound represented by formula (7) is a compound having a thiophosphate triester bond. 【Transformation 7】 [In the formula, the symbols have the same meaning as above.] A method for producing a nucleic acid molecule according to claim 13, wherein the nucleic acid compound is represented by [the specified formula].

15. The precursor having the phosphite triester bond is given by formula (8): 【Transformation 8】 [During the ceremony, G 1 This represents a protecting group for hydroxyl groups, G 2 Each of these independently, identically or distinctly, represents a protecting group for a hydroxyl group. B a Each of these independently represents a nucleic acid base that may be protected by a protecting group, either identical or distinct. Each R independently represents a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, OQ' group, or NQ' group, either identical or distinct. Q' represents an alkylene group or carbonyl group that is bonded to the carbon atom at the 4' position of ribose, independently, either identically or distinctly. Each Y independently represents either the same or different oxygen or sulfur atom. n represents any integer between 1 and 300, When X represents an OZ group, W represents an OV group, V represents a hydroxyl protecting group, or, When X represents an R group, W represents an OZ group, and, Z represents a group having a structure consisting of a solid support and a linking group. The compound shown is a compound having a thiophosphate triester bond, and is given by formula (9): 【Chemistry 9】 A method for producing a nucleic acid molecule according to claim 13, wherein the nucleic acid compound is represented by [the symbol in the formula has the same meaning as described above].