RESISTANCE IN SOLANUM LYCOPERSICUM PLANTS TO TOBAMOVIRUS (TOBAMOVIRUS)

MX434917BActive Publication Date: 2026-06-12VILMORIN & CO +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
MX2021015483
Authority / Receiving Office
MX · MX
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-06-14
Filing Date
2021-12-13
Publication Date
2026-06-12
Estimated Expiration
2040-06-12

AI Technical Summary

Technical Problem

Existing tomato plants lack sufficient resistance to the Tomato Brown Rough Fruit Virus (TBRFV), leading to severe fruit deformations and poor marketability, with current resistance genes like Tm-1 becoming ineffective against new strains, and tolerance QTLs failing to prevent viral spread.

Method used

Combining the Tm-1 resistance gene with specific quantitative trait loci (QTLs) such as QTL1, QTL2, and QTL3 on chromosomes 6, 9, and 11, respectively, to enhance resistance and tolerance in tomato plants, particularly against the Israeli strain of TBRFV.

Benefits of technology

The combination significantly reduces viral replication and spread, providing at least 50% lower viral sequence levels compared to susceptible plants, with improved fruit and leaf resistance, ensuring higher marketable yields.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to a method for detecting and / or selecting S. lycopersicum plants resistant to Tomato Brown Rugose Fruit Virus (TBRFV), which inhibit, reduce, or delay virus replication, characterized in that it comprises the steps of: a) detecting at least one of the following markers: T allele of TO-0122252 (SEQ ID NO:7), C allele of TO-0144317 (SEQ ID NO:8), T allele of TO-0142270 (SEQ ID NO:9), G allele of TO-0142294 (SEQ ID NO:10), A allele of TO-0142303 (SEQ ID NO:11), A allele of TO-0142306 (SEQ ID NO:12), G allele of TO-0182276 (SEQ ID NO:13), G allele of TO-0181040 (SEQ ID NO:14), G allele of TO-0123057 (SEQ ID NO:15), A allele of TO-0125528 (SEQ ID NO:16), C allele of TO-0162432 (SEQ ID NO:17) and T allele of TO-0162427 (SEQ ID NO:18), and b) detect the homozygous presence of the Tm-1 gene, preferably by detecting the A allele of the SNP marker TO-0200838 (SEQ ID NO:21).
Need to check novelty before this filing date? Find Prior Art

Description

The present invention relates to resistance in plants of Solanum lycopersicum, also known as Lycopersicum esculentum, to the Tomato Brown Rugose Fruit Virus (TBRFV, also known as ToBRFV). More specifically, the present invention relates to tomato plants and fruits comprising one or more genetic determinants, in combination with the Tm-1 resistance gene, that confer resistance to the Tomato Brown Rugose Fruit Virus. The invention further relates to markers linked to such one or more genetic determinants and the Tm-1 gene, and to the use of such markers to identify or select plants that possess such resistance. The invention also relates to the seeds and progeny of such plants, the propagation of material to obtain such plants, and various uses of such plants. BACKGROUND OF THE INVENTION All cultivated and commercial varieties of tomato belong to a species most frequently referred to as Lycopersicum esculentum Miller. Lycopersicum is a relatively small genus within the extremely large and diverse Solanaceae family, which is considered to consist of approximately 90 genera, including peppers, tobacco, and eggplant. The genus Lycopersicum has been divided into two subgenera: the esculentum complex, which contains those species that readily cross with the commercial tomato, and the peruvianum complex, which contains those species that cross with considerable difficulty (Stevens, M. and Rick, C.M. 1986). Due to its value as a crop, L. esculentum Miller has been widely disseminated throughout the world.Although the precise origin of the cultivated tomato is still somewhat unclear, it appears to have originated in the Americas, being native to Ecuador, Peru, and the Galápagos Islands, and initially cultivated by the Aztecs and Incas as early as 700 AD. Mexico seems to have been the site of domestication and the source of the first introduction. The cherry tomato, *Lithium esculentum* var. *cerasiforme*, is considered the direct ancestor of modern cultivated varieties. The tomato is cultivated for its fruit, widely used as a fresh or processed market product. As a crop, tomatoes are grown commercially wherever environmental conditions allow for economically viable production. Most fresh market tomatoes are hand-picked at the mature and semi-green stages of vine maturity. Fresh market tomatoes are available year-round. Tomatoes for processing are primarily harvested mechanically and used in many forms, such as canned tomatoes, tomato juice, tomato sauce, puree, paste, or even ketchup. The tomato is a normally simple diploid species with twelve pairs of differentiated chromosomes. However, the polyploid tomato is also part of the present invention. Cultivated tomatoes are almost exclusively self-fertilizing and self-pollinating. Tomato flowers are hermaphroditic. Commercial crops were initially open-pollinated. Since hybrid vigor has been identified in tomatoes, hybrids are replacing open-pollinated varieties, gaining increasing popularity among farmers due to their improved yield and uniformity of plant characteristics. Because of their widespread distribution and high value, tomatoes have been intensively cultivated. This explains why a wide range of tomatoes is now available. Shapes can vary from small to large, and there are cherry, plum, pear, block, round, and steak types.Tomatoes can be grouped by the amount of time it takes for the plants to mature for harvest, and generally, varieties are considered early, mid-season, or late-maturing. Tomatoes can also be grouped by the plant's growth habit: determinate, semi-determinate, or indeterminate. Determinate plants tend to grow their foliage first, then produce flowers that mature into fruit, and pollination is successful. All the fruit on a plant tends to ripen at approximately the same time. Indeterminate tomatoes begin by growing some foliage, then continue to produce foliage and flowers throughout the growing season. These plants will tend to have tomato fruit at different stages of maturity at any given time.Semi-determinate tomatoes have a phenotype between determinate and indeterminate; they are typically determinate types except that they grow larger than determinate varieties. More recent developments in tomato breeding have led to a wide range of fruit colors. In addition to the standard ripe red color, tomatoes can be creamy white, lime green, pink, yellow, golden, orange, or purple. Commercial hybrid tomatoes can be produced by hand pollination. Pollen from the male parent is harvested and applied manually to the stigmatic surface of the inbred female. Before and after hand pollination, the flowers are covered to prevent insects from carrying foreign pollen and creating a mixture or impurity. The flowers are marked to identify the pollinated fruit from which the seeds will be harvested. A variety of pathogens affect the productivity of tomato plants, including viruses, fungi, bacteria, nematodes, and insects. Tomatoes are, among other things, susceptible to many viruses, and virus resistance is therefore of major agricultural importance. Tobamoviruses are among the most important plant viruses causing severe damage to agriculture, especially to vegetables and ornamental crops worldwide. Tobamoviruses are easily transmitted mechanically, although there is no evidence of a natural vector, nor is there evidence of seed transmission. Tobamoviruses are generally characterized by a rod- or bacillus-shaped particle approximately 300 nm in diameter. Their structure consists of a single-stranded, positive-sense RNA genome encoded by four proteins, encapsulated by 17 kDa coat protein (CP) molecules. In tomatoes, tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV) are feared by growers worldwide because they can severely damage crop production, for example, through uneven ripening (fruits with yellowish patches on the surface and brown spots beneath the surface). Several genera have been identified by plant growers over the years. The first resistance gene identified was the Tm-1 gene, which confers resistance to TMV. This gene, introgressed from S. habrochaites, is completely dominant, and homozygosity was generally required for TMV resistance. However, the Tm-1 gene was outcompeted within approximately one year of its introduction into commercial horticulture, rendering the pursuit of its introduction into other commercial lines entirely futile (Pelham et al., 1970. “The establishment of a new strain of tomato mosaic virus resulting from the use of resistant varieties of tomato”; Ann. Appl. Biol., 65:293-297). (This gene was also identified as conferring resistance to ToMV, but today, the vast majority of circulating TMV and ToMV strains are capable of infecting commercial plants that harbor the Tm-1 gene, since this gene is no longer considered a resistance gene against TMV / ToMV infection in commercial plants.)The use of this Tm-1 gene has now been completely abandoned in favor of alternative resistance genes. During the last few decades, all indeterminate tomato varieties and many determinate tomato varieties actually contain the Tm-2 gene or preferably the Tm-22 allele of this gene, which confers immunity to almost any known race of Tobamovirus that affected commercial tomatoes (ToMV and TMV) before 2014. During 2014–2015, a severe virus outbreak affected tomato-producing areas in the Middle East, such as Jordan and Israel. Most of the affected tomato varieties were considered resistant to TMV and / or ToMV, but they were still severely affected and showed symptoms similar to typical TMV / ToMV: while foliar symptoms were very similar to TMV / ToMV symptoms, fruit symptoms were much more frequent and severe than the usual symptoms of these viruses, with lesions and deformations in the fruit. Fruit quality was very poor and the fruit was not very marketable. Salem et al. (Arch. Virol. 161(2), 503–506, 2015) extracted RNA from the fruit and leaves of symptomatic, infected plants in Jordan and performed several tests that led to the identification of a new species of Tobamovirus, the sequence of which corresponds to the GenBank accession number.KT383474 (SEQ ID No: 25); Salem et al. proposed naming this Jordanian virus Tomato Brown Rugose Fruit Virus (TBRFV or ToBRFV). Comparison with other Tobamovirus sequences showed that this is indeed a Tobamovirus, but not a TMV or ToMV. Resistance to TMV and / or ToMV does not confer resistance to this new TBRF virus. Luria et al (PLoS One.2017; 12 (1): e0170429) have isolated and simultaneously sequenced the complete genome of the Israeli tobamovirus that infects tomatoes in Israel, corresponding to GenBank accession number KX619418 (SEQ ID No: 26). They have thus shown a very high sequence identity between the Israeli and Jordanian viruses (more than 99% sequence identity) and have concluded that these are two different isolates of the Tomato Brown Rugose Fruit Virus. The virus was recently identified in Europe, particularly in Sicily, Germany, and the Netherlands, as well as in Mexico, and is now considered a major global threat to tomato cultivation. The identified strain appears to be the Israeli strain, rather than the Jordanian strain. In Israel, the inventors of this study collected and sequenced seven isolates representative of all crop-producing areas (north, central, and south). Sequence comparison with the sequence of the Jordanian ToBRFV appears to indicate that all Israeli isolates are essentially, but not entirely, identical to the Jordanian isolate, thus confirming that they are likely to be considered two different strains of the same virus in both countries. In a prior application, the inventors herein have for the first time identified tomato plants which exhibit tolerance to the Tomato Brown Rugose Fruit Virus and have been able to locate and identify genetic determinants, also referred to herein as QTL (Quality Trait Locus) Quantitative) leading to tolerance to Tomato Brown Rugose Fruit Virus. Two QTLs, namely QTL1 and QTL2, are located on chromosomes 6 and 9 respectively and independently or in combination confer enhanced tolerance in the fruit of a tomato plant infected or likely to be infected by TBRFV when homozygous in an ancestor of S. lycopersicum. A third QTL, QTL3, is located on chromosome 11 and confers enhanced tolerance in the leaves of a tomato plant infected or likely to be infected by TBRFV when homozygous. These QTLs are those referred to and described in PCT patent application WO2018 / 219941. These QTLs will be referred to as tolerance QTLs in the following description. While these QTLs, either alone or in combination, provide tolerance to TBRFV, the inventors have now established that, most of the time, they cannot confer resistance to tomato plants, especially not enough to delay, reduce, or inhibit virus replication or multiplication in the leaves. In fact, plants infected with one or more tolerance QTLs still spread the virus, which remains a threat to all surrounding tomato plants that do not carry these QTLs. Since Tobamoviruses are not easily controlled except through genetic improvement by identifying and using resistant genes in breeding, and since the resistance genes currently available to control TMV and / or ToMV are useless against the damage and spread of the new Tomato Brown Rugose Fruit Virus, and tolerance QTLs are able to stop or sufficiently reduce viral spread, there is an urgent need to identify resistance against this new Tobamovirus; otherwise, entire regions could no longer produce tomato crops. BRIEF DESCRIPTION OF THE INVENTION The inventors of the present have identified tomato plants that exhibit resistance to the Tomato Brown Rugose Fruit Virus and have been able to identify the combination of genetic determinants that lead to resistance to the Tomato Brown Rugose Fruit Virus, i.e., the combination of QTL (Quantitative Trait Locus) and gene that provides this increased resistance or tolerance. The resistance according to the present invention is conferred by the Tm-1 resistance gene when combined with genetic determinants or QTLs, wherein these QTLs confer tolerance only to Tomato Brown Rugose Fruit Virus (TBRFV) at the level of the leaves and / or fruits of tomato plants when not combined with the Tm-1 resistance gene. These QTLs or genetic determinants are described as being recessive in nature, according to WO2018 / 219941. The presence of the Tm-1 resistance gene in the homozygous state is not required, contrary to the main mode of action of the Tm-1 gene with respect to past resistance to TMV / ToMV, although this resistance has not yet been overcome by circulating TMV / ToMV strains. Fruit tolerance is imparted independently by QTL1 or QTL2 and foliar tolerance by QTL3; its transfer to different genetic backgrounds, i.e., to various tomatoes, can be easily carried out by a plant production expert, especially given the information regarding suitable markers associated with the QTLs provided in WO2018 / 219941. The same is also true for the Tm-1 gene. The present invention thus provides the combination of: - genetic determinants, also called here QTL or tolerance QTL, which, when present in the homozygous state, confer TBRFV tolerance phenotypes at the level of the leaves and / or fruits of tomato plants infected by TBRFV and - the Tm-1 gene, where this combination provides resistance to TBRFV, in particular the ability to slow, reduce and / or inhibit viral replication, whereas none of the QTLs alone or in combination, nor the Tm-1 gene alone, provides that level of resistance or increased tolerance. The present invention also relates to commercial S. lycopersicum plants exhibiting resistance to TBRFV, as well as to methods for producing or identifying S. lycopersicum plants or populations (germplasm) exhibiting TBRFV resistance. The present invention further describes molecular genetic markers, particularly SNPs, linked to tolerance QTLs and the Tm-1 gene, which can be used in any selection method to obtain the plant of the invention. Plants obtained through the methods and uses of these molecular markers are also provided. The invention also provides several methods for improving the yield of tomato production in an environment infested by TBRFV and methods for protecting a tomato field against TBRFV infestation. Definitions: The term “Resistance,” as defined by the Vegetable and Ornamental Crops Section of the ISF (International Seed Federation), describes the response of plants to pests or pathogens and abiotic stresses for the vegetable seed industry. Specifically, resistance refers to the ability of a plant variety to restrict the growth and development of a specific pest or pathogen and / or the damage they cause when compared to susceptible plant varieties under similar environmental conditions and pest and pathogen pressure. Resistant varieties may exhibit some symptoms or damage from the disease under heavy pest or pathogen pressure. The term “Tolerance” is used herein to indicate a plant phenotype in which at least some disease symptoms remain absent after the plant has been exposed to an infectious dose of virus. Therefore, the presence of systemic or local infection, viral replication, or at least the presence of viral genomic sequences in plant cells and / or their genomic integration can be established, at least under some growing conditions. Tolerant plants are thus resistant to symptom expression but are asymptomatic carriers of the virus. Sometimes, viral sequences may be present or even multiply in the plants without causing disease symptoms. It should be understood that a tolerant plant, even when infected by the virus, is generally capable of withstanding at least moderate viral growth and development. In the case of TBRFV, leaf tolerance refers to the phenotype of a plant where disease symptoms on the leaves remain absent after the plant has been exposed to an infectious dose of TBRFV. However, disease symptoms on the fruit may be present in infected plants. Fruit tolerance, in the case of TBRFV, means the phenotype of a plant where symptoms of the fruit disease remain absent after the plant has been exposed to a dose MA / a / ZUZl / U1 0400 infectious TBRFV. Symptoms of the disease on the leaves may be present on infected plants. Symptoms of TBRFV infection on leaves typically include mosaic patterns, distortion of small leaves, and in many cases, leaf spots. Symptoms of TBRFV infection on fruit generally include characteristic yellow lesions and fruit deformation. In many cases, "chocolate-colored spots" are also present on the fruit. Susceptibility: The inability of a plant variety to restrict the growth and development of a specific pest or pathogen; a susceptible plant exhibits the damaging symptoms linked to virus infection, i.e., foliar damage and fruit damage in the case of TBRFV infection. A S. lycopersicum plant susceptible to Tomato Brown Rugose Fruit Virus (TBRFV) is, for example, the commercially available variety Candela, as mentioned in the 2015 publication by Salem et al. Hazera lines No. 2 and Hazera No. 4, mentioned in PCT patent application WO2018 / 219941, are also susceptible. All commercially available tomato varieties grown in TBRFV-infected areas are, to date (i.e., prior to the present invention), susceptible to TBRFV or, at best, tolerant to plants carrying tolerance QTLs, such as the deposited seeds of HAZTBRFVRES1. A sample of this S. lycopersicum seed has been deposited by Hazera Seeds Ltd., Berurim, MPShimim 79837, Israel, in accordance with and in satisfaction of the requirements of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Proceedings (“the Budapest Treaty” with the National Collection of Industrial, Food and Marine Bacteria (NCIMB) (NCIMB, Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, United Kingdom) of 16 May 2017 under accession number 42758. A plant according to the invention thus has at least improved resistance or increased tolerance to the Tomato Brown Rugose Fruit Virus, with respect to the Candela variety and more generally with respect to any commercial variety of tomato growing in an area infected by the Tomato Brown Rugose Fruit Virus, including the tolerant plant and with respect to HAZTBRFVRES1. As used herein, the term “offspring” or “progeny” refers to any plant resulting from vegetative or sexual reproduction of one or more parent plants or their descendants. For example, a descendant plant can be obtained by cloning or self-fertilization of a parent plant, or by crossing two parent plants, including self-fertilization, as well as F1 or F2 and even further generations. An F1 is a first-generation offspring produced from parents, at least one of which is used for the first time as a donor of a trait, while second-generation (F2) or subsequent generations (F3, F4, etc.) are specimens produced from self-fertilization of F1, F2, etc.An F1 can be (and usually is) thus a hybrid resulting from a cross between two true breeding parents (the true breeder is homozygous for a trait), while an F2 can be (and usually is) an offspring resulting from the self-pollination of F1 hybrids. As used herein, the term “cross,” “crossing,” “cross-pollination,” or “crossbreeding” refers to the process by which pollen from one flower of a plant is applied (artificially or IVlA / a / ZUZ I / UI O4OJ natural) to the ovule (stigma) of a flower on another plant. As used herein, the term “genetic determinant” and / or “QTL” refers to any segment of DNA associated with a biological function. Thus, QTLs and / or genetic determinants include, but are not limited to, genes, coding sequences, and / or regulatory sequences required for their expression. QTLs and / or genetic determinants may also include unexpressed DNA segments that, for example, form recognition sequences for other proteins. As used herein, the term “genotype” refers to the genetic makeup or appearance of an individual cell, cell culture, tissue, organism (e.g., a plant), or group of organisms. As used herein, the term “grafting” is the operation by which a rhizome is grafted onto a scion. The primary reason for grafting is to avoid damage from soilborne pests and pathogens when genetic or chemical approaches to disease management are unavailable. Grafting a susceptible scion onto a resistant rhizome can provide a crop without the need to produce resistance in the crop. In addition, grafting can increase tolerance to abiotic stress, boost yield, and result in more efficient use of water and nutrients. As used herein, the term “heterozygote” refers to a diploid or polyploid individual cell or plant that has different alleles (forms of a given gene, determinant, or genetic sequences) present at at least one locus. As used herein, the term “heterozygous” refers to the presence of different alleles (forms of a given gene, determinant, or genetic sequences) at a particular locus. As used herein, “homologous chromosomes” or “homologs” refers to a set of maternal and paternal chromosomes that pair up with each other during meiosis. These copies have the same genes at the same loci and the same centromere location. As used herein, the term “homozygous” refers to an individual cell or plant that has the same alleles at one or more loci on all homologous chromosomes. As used herein, the term “homozygous” refers to the presence of identical alleles at one or more loci on homologous chromosomal segments. As used herein, the term “hybrid” refers to any individual cell, tissue, or plant resulting from a cross between parents that differ in one or more genes. As used herein, the term “locus” (plural: “loci”) refers to any genetically defined site, which may be a single position (nucleotide) or a chromosomal region. A locus may be a gene, a genetic determinant, a part of a gene, or a DNA sequence, and may be occupied by different sequences. A locus may also be defined by a single nucleotide polymorphism (SNP), by several SNPs, or by two flanking SNPs. As used herein, the term “rhizome” is the lower part of a plant capable of receiving a shoot in a grafting process. As used herein, the term “scion” is the top part of a plant that can be grafted onto a rhizome in a grafting process. BRIEF DESCRIPTION OF THE FIGURES Figure 1: Results of the first ELISA tests performed at 45 DPI (“Microlab” 1st score at MA / a / ZUZl / U1 O4OJ DPI) that illustrate the presence or absence of TBRFV coating protein in leaves of tested plants. This figure reports the optical density, measured at 405 nm in the ELISA test, for 4 different plants. Figure 2: Results of ELISA tests performed at 75 DPI (“Microlab” 2d0score at 75 DPI) illustrating the presence or absence of TBRFV coating protein in leaves of tested plants. This figure reports the optical density, measured at 405 nm in the ELISA test, for 4 different plants. Figure 3: Results of ELISA tests performed at approximately 110 DPI illustrating the presence or absence of TBRFV coating protein in leaves of tested plants. This figure reports the optical density, measured at 405 nm in the ELISA test, for 4 different plants. Figure 4: Results of ELISA tests performed at 70 DPI on different QTL combinations, illustrating the presence or absence of TBRFV coating protein in leaves of tested plants. Figure 5: Results of ELISA tests performed at 91 DPI on different QTL combinations, illustrating the presence or absence of TBRFV coating protein in leaves of tested plants. Figure 6: Results of the evaluation of foliar symptoms 31 days after ToBRFV inoculation. Ch11-S, Ch11-H, Ch11-R respectively mean absence of QTL3 on chromosome 11 (S), heterozygous presence of QTL3 (H) or homozygous presence of QTL3 (R). Ch9-S, Ch9-H, Ch9-R respectively mean absence of QTL2 on chromosome 9 (S), heterozygous presence of QTL2 (H) or homozygous presence of QTL2 (R). Tm1-S, Tm1-H, Tm1-R respectively means absence of Tm-1 gene on chromosome 2 (S), heterozygous presence of the Tm1 gene (H) or homozygous presence of the Tm1 gene (R). Figure 7: Results of ELISA tests performed at 35 DPI on different QTL combinations, illustrating the presence or absence of TBRFV coating protein in leaves of tested plants. This figure reports the optical density, measured at 405 nm in the ELISA test. The QTL and Tm1 gene combinations are as explained in Figure 6. Figure 8: Results of the fruit symptom assessment 112 days after ToBRFV inoculation. The tested genotypes are as detailed for Figure 6. DETAILED DESCRIPTION OF THE INVENTION The inventors hereof have demonstrated that the three QTLs described in WO2018 / 219941, which, when homozygous present in a S. lycopersicum plant, alone or in combination, provide enhanced tolerance in the fruit and / or leaves of a tomato plant infected or likely to be infected by Tomato Brown Rugose Fruit Virus (TBRFV or ToBRFV hereafter), are not entirely capable of restricting the spread of the virus. In fact, they have found that virus replication generally occurs within such plants, as evidenced by the detection of these viral genomic sequences in plant cells. These plants are thus carriers of the virus and are unable to limit the spread of the virus from plant to plant. The three QTLs described in WO2018 / 219941, namely QTL1, QTL2, and QTL3, on chromosomes 6, 9, and 11 respectively, will be referred to hereafter as the “tolerance QTLs.” More specifically, QTL1 and QTL2 will be referred to as the “fruit tolerance QTLs,” and QTL3 on chromosome 11 as the “foliar tolerance QTL.” The inventors hereof have unexpectedly found that combining at least one of the tolerance QTLs, namely QTL1, QTL2, and / or QTL3, with the resistance gene Tm-1 confers tolerance or enhanced resistance in tomato against TBRFV, particularly against the Israeli isolated strain, reduces the viral titer in tomato plants, inhibits virus propagation, delays viral progression and thus any associated symptoms, and / or increases the level of resistance. Specifically, resistance is improved or increased compared to the corresponding plant lacking the Tm-1 resistance gene with respect to at least one of the criteria comprising viral titer, viral progression, foliar infection symptoms, or fruit infection symptoms. According to a preferred modality, at least one of the tolerance QTLs is present homozygous, for example QTL3, especially if there is only one QTL. Furthermore, it is also preferred that at least two tolerance QTLs be combined with the Tm1 gene; in that case, at least one QTL is advantageously present heterozygous, for example, QTL2. According to one modality, there are 2 or 3 of the tolerance QTLs, in combination with the Tm-1 gene, and at least one QTL is present homozygous and at least one heterozygous. It should be noted that the Tm-1 resistance gene, although previously identified as a resistance gene against TMV and ToMV, no longer provides resistance to circulating ToMV / TMV strains, since these strains have mutated to evade this resistance. The presence of the Tm-1 resistance gene in the plants of the invention therefore does not confer resistance against ToMV and / or TMV to these plants, particularly to commercially important plants specifically threatened by circulating ToMV / TMV strains. As demonstrated in the examples, the phenotype of the plants according to the invention is resistant to TBRFV, i.e., foliar and / or fruit resistance, and the plants of the invention are able to improve the restriction of viral propagation, in at least some stages after infection. Enhanced restriction of viral spread means that the level of viral sequences (e.g., as detected by qRT-PCR) or protein detected in a plant, as measured by ELISA around 70–90 days post-inoculation (DPI), is at least 50% lower than the level of viral sequences detected in a susceptible plant or a tolerant but not resistant plant at the same time using the same technique, preferably at least 60%, 70%, or 80% lower. The level of viral protein sequences can also be measured around 30 DPI; the level is considered lower if it is at least 20% lower than the level measured in a susceptible plant. According to a first aspect, the invention is thus directed to a Solanum plant IVIA / a / ¿U¿ I / UI O4OJ lycopersicum, resistant to the Tomato Brown Rough Fruit Virus (TBRFV), comprising in its genome the combination of: - the Tm-1 resistance gene, homozygous or heterozygous and - at least one quantitative tolerance trait (QTL) locus, present either homozygous or heterozygous. Preferably, there are at least two QTLs, preferably one present homozygous and one present heterozygous. The invention is also directed to a cell of these plants, as well as to the seeds comprising said QTLs in combination with a Tm-1 gene. The tolerance QTL must be chosen from the group consisting of QTL3 on chromosome 11, QTL1 on chromosome 6, and QTL2 on chromosome 9. Each of these tolerance QTLs independently confers foliar and / or fruit resistance to TBRFV and confers enhanced resistance or tolerance to TBRFV when combined with the Tm-1 gene. The tolerance QTLs are present in the genome of a plant from the seeds HAZTBRFVRES1, accession number NCIMB 42758. The Tm-1 gene is as defined, inter alia, in the publication by Ishibashi et al, 2007 (An inhibitor of viral RNA replication encoded by a plant resistance gene. PNAS August 21, 2007 104 (34) 13833-13838); preferably the 'Tm-T gene' refers to a genetic sequence that encodes a protein having the Tm-1 activity reported in the article, i.e. the ability to inhibit viral replication of a Tm-1-sensitive wild-type ToMV strain, for example the ToMV-L strain described in this article.According to a preferred embodiment, the Tm-1 gene according to the invention is a gene encoding a protein having the 754 amino acid sequence reported in Ishibashi et al, corresponding to SEQ ID No: 19 (NCBI BAF75724) or a protein having at least 75%, preferably at least 80%, more preferably at least 85%, 90% or 95% sequence identity with SEQ ID No: 19 and exhibiting the Tm-1 activity reported in Ishibashi et al, 2007, i.e., the ability to inhibit viral RNA replication of a wild-type Tm-1-sensitive ToMV strain. According to a preferred embodiment, this gene has a sequence corresponding to the mRNA sequence referred to in Ishibashi et al, 2007, namely the sequence NCIB AB287296 (SEQ ID No: 20) or a sequence having at least 50%, preferably at least 60%, at least 70%, more preferably at least 75%, 80%, 85%, 90% or 95% sequence identity with SEQ ID No: 20.Regardless of the degree of sequence identity with SEQ ID No: 20, a Tm-1 gene according to the invention preferably encodes a protein exhibiting the Tm-1 activity reported in Ishibashi et al, 2007, i.e., the ability to inhibit wild-type ToMV viral RNA replication. It is preferred that, in the genome of the plant, seed or cell of the invention, the Tm-1 gene be present on chromosome 2. The present invention, however, also covers the plant, seeds or cell comprising the Tm-1 gene at a locus which does not correspond to the locus mentioned in Ishibashi et al, 2007. The invention thus encompasses plants, cells, or seeds of S. lycopersicum, comprising in their genome various combinations of QTL1, QTL2, and QTL3, preferably at least one QTL being in a homozygous state and / or at least one in a heterozygous state, in association with the Tm-1 gene. Preferably, there are at least two QTLs, with at least one in the homozygous state and at least one in the heterozygous state. The invention thus encompasses plants comprising the combination of QTL3 and Tm-1, the combination of QTL1 and Tm-1, the combination of QTL2 and Tm-1, the combination of QTL3, QTL1, and Tm-1, the combination of QTL3, QTL2, and Tm-1, the combination of QTL1, QTL2, and Tm-1, and the combination of QTL1, QTL2, QTL3, and Tm-1. The particularly preferred combinations are QTL3 and Tm-1 and QTL2, QTL3 and Tm-1.Different alternative combinations are described in Table 1 below; it is particularly preferred that QTL3 be present in the homozygous state and QTL2 in the heterozygous state. The Tm-1 resistance gene can be found in either the heterozygous or homozygous state. A preferred combination is, for example, QTL3 in the homozygous or heterozygous state, QTL2 in the heterozygous state, and Tm-1 homozygous. It should be understood that, in the context of the present invention, preferably at least one of the tolerance QTLs is found in a homozygous state in the plant genome, while the Tm-1 resistance gene can be found in a heterozygous or homozygous state. According to one embodiment, QTL2 on chromosome 9 is present in a heterozygous state in a plant according to the invention. In another preferred embodiment, the plant comprises homozygous QTL3, in combination with either homozygous or heterozygous Tm-1. This plant may also advantageously comprise QTL2, preferably heterozygous. According to a preferred embodiment, the Tm-1 resistance gene is also found in the homozygous state. In a preferred embodiment, a plant thus comprises QTL3 and Tm-1 in the homozygous state and QTL2 in the heterozygous state. The tolerance QTLs according to the invention, namely QTL1, QTL2 and QTL3, confer resistance to TBRFV when combined with the Tm-1 gene and confer tolerance to TBRFV in the absence of that combination, are selected from those present in the seed genome of HAZTBRFVRES1. A sample of this S. lycopersicum seed was deposited by Hazera Seeds Ltd., Berurim, MP Shikmim 79837, Israel, in accordance with and in satisfaction of the requirements of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Proceedings (“The Budapest Treaty”) with the National Collection of Industrial, Food and Marine Bacteria (NCIMB) (NCIMB, Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, United Kingdom) on May 16, 2017, under accession number 42758. A deposit of this tomato seed is held by Hazera Seeds Ltd., Berurim, MP Shikmim 79837, Israel. The tolerance QTLs that confer tolerance to TBRFV and that confer resistance when combined with the Tm-1 gene are located on chromosome 6 for QTL1, on chromosome 9 for QTL2, and on chromosome 11 for QTL3. They are most preferentially located within a chromosomal interval of chromosome 6 comprising SNP TO-0005197 (SEQ ID No: 1) and SNP TO-0145581 (SEQ ID No: 2) for QTL1, within a chromosomal interval of chromosome 9 comprising SNP TO-0180955 (SEQ ID No: 3) and SNP TO-0196109 (SEQ ID No: 6) for QTL2, and within a chromosomal interval of chromosome 11 comprising SNP TO-0122252 (SEQ ID No: 7) and SNP TO-0162427 (SEQ ID No: 18) for QTL3. The specific polymorphisms corresponding to the SNPs (Single Nucleotide Polymorphisms) referred to in this description, as well as the flanking sequences of these SNPs in the S. lycopersicum genome, are provided in the experimental section (see Tables 3 and 4) and the accompanying sequence listing. Their location with respect to version 2.40 of the tomato genome, on chromosomes 6, 9, and 11, is indicated in Table 3, and their flanking sequences are also illustrated in Table 4, in the sequence listing. It should be noted in this regard that, by definition, a SNP refers to a single nucleotide in the genome, which varies depending on the allele in which it is present, while the flanking nucleotides are identical. To facilitate the clear identification of the position of the different SNPs, their positions are provided in Tables 3 and 4, with reference to the tomato genome sequence in its 2.40 version and with reference to their flanking sequences, identified by the SEQ ID number. In the sequence associated with a specific SNP in this application, for example, SEQ ID No: 1 for SNP TO0005197, only one nucleotide within the sequence actually corresponds to the polymorphism; that is, nucleotide 61 of SEQ ID No: 1 corresponds to the polymorphic position of SNP TO-0005197, which can be T or C, as indicated in Table 4.The flanking sequences for the SNP placement in the genome are provided but are not part of the polymorphism as such. The inventors of the present have identified that the tolerance QTLs responsible for increased resistance or tolerance when combined with the Tm-1 gene must be located in the chromosomal regions mentioned above, identifying the presence of sequences at different loci along said region, i.e., at 18 different loci defined by the following 18 SNPs: TO-0005197 (SEQ ID No:1) and TO-0145581 (SEQ ID No:2) for QTL1 on chromosome 6, TO-0180955 (SEQ ID No:3), TO0196724 (SEQ ID No:4), TO-0145125 (SEQ ID No:5) and TO-0196109 (SEQ ID No:6) for QTL2 on chromosome 9 and TO-0122252 (SEQ ID No:7), TO-0144317 (SEQ ID No:8), TO-0142270 (SEQ ID No:9), TO0142294 (SEQ ID No:10), TO-0142303 (SEQ ID No:11), TO-0142306 (SEQ ID No:12), TO-0182276 (SEQ ID No:13), TO-0181040 (SEQ ID No:14), TO-0123057 (SEQ ID No:15), TO-0125528 (SEQ ID No:16), TO0162432 (SEQ ID No:17) and TO-0162427 (SEQ ID No:18) for QTL3 on chromosome 11. These 18 SNPs are genetically associated or linked to at least one of the tolerance QTLs. Genetic association, or more specifically genetic linkage, means that a genetic polymorphism of the marker (i.e., a specific allele of the SNP marker) and the phenotype of interest occur simultaneously, that is, they are inherited together, more frequently than would be expected based on the probability of occurrence. In other words, there is a non-random association of the allele and the corresponding genetic sequences for the phenotype, as a result of their proximity on the same chromosome. A molecular marker of the invention, any of the 18 markers described above or alternative markers, is inherited with the phenotype of interest in preferably more than 90% of meioses, preferably in more than 95%, 96%, 98% or 99% of meioses. According to another embodiment of the invention, the tolerance QTLs present in the genome of a plant, seed, or cell of the invention should preferably be located at least one or more of the 18 loci spanning the 18 SNPs mentioned above, namely, the locus spanning TO-0005197 (SEQ ID No:1), the locus spanning TO-0145581 (SEQ ID No:2) for QTL1 on chromosome 6, the locus spanning TO-0180955 (SEQ ID No:3), the locus spanning TO-0196724 (SEQ ID No:4), the locus spanning TO13 0145125 (SEQ ID No:5), the locus spanning TO-0196109 (SEQ ID No:6), for QTL2 on chromosome 9, the locus spanning TO-0122252 (SEQ ID No:7), the locus spanning TO-0144317 (SEQ ID No:8), the locus spanning TO-0142270 (SEQ ID No:9), the locus spanning TO-0142294 (SEQ ID No:10), the locus spanning TO-0142303 (SEQ ID No:11), the locus spanning TO-0142306 (SEQ ID No:12), the locus spanning TO-0182276 (SEQ ID No:13), the locus spanning TO-0181040 (SEQ ID No:14), the locus spanning TO0123057 (SEQ ID No:15), the locus encompassing TO-0125528 (SEQ ID No:16), the locus encompassing TO-0162432 (SEQ ID No:17) and the locus encompassing TO-0162427 (SEQ ID No:18) for QTL3 on chromosome 11. In one embodiment, in a tomato plant according to the invention, the QTLs present in the genome of the plant, seed or cell of that tomato plant and which will be combined with the Tm-1 gene, should preferably be located at least at one or more of the following loci: the locus encompassing TO0005197, the locus encompassing TO-0145581 for QTL1 on chromosome 6 and / or the locus encompassing TO0180955, the locus encompassing TO-0196724, the locus encompassing TO-0145125 and the locus encompassing TO0196109 for QTL2 on chromosome 9. In another embodiment of the invention, the QTLs present in the genome of a tomato plant, seed, or cell, which will be combined with the Tm-1 gene, must preferably be located at least at one or more of the following loci: the locus encompassing TO-0122252, the locus encompassing TO-0144317, the locus encompassing TO-0142270, the locus encompassing TO-0142294, the locus encompassing TO-0142303, the locus encompassing TO-0142306, the locus encompassing TO-0182276, the locus encompassing TO-0181040, the locus encompassing TO-0123057, the locus encompassing TO-0125528, the locus encompassing TO-0162432, and the locus encompassing TO-0162427 for QTL3 on the chromosome 11. The alleles of the 18 SNPs linked to tolerance QTLs that confer TBRFV tolerance are the T allele of TO-0005197, the C allele of TO-0145581, the G allele of TO-0180955, the C allele of TO-0196724, the G allele of TO-0145125, the G allele of TO-0196109, the T allele of TO-0122252, the C allele of TO-0144317, the T allele of TO-0142270, the G allele of TO-0142294, the A allele of TO-0142303, the A allele of TO-0142306, the G allele of TO-0182276, the G allele of TO-0181040, the G allele of TO-0123057, and the A allele of TO-0125528, the C allele of TO-0162432, and the T allele of TO-0162427. The presence of the tolerance QTLs can be revealed by the presence of the specific alleles. The alleles of these SNPs can thus reflect the presence of the tolerance QTLs according to the invention, which will combine with the Tm-1 gene. According to a preferred embodiment of the present invention, the QTLs conferring tolerance to TBRFV, which are combined with the Tm-1 gene, are located on one or more chromosomal intervals determined by the SNPs as described. According to this embodiment, QTL1 is located on a chromosomal interval of chromosome 6 bounded on one side by SNP TO-0005197 and on the other side by SNP TO-0145581. According to another modality, QTL2 is located on a chromosomal interval of chromosome 9 delimited on one side by SNP TO-0180955 and on the other side by SNP TO-0196109. According to another scenario, QTL3 is located on a chromosomal range of chromosome 11 bounded on one side by the SNP TO-0122252 and on the other side by TO-0162427. The most preferred chromosomal ranges on chromosome 11 within which QTL3 can be found are the range bounded by TO-0144317 and TO-0125528, the range bounded by TO-0142270 and TO-0162432, the / U1 0400 range bounded by TO-0144317 and TO-0162432, and the range bounded by TO-0142270 and TO-0125528. The even more preferred range is the range bounded by TO-0142270 and TO-0125528. Another preferred interval is the interval bounded by TO-0142294 and TO-0125528. It should be noted in this regard that specific positions on a chromosome can actually be defined with respect to single nucleotide polymorphisms, whereas the flanking sequences of SNPs are defined to unambiguously place them on the genome. The inventors of the present invention have used SNPs, identified by their flanking sequences, with different alleles, to identify and track the QTLs of the present invention. A chromosomal region delimited by two SNPs X and Y refers to the section of the chromosome that lies between the positions of those two SNPs and comprises the SNPs; therefore, the nucleotide sequence of this chromosomal region begins with the nucleotide corresponding to SNP X and ends with the nucleotide corresponding to SNP Y, i.e., the SNPs are contained within the region they delimit, in the sense of the invention. In a plant, seed, or cell of the invention, the presence of the tolerance QTLs, which will be combined with the Tm-1 resistance gene, is preferably characterized by TO-0005197 and / or TO-0145581 for QTL1 on chromosome 6 and / or by TO-0180955, TO-0196724, TO-0145125 and / or TO-0196109 for QTL2 on chromosome 9 and / or by TO-0122252, TO-0144317, TO-0142270, TO-0142294, TO-0142303, TO-0142306, TO-0182276, TO-0181040, TO-0123057, TO-0125528, TO-0162432 and TO-0162427, more preferably TO-0142294, TO-0142303, TO-0142306, TO-0182276, TO-0181040, TO-0123057, TO0125528 and even more preferably TO-0182276, for QTL3 on chromosome 11. When present homozygous in the genome of a tomato plant, QTL1 and / or QTL2 will independently and collectively confer fruit tolerance to TBRFV and QTL3 will confer leaf tolerance to TBRFV, unless combined with the Tm-1 resistance gene to confer resistance or increased tolerance to TBRFV according to the invention. The tolerance QTLs as defined above are in combination with the Tm-1 gene, in the genome of a plant, seed or cell of the invention. The Tm-1 gene may be present heterozygous or homozygous in the gene of a plant, seed, or cell of the invention. However, it is preferred that the gene be present homozygous. The inventors of the present invention have also found suitable markers for detecting the presence of the Tm-1 gene in the genome of a plant, seed, or cell of the invention. The presence of the Tm-1 resistance gene, which is to be combined with one or more tolerance QTLs, is preferably characterized by the SNP TO-0200838 (SEQ ID No: 21). The allele of the SNP TO-0200838 corresponding to the Tm-1 gene is the A allele of TO-0200838. The presence of the Tm-1 gene that confers resistance to TBRFV when combined with at least one QTL of tolerance requires to be revealed by the presence of the specific allele. According to one embodiment, a plant, cell, or seed of S. lycopersicum according to the invention also comprises in its genome a Tm-2 resistance gene, specifically the Tm-2 or Tm22 allele (also known as Tm-2a). The Tm-2 and Tm-22 alleles are well known to those knowledgeable readers and are described in detail in the literature. These Tm-2 or Tm-22 alleles are found homozygous or heterozygous in the genome of a plant, cell, or seed according to the invention, but preferably heterozygous. In a preferred embodiment, a plant of the invention comprises a Tm-2 gene, preferably a Tm-22 allele, on one homolog of chromosome 9 and QTL2 on the other homolog. This plant further comprises homozygous for at least one of QTL1 and QTL3, more preferably QTL3. This plant also comprises the Tm-1 gene, either homozygous or heterozygous. Alternatively, although less preferred, a plant, seed, or cell according to the invention does not exhibit resistance to TMV or ToMV insofar as the Tm-1 resistance gene does not provide resistance to TMV or ToMV to most circulating strains of TMV and ToMV, especially since it does not comprise a Tm-2 resistance gene. The invention covers tomato plants, comprising for example the genotype combinations according to Table 1, where “Hom” means homozygous for the tolerance QTL or resistance gene, “Het” means heterozygous for the tolerance QTL or resistance gene, and “0” means absence of the tolerance QTL or resistance gene. Table 1: Preferred genotypes according to the invention: # QTL1 QTL2 QTL3 Tm- 1 1 Hom 0 0 Het 2 0 Hom 0 Het 3 0 0 Hom Het 4 Hom 0 0 Hom 5 0 Hom 0 Hom 6 0 0 Hom Hom 7 Het 0 Hom Het 8 0 Het Hom Het 9 Het Het Hom Het 10 Het 0 Hom Hom 11 0 Het Hom Hom 12 Het Het Hom Hom 13 Hom 0 Hom Het # QTL1 QTL2 QTL3 Tm- 1 14 0 Hom Hom Het 15 Hom 0 Hom Hom 16 0 Hom Hom Hom 17 Hom Het Hom Het 18 Hom Het Hom Hom 19 Hom Het 0 Het 20 Hom 0 Het Het 21 Hom Het Het Het 22 Hom Het 0 Hom 23 Hom 0 Het Hom 24 Hom Het Het Hom 25 Het Het Het Hom 26 Het Het Het Het The presence of the homozygous or heterozygous state of the tolerance QTLs and the Tm-1 gene can be detected with the different SNP markers described in this description. Preferably, an S. lycopersicum plant according to the invention is a commercial plant or line. That plant or commercial line preferably also exhibits additional resistances such as nematode resistance (Mi-1 or Mi-j), as well as resistance to Fusarium and Verticillium. Other resistances or tolerances are also considered in accordance with the invention. According to a preferred embodiment, a plant of the invention is not resistant to Cucumber Mosaic Virus (PepMV). According to another embodiment, a tomato plant of the invention is also resistant to PepMV. According to another modality, a plant of the invention is a plant or seed or cell thereof determined, indeterminate or semi-indeterminate, that is, corresponding to the determined, indeterminate or semi-indeterminate growth habit. Determinate means that in determinate tomato plants, the foliage grows first, then flowers which mature into fruit if pollination is successful. All the fruit tends to ripen on the plant at approximately the same time. Indeterminate tomatoes begin by growing some foliage, then continue to produce foliage and flowers throughout the growing season. These plants will tend to have tomato fruit at different stages of maturity at any given time. Semi-determinate tomatoes have a phenotype between determinate and indeterminate; they are typical determinate types except that they grow larger than determinate varieties. According to another embodiment, a plant of the invention is used as a scion or rhizome in a grafting process. Grafting is a process that has been used for many years in crops such as cucurbits, but only more recently for tomatoes. Grafting can be used to provide a certain level of resistance to soilborne pathogens or certain nematodes. Grafting, therefore, aims to prevent contact between the plant or variety to be cultivated and infested soil. The variety of interest used as the scion or rootstock, optionally an F1 hybrid, is grafted onto the resistant plant used as a rhizome. The resistant rhizome remains healthy and provides, from the soil, the normal supply of nutrients to the graft, thus isolating it from diseases. Furthermore, the commercial plant of the invention yields fruits under suitable conditions, which are at least 25 grams at full maturity, preferably at least 100 g at full maturity or even more preferably at least 200 g at full maturity. As detailed above, the invention is directed to S. lycopersicum plants, which exhibit the TBRFV resistance phenotype, as well as to seeds that give rise to those plants. A plant or seed according to the invention may be a progeny or offspring of a hybrid between a plant grown from the deposited seeds HAZTBRFVRES1, deposited at the NCIMB under accession number NCIMB 42758, and an S. lycopersicum plant having the Tm-1 gene. The plants grown from the deposited seeds are actually homozygous for the tolerance QTLs, since they have the QTLs of interest in their genome on each of the homologs of chromosomes 6, 9, and 11. They can be used to combine these QTLs with the Tm-1 gene, as illustrated in the examples in this application, by crossing, self-fertilization, and / or backcrossing steps. With regard to the deposited seeds of HAZTBRFVRES1 (NCIMB 42758), it should be noted that these seeds do not correspond to a plant variety, are not homozygous for most genes except the tolerance QTLs; their phenotype is thus not fixed during propagation, except for the foliar and fruit tolerance of the invention; so that their phenotypic traits segregate during propagation, with the exception of foliar and fruit tolerance to TBRFV. According to one embodiment of the invention, the plant, seed, or cell is more specifically resistant to the Israeli strain of TBRFV. The Israeli strain of TBRFV is understood to be a strain of TBRFV as first identified and sequenced by Luria et al., that is, a strain that infects tomatoes and IVIA / a / ZUZ I / UI O4OJ, which has a sequence with a very high degree of sequence identity with KX619418 (SEQ ID No: 26), i.e., a degree of sequence identity with SEQ ID No: 26 that is greater than the degree of sequence identity with SEQ ID No: 25, thus a sequence identity greater than 99%, preferably greater than 99.5% or even greater. A plant, seed, or cell of the invention is thus, according to one embodiment, more resistant to the Israeli strain than to the Jordanian strain; for example, it is resistant only to the Israeli strain. The invention also relates to plants or seeds obtainable by transferring the tolerance QTLs from a *S. lycopersicum* plant comprising the tolerance QTLs, representative seeds of which were deposited under NCIMB accession number NCIMB-42758, into another genetic antecedent of *S. lycopersicum* comprising the Tm-1 gene, for example, by crossing the plant with a mother tomato plant comprising the Tm-1 gene and selecting plants that carry the tolerance QTLs or at least one of them and the Tm-1 gene. In this cross, QTL1, QTL2, and / or QTL3, or any combination thereof, could be transferred. According to one embodiment, only QTL1, only QTL2, or both QTL1 and QTL2 are transferred. According to another embodiment, QTL3 is transferred.Alternatively, QTL1 and QTL3, QTL2 and QTL3, or QTL1, QTL2 and QTL3, preferably QTL2 and QTL3, are transferred from deposited seeds of HAZTBRFVRES1 (NCIMB 42758) into a tomato genetic ancestor comprising the Tm-1 gene. Preferably, the resulting progeny is self-fertilized, so that at least one tolerance QTL is homozygous present in the resulting genome. According to a preferred embodiment, the plant comprises at least two QTLs selected from QTL1, QTL2 and QTL3, at least one being heterozygous; preferably at least one is homozygous. It should be noted that the seeds or plants of the invention can be obtained by different processes and are not obtained exclusively through an essentially biological process. Accordingly, the invention relates to a tomato plant or seed, preferably a non-natural tomato plant or seed, which may comprise two or more mutations in its genome, which provide the plant with resistance to the Tomato Brown Rugose Fruit Virus, wherein at least one mutation is, for example, present in the genome of the plants from which a representative sample was deposited with the NCIMB under deposit number NCIMB 42758 and at least one other mutation is located on chromosome 2 and corresponds to the sequence of a Tm-1 gene. In another embodiment, the invention relates to a method for obtaining a tomato plant or seed containing two or more mutations in its genome that confer resistance to the Tomato Brown Rugose Fruit Virus. This method is illustrated in Example 4 and may comprise: a) treat the M0 seeds of a tomato plant that will be modified with a mutagenic agent to obtain M1 seeds; b) grow the M1 seeds thus obtained to obtain M1 plants; c) produce M2 seeds by self-fertilization of M1 plants; and d) optionally repeat steps b) and c) n times until you obtain M1 +n seeds. M1+n seeds are grown into plants and subjected to infection by the Tomato Brown Rugose Fruit Virus. Surviving plants, or those with mild symptoms of TBRFV infection, are multiplied for one or more additional generations while continuing to be selected for their resistance to the fruit virus. MA / a / ZUZ 1 / Ul 0400 Rough Brown Tomato. M0 seeds are, for example, from a tomato plant that has the Tm-1 gene. In this method, the M1 seeds from step a) can be obtained via chemical mutagenesis such as EMS mutagenesis. Other chemical mutagenic agents include, but are not limited to, diethyl sulfate (des), ethyleneimine (ei), propane sultone, N-methyl-N-nitrosourethane (mnu), N-nitroso-N-methylurea (NMU), N-ethyl-N-nitrosourea (enu), and sodium azide. Alternatively, mutations are induced by irradiation, which is selected for example by x-rays, fast neutrons, UV radiation. In another embodiment of the invention, the mutations are induced by genetic engineering. These mutations also include the integration of sequences corresponding to the tolerance QTLs and the Tm-1 gene, as well as the substitution of resident sequences with alternative sequences that confer resistance to TBRFV. Preferably, the mutations are the integration of one or more of QTL1, QTL2, and QTL3 as described above, in the replacement of homologous sequences from S. lycopersicum plants and the integration of the Tm-1 gene, preferably on chromosome 2. Even more preferably, the mutation includes the substitution of the sequence comprised within SNP TO-0122252 (SEQ ID No: 7) and SNP TO-0162427 (SEQ ID No: 18) on chromosome 11 of the S. lycopersicum genome.lycopersicum or a fragment thereof, by the homologous sequence on chromosome 11 present in the genome of a plant from which a representative sample was deposited with the NCIMB under deposit number NCIMB 42758 and also includes the incorporation of the Tm-1 resistance gene, where the combination of the integrated sequences confers resistance to TBRFV. The substitution on chromosome 11 corresponding to QTL3 is preferably homozygous; the incorporation of the Tm-1 gene can be homozygous or heterozygous. The genetic engineering methods that can be used include the use of all those techniques called New Breeding Techniques, which are various novel technologies developed and / or used to create new characteristics in plants through genetic variation, with the objective being targeted mutagenesis, targeted introduction of new genes, or gene silencing (RdDM). Examples of these new breeding techniques are targeted sequence changes facilitated through the use of Zinc Finger Nuclease (ZFN) technology (ZFN-1, ZFN-2, and ZFN-3, see U.S. Patent No. 9,145,565), Oligonucleotide-Directed Mutagenesis (ODM), cisgenesis and intragenesis, grafting (on GM rhizomes), reverse breeding, agroinfiltration (agroinfiltration “sensu stricto”, agroinoculation, floral immersion), and Transcription Activator-Like Effector Nucleases (TALENs, see U.S. Patent Nos.8,586,363 and 9,181,535), the CRISPR / Cas system (see U.S. Patents Nos. 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,895,308; 8,906,616; 8,932,814; 8,945,839; 8,993,233; and 8,999,641), meganuclease-modified target-seeking endonucleases, DNA-guided genome editing (Gao et al., Nature Biotechnology (2016)), and synthetic genomics. A major part of targeted genome editing, another term for New Breeding Techniques, involves applications that induce double-strand breaks (DSBs) at a selected site in the genome where modification is desired. Targeted DSB repair enables targeted genome editing. These applications can be used to generate mutations (e.g., targeted mutations or precise native gene editing) as well as to precisely insert genes (e.g., cisgenes, intragenes, or transgenes).Applications that lead to mutations are frequently identified as site-directed nuclease (SDN) technology, such as SDN1, SDN2, and SDN3. For SDN1, the result is a targeted, non-specific deletion mutation: the position of the DNA DSB is precisely selected, but DNA repair by the host cell is random and results in deletions, additions, or substitutions of small nucleotides. For SDN2, an SDN is used to generate a targeted DSB, and a DNA repair template (a short DNA sequence identical to the targeted DSB DNA sequence except for one or a few nucleotide changes) is used to repair the DSB: this results in a targeted, predetermined point mutation in the desired gene of interest. As with SDN3, the SDN is used in conjunction with a DNA repair template containing the new DNA sequence (e.g., gene).The result of this technology would be the integration of that DNA sequence into the plant's genome. The application most likely to illustrate the use of SDN3 would be the insertion of cisgenic, intragenic, or transgenic expression cassettes at least at one selected location in the genome. A complete description of each of these techniques can be found in the report produced by the Joint Research Centre (JRC) Institute for Prospective Technological Studies of the European Commission in 2011, entitled “New plant breeding techniques - State-of-the-art and prospects for commercial development.” The invention in another aspect also relates to a plant that is likely to be obtained from seeds or plants of the invention as described above and also plant parts such as a plant and more preferably an explant, shoot, cutting, seed, fruit, root, rhizome, pollen, ovule, embryo, protoplasts, leaf, anther, stem, petiole and any other plant part, wherein the plant, explant, shoot, cutting, seed, fruit, root, rhizome, pollen, ovule, embryo, protoplasts, leaf, anther, stem, petiole, and / or plant part is obtainable from a seed or plant according to the first aspect of the invention, i.e., carrying one, two or three of the tolerance QTLs of interest, in combination with the Tm-1 gene.These plant parts, inter alia, explant, shoot, cutting, seed, fruit, root, rhizome, pollen, ovule, embryo, protoplasts, leaf, anther, stem or petiole, comprise in their genome the tolerance QTLs that confer the fruit and / or foliar tolerance phenotype to TBRFV when present homozygous in the absence of the Tm-1 gene and that confer resistance to TBRFV when present in combination with the Tm-1 gene. The tolerance QTLs referred to in this aspect of the invention are those defined above in the context of the plants of the invention. The different characteristics of the tolerance QTLs defined in relation to the first aspect of the present invention apply mutatis mutandis to this aspect of the invention. The tolerance QTLs are thus preferably chosen from those present in the genome of a plant corresponding to the deposited material HAZTBRFVRES1 (NCIMB accession number 42758).They are advantageously characterized by the presence of the T allele of TO-0005197, the C allele of TO-0145581, the G allele of TO-0180955, the C allele of TO-0196724, the G allele of TO-0145125, the G allele of TO-0196109, the T allele of TO-0122252, the C allele of TO-0144317, the T allele of TO-0142270, the G allele of TO-0142294, the A allele of TO-0142303, the A allele of TO-0142306, the G allele of TO-0182276, the G allele of TO-0181040, the G allele of TO-0123057, the A allele of TO-0125528, and the C allele of TO-0162432 and / or the T allele of TO-0162427, depending on the QTL of interest and preferably by the presence of this or those alleles in a homozygous manner. The presence of the Tm-1 resistance gene, which must be combined with one or more tolerance QTLs, is preferably characterized by the SNP TO-0200838 (SEQ ID 21), more specifically by the A allele of TO-0200838. TBRFV resistance is, advantageously, resistance to the Israeli strain of TBRFV. The invention also relates to S. lycopersicum plant cells, such that these cells comprise, in their genome, the combination of the Tm-1 gene, either homozygous or heterozygous, and at least one of the tolerance QTLs that confer the fruit and / or foliar tolerance phenotype to TBRFV when present homozygous in the absence of the Tm-1 gene, and that confer resistance to TBRFV when present in combination with the Tm-1 gene. The tolerance QTLs are those already defined in the description; they are characterized by the same features and preferred modalities already described with respect to plants and seeds according to the preceding aspects of the invention. The presence of these tolerance QTLs can be revealed by techniques described above and well known to those skilled in the field.It can be determined, inter alia, whether the QTLs are present homozygous or heterozygous in the genome of that cell of the invention. They are advantageously characterized by the presence of the T allele of TO-0005197, the O allele of TO-0145581, the G allele of TO-0180955, the C allele of TO-0196724, the G allele of TO-0145125, the G allele of TO-0196109, the T allele of TO-0122252, the C allele of TO-0144317, the T allele of TO-0142270, the G allele of TO-0142294, the A allele of TO-0142303, the A allele of TO-0142306, the G allele of TO-0182276, the G allele of TO-0181040, the G allele of TO-0123057, the A allele of TO-0125528, and the C allele of TO0162432 and / or the T allele of TO-0162427, depending on the tolerance QTL of interest and preferably by the presence of this allele or these alleles simultaneously on each chromosome, i.e., homozygous. Preferably, at least one QTL is present homozygous and at least one QTL is present heterozygous. According to one embodiment, QTL2 on chromosome 9 is heterozygous in a cell according to the invention. The other homolog of chromosome 9 according to a specific embodiment comprises a Tm-2 or Tm-22 gene or allele. That cell thereby exhibits resistance to TMV / ToMV. The preferred genotypes for a cell of the invention are described in Table 1. The presence of the Tm-1 resistance gene, which will combine with one or more tolerance QTLs, is preferably characterized by the SNP TO-0200838, more specifically by the A allele of TO0200838. The cells according to the invention can be any type of S. lycopersicum cell, inter alia, an isolated cell and / or a cell capable of regenerating a complete S. lycopersicum plant, having one or more of the tolerance QTLs of interest, preferably two tolerance QTLs and the Tm-1 gene. The present invention is also directed to a tissue culture of non-regenerable or regenerable plant cells as defined above in accordance with the present invention; preferably, the regenerable cells are derived from embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, stems, petioles, roots, root tips, fruits, seeds, flowers, cotyledons and / or hypocotyl of the invention and the cells contain the combination of the Tm-1 gene and one, two or three of the tolerance QTLs of interest, in any combination, homozygous or heterozygous in their genome, the QTLs, when present, conferring homozygous fruit tolerance to TBRFV for QTL1 and / or QTL2, foliar tolerance to TBRFV for QTL3 and conferring, when present in combination with Tm-1, MA / a / ZUZl / U1 0400 increased resistance or tolerance to TBRFV. The tissue culture will preferably be capable of regenerating plants that have the physiological and morphological characteristics of the aforementioned tomato plant and of regenerating plants that have substantially the same genotype as the aforementioned tomato plant. The present invention also provides tomato plants generated from tissue cultures of the invention. The invention also provides a protoplast of the above-defined plant or tissue culture, the protoplast containing the combination of the Tm-1 gene and the tolerance QTLs that confer resistance to TBRFV. According to another aspect, the present invention is also directed to the use of a tomato plant of the invention, which preferably homozygously comprises at least one of the QTLs of the invention and also preferably homozygously comprises the Tm-1 gene, as a breeding partner in a breeding program to obtain S. lycopersicum plants with TBRFV resistance. This breeding partner homozygously harbors at least one of the tolerance QTLs in its genome. By crossing this plant with a tomato plant, especially a line, it is possible to transfer one, two, or three of the tolerance QTLs, as well as the Tm-1 gene, to the progeny. A plant according to the invention can thus be used as a breeding partner to introgress the tolerance QTLs and the Tm-1 gene into S. lycopersicum plasma or germplasm.Although a plant or seed that has the tolerance QTLs or the Tm-1 gene heterozygously can also be used as a breeding partner as defined above, phenotype segregation may make the breeding program more complex. The introgressed tolerance QTLs and Tm-1 gene will be advantageously introduced into a variety that contains other desirable genetic traits such as disease resistance, especially TMV / ToMV resistance, early fruit ripening, drought tolerance, fruit shape, and the like. The invention also relates to the use of a plant or seed comprising at least one of the tolerance QTLs, preferably homozygous, such as an S. lycopersicum plant or seed deposited at the NCIMB under accession number NCIMB 42758 or its progeny, which is homozygous for the QTLs conferring tolerance to TBRFV infection, as a breeding partner in a breeding program with S. lycopersicum plants comprising the Tm-1 gene. This breeding program allows for obtaining TBRFV-resistant S. lycopersicum plants or seeds. In that breeding program, the selection of offspring that exhibit the desired TBRFV resistance phenotype or that have at least one of the tolerance QTLs and the Tm-1 gene can be advantageously carried out on the basis of SNP marker alleles, especially the SNP markers described above. A progeny of the plant is preferably selected for the presence of the T allele of TO-0005197 and / or the C allele of TO-0145581 for the presence of QTL1 on chromosome 6, the G allele of TO-0180955, the C allele of TO-0196724, the G allele of TO-0145125 and / or the G allele of TO-0196109 for the presence of QTL2 on chromosome 9, the T allele of TO-0122252, the C allele of TO-0144317, the T allele of TO-0142270, the G allele of TO-0142294, the A allele of TO-0142303, the A allele of TO-0142306, the G allele of TO-0182276, the G allele of TO-0181040, and the G allele of TO-0123057, allele A of TO-0125528, allele C of TO-0162432 and / or allele T of TO-0162427 for the presence of QTL3 on chromosome 11. The plant progeny is preferably selected for the presence of the same allele on both homologs of each chromosome. With regard to the presence of the Tm-1 gene, progeny is preferably selected on the basis of the A allele of TO-0200838. Selection can be based on the presence of any of the alleles of the 18 SNPs linked to the tolerance QTLs, or a combination of these alleles, in addition to selection for the presence of the Tm-1 gene. This selection will be based on the presence of the alleles of interest in a sample of genetic material from the plant being selected. In fact, the presence of these alleles actually confirms the presence of the tolerance QTLs at the loci defined by the SNPs. Furthermore, besides the event of mutation or point recombination, it is conceivable that at least one or two of these alleles will be lost, with the remaining chromosomal fragment containing the tolerance QTLs. A plant according to the invention is thus particularly valuable in marker-assisted selection for obtaining commercial tomato lines and varieties that have the improved phenotype of the invention. The invention also relates to a method for identifying, detecting, and / or selecting S. lycopersicum plants resistant to TBRFV, capable of inhibiting, reducing, or delaying virus replication and / or reducing the virus titer in the plant. This method comprises the step of detecting, in a plant to be tested or selected, the combination of the Tm-1 gene and at least one of the tolerance QTLs, where the QTLs are preferably present homozygous.The method may thus comprise the detection of at least one of the following markers: T allele of TO-0005197, C allele of TO-0145581, G allele of TO-0180955, C allele of TO-0196724, G allele of TO-0145125, G allele of TO-0196109, T allele of TO-0122252, C allele of TO-0144317, T allele of TO-0142270, G allele of TO-0142294, A allele of TO-0142303, A allele of TO-0142306, G allele of TO-0182276, G allele of TO-0181040, G allele of TO-0123057, A allele of TO-0125528, C allele of TO-0162432 or the T allele of TO-0162427, preferably in a homozygous state in a sample of genetic material from the plant to be identified and / or selected, as well as the detection of the Tm-1 gene.Preferably, the tolerance QTL is QTL3 and is detected by the presence of T of TO0122252, C allele of TO-0144317, T allele of TO-0142270, G allele of TO-0142294, A allele of TO-0142303, A allele of TO-0142306, G allele of TO-0182276, G allele of TO-0181040, G allele of TO-0123057, A allele of TO-0125528, C allele of TO-0162432 and T allele of TO-0162427, preferably in the homozygous state. Advantageously, the method comprises the detection of two tolerance QTLs, at least one of which is heterozygous and preferably at least one of which is homozygous. Preferably, QTL2 is present heterozygous and QTL3 is present homozygous. The invention is also directed to a method for detecting or screening S. lycopersicum plants that have at least one of the tolerance QTLs in combination with the Tm-1 gene, i.e., that have the marker alleles described herein, wherein the screening or screening is carried out on the TBRFV infection condition comprising inoculating TBRFV onto the plants to be tested and detecting the inhibition, reduction or delay of viral replication and / or reduction of the virus titer in the plant. The invention is also directed to a method for detecting and / or selecting S. plants. Lycopersicum species possessing the Tm-1 gene and at least one of the tolerance QTLs, where the detection of the tolerance QTL is based on the detection of any molecular marker that reveals the presence of the QTLs. In fact, the identification and subsequent use of molecular markers, other than the 18 SNPs described above, can be easily performed by a person skilled in the art. Tolerance QTLs can thus be identified through the use of different alternative markers. The invention is thus directed to a method for detecting and / or selecting S. lycopersicum plants resistant to TBRFV, inhibiting, reducing or delaying the replication of the virus, the method comprising the steps of: a) Test the tomato plant for the combination in its genome of • the presence of the Tm-1 resistance gene on chromosome 2 and • the presence of at least one genetic marker genetically linked to a tolerance QTL chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, b) Select a plant that includes in its genome the Tm-1 gene and the genetic marker and the QTL linked to the genetic marker, where the chosen QTL and the genetic marker will be found, for QTL1, on chromosome 6, within the chromosomal region delimited by TO-0005197 (SEQ ID No: 1) and TO-015581 (SEQ ID No: 2), for QTL2, on chromosome 9, within the chromosomal region delimited by TO-0180955 (SEQ ID No: 3) and TO-0196109 (SEQ ID No: 6) and for QTL3, on chromosome 11, within the chromosomal region delimited by TO-0122252 (SEQ ID No: 7) and TO-0162427 (SEQ ID No: 18). The genetic marker under consideration is preferably an SNP marker. The tolerance QTLs are as defined in this description and as found in the genome of a plant from the seeds HAZTBRFVRES1 with accession number NCIMB 42758. According to another aspect, the invention also relates to methods or processes for producing *Saccharomyces lycopersicum* plants resistant to *TBRFV*, especially commercial plants and inbred mother lines. The present invention is also directed to transferring one or more tolerance QTLs and / or the Tm-1 gene, to confer TBRFV resistance, to other tomato varieties or other inbred mother lines, particularly resistance to the Israeli strain of TBRFV, and is useful for producing new types and varieties of tomato. These methods comprise transferring at least one tolerance QTL and the Tm-1 gene to another plant, as well as transferring at least one tolerance QTL to another plant that possesses Tm-1. A method or process for producing a plant with these characteristics might include, for example, the following steps: a) Crossing a plant grown from the deposited seeds NCIMB 42758 or progeny thereof, which carry QTL1, QTL2 and / or QTL3 conferring tolerance to TBRFV, and an S. lycopersicum plant, preferably devoid of the QTLs and having the Tm-1 gene, b) Select a plant from the progeny thus obtained, which has one, two or three of the QTLs1, QTL2 and / or QTL3 of tolerance in combination with the Tm-1 gene; c) Optionally self-pollinate the plant obtained in step b) one or more times and select from the progeny thus obtained a plant that has resistance to TBRFV. TBRFV resistance slows, reduces or inhibits the replication or multiplication of the TBRF virus and / or reduces the virus titer in the plant. Alternatively, the method or process may comprise, instead of step a), the following steps: a1) Crossing a plant grown from the deposited seeds NCIMB 42758 or progeny thereof, which carry QTL1, QTL2 and / or QTL3 conferring tolerance to TBRFV, and an S. lycopersicum plant, preferably devoid of the QTLs and having the Tm-1 gene, thereby generating F1 hybrids, a2) Increasing the F1 hybrid by means of self-fertilization to create the F2 population, In the above methods or processes, SNP markers are preferably used in steps b) and / oc), to select plants that carry the tolerance QTL and / or the Tm-1 gene. The SNP markers for tolerance QTLs are preferably one or more of the 18 SNP markers already described in this description, including all combinations thereof as mentioned elsewhere in the application. According to a preferred modality, the selection of plants having a tolerance QTL is carried out on the basis of TO-0182276 or on the basis of at least one of TO-0142294, TO-0142303, TO-0142306, TO-0182276, TO-0181040, TO-0123057, TO-0125528. By selecting a plant on the basis of the allele of one or more SNPs, it must be understood that the plant is selected as if it had a tolerance QTL when the allele of the SNPs is the allele corresponding to the parent's allele HAZTBRFVRES1 for this SNP and not the allele of the initial S. lycopersicum plant devoid of the QTLs. For example, a plant can be selected as having the tolerance QTLs of the invention, when the T allele of TO-0005197, C allele of TO-0145581, G allele of TO-0180955, C allele of TO-0196724, G allele of TO-0145125, G allele of TO-0196109, T allele of TO-0122252, C allele of TO-0144317, T allele of TO-0142270, G allele of TO-0142294, A allele of TO-0142303, A allele of TO-0142306, G allele of TO-0182276, G allele of TO-0181040, G allele of TO-0123057, A allele of TO-0125528, allele C of TO-0162432 and / or allele T of TO-0162427 is detected. Preferably, the S. lycopersicum plant from step a) or a1) is the elite line, used to obtain a plant with commercially desirable or horticultural traits. This plant has preferably been previously modified to incorporate the Tm-1 gene. According to one embodiment, this plant is susceptible to TBRFV. This plant preferably comprises the Tm-1 gene and preferably also the Tm-2 gene or its allele Tm-22. The selection of plants carrying the Tm-1 gene is preferably carried out by detection of the A allele of the SNP TO-0200838. A method or process as defined above may advantageously comprise backcrossing steps, preferably after step c), to obtain plants having all the characteristic traits of S. lycopersicum plants. Accordingly, a method or process for producing a plant having these characteristics may also comprise the following additional steps: d) Retrospective crossing of the resistant plant selected in step b) or c) with a S. lycopersicum plant; iviA / a / ¿u¿ ι / ui e) Select a plant that has one, two or three of the tolerance QTLs1, QTL2 and / or QTL3 in combination with the Tm-1 gene. The plant used in step a), i.e., the plant corresponding to the deposited seeds, may be a plant grown from the deposited seeds; alternatively, it may be any plant according to the first aspect of the invention, having the QTLs that confer the phenotype, preferably having at least one of those sequences homozygous. In that case, the plant is crossed in step a) with an S. lycopersicum plant, preferably lacking the QTLs, but not necessarily having the Tm-1 gene. In step e), SNP markers can be used for the selection of plants that carry a tolerance QTL and a Tm-1 gene; the SNP markers that can be used are, for example, those described in the previous sections of this description. It should be noted that when selecting plants homozygous for at least one tolerance QTL, the selection must be based on one or more of the SNPs linked to the tolerance QTLs, in the presence of the representative alleles of the QTLs, i.e., the alleles of the parent HAZTBRFVRES1, coupled with the absence of the representative alleles of the recurrent susceptible S. lycopersicum parent. When selecting plants heterozygous for at least one tolerance QTL, the selection must be based on one or more of the SNPs linked to the tolerance QTLs, in the presence of both alleles of the SNPs, i.e., the allele of the parent HAZTBRFVRES1 and the allele of the recurrent susceptible S. lycopersicum parent. The plant selected in step b), c) or e) is preferably a commercial plant, especially a plant that has fruit weighing at least 25 g, at least 100 g or at least 200 g at full maturity under normal growing conditions. Preferably, steps d) and e) are repeated at least twice and preferably three times, not necessarily with the same S. lycopersicum plant. The S. lycopersicum plant is preferably a breeding line. The trait of nematode resistance or ToMV resistance can be additionally selected at each selection step of the processes described above. The steps of self-pollination and backcrossing can be carried out in any order and can be interleaved; for example, a backcross can be carried out before and after one or more self-pollinations, and self-pollinations can be considered before and after one or more backcrosses. The selection of progeny that has the desired TBRFV resistance, which slows, reduces and / or inhibits virus replication and / or reduces the virus titer in the plant, can also occur on the basis of comparing the resistance to the Tomato Brown Rugose Fruit Virus of the parent S. lycopersicum, through protocols as described Inter alia in the examples. The method used for allele detection can be based on any technique that allows the distinction between two different alleles of a SNP, on a specific chromosome. The present invention also relates to a plant obtained or obtainable by this method. This plant is actually an S. lycopersicum plant that has resistance to TBRFV according to the first aspect of the invention. In all methods and processes according to the invention, the S. lycopersicum plant susceptible to the initial TBRFV can be determinate, indeterminate, or semi-determinate. As previously described, the tomato plants according to the invention are preferably also resistant to Tomato Mosaic Virus, nematodes, and Fusarium and Verticillium. To obtain such plants using the processes and methods of the invention, the S. lycopersicum parents used in the breeding schemes preferably carry sequences that confer resistance to Tomato Mosaic Virus, nematodes, and Fusarium and Verticillium; and the selection steps are carried out to select plants that have these resistance sequences, in addition to the tolerance QTLs and the Tm-1 gene. The invention is also directed to a method of breeding S. lycopersicum plants that have TBRFV resistance, comprising steps of crossing a plant grown from NCIMB 42758 deposited seeds or progeny thereof carrying QTL1, QTL2 and / or QTL3 conferring TBRFV tolerance, with an S. lycopersicum plant having the Tm-1 gene. The present invention is also directed to a plant or seed of S. lycopersicum obtainable by any of the methods and processes described above. Any S. lycopersicum seed of the invention is preferably coated or granulated with individual or combined species as plant nutrients, growth-enhancing microorganisms, or products for disinfecting the seed and plant environment. These species and chemical compounds may be a product that promotes plant growth, for example, hormones, or that increases resistance to environmental stress, for example, defense stimulants or pH stabilizers of the substrate and its immediate surroundings, or alternatively, a nutrient. They can also be products that protect against agents detrimental to the growth of young plants, including viruses and pathogenic microorganisms. Examples include fungicides, bactericides, nematicides, insecticides, or herbicides that act by contact, ingestion, or gaseous diffusion. Suitable essential oils, such as thyme extract, are also examples. All these products strengthen the plant's resistance responses and / or disinfect or regulate the plant's environment. They can also be biological material, such as a non-pathogenic microorganism, including at least one fungus, bacterium, or virus, ideally in a medium that ensures its viability. This microorganism, such as Pseudomonas, Bacillus, Trichoderma, Clonostachys, Fusarium, or Rhizoctonia, stimulates plant growth or protects it against pathogens. In all the above methods and processes, the identification of plants that homozygously carry the tolerance QTLs could be carried out by detecting at least one of the alleles linked to each of the QTLs, but also in combination with the absence of another allelic form of the SNPs of the present invention. Therefore, the identification of a plant that is homozygous for the QTL3 of the present invention will be based on the identification of the T allele of TO-0122252 and / or the C allele of TO-0144317 and / or the T allele of TO-0142270 and / or the G allele of TO-0142294 and / or the A allele of TO-0142303 and / or the A allele of TO-0142306 and / or the G allele of TO-0182276 and / or the G allele of TO-0181040 and / or the G allele of TO-0123057 and / or the A allele of TO-0125528 and / or the C allele of TO-0162432 and / or the T allele of TO-0162427 as well as the absence of the A allele of TO-0122252, the T allele of TO-0144317, C allele of TO-0142270, A allele of TO-0142294, C allele of TO IVIA / a / ZUZ I / UI O4OJ 0142303, G allele of TO-0142306, A allele of TO-0182276, A allele of TO-0181040, T allele of TO-0123057, G allele of TO-0125528, T allele of TO-0162432 and C allele of TO-0162427. When plants that heterozygously carry one of the tolerance QTLs, preferably heterozygous carrying the tolerance QTLs2, are to be selected, identification involves the detection of the G allele of TO-0180955 and / or the C allele of TO-0196724 and / or the G allele of TO-0145125 and / or the G allele of TO-0196109 as well as, simultaneously, the detection of the A allele of TO-0180955, the T allele of TO-0196724, the A allele of TO-0145125 and the T allele of TO-0196109. In all the above methods and processes, the preferred combinations of QTL and Tm-1 gene will be associated or detected as described in relation to the first aspect of the invention and include namely Tm-1 homozygous with QTL2 heterozygous and QTL3 homozygous or heterozygous, as well as Tm-1 heterozygous with QTL2 heterozygous and QTL3 homozygous or heterozygous. Given the ability of the resistant plants of the invention to restrict the damage caused by TBRFV infection, to reduce the viral titer, and to slow, reduce, and / or inhibit viral replication and thus its spread, they are advantageous for growing in an environment infested or likely to become infested or infected by TBRFV, especially the Israeli strain or isolate. Under these conditions, the resistant plants of the invention produce more marketable tomatoes than susceptible plants. They also restrict the spread of the virus to other fields, thereby protecting less resistant plants and indirectly improving their yield. The invention is thus also directed to a method for improving the performance of tomato plants in an environment infested or likely to be infected by TBRFV, especially the Israeli strain or isolate, comprising growing TBRFV-resistant tomato plants according to the invention, which thus comprise in their genome at least one tolerance QTL, namely QTL1, QTL2, and / or QTL3 as defined in WO2018 / 219941 on chromosomes 6, 9, and 11 respectively, in combination with the Tm-1 gene, either homozygous or heterozygous. Preferably, at least one of the tolerance QTLs is present homozygous. According to another embodiment, at least one is present heterozygous, preferably with another present homozygous. Preferably, the method comprises a first step of choosing or selecting a tomato plant that has at least one of the tolerance QTLs and the Tm-1 gene.The method can also be defined as a method for increasing the productivity of a tomato field, tunnel, greenhouse or glass greenhouse. As described in the preceding section, the preferred tomato plant also comprises a Tm-2 or Tm-22 allele, preferably heterozygous. The preferred tomato plant or seed genotypes are illustrated in Table 1. According to a preferred embodiment, the method comprises growing a tomato plant comprising QTL3 as defined above on chromosome 11, preferably homozygous, and a Tm-1 gene. The invention is also directed to a method for reducing tomato yield losses under TBRFV infestation or infection conditions, comprising growing a TBRFV-resistant tomato plant as defined above. These methods are particularly valuable for a population of tomato plants, whether in a field, in a tunnel, greenhouse, or in glass greenhouses. Alternatively, methods to improve yield or reduce tomato production losses may involve, first, identifying tomato plants resistant to TBRFV that possess a tolerance QTL on chromosomes 6, 9, and / or 11, either homozygous or heterozygous, in combination with a Tm-1 gene, and then growing these resistant plants in an environment infested or likely to become infested by the virus. Preferably, the plants contain a homozygous tolerance QTL on chromosome 11 in combination with the Tm-1 gene, heterozygous tolerance QTLs on chromosome 9, and heterozygous the Tm-2 or Tm-2 allele. According to a preferred modality, the plants will be identified in the first step comprising the G allele of TO-0182276. The resistant plants of the invention are also capable of restricting and even inhibiting the growth of TBRFV, especially the Israeli isolate or strain of TBRFV, thereby limiting the infection of additional plants and the spread of the virus. Accordingly, the invention is also directed to a method of protecting a field, tunnel, greenhouse, or any other type of planting against TBRFV infestation, or at least limiting the level of TBRFV infestation in the field, tunnel, greenhouse, or greenhouse, or limiting the spread of TBRFV in a field, tunnel, greenhouse, or greenhouse, especially in a tomato field. The method preferably comprises the step of growing a resistant plant of the invention, i.e., a plant comprising in its genome a tolerance QTL on chromosome 6, 9, and / or 11, preferably homozygous, and the Tm-1 gene.The plant of the invention to be used preferably comprises QTL3 on chromosome 11; more preferably the plant exhibits the G allele of TO-0182276. Other preferred resistant plants have one of the genomic combinations described in Table 1. Preferably, the method comprises a first step of choosing or selecting a tomato plant that has a tolerance QTL, especially QTL3 on chromosome 11 and the Tm-1 resistance gene. The methods may also include a subsequent step of harvesting tomatoes. The invention also relates to the use of a TBRFV-resistant plant to control TBRFV infection or infestation in a field, tunnel, greenhouse, or other plantation; that plant being a plant of the invention, comprising in its genome at least one of the tolerance QTLs as defined above, preferably homozygous, on chromosomes 6, 9 and / or 11 and the Tm-1 gene. In a preferred embodiment, the plant comprises in its genome two tolerance QTLs, at least one heterozygous, for example one heterozygous and one homozygous. According to this use, the plants of the invention are therefore used to protect a field, tunnel, greenhouse, or glasshouse against TBRFV infestation. The plants of the invention to be used preferably comprise QTL3 on chromosome 11; more preferably, they exhibit the G allele of TO-0182276. Other preferred resistant plants have one of the genomic combinations described in Table 1. The TBRFV is, according to a preferred embodiment, the Israeli strain or isolate of TBRFV. The tolerance QTLs are preferably those present in the genome of a seed plant HAZTBRFVRES1 NCIMB 42758. In all such uses, the preferred combination of QTL and the Tm-1 gene shall be associated or detected as described in relation to the first aspect of the invention and include namely Tm-1 homozygous with QTL2 heterozygous and QTL3 homozygous or heterozygous, as well as Tm-1 heterozygous with QTL2 heterozygous and QTL3 homozygous or heterozygous. EXAMPLES: Example 1: Materials and methods Line descriptions: Haz-Tm1 Line: This line is a commercial indeterminate loose-type tomato with regular round, red fruits weighing approximately 120 g. The plant has light green foliage and is resistant to TMV race 0. Resistance test: The Haz-Tm1 line was tested in 2 replicates of 10 plants each (20 plants total) for resistance to TBRFV. The susceptible controls used were as follows (Table 2): Table 2 IVIA / a / ZUZ I / UI O4OJ Susceptible Control Name Rep. No. of Plants Foliar Symptoms Fruit Symptoms HA-29628 1 10 Severe Slight HA-29628 2 10 Severe Slight HA-29406 1 10 Severe Severe HA-29406 2 10 Severe Severe “Rep” is the repetition number. “No. of plants” is the number of plants in the repetition. Line NB2: used to produce the population This line is an indeterminate loose-flowering tomato with spherical, deep red fruits weighing approximately 160 grams. The plant has dark green foliage and is resistant to Stemphylium, Verticillium, Nematodes, Fol race 1 race 2, and TMV race 2. The symptoms: The symptoms of TBRFV infection are as follows: Mild foliar symptoms: usually mosaic which is not severe, without significant distortion of the shape of small leaves. Severe foliar symptoms: the leaves become distorted, in many cases there are also symptoms of "soreness", the mosaic is almost always severe. Mild fruit symptoms: some yellow lesions (sometimes seen as “covered in spots”), but no deformed or distorted fruit. Severe fruit symptoms: typical deformed fruit, sometimes also “chocolate-colored spots”. TBRFV symptom score: 4 score values, as described in WO2018 / 219941, with 4 corresponding to no symptoms and 1 corresponding to severe symptoms. ELISA protocol: Each sample containing 1-2 tomato leaves is crushed with a homogenizer. 3 mL of SEB buffer (Sample Extraction Buffer) was added and the sample was homogenized with a mixing bag for 30 seconds. The PrimeDiagnostics ToMV prime ELISA protocol was then followed; this diagnostic test was chosen because it allows the detection of ToBRFV infection, although it was designed for ToMV infection. Student's t-test The t-test is used to determine if the means of two data sets are significantly different from each other. In the comparison circle chart (see Figures), the position of the circles corresponds to the means of the different groups. The distance between the centers of the circles represents the real difference. The external angle of intersection of the comparison circles is informative about whether the group means are significantly different. The circles for means that are significantly different do not intersect or intersect only slightly, so that the interior angle of intersection is less than 90 degrees. Scoreboards: The appropriate SNP markers for tolerance QTL detection are described below. Table 3: List of SNPs, their position, and the alleles found in susceptible plants (1st nucleotide named: allele S) against the alleles of markers linked to tolerance (2nd nucleotide named: allele T). Table 4: SNP sequences. Table 3: SNP Chromosome Position SL2.40 Allele S / T TO-0005197 6 33932438 C / T TO-0145581 6 33933905 T / C TO-0180955 9 4800680 A / G TO-0196724 9 5203457 T / C TO-0145125 9 40025769 A / G TO-0196109 9 59014540 T / G TO-0122252 11 8090264 A / T TO-0144317 11 8334467 T / C TO-0142270 11 8633469 C / T TO-0142294 11 8764030 A / G TO-0142303 11 8903092 C / A TO-0142306 11 9318832 G / A TO-0182276 11 9548029 A / G TO-0181040 11 9797143 A / G TO-0123057 11 9825111 T / G TO-0125528 11 9837711 G / A TO-0162432 11 10015478 T / C TO-0162427 11 10018811 C / T Table 4: Sequences of SNPs linked to tolerance QTLs SEQ ID Sequence of SNPs: the allele associated with tolerance to Rugoso Virus Tomato Coffee is mentioned in the bracketed section TO0005197 1 ATTAA TAATTTTTCGTTTTGAGTTTT TO01455581 2 TTCAGAGAGCAACACTCCTGCAAGACCAACTCGGAGTAATTCAGTA ACT CGACCTTCCAT[T / C]TCTAGCTCTCAGTATAGTACTTACTCAAATAAA TOA GGCTCTATTCTA95AACACA18CT TTCCGAAATGAGGACGATCCATCAGCTTTCAGCTGAGAGCCCC TGG TC[A / G]ACATACCAGAATCTCTGTTTTTCTAAAACTGTCCAAAAATCTCC TGT AAAGA TO0196724 4 GATCGAATTGATCGAGATTCAT / C] TO0145125 5 AGAGAATGATATCACTGCCTTAGTTTCTCAATTAAAAGTTGTGCCAAA A ACAAAACACACA[A / G]CTAGATGAGAAAAACAGAGCATTCGCCTCA A AGCTTCAGACAAAAGTTGAGACAAC TO0196109 6 TACAATACCTTCTGGCATCCCTTTCCCGCAAAACGA[T / G]AGATCTTT AG TATCAAAACCGAGCACTGTCACC TO0122252 7 ATGGCAATAGTGACTGCAGATACAACTGAAATTGCAGAACACCCT TAAA[A / T]AGTAGATTCATTCATTCAATCAATCAAGAA TO0144317 8AGCCATTGTGATTGTGTCTGTTGTACATTACCAAATTCTCTAGAGA AAG[T / C]GATACACATGCCAGCCCTATCGATAAAGCAACGCAAG GTGGATTCTGC TO0142270 9 AACCATTGTAGAGCACAGCGAAACAATGGCCTCAGGAAGATC TACTT[C / T]GCGAAGTGCAGCAAGCCACTCCATACCTCCACCAGGC TTTGATTTCAGTG TO0142294 10 TCAACTGCAACTTTAACCTGATTCAACTTCTTCTTCTTTCGAAAC ATC[A / G]CATTGAATGTAACGACCTCCAATAGATTCATTAACCTAACTAACTAACGACCTCCAATAGATTCATTAACCTA3013142294 GAGGAGCTATCAACTTCATAGTCAGATTCAGAAAATGATTCAGATG AGGA[C / A]GTGGCTGATTCTTCTTG lily CTTTTCTTCCTTCTGCTC GAACTCTCTCC TO0142306 12 CAGAAATAATAGAAAATCAGAAAAAAATCAGCTTTCTAAATGGA AAAG[G / A]CGATGGCACTATGTTTGAAGTTTTAAGCAAC lily CTGA AGTCCCAAAAG TO0182276 13 CTCCTATTGAACATCCTGAAAACTTGTGTCTACATCATGAGAAGAT GCA GGCCAATTC[A / G]CTCAGTACATGGAATGCACGAGGGGGGGGGGAT ATTCTAACGCAAAGCATAAGCTTGATACTTGAATAAAAGATGAAAC AND ACTTACTTCTTCTCAAACT TO0181040 14 CTCTTGGTGACAAACCACTGGCTCAATTTCTTCGCGAAGCTAAAG CTATC[A / G]CTGATGAGCTTGTCACGGCAGGCACGTGTCTCCTG ATG AATTCAATGC TO0123057 15 CATTACTGTTGAGATATCCCATCCATCCGCCTCGACCGCCG CCGC[T / G]TGTCCTCCAGGATCTGATTTCAGAAAGGATGAATAGTAA CTGT GTTTCAG TO0125528 16 CAAGAACCCAACGACTTCTTCTCTTTGCTTATTGAAAAACTTGGT TTTGAAATGAAAGG[G / A]ATCGAGAAATTGGATACTCAGTTCGGGTT TACTAAACCTTCTCCTGATTTTAAGAAA TO0162432 17 TGATCGACAATTCTTGTTGTTGAAACTCTGCAAGTGAGAGAGG GATG [T / C]ATATAG AGAAAGGATATTGGTAAAGGACAATTCTAGAAGGGTCTA GGGAA TO0162427 GCACCAGTTATAGTAATGTCCTGCTTCTTTCCTGTACCCTTATCAGT AGC[C / T]GTGACAGAAAGAATACCGTTGGTGTCAATGTCGAACTTCA CTTCAATCTG MA / a / ZUZ 1 / U1 0400 For Tm-1, a marker was developed on the basis of the report by Ishibashi et al, 2007: Four SNPs in the gene were defined, KASPar assays were developed and only one was found to be suitable. Marker code: TO-0200838 SNP sequence: first the allele associated with the resistant virus (i.e. A) is mentioned in brackets: CAAAGCTCTT / GGAAACTTTCCTAAGTAT / AAGCTAATG[A / G]TGAACAGAATCTTGCTGGAGTA / GA TTGGCCTTGGGGGTAGTGGAGGAACA (SEQ ID No: 21). KASPar Scoreboard Primers: Direct starter Fam: GAAGGTGACCAAGTTCATGCTCAATYACTCCAGCAAGATTCTGTTCAT (SEQ ID No: 22) Direct primer Vic: GAAGGTCGGAGTCAACGGATTACTCCAGCAAGATTCTGTTCAC (SEQ ID No: 23) Common reverse primer: CAAAGCTCTKGAAACTTTCCTAAGTA ((SEQ ID No: 24) Example 2: Resistance Sources First source of resistance The inventors have identified for the first time a cultivated tomato (Solanum lycopersicum) line—the Haz-Tm1 line—that has a high level of foliar resistance to TBRFV. This line was also known to contain the Tm-1 gene. According to the literature and as is known to experienced growers, the Tm-1 gene was initially introgressed from the wild tomato species *Solanum habrochaites* PI126445 into the cultivated tomato species *Solanum lycopersicum* with the aim of conferring resistance to ToMV / TMV. However, this gene's resistance to ToMV was interrupted within a year of its introduction into commercial tomato crops in the 1960s. Therefore, this gene is rarely, if ever, found in currently commercial varieties and can no longer be considered a ToMV or TMV resistance gene. A marker for the Tm-1 gene (on chromosome 2) was developed based on the publicly available genetic sequence. Four SNPs were defined, KASPar assays were developed, and only one was found to be suitable. The inventors first found that the Haz-Tm1 line was slightly resistant to TBRFV, in two trials under artificial laboratory tests. The inventors also subsequently studied the Haz-Tm1 line for fruit resistance under field conditions in a greenhouse trial (natural infection). The trial was transplanted into a 4-dunam greenhouse (equivalent to 4,000 m²). The results showed that the Haz-Tm1 line exhibited mild TBRFV symptoms in the fruit, primarily in the later stages of plant growth. It was concluded that the Haz-Tm1 line likely has high resistance to foliar symptoms and weak to insufficient resistance to fruit symptoms. The Haz-Tm1 line was then tested, including the ELISA test, which included: (1) Sow in “54” trays, (2) mechanical inoculation of young seedlings (3) scoring-observation of Tobamovirus symptoms (4) Verify the presence / absence of the virus with the Immunostrip equipment (AGDIA) and with an ELISA test at three time points (5) Seedlings planted in the greenhouse until the complete growth cycle. Sow in seed trays on October 9th Mechanical inoculation: October 31 Transplant part of the trial in Brurim (GH 3 and 4 greenhouses): November 5th Transplant part of the trial to the Mivtahim greenhouse: November 13th 1st Score and sampling for the ELISA test: December 16 and 17. 2d0Score and sampling for the ELISA test: January 14. 3rd Score and sampling for the ELISA test: February 19. The results of the first scoring, around 45 days after inoculation (DPI), are detailed in Table 5. At this stage, there are no fruits, so only foliar resistance was tested. Table 5: First score of follicular symptoms at 45 DPI / Ul 0400 No. Line Name Location Total number of plants Health (score 4) Mild symptoms (score 2 or 3) Severe symptoms (score 1) Observations 1 Haz. Tm-S GH.3 5 5 Typical “muscle soreness” GH.4 5 5 Mivtahim 10 10 4 Do. Tm-1 GH.3 5 5 GH.4 5 5 Mivtahim 10 9 1 5 Beam. Tm-22 GH.3 5 5 Typical severe mosaic GH.4 5 5 Mivtahim 10 10 The results of the ELISA test are illustrated in Figure 1. 2nd score The phenotypic score of the second test yielded similar results to those obtained in the first test. The results of the ELISA test are illustrated in Figure 2. 3rd point The results of the 3rd score, around 110 DPI, are detailed in Table 6. At this stage, there are fruits, thus the foliar and fruit resistance were rated. Table 6: 3rd score of foliar symptoms at 110 DPI No. Line Name Location Foliar Symptoms Fruit Symptoms Total No. of Plants No symptoms (score 4) Mild symptoms (score 2 or 3) Severe symptoms (score 1) No symptoms (score 4) Mild symptoms (score 2 or 3) Severe symptoms (score 1) 1. TmS GH.3 5 5 5 GH.4 5 5 5 Mivtahim 10 10 10 4. Tm-1 GH.3 5 5 5 GH.4 5 5 5 Mivtahim 10 10 10 5. Tm-22 GH.3 5 5 5 GH.4 5 5 5 Mivtahim 10 10 10 The results of the ELISA test are illustrated in Figure 3. The ELISA results suggest that the Haz. Tm-1 line has a defense mechanism that delays virus replication in the plant. Second source of resistance WO2018219941 describes tolerance QTLs for TBRFV, essentially a foliar tolerance QTL, QTL3, on chromosome 11 and two fruit tolerance QTLs, QTL1 and 2, on chromosomes 6 and 9 respectively. Example 3: Combination by crossing the two sources Population creation: A cross was made between the Haz-Tm1 line and the NB2 line to produce F1 seeds; the F1 was the last to self-pollinate to produce F2 seeds. The F2 seeds were sown in trays, and selection for homozygotes for the tolerance QTL3 (i.e., QTL on chromosome 11) was carried out using a representative marker such as TO-0142306; these plants advanced to produce F3 seeds, which are referred to in the examples as population 1 (see Table 7). Plant genotyping and selection: The F3 seeds (population 1) were sown in trays, and approximately 500 seedlings were obtained. A leaf disc was sampled from each F3 seedling for DNA extraction, and the DNA was used for molecular marker analysis. For selection, two molecular markers were used, one of the TM-1 gene on chromosome 2 and the second representative of the QTL on chromosome 9 (QTL2), the QTL for chromosome 11 (QTL3 of tolerance) had already been fixed in the F2 as homozygous resistant (see population creation). Results: Crosses were made between the Haz. Tm-1 line and the NB2 breeding line containing the QTLs on chromosome 11 and the QTL on chromosome 9. The F3 seeds were obtained as described above. F3 plants were pre-selected in the tray using molecular markers linked to tolerance QTLs and the Tm-1 gene and the selected plants were mechanically inoculated at the young seedling level, the seedlings were planted in the greenhouse in Bsor and grown in the greenhouse. The molecular marker analysis included one marker per QTL. Tables 7 and 9 present different F3 plants from population 1 containing different genotypes at the 3 loci (QTL2, QTL3, and Tm-1), the resistance basis based on the phenotypic score, and the ELISA results for each plant. Controls are also indicated. Healthy controls were not infected. Table 7 presents the results at 70 DPI and Table 9 at 91 DPI. Some of the foliar symptoms reported in the tables may have been exacerbated by the presence of pepinovirus in the greenhouse, as well as by severe temperature conditions. It is well known that tobamovirus infection symptoms increase with increasing temperature. This means that the severe symptoms observed in this trial could, under mild conditions, be considered only mild. This trial was actually designed to discriminate between resistant plants on the one hand and tolerant or susceptible plants on the other, not between resistant / tolerant plants and susceptible plants. Table 7: ELISA results at 70 DPI and symptom scores of F3 plants. R signifies homozygous resistant genotype, i.e., the marker allele linked to resistance (or tolerance for the tolerance QTLs). S signifies “homozygous susceptible genotype.” D.0.1 and D.0.2 correspond to the results of two different assays. Chr11 QTL refers to tolerance QTL3; Chr9 QTL refers to tolerance QTL2. Code Detail Chr11 QTL Gen Tm-1 Chr9 QTL DO (405 nm) 1 DO (405 nm) 2 ELISA Result Foliar Symptoms Blank ELISA Control 0.093 0.095 Positive Control ELISA Control 1.475 2.196 Negative Control ELISA Control 0.096 0.110 Cutoff (2*CtrolNeg) Calculation 0.192 0.219 H-1 Healthy Control 0.092 0.105 negative NA H-2 Healthy Control 0.091 0.095 negative N.A. H-3 Healthy control 0.102 0.115 negative NA H-4 Healthy control 0.089 0.101 negative NA H-5 Healthy control 0.133 0.166 negative NA H-6 Healthy control 0.128 0.156 negative NA H-7 Healthy control 0.099 0.116 negative NA H-8 Healthy control 0.116 0.141 negative NA 6305 population 1 RRR 0.172 0.227 slightly positive no 6328 population 1 RRR 0.112 0.127 negative no 6381 population 1 RRR 0.088 0.100 negative no 6415 population 1 RRR 0.131 0.154 negative no 6429 population 1 RRR 0.093 0.105 negative no 6450 population 1 RRR 0.120 0.149 negative no 6464 population 1 RRR 0.116 0.143 negative no 6470 population 1 RRR 0.112 0.136 negative no 6472 population 1 RRR 0.111 0.134 negative no 6317 population 1 RRS 0.342 0.502 slightly positive no 6338 population 1 RRS 0.311 0.443 slightly positive no 6339 population 1 RR s 0.401 0.576 slightly positive no. MA / a / ¿U¿ 1 / Ul 0400 6344 Population 1 RRS 0.254 0.352 Slightly positive No 6368 Population 1 RRS 0.514 0.742 Slightly positive No 6373 Population 1 RRS 0.289 0.393 Slightly positive No 6386 Population 1 RRS 0.200 0.279 Slightly positive No 6414 Population 1 RRS 0.175 0.262 Slightly positive No 6432 Population 1 RRS 0.226 0.327 Slightly positive No 6314 Population 1 RSS 1.365 2.030 Slightly positive 6321 Population 1 RSS 1.307 1.930 Slightly positive 6324 Population 1 RSS 1.444 2.153 Slightly positive 6327 Population 1 RSS 1.689 2.488 Slightly positive 6300 population 1 RSR 1.462 2.171 positive Medium-severe 6333 population 1 RSR 1.402 2.126 positive Medium-severe 6378 population 1 RSR 1.405 2.091 positive Medium-severe 6380 population 1 RSR 1.397 2.099 positive Medium-severe 1409-1 population 1 SSR 1.389 2.086 positive severe 1409-2 population 1 SSR 1.434 2.099 positive severe 1409-3 population 1 SSR 1.369 2.084 positive severe 1409-4 population 1 SSR 1.642 2.441 Severely Positive ELISA Control Blank 0.148 0.185 Positive Control ELISA Control 1.504 2.228 Negative Control ELISA Control 0.127 0.162 Cutoff (2* Negative Control) Calculation 0.254 0.324 Beam Tm-S-1 Susceptible Control 1.328 2.007 Severely Positive Beam Tm-S-2 Susceptible Control 1.421 2.142 Severely Positive Beam Tm-S-3 Susceptible Control 1.457 2.168 Severely Positive Beam Tm-S-4 Susceptible Control 1.394 2.094 Severely Positive Beam Tm-S-5 Susceptible Control 1.375 2.094 Severely Positive Beam Tm-S-6 Susceptible Control 1.386 2.109 Severely Positive MA / a / xíUZ 1 / U1 0400 Table 8: ELISA means of readings at 70 DPI for different combinations and QTL controls: Genotype No. of Plants Mean Standard Error Less than 95% Greater than 95% Control Hale Tm-S 6 2.10233 0.04735 2.0064 2.1983 Healthy Control 8 0.12438 0.04101 0.0413 0.2075 chr11-R;Tm-1-R;chr9-R 9 0.14167 0.03866 0.0633 0.2200 chr11-R;Tm-1-R;chr9-S 9 0.43067 0.03866 0.3523 0.5090 chr11-R;Tm-1-S;chr9-R 4 2.12175 0.05799 2.0042 2.2393 chr11-R;Tm-1-S;chr9-S 4 2.15025 0.05799 2.0327 2.2678 chr11-S;Tm-1-S;chr9-R 4 2.17750 0.05799 2.0600 2.2950 Figure 4 illustrates the results of the ELISA test for different combinations and QTL controls, at 70 DPI. It can be deduced that the combination of the Tm-1 gene and at least one of the tolerance QTLs results in a large decrease in the detection level of the ToBRFV virus coating protein in plants and that the combination of the Tm-1 gene with two tolerance QTLs gives a ToBRFV detection level as low as the level found in healthy uninfected plants (Chr11-R, Tm-1-R, Chr9-R). Table 9: ELISA results at 91 DPI and symptom score of F3 plants. R means homozygous resistant genotype, i.e. the marker allele that is linked to resistance (or tolerance for the tolerance QTLs), S means the “homozygous susceptible genotype. D.0.1 and DO2 correspond to the results of two different assays. Chr11 QTL refers to QTL3 tolerant; Chr9 QTL refers to QTL2 tolerant. Code Detail Chr11 QTL Gen Tm-1 Chr9 QTL OD (405 nm) 1 OD (405 nm)2 ELISA Result Foliar Symptoms Fruit Symptoms Observations Blank ELISA Control 0.097 0.110 Positive Control ELISA Control 1.717 2.711 Negative Control ELISA Control 0.117 0.137 Cutoff (2'CtrolNeg) Calculation 0.232 0.271 H-1 Healthy Control 0.128 0.165 negative na na ELISA Control H-2 Healthy Control 0.154 0.209 negative na na ELISA Control H-3 Healthy Control 0.111 0.139 negative na na ELISA Control H-4 Healthy control 0.107 0.129 negative na na Control for ELISA H-5 Healthy control 0.118 0.146 negative na na Control for ELISA H-6 Healthy control 0.131 0.166 negative na na Control for ELISA H-7 Healthy control 0.119 0.147 negative na na Control for ELISA H-8 Healthy control 0.117 0.146 negative na na Control for ELISA 6305 population 1 RRR 0.385 0.608 Slightly positive no no No clear symptoms but has some spots 6328 population 1 RRR 0.327 0.507 Slightly positive no no No clear symptoms but has some spots 6381 population 1 RRR 0.229 0.342 Slightly positive no no No clear symptoms but has some spots 6415 population 1 RRR 0.193 0.275 Slightly positive no no No clear symptoms but has some spots 6429 population 1 RRR 0.264 0.388 Slightly positive no no No clear symptoms but has some spots 6450 population 1 RRR 0.156 0.209 Slightly positive no no No clear symptoms but has some spots 6464 population 1 RRR 0.214 0.308 Slightly positive no no No clear symptoms but has some spots 6470 population 1 RRR 0.216 0.316 Slightly positive no no No clear symptoms but has some spots 6472 population 1 RRR 0.407 0.633 Slightly positive no no No clear symptoms but has some spots 6317 population 1 RRS 0.543 0.856 Slightly positive no no No clear symptoms but has some spots 6338 population 1 RRS 0.260 0.400 Slightly positive no no No clear symptoms but has some spots 6339 population 1 RRS 0.263 0.396 Slightly positive no no No clear symptoms but has some spots 6344 population 1 RRS 0.206 0.293 Slightly positive no no No clear symptoms but has some spots 6368 population 1 RRS 0.346 0.526 Slightly positive no no No clear symptoms but has some spots. MA / a / ZUZI / U1 0403 6373 population 1 RRS 0.251 0.377 Slightly positive no no No clear symptoms but has some spots 6386 population 1 RRS 0.195 0.286 Slightly positive no no No clear symptoms but has some spots 6414 population 1 RRS 0.280 0.439 Slightly positive no no No clear symptoms but has some spots 6432 population 1 RRS 0.296 0.453 Slightly positive no no No clear symptoms but has some spots 6314 population 1 RSS 0.801 1.259 Severe positive Medium Some distortion on the fruit with pointed flower end 6321 population 1 RSS 0.631 0.982 Severe positive Medium Some distortion on the fruit with pointed flower end 6324 population 1 RSS 0.760 1.203 severe positive Medium Some distortion on the fruit with pointed end of the flower 6327 population 1 RSS 0.978 1.558 severe positive Medium Some distortion on the fruit with pointed end of the flower 6300 population 1 RSR 0.978 1.593 Severe positive Mild No significant distortion, no pointed flower 6333 population 1 RSR na na na na na Dead plant 6378 population 1 RSR 0.985 1.594 Severe positive Mild No significant distortion, no pointed flower 6380 population 1 RSR 1.083 1.751 Severe positive Mild No significant distortion, no pointed flower 1409-1 population 1 SSR 1.012 1.623 Severe positive No 1409-2 population 1 SSR 0.803 1.278 Severe positive No 1409-3 population 1 SSR 0.754 1.180 Severe positive No 1409-4 population 1 SSR na na na na na Dead plant Blank ELISA control 0.109 0.128. Positive Control ELISA Control 1.919 2.830 Negative Control ELISA Control 0.131 0.161 Cutoff (2*CtrolNeg) Calculation 0.263 0.321 Beam Tm-S-1 Susceptible Control 1.144 1.698 Positive Severe Mild Moderate Symptoms Beam Tm-S-2 Susceptible Control 1.280 1.890 Positive Severe Mild Moderate Symptoms Beam Tm-S-3 Susceptible Control 1.148 1.709 Positive Severe Mild Moderate Symptoms Beam Tm-S-4 Susceptible Control 1.049 1.560 Positive Severe Mild Moderate Symptoms Beam Tm-S-5 Susceptible Control 0.929 1.399 Positive Severe Mild Moderate Symptoms Beam Tm-S-6 Susceptible Control 0.953 1.428 Positive Severe Symptoms Mild Symptoms Moderate Table 10: ELISA media of readings for different combinations and QTL controls (91 DPI) Genotype Number of Plants Mean Standard Error Below 95% Above 95% Beam Control Tm-S 6 1.61400 0.06391 1.4845 1.7435 Healthy Control 8 0.15588 0.05535 0.0437 0.2680 chr11-R, Tm-1-R, chr9-R 9 0.39844 0.05218 0.2927 0.5042 chr11-R, Tm-1-R, chr9-S 9 0.44733 0.05218 0.3416 0.5531 chr11-R, Tm-1-S, chr9-R 4 1.64550 0.07827 1.4869 1.8041 chr11-R, Tm-1-S, chr9-S 4 1.25050 0.07827 1.0919 1.4091 chr11-S, Tm-1-S, chr9-R 4 1.40075 0.07827 1.2422 1.5593 Figure 5 illustrates the results of the ELISA test for different combinations and QTL controls, at 91 DPI. The results presented in Table 9 and Table 10 confirm the resistance of plants comprising Tm-1 and at least one QTL of tolerance and demonstrate that this resistance is present even 3 months after infection, thus protecting the plants against foliar and fruit damage. Example 4: Genetic modification of tomato seeds by Ethyl Methan Sulfonate (EMS) The seeds of a tomato variety will be treated with EMS by immersing them approximately 2000 seeds per variety in an aerated solution of EMS at 0.5% (w / v) or 0.7% for 24 hours at room temperature. Approximately 1500 seeds per variety per dose of EMS are germinated and the resulting plants are grown, preferably in a greenhouse, for example, from May to September, to produce seeds. After maturation, the M2 seeds are harvested and grouped by variety and treatment. The resulting groups of M2 seeds are used as raw material to identify individual M2 seeds and plants with fruit and / or foliage tolerant to Tomato Brown Rugose Fruit Virus. Example 5: ToBRFV Quarantine Assay - Test for different combinations of QTL and Tm-1 In this experiment, the inventors tested various combinations of the QTLs from Chromosome 11 (QTL3 or Ch11 as in Example 3), Chromosome 9 (QTL2 or Ch9 as in Example 3), and Tm-1 on chromosome 2 and a susceptible control containing the Tm2 gene (Tm-R beam). The healthy control was a plant not exposed to the virus. The materials and methods are described in Example 3, particularly regarding the leaf and fruit ratio and the ELISA tests. Timetable • Sowing: T0 • Sampling for DNA extraction: T0 + 14 days • Mechanical inoculation: T0 + 28 days • Transplanting in quarantine: T0 + 29 days = 1 DPI • 1st score (foliar symptoms): 31 DPI • Sampling for ELISA: 35 DPI • 2nd score (fruit symptoms): 112 DPI Results: 1st score (foliar symptoms) and ELISA (31 DPI) General observation: without bearing fruit yet, significant foliar symptoms in all plants of susceptible genotypes. Foliar symptom index: 1 - severe foliar symptoms, 9 - no visible symptoms. Moderate foliar symptoms are illustrated in Figure 6. It is observed that the addition of the Tm-1 gene improves the score and that the improvement is even better when the Tm-1 gene is present homozygous. Furthermore, it was observed that 3 genotypes do not produce symptoms, namely [Ch11-R Tm1-R Ch9-H], [Ch11-R Tm1R Ch9-R] and [Oh 11-R Tm1-R Ch9-S]. At this early stage (31 DPI) QTL2 on chromosome 9 (fruit tolerance QTL) does not contribute to foliar resistance. Three other genotypes, namely [Ch11-R Tm1-H Ch9-H], [Ch11-R Tm1-H Ch9-R] and [Ch11-R Tm1-H Ch9S], also exhibit significant foliar resistance, although slightly less significant than that of the three previous genotypes. The ELISA test was carried out four days later, at 35 DPI. The results are reported in Table 11 and illustrated in Figure 7. IVIA / a / ZUZ I / UI O4OJ Table 11: ELISA results (DO at 405 nm) Línea / combinación No. de plantas Media Desviación estándar Media del Error Estándar Inferior al 95% Superior al 95% Ch11-H Tm1-H Ch9-H 11 2.3586 0.27 0.0808133 2.1785367 2.5386633 Ch11-H Tm1-H Ch9-R 10 2.16279 0.407358 0.1288179 1.8713787 2.4541913 Ch11-H Tm1-H Ch9-S 10 1.71319 0.729089 0.2305581 1.1916314 2.2347486 Ch11-RTm1-H Ch9-H 14 1.96077 0.388241 0.1037619 1.736604 2.1849318 Ch11-RTm1-H Ch9-R 11 2.3096 0.277721 0.083736 2.1230245 2.4961755 Ch11-RTm1-H Ch9-S 10 1.81148 0.588321 0.1860436 1.3906202 2.2323398 Ch11-RTm1-R Ch9-H 10 0.59897 0.109245 0.0345463 0.5208209 0.6771191 Ch11-RTm1-R Ch9-R 10 0.88279 0.38208 0.1208242 0.6094617 1.1561083 Ch11-RTm1-R Ch9-S 10 0.75813 0.176183 0.0557138 0.6320965 0.8841635 Ch11-RTm1-S Ch9-H 11 2.34288 0.143215 0.043181 2.2466685 2.4390951 Ch11-RTm1-S Ch9-R 10 2.29042 0.222169 0.070256 2.131485 2.449345 Ch11-RTm1-S Ch9-S 10 2.17247 0.134591 0.0425615 2.0761842 2.2687458 Ch11-S Tm1-S Ch9-H 10 2.14809 0.130071 0.0411319 2.0550431 2.2411369 Ch11-S Tm1-S Ch9-R 10 2.26306 0.185008 0.0585046 2.1307135 2.3954065 Ch11-S Tm1-S Ch9-S 7 2.37161 0.170053 0.064274 2.2143342 2.5288801 Beam. Tm-R 14 2.16388 0.143211 0.0382747 2.0811876 2.2465624 Healthy control 8 0.23817 0.049716 0.0175773 0.196605 0.2797325. It is observed that plants that have both QTL3 and Tm1 homozygous (Ch11-R Tm1-R) have a lower level of virus than all other genotypes. From these foliar symptom scores and ELISA tests at 31 / 35 DPI, it can be concluded that: 1. All plants with the Ch11-R-Tm-1-R combinations (3 combinations with Ch9 (QTL2) in all three states) are asymptomatic. These combinations are positive in ELISA, but show a much better virus content than all other combinations. 2. Three combinations of Chr-11-R Tm-1-H give plants which are almost completely asymptomatic, but their ELISAs do not appear to be statistically different from susceptible genotypes at this specific 30 DPI stage. 2d0score- fruit symptoms (112 DPI) General observation: in most plants, few clusters with red fruit. Fruit symptom index: 1 - severe foliar symptoms, 9 - symptoms not visible. The foliar symptoms are consistent with the 1st observation. Fruit symptoms are reported in Figure 8 and detailed in Table 12. Table 12: Fruit symptoms to ToBRFV at 112 DPI. Línea / combinación No. de plantas Media Desviación estándar Media del Error Estándar Inferior al 95% Superior al 95% Ch11-H Tm1-H Ch9-H 11 7.545455 2.207426 0.6655638 6.062486 9.028423 Ch11-H Tm1-H Ch9-R 10 8.6 0.843274 0.2666667 7.996758 9.203242 Ch11-H Tm1-H Ch9-S 10 3.8 2.149935 0.6798693 2.262029 5.337971 Ch11-R Tm1-H Ch9-H 14 8.714286 1.069045 0.2857143 8.097038 9.331534 Ch11-RTm1-H Ch9-R 11 9 0 0 9 9 Ch11-RTm1-H Ch9-S 10 6.4 2.503331 0.7916228 4.609225 8.190775 Ch11-RTm1-RCh9-H 10 8.4 1.897367 0.6 7.042706 9.757294 Ch11-RTm1-RCh9-R 10 9 0 0 9 9 Ch11-R Tm1-RCh9-S 8 8 2.13809 0.7559289 6.212512 9.787488 Ch11-R Tm1-S Ch9-H 11 9 0 0 9 9 Ch11-RTm1-S Ch9-R 10 9 0 0 9 9 Ch11-RTm1-S Ch9-S 9 4.555556 2.962732 0.9875772 2.278199 6.832913 Ch11-S Tm1-S Ch9-H 8 5 2.390457 0.8451543 3.001528 6.998472 Ch11-S Tm1-S Ch9-R 4 4.5 1.914854 0.9574271 1.45304 7.54696 Ch11-S Tm1-S Ch9-S 7 4.142857 2.544836 0.9618576 1.789276 6.496438 Haz. Tm-R 11 1.545455 0.934199 0.2816715 0.917851 2.173058 It can be deduced that the presence of QTL2 on chromosome 9 (Ch9), whether homozygous or heterozygous, generally improves fruit resistance (see, for example, the first 3 genotypes in Figure 8, where fruit symptoms are absent with QTL2 in the homozygous state (Ch9-R) and mild when QTL2 is present heterozygous (Ch9-H), while those symptoms are more significant when QTL2 is absent (Ch9-S). This assay does not allow discrimination between the [Ch11-R, Tm1-R / H, Ch9-H] and [Ch11-R, Tm1-S, Ch9-H] genotypes, since both genotypes score 9 in this protocol. However, the results of Example 3 suggest that, under different ToBRFV infection conditions or at a later stage of infection, the presence of the Tm1 gene, whether homozygous or heterozygous, provides a higher level of resistance compared to plants with the [Ch11-R, Ch9-H] genotype. Conclusions The presence of QTL3 on chromosome 11, preferably homozygous, in combination with the Tm1 gene, provides the least foliar resistance, associated with a reduced virus titer when both are present homozygous (Ch11-R;Tm1-R). This combination thus provides the best resistance in the early stages of ToBRFV infection; furthermore, foliar resistance ensures proper plant development, resulting in healthy plants with improved photosynthesis and a higher expected fruit yield. In addition, the virus titer means that plants are less likely to contaminate surrounding plants and spread the virus, and the slower viral progression may allow plants to avoid the more severe stages of infection, especially in cases of late infection. To ensure good fruit resistance, this combination should preferably be combined with QTL2 on chromosome 9 (Ch9-H or Ch9-R). In conclusion, the genotypes corresponding to Ch11-R, Tm1-R and Ch9-H or R, provide overall the best results on the combined criteria of foliar resistance (advantageous for photosynthesis and yield), virus titer (less contamination and slower progress) and fruit resistance (higher yield of marketable fruit).

Claims

1. A Solanum lycopersicum plant resistant to Tomato Brown Rugose Fruit Virus (TBRFV) characterized in that it comprises in its genome the combination of: a. the resistance gene Tm-1 on chromosome 2 and b. at least one quantitative trait locus (QTL) chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, which independently confers to the plant foliar and / or fruit tolerance to TBRFV, characterized in that the QTLs are present in the genome of a plant from the seeds HAZTBRFVRES1 with NCIMB accession number 42758.

2. The S. lycopersicum plant according to claim 1 further characterized in that it comprises in its genome the combination of: a. the Tm-1 resistance gene on chromosome 2, preferably homozygous, b. the QTL3 on chromosome 11 homozygous and c. the QTL2 on chromosome 9 heterozygous.

3. The S. lycopersicum plant according to claim 1 further characterized in that it comprises in its genome the combination of the Tm-1 resistance gene and at least two QTLs selected from QTL1, QTL2 and QTL3, characterized in that at least one of the QTLs is heterozygous.

4. The S. lycopersicum plant according to claim 1 further characterized in that it homozygously comprises in its genome the combination of: a. the Tm-1 resistance gene on chromosome 2 and b. the QTL3 on chromosome 11.

5. The S. lycopersicum plant according to any of claims 1 to 4, further characterized in that the plant slows down, reduces or inhibits the replication or multiplication of the virus or reduces the virus titer in the plant.

6. The S. lycopersicum plant according to any of claims 1 to 5, characterized in that the TBRF virus is the Israeli strain of TBRFV.

7. The S. lycopersicum plant according to any of claims 1 to 6, further characterized in that it further comprises the Tm-2 resistance gene, preferably heterozygous.

8. The S. lycopersicum plant according to any of claims 1 to 7, further characterized in that the QTLs are located, for QTL1, on chromosome 6, within the chromosomal region delimited by TO-0005197 (SEQ ID NO:1) and TO-015581 (SEQ ID NO:2), for QTL2, on chromosome 9, within the chromosomal region delimited by TO0180955 (SEQ ID NO:3) and TO-0196109 (SEQ ID NO:6) and for QTL3, on chromosome 11, within the chromosomal region delimited by TO-0122252 (SEQ ID NO:7) and TO-0162427 (SEQ ID NO:18).

9. S. lycopersicum according to any of claims 1 to 8, further characterized by the presence in the S. lycopersicum genome of at least one of the following alleles: • T allele of TO-0005197 and / or • C allele of TO-0145581 for the presence of QTL1, • G allele of TO-0180955 and / or • C allele of TO-0196724 and / or • G allele of TO-0145125 and / or • G allele of TO-0196109 for the presence of QTL2, • T allele of TO-0122252 and / or • C allele of TO-0144317 and / or • T allele of TO-0142270 and / or • G allele of TO-0142294 and / or • A allele of TO-0142303 and / or, • A allele of TO-0142306 and / or • G allele of TO-0182276 and / or • G allele of TO-0181040 and / or • G allele of TO-0123057 and / or • A allele of TO-0125528 and / or • C allele of TO-0162432 and / or • T allele of TO-0162427 for the presence of QTL3, in combination with the A allele of the SNP marker TO-0200838 (SEQ ID No: 21).

10. The plant according to any of claims 1 to 9, further characterized in that the plant is a progeny of a hybrid between a plant grown from the seeds of HAZTBRFVRES1 (with NCIMB accession number 42758) and an S. lycopersicum having the Tm-1 gene.

11. A cell of an S. lycopersicum according to any of claims 1 to 10, characterized in that it comprises in its genome the combination of the Tm1 gene and at least one of the QTLs1 on chromosome 6, the QTL2 on chromosome 9 and / or the QTL3 on chromosome 11, characterized in that the combination confers resistance to the TBRF virus.

12. A plant part of an S. lycopersicum according to any of claims 1 to 10, in particular seeds, explants, reproductive material, shoot, cutting, seed, fruit, root, rhizome, pollen, ovule, embryo, protoplasts, leaf, anther, stem, petiole or flowers, characterized in that the plant part comprises cells according to claim 11.

13. A seed of an S. lycopersicum, characterized in that it develops into a plant resistant to TBRFV in accordance with any of claims 1 to 10.

14. A plant cell tissue culture according to any of claims 1 to 10, characterized in that the cells are derived from embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, stems, petioles, roots, root tips, seeds, flowers, cotyledons and / or hypocotyl and contain in their genome QTL1 on chromosome 6, QTL2 on chromosome 9 and / or QTL3 on chromosome 11 which independently confer to the fruit or foliage tolerance to the TBRF virus, in combination with the Tm-1 gene.

15. A method for detecting and / or selecting TBRFV-resistant S. lycopersicum, inhibiting, reducing or delaying viral replication, characterized in that it comprises the steps of: a. Detecting at least one of the following markers: T allele of TO-0122252, C allele of TO-0144317, T allele of TO-0142270, G allele of TO-0142294, A allele of TO-0142303, A allele of TO-0142306, G allele of TO-0182276, G allele of TO-0181040, G allele of TO-0123057, A allele of TO-0125528, C allele of TO-0162432 and T allele of TO-0162427 and b. Detect the homozygous presence of the Tm-1 gene, preferably detect the A allele of the SNP marker TO-0200838.

16. A method for detecting and / or selecting S. lycopersicum resistant to TBRFV, inhibiting, reducing, or delaying virus replication, the method being characterized in that it comprises: a) Testing tomato plants for the combination in their genome of • the Tm-1 resistance gene on chromosome 2 and • at least one genetic marker genetically linked to a QTL chosen from QTL3 on chromosome 11, QTL1 on chromosome 6, and QTL2 on chromosome 9, which independently confers foliar and / or fruit tolerance to TBRFV to the plant, b) Selecting a plant comprising the Tm-1 gene and the genetic marker and conferring the chosen QTL foliar and / or fruit tolerance to TBRFV, wherein the chosen QTL and the genetic marker are located, for QTL1, on chromosome 6, within the chromosomal region delimited by TO-0005197 (SEQ ID NO:1) and TO015581 (SEQ ID NO:2), for QTL2, on chromosome 9,within the chromosomal region delimited by TO-0180955 (SEQ ID NO:3) and TO-0196109 (SEQ ID NO:6) and for QTL3, on chromosome 11, within the chromosomal region delimited by TO-0122252 (SEQ ID NO:7) and TO0162427 (SEQ ID NO:18)., 17. A method for conferring TBRFV resistance to S. lycopersicum, characterized comprising the steps of: a) Crossing a plant grown from seeds deposited as NCIMB 42758 or progeny thereof, having QTL1, QTL2 and / or QTL3 conferring tolerance to TBRFV, and S. lycopersicum, preferably devoid of the QTLs and having the Tm-1 gene; b) Selecting a plant from the progeny thus obtained, having one, two or three of the QTLs1, QTL2 and / or QTL3 in combination with the Tm-1 gene; c) Optionally self-pollinating the plant obtained in step b) one or more times and selecting from the progeny thus obtained a plant having TBRFV resistance, characterized in that the resistance delays, reduces or inhibits the replication or multiplication of the virus.

18. A method for conferring TBRFV resistance to S. lycopersicum, characterized comprising the steps of: a1) Crossing a plant grown from seeds deposited as NCIMB 42758 or progeny thereof, having QTL1, QTL2 and / or QTL3 conferring tolerance to TBRFV and an S. lycopersicum, preferably devoid of the QTLs and having the Tm-1 gene, thereby generating F1 hybrids, a2) self-fertilizing the F1 hybrids to create the F2 population, b) Selecting individuals from the progeny thus obtained that have TBRFV resistance, characterized in that the resistance slows, reduces or inhibits virus replication.

19. The method according to claim 17 or 18, further characterized in that the SNP markers are used in steps b) and / oc) to select plants having QTLs1, QTL2 and / or QTL3 that confer tolerance to TBRFV and / or to select plants having the Tm-1 gene.

20. A method for reproducing S. lycopersicum having resistance to TBRFV, characterized in that it comprises the steps of crossing a plant grown from seeds deposited as NCIMB 42758 or progeny thereof having the QTLs1, QTL2 and / or QTL3 conferring tolerance to TBRFV, with an S. lycopersicum having the Tm-1 gene.

21. An S. lycopersicum plant obtainable by the method in accordance with any of claims 17 to 20.

22. A method for improving the performance of tomato plants in a TBRFV-infested environment comprising growing tomato plants comprising in their genome the combination of: a. the Tm-1 resistance gene on chromosome 2 and b. at least one QTL and preferably two QTLs, chosen from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, characterized in that the QTLs are present in the genome of a plant from the seeds HAZTBRFVRES1 with NCIMB accession number 42758 and independently confer foliar and / or fruit tolerance to the tomatoes to TBRFV.

23. The method according to claim 22, further characterized in that the plant comprises the combination of the Tm-1 gene on chromosome 2 and a QTL on chromosome 11, wherein the QTL is present in the genome of a plant from the HAZTBRFVRES1 seeds with NCIMB accession number 42758 and confers foliar tolerance to TBRFV.

24. A method for reducing the loss on tomato production under TBRFV infestation conditions, comprising growing resistant tomato plants comprising in their genome the combination of: - the Tm-1 resistance gene on chromosome 2 and - at least QTLs and preferably two QTLs, selected from QTL3 on chromosome 11, QTL1 on chromosome 6 and QTL2 on chromosome 9, characterized in that the QTLs are present in the genome of a plant from the seeds HAZTBRFVRES1 with NCIMB accession number 42758 and independently confer foliar and / or fruit tolerance to the tomatoes to TBRFV.

25. A method of protecting a field, tunnel, greenhouse, or glass greenhouse of tomato plants against TBRFV infestation, comprising growing plants comprising in their genome the combination of: 1 / Ul 0400 - the Tm-1 resistance gene on chromosome 2 and - at least one QTL and preferably two QTLs, selected from QTL3 on chromosome 11, QTL1 on chromosome 6, and QTL2 on chromosome 9, characterized in that the QTLs are present in the genome of a plant from the seeds HAZTBRFVRES1 with NCIMB accession number 5 and independently confer foliar and / or fruit tolerance to the tomatoes to TBRFV.

26. Use of a TBRFV-resistant tomato plant to control TBRFV infestation in a field, tunnel, greenhouse, or glasshouse, wherein the tomato plant comprises in its genome the combination of the resistance gene Tm-1 on chromosome 2 and at least one QTL and preferably two QTLs, selected from QTL3 on chromosome 11, QTL1 on chromosome 6, and QTL2 on chromosome 9, wherein the QTLs are present in the genome of a plant from the seeds HAZTBRFVRES1 with NCIMB accession number 42758 and independently confer foliar and / or fruit tolerance to TBRFV to the tomatoes.