Campylobacter jejuni / 723 bacterial strain for use as control strain in rt-PCR and for identification of campylobacter bacteria

The Campylobacter jejuni/723 strain addresses the challenges of isolating and identifying Campylobacter jejuni by serving as a control in real-time PCR and MALDI-TOF mass spectrometry, improving diagnostic efficiency and reducing antibiotic reliance.

RU2864810C1Active Publication Date: 2026-06-29FEDERALNOE GOSUDARSTVENNOE BIUDZHETNOE UCHREZHDENIE FEDERALNYI TSENTR OKHRANY ZDOROVIA ZHIVOTNYKH FGBU VNIIZZH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
RU2025130977
Authority / Receiving Office
RU · RU
Patent Type
Patents
Current Assignee / Owner
Filing Date
2025-11-10
Publication Date
2026-06-29
Estimated Expiration
2045-11-10

AI Technical Summary

Technical Problem

Current methods for isolating and identifying Campylobacter jejuni strains are labor-intensive due to complex growth requirements and environmental sensitivity, complicating the development of diagnostic tools for campylobacteriosis.

Method used

Development of the Campylobacter jejuni/723 bacterial strain, which can be used as a control strain for real-time PCR and a marker in MALDI-TOF mass spectrometry, expanding the arsenal of strains suitable for rapid identification and diagnosis.

Benefits of technology

The strain facilitates efficient and accurate identification of Campylobacter bacteria, contributing to safer livestock products and reducing antibiotic use, while enhancing diagnostic capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000002
    Figure 00000002
  • Figure 00000003
    Figure 00000003
  • Figure 00000004
    Figure 00000004
Patent Text Reader

Abstract

FIELD: biotechnology.SUBSTANCE: concerns a new strain of bacteria Campylobacter jejuni / 723 of the family Campylobacteriасеае of the genus Campylobacter species C. jejuni, deposited in the All-Russian State Collection of Exotic Types of Foot-and-Mouth Disease Viruses and Other Animal Pathogens (GKSHM) of the FSBI ARRIAH under the registration No. 723-dep / 24-GKSHM of the FSBI ARRIAH. The proposed strain grows on Columbia agar with the addition of 5% defibrinated ram blood; the strain possesses pronounced properties characteristic of its species.EFFECT: presented strain can be used in the development and production of components (antigen and serum) for serological reactions for the diagnosis of campylobacteriosis in farm animals and as a positive control for the identification of bacteria of the genus Campylobacter by real-time PCR and the identification of the species Campylobacter jejuni by time-of-flight mass spectrometry.1 cl, 3 dwgs, 3 tbls, 5 ex
Need to check novelty before this filing date? Find Prior Art

Description

[0001] The invention relates to the field of veterinary microbiology and biotechnology, namely to the production of a new strain "723" of Campylobacter jejuni bacteria and the possibility of using it as a control strain for the detection and identification of campylobacter isolates in a real-time polymerase chain reaction and as a marker for the identification of Campylobacter bacteria in matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF), as well as replenishing the database of the MALDI Autof mass spectrometer.

[0002] Many species of the genus Campylobacter are pathogens for both humans and animals, but the main etiological factor in the development of intestinal infections is Campylobacter jejuni [1, 2]. More than 166 million cases of foodborne campylobacteriosis are registered annually worldwide [3]. Furthermore, campylobacteriosis ranks third after listeriosis among the causes of death in humans from acute intestinal infections [4].

[0003] In accordance with veterinary rules 13.4.1307-96 “Prevention and control of infectious diseases common to humans and animals...” campylobacteriosis is defined as an infectious disease of animals and humans caused by pathogenic microorganisms of the genus Campylobacter, which is characterized by varying degrees of severity and polymorphic manifestations [5].

[0004] Among farm animals, campylobacteriosis most commonly affects cattle and sheep, with clinical manifestations ranging from asymptomatic carriage to severe disease. While infection with C. jejuni in adult cattle is asymptomatic, a dysentery-like form of the disease develops in calves. In sheep, C. jejuni causes abortions and generalized lesions. In other animals, the infection manifests as enteritis. C. jejuni is also pathogenic in birds, while other species of campylobacter, such as Campylobacter coli, Campylobacter laridis, and Campylobacter hyointestinalis, are commensals. It should be noted that the spread of campylobacteriosis is a problem not only in the Russian Federation. For more than 20 years, in accordance with WHO recommendations, this infection has been included in national programs to combat infectious diseases in more than 100 countries [6].

[0005] The relevance of the fight against campylobacteriosis in farm animals in the Russian Federation is confirmed by the introduction of new, stricter “Veterinary rules for the implementation of preventive, diagnostic, therapeutic, restrictive and other measures, the establishment and cancellation of quarantine and other restrictions aimed at preventing the spread and eliminating foci of campylobacteriosis” from September 2024, approved by order of the Ministry of Agriculture of Russia dated December 26, 2023 N 941 [7].

[0006] Bacteria of the genus Campylobacter are Gram-negative, spiral-shaped, rod-shaped or curved bacteria with one polar flagellum, or bipolar flagella or no flagella, depending on the species, do not form spores and have a size of 0.2-0.8 by 0.5-5 μm [8].

[0007] The isolation of viable campylobacter from pathological and biological material remains a labor-intensive procedure to this day, not only due to their complex growth requirements, but also due to the specific requirements for the gas medium composition. A method for isolating campylobacter using a selective medium containing antibiotics and incubation at 43°C in a microaerobic atmosphere (5% oxygen, 10% carbon dioxide, and 85% hydrogen) was first developed in 1977 [9]. It is the specific conditions required for campylobacter to thrive that make them more sensitive to environmental stress factors, creating difficulties in isolation and identification

[10] . At the same time, some authors note that campylobacters have such features as “genome plasticity” and regulatory genes that respond to environmental changes, which affects their survival in unfavorable conditions [11, 12].

[0008] Despite the ongoing development of new molecular genetic and proteomic methods and the refinement of existing ones, problems with identifying pathogenic Campylobacter species remain, complicating the isolation and identification of Campylobacter isolates. Therefore, it is necessary to continually expand the collection of Campylobacter strains to develop new diagnostic tools for campylobacteriosis and markers for identifying Campylobacter bacteria using modern instrumental methods.

[0009] The strain C. jejuni No. 169 / 17 (serotype 1) is known (USSR author's certificate No. 1360192), which is used for hyperimmunization of producer animals with inactivated and live vaccines in order to obtain a polyvalent hyperimmune serum used against campylobacteriosis of newborn calves caused by the species C. jejuni. Calves aged 8-12 months are used as producer animals

[13] .

[0010] The strain C. jejuniCG8421 is known, which is used to develop and improve a model for studying campylobacteriosis, assessing the immune response and evaluating the effectiveness of vaccines against campylobacter in humans

[14] .

[0011] The strain C. jejuni F38011, a causative agent of enteritis in humans, is known. When studying it at the genomic and proteomic levels, peptides corresponding to the isolated amino acid sequence of C. jejuni enzymes were identified and the functions of the putative restriction-modification enzymes of C. jejuni were revealed

[15] .

[0012] A strain of C. jejuni (NCTC 11168) is known to be used to obtain antigenic polypeptides that can serve as components of vaccines against infections caused by C. jejuni and for the diagnosis of infections caused by C. jejuni

[16] .

[0013] The strain C. jejuni VKShM-B-897M was isolated from the feces of cattle, its resistance to doxycycline, azithromycin, gentamicin, ciprofloxacin was studied, genetic resistance factors were reliably confirmed in this strain and it is used to control resistance to a wide range of antibacterial drugs

[17] .

[0014] The patent and scientific literature do not contain any technical solutions containing the Campylobacter jejuni / 723 bacterial strain similar to the claimed one, i.e. the proposal meets the criterion of “novelty”.

[0015] Obtaining the Campylobacter jejuni / 723 bacterial strain from animal products contaminated with campylobacter and using it as a production strain to obtain components for real-time polymerase chain reaction and as a marker for identifying campylobacter is a relevant area and will contribute to providing the country with safe livestock products, reducing the use of antibacterial drugs in livestock farming and, due to this, the possible export of products.

[0016] The technical result consists in expanding the arsenal of current industrial strains of Campylobacter jejuni bacteria, possessing new biological characteristics and suitable for use in the development and manufacture of components for conducting a polymerase chain reaction in real time and as a marker for identifying bacteria of the genus Campylobacter by time-of-flight mass spectrometry, as well as replenishing the database of the MALDI Autof mass spectrometer.

[0017] The above problem was solved by obtaining the bacterial strain “Campylobacter jejuni / 723”, which can be used as a control strain when performing RT-PCR and for identifying Campylobacter bacteria using time-of-flight mass spectrometry.

[0018] The isolate C. jejuni, which served as the source for obtaining the bacterial strain "Campylobacter jejuni / 723", was isolated at the Federal State Budgetary Institution "All-Russian Research Institute of Animal Health" in 2024 during a bacteriological study of a poultry meat sample received from a farm in the Vladimir region for scientific research.

[0019] The bacterial strain "Campylobacter jejuni / 723" is deposited in the All-Russian State Collection of Exotic Types of Foot-and-Mouth Disease Virus and Other Animal Pathogens (GKShM) of the All-Russian Research Institute of Animal Health (ARRIAH) under the registration number: No. 723 - dep / 24 GKShM of the All-Russian Research Institute of Animal Health (ARRIAH).

[0020] The possibility of using the bacterial strain “Campylobacter jejuni / 723” for the identification of bacteria by RT-PCR and time-of-flight mass spectrometry methods was experimentally confirmed.

[0021] The essence of the invention is reflected in the graphic image:

[0022] Fig. 1. Mass spectrum of the bacterial strain “Campylobacter jejuni / 723”.

[0023] Fig. 2. Using the bacterial strain "Campylobacter jejuni / 723" as a positive control in the identification of the genome of Campylobacter spp. Note: "1" - Campylobacter jejuni / 723; "2" - Campylobacter jejuni ATCC 33291, "3" - Campylobacter coli ATCC 43478; "4" - Campylobacter lary ATCC 35221; "5, 6, 7" isolates of bacteria of the genus Campylobacter isolated from poultry meat, "8" - Salmonella typhimurium ATTC 14028).

[0024] Fig. 3. - Use of the strain "Campylobacter jejuni / 723" as a positive control in the identification of isolates of bacteria of the genus Campylobacter by mass spectrometry

[0025] The essence of the invention is explained in the sequence listing, in which:

[0026] SEQ ID NO: 1 represents the nucleotide sequence of forward primer;

[0027] SEQ ID NO: 2 represents the nucleotide sequence of reverse primer;

[0028] SEQ ID NO: 3 represents the nucleotide sequence of the molecular probe.

[0029] The bacterial strain "Campylobacter jejuni / 723" is characterized by the following features and properties.

[0030] Morphological characteristics

[0031] The bacterial strain "Campylobacter jejuni / 723" belongs to the family Campylobacteraceae, genus Campylobacter, species Campylobacter jejuni and has morphological features characteristic of bacteria of the genus Campylobacter.

[0032] Gram-negative, non-spore-forming rods of curved or spiral shape. Bacterial motility is provided by one or two polar flagella. Cell thickness is 0.2-0.5 µm, length 0.5-0.8 µm. Flagella are two to three times longer than the cell itself. The ends of bacterial cells are pointed. In aging cultures (after 48-72 hours of incubation on solid medium), bacterial cells may assume a coccoid shape. They do not produce pigments.

[0033] Growth properties

[0034] C. jejuni / 723 bacteria are capable of growing at reduced partial oxygen pressure on complex nutrient media with the addition of antibiotics to suppress accompanying microflora, for example, to suppress gram-negative - polymyxin; to suppress gram-positive - vancomycin; fungi - amphotericin.

[0035] On solid nutrient media, C. jejuni / 723 bacteria form flat, moist, slimy, grayish, "spreading," droplet-shaped colonies with jagged edges, or small, discrete, shiny, convex colonies 1-2 mm in size. On semi-liquid and liquid media, they form a bluish-gray surface film. C. jejuni / 723 bacteria are rapidly mobile; cells taken from agar move in a wave-like pattern, while those from broth move in a spiral pattern.

[0036] Bacterial strain “Campylobacter jejuni / 723”:

[0037] - microaerophiles, they require an atmosphere with a reduced concentration of oxygen (approximately 5-10% O2) and an increased concentration of carbon dioxide (5-10% CO2);

[0038] - thermophiles, optimal growth temperature from 42°C to 43°;

[0039] - The pH level for the growth of the bacterial strain C. jejuni / 723 should be in the range of 5.5 to 8.0, at a pH value above 9.0 and below 5.0, the bacterial cells die;

[0040] - when grown on Bolton broth, they form a homogeneous turbidity of the medium and sediment;

[0041] - On solid medium of selective agar for Campylobacter CCDA, colonies are grayish in color, often with a metallic sheen. They are small, flat, moist, tend to grow, and resemble drops of condensation;

[0042] - on Columbia agar with the addition of 7% defibrinated ram blood, the colonies are also small, dew-colored, grayish-white in color, translucent, and do not form hemolysis zones;

[0043] - when grown on Preston medium, they form moist, gray, flat colonies that tend to stick together.

[0044] The bacterial strain "Campylobacter jejuni / 723" is demanding of nutrient media and is dependent on the presence of such components in them as:

[0045] - amino acids,

[0046] - protein hydrolysate (in particular, casein hydrolysate),

[0047] - defibrinated ram blood,

[0048] - growth factors (yeast extract, hemin) and

[0049] - Na salts (sodium pyruvic acid, sodium metabisulfite, sodium dibasic phosphate),

[0050] - iron sulfate (II),

[0051] - L-cysteine ​​hydrochloride,

[0052] - potassium phosphate monobasic.

[0053] Biochemical properties

[0054] When cultured on Giss media or the commercial test system “API Campy”, the bacterial strain “Campylobacter jejuni / 723” exhibits the following biochemical properties, presented in Table 1:

[0055] - form oxidase, catalase, esterase, γ-glutamyl transferase, alkaline phosphatase, pyrrolidone arylamidase, L-arginine arylamidase, L-aspartate arylamidase,

[0056] - hydrolyze sodium hippurate,

[0057] - reduce nitrates, triphenyltetrazolium chloride,

[0058] - assimilate sodium succinate,

[0059] - do not assimilate D-glucose, sodium acetate, sodium citrate, propionic acid, malic acid,

[0060] - do not form H2S,

[0061] - sensitive to tetracycline and chloramphenicol,

[0062] - resistant to cefazolin sodium, nalidixic acid and erythromycin.

[0063] Proteomic properties

[0064] During the mass spectrometric analysis of the outer membrane proteins of the bacterial strain "Campylobacter jejuni / 723", the results are presented in Table 2. They show that the spectra with the highest signal intensity were in the range from 2624 to 10321 Da. The number of peaks observed during the mass spectral analysis was 71 (Fig. 1).

[0065] For the bacterial strain “Campylobacter jejuni / 723”, the highest signal intensity of 73 units, 89 units and 94 units is characteristic of peaks of 5499 Da, 4366 Da, 5246 Da, respectively (Table 2).

[0066] Biotechnological properties

[0067] The optimal conditions for culturing the bacterial strain "Campylobacter jejuni / 723" are as follows:

[0068] - Columbia agar nutrient medium with the addition of 5% defibrinated ram blood on Petri dishes;

[0069] - the cultures are incubated for 24 hours at a temperature of (37.0±0.5)°C under microaerobic conditions (CO2- 10%, O2- 5%, N2- 85% [MUK 4.2.2321-08]).

[0070] The purity of the culture is checked by light microscopy of Gram-stained smears.

[0071] After completion of cultivation, the agar culture of the bacterial strain "Campylobacter jejuni / 723" is washed with sterile meat-peptone broth or any liquid nutrient medium without antibiotics and blood.

[0072] Antimicrobial resistance

[0073] The bacterial strain "Campylobacter jejuni / 723" is sensitive to ampicillin, amikacin, doxycycline, gentamicin, tetracycline, chloramphenicol.

[0074] Resistant to antibiotics such as ofloxacin, cephalothin, nalidixic acid, ciprofloxacin and erythromycin.

[0075] Additional features and properties

[0076] Contamination with bacteria, fungi, mycoplasma - the bacterial strain "Campylobacter jejuni / 723" is not contaminated with bacteria, fungi, mycoplasma.

[0077] Storage conditions.

[0078] For cryopreservation of the Campylobacter jejuni / 723 bacterial strain, use a semi-liquid nutrient agar containing fermented meat peptone, casein hydrolysate, yeast extract, microbiological agar, sodium chloride, sodium pyruvic acid, sodium metabisulfite, and ferrous sulfate. When stored natively at -70.0 ± 5.0°C, the permissible shelf life without refreshing is 12 months, and when stored lyophilized at the same temperature, it is 10 years.

[0079] The essence of the proposed invention is explained by examples of its use, which do not limit the scope of the invention.

[0080] Example 1. Cultivation of the bacterial strain "Campylobacter jejuni / 723" in order to obtain the biomass of this strain

[0081] To cultivate the Campylobacter jejuni / 723 bacterial strain, Columbia agar supplemented with 5% defibrinated sheep blood was used in Petri dishes. The cultures were incubated for 24 hours at 37.0 ± 0.5°C under microaerobic conditions (10% CO2, 5% O2, 85% N2). Culture purity was verified by light microscopy of Gram-stained smears.

[0082] After 24 hours, the agar culture of the bacterial strain “Campylobacter jejuni / 723” was washed off with sterile saline.

[0083] Thus, the native biomass of the bacterial strain “Campylobacter jejuni / 723” was obtained and used for further work.

[0084] Example 2. Determination of the stability of the bacterial strain "Campylobacter jejuni / 723" during storage

[0085] The obtained bacterial mass of the strain “Campylobacter jejuni / 723” as described in Example 1 was used to determine the stability of the strain during storage.

[0086] After incubation, the agar culture was washed off with sterile sucrose-gelatose medium (stabilizing medium) in a volume of 5.0 cm 3 per cup. The concentration of the bacterial suspension was determined using the ORMET standard sample of bacterial suspension turbidity. Based on the results of visual standardization, the concentration of the initial bacterial suspension was adjusted to 10 9 m.k. / cm 3 .

[0087] Bacterial suspension was packaged in 0.5 cm 3 in ampoules of appropriate capacity.

[0088] The lyophilization process after adding stabilizers was carried out as described above.

[0089] The date of manufacture of the Campylobacter jejuni / 723 strain of bacteria was considered to be the date of lyophilization.

[0090] The Campylobacter jejuni / 723 bacterial strain was stored lyophilized in sealed ampoules packed in cardboard boxes and metal containers at a temperature of -40-70°C. The shelf life of Campylobacter jejuni / 723 is 5 years from the date of lyophilization.

[0091] After 6 months of storage, 5 ampoules containing a lyophilized culture of the bacterial strain "Campylobacter jejuni / 723" were opened and the strain's physicochemical and biological parameters were determined. All parameters met the required standards, indicating that the strain's properties had not changed during storage for 6 months.

[0092] Example 3. Determination of the biochemical properties of the bacterial strain "Campylobacter jejuni / 723"

[0093] The biochemical properties of the bacterial strain "Campylobacter jejuni / 723" were determined using the API Campy kit (BioMerieux) for the identification of bacteria of the Campylobacteraceae family by hydrolysis of urea and sodium hippurate, reduction of nitrates and triphenyltetrazolium chloride, cleavage of esterase, the presence of arginine arylomidase, oxidation of D-glucose, release of H2S, assessment of resistance to nalidixic acid, cefazolin sodium and erythromycin.

[0094] 5 cm was added to the incubation container (tray and lid) 3 purified water to create a humid atmosphere. The strip was placed in an incubation container. In a test tube containing 5 cm 3Two to three isolated colonies of the Campylobacter jejuni / 723 bacterial strain were added to a test tube of sterile saline using a bacteriological loop and thoroughly triturated. The suspension was pipetted into the wells of the strip, avoiding the formation of bubbles. The tray was covered with a lid and incubated at 37.0 ± 0.5°C for 18-24 hours.

[0095] Catalase production was determined in a test with a 3% hydrogen peroxide solution.

[0096] The biochemical properties of the strain are presented in Table 1, which correspond to the properties presented in Bergey's identification guide

[18] for the species Campylobacter jejuni. According to the results of the studies, the bacterial strain "Campylobacter jejuni / 723" belongs to the genus Campylobacter, species C. jejuni.

[0097] Example 4. Use of the bacterial strain “Campylobacter jejuni / 723” as a positive control in RT-PCR for the detection of Campylobacter bacteria.

[0098] To use the bacterial strain “Campylobacter jejuni / 723” in RT-PCR as a positive control, a bacterial suspension with a density of 0.5 McFarland units was prepared as described in Example 1. The density was measured using a densitometer (BioMerieux, France).

[0099] Bacterial DNA was isolated using the RIBO-Prep kit (Amplisens, Moscow) in accordance with the manufacturer's instructions.

[0100] Primers and probes encoding the 16S rRNA gene sequence for the identification of campylobacter, used in this work and described previously by M. Lund et al.

[19] , were synthesized by Syntol. The primary structures of the oligonucleotides are presented in Table 3.

[0101] The RT-PCR reagent kit (Synthol, Russia) was used for setting up the RT-PCR. The reaction mixture was assembled from the following components per 25 μl sample: 5 μl DNA; 10x PCR buffer; 2.5 μl 2.5 mM dNTP; 2.5 μl 25 mM MgCl2; 0.3 pM each of forward and reverse primers; 0.15 pM probe; 2.5 U SynTaq DNA polymerase.

[0102] Real-time amplification was performed on a CFX-96 thermal cycler (BIO-RAD, USA) under the following conditions: mixture heating at 50°C for 2 min; enzyme activation at 95°C for 10 min; 45 cycles of 95°C for 15 sec, 58°C for 1 min. Results were interpreted based on the presence or absence of the Ct threshold cycle value. The sample was considered positive at Ct ≤ 40.

[0103] The analytical sensitivity of RT-PCR was determined using a series of 10-fold dilutions of bacterial DNA isolated from a suspension of the reference strain C. jejuni ATCC 33291 with an optical density of 1 unit according to the McFarland standard, which corresponds to 3x10 8 CFU / cm 3The suspension was prepared using a 0.9% NaCl solution. Microorganism concentration was confirmed by titration on a solid nutrient medium—Columbia agar (HiMedia, India) supplemented with 5% defibrinated sheep blood. The concentration of isolated DNA was determined using an Implen NanoPhotometer P-Class P-360 spectrophotometer (IMPLEN, Germany). DNA dilutions were prepared using 100 µl of TE buffer.

[0104] As a result of the conducted studies, it was established that the genome of the bacterial strain "Campylobacter jejuni / 723" is detected at a concentration of at least 40 target molecules in the test sample. RT-PCR conditions were optimized: the optimal magnesium concentration (2.5 mM) and primer annealing temperature (58°C) were selected. The selected primers were found to be highly specific and did not produce false-positive reactions.

[0105] Various bacterial strains were studied in real-time polymerase chain reaction. The following bacterial strains were used for this purpose: "Campylobacter jejuni / 723" - the proposed invention; Campylobacter jejuni ATCC 33291, Campylobacter coli ATCC 43478; Campylobacter lary ATCC 35221; isolates of Campylobacter bacteria isolated from poultry meat and Salmonella typhimurium ATTC 14028 (Fig. 2). The bacterial strain "Campylobacter jejuni / 723" proposed by the invention was used as a control strain. The presented bacterial strain "Campylobacter jejuni / 723" is defined in RT-PCR as Campylobacter spp., with a PCR efficiency of 92.26%. As can be seen in Fig. 2, only sample number 8 showed a negative result, i.e. sample number 8 did not contain the genome of bacteria of the genus Campylobacter.

[0106] The use of the bacterial strain "Campylobacter jejuni / 723" as a positive control in RT-PCR was confirmed.

[0107] Example 5. Expansion of the MALDI Autof mass spectrometer database with the spectrum of the Campylobacter jejuni / 723 bacterial strain by time-of-flight mass spectrometry and the use of the Campylobacter jejuni / 723 bacterial strain as a positive control in the identification of campylobacter.

[0108] When identifying campylobacter bacteria using mass spectrometry, the bacterial strain "Campylobacter jejuni / 723" was used as a positive control. Time-of-flight mass spectrometry was performed using the reference strain Campylobacter jejuni ATCC 33560 and campylobacter isolates from poultry meat (237-24, NN-15, NN-274). These strains and isolates share common peaks, indicating that they belong to the same genus of bacteria, namely, the genus Campylobacter.

[0109] Time-of-flight mass spectrometry was performed according to the following scheme.

[0110] Preparing the culture

[0111] 1. Add 300 µl of highly purified deionized water to an Eppendorf tube.

[0112] 2. Add one or two isolated colonies to a test tube using a disposable plastic bacteriological loop; vortex for 30 seconds (to lyse the cells in a hypoosmotic environment).

[0113] 3. Add 900 µl of 96% ethanol and vortex for 30 seconds.

[0114] 4. Centrifuge the resulting suspension at 14 thousand rpm for 2 minutes, remove the supernatant.

[0115] 5. Repeat centrifugation in the same mode, remove the supernatant without touching the sediment.

[0116] 6. Dry the precipitate for 5-10 minutes at room temperature or in a solid-state thermostat at 37-40°C for 2-5 minutes (no traces of liquid should be observed on the surface of the precipitate).

[0117] 7. Add 10 µl of “lysate 1” to the microtube with the sediment and vortex for 30 seconds.

[0118] 8. Add 10 µl of “Lysate 2” (Autobio Diagnostics Co., Ltd., China) and vortex for 30 seconds.

[0119] 9. Centrifuge at 14 thousand rpm for 2 minutes.

[0120] 10. Apply 1 μl of the resulting supernatant to the sample plate and dry at room temperature.

[0121] 11. Immediately after drying, apply 1 μl of CHCA (α-cyano-4-hydroxycinnamic acid) solution on top and dry at room temperature.

[0122] 12. Place the sample plate into the mass spectrometer.

[0123] During the mass spectrometric analysis of the outer membrane proteins of the bacterial strain "Campylobacter jejuni / 723", the results of which are presented in Fig. 1 and Table 2, it was found that for the bacterial strain "Campylobacter jejuni / 723", the highest signal intensity of 73 units, 89 units and 94 units was characteristic of the peaks of 5499 Da, 4366 Da, 5246 Da, respectively (Table 2). The obtained data were used to expand the database of the MALDI Autof mass spectrometer.

[0124] When identifying campylobacter using mass spectrometry (Fig. 3), it was shown that the characteristic signal intensity was repeated in the test samples. This confirms that the bacterial strain and isolates used in the experiment belong to the genus Campylobacter.

[0125] The use of the bacterial strain "Campylobacter jejuni / 723" as a positive control for the identification of Campylobacter bacteria in matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry and for replenishing the database of the MALDI Autof mass spectrometer was confirmed.

[0126] Sources of information taken into account when drafting the description of the invention for the application for the issuance of a Russian Federation patent for the invention “Bacterial strain Campylobacter jejuni for use as a control strain in RT-PCR and for the identification of bacteria of the genus Campylobacter using time-of-flight mass spectrometry”:

[0127] 1. Kaakoush NO, Castano-Rodriguez N, Mitchell HM, Man SM. Global epidemiology of Campylobacter infection. Clinical Microbiology Reviews. 2015;28(3):687-720.

[0128] 2. Man SM. The clinical importance of emerging Campylobacter species. Nature Reviews Gastroenterology & Hepatology. 2011;8(12):669-685.

[0129] 3. Kirk MD, Pires SM, Black RE, Caipo M, Crump JA, Devleesschauwer B, et al. World Health Organization estimates of the global and regional disease burden of 22 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis. PLOS Medicine. 2015;12(12):e1001921.

[0130] 4. EFSA, ECDC. The European Union summary report on trends and sources of zoonoses, zoonotic agents and foodborne outbreaks in 2014. EFSA Journal. 2015;13(12):4329.

[0131] 5. Sanitary Rules SP 3.1.087-96 and Veterinary Rules VP 13.4.1307-96 "Prevention and control of infectious diseases common to humans and animals. 4. Campylobacteriosis."

[0132] 6. Klevo E.I. Use of neutral anolyte solution ANK in slaughterhouses of poultry farms to prevent contamination of poultry carcasses and offal with campylobacteriosis pathogens: diss. ... Cand. veterinary sciences / Klevo E.I.; 16.00.06. M., 2006. - 113 p.

[0133] 7. "Veterinary rules for the implementation of preventive, diagnostic, therapeutic, restrictive and other measures, the establishment and cancellation of quarantine and other restrictions aimed at preventing the spread and eliminating foci of campylobacteriosis" approved by Order of the Ministry of Agriculture of Russia dated 26.12.2023 N 941.

[0134] 8. Huang H, Brooks BW, Lowman R, Carrillo CD. Campylobacter species in animal, food, and environmental sources, and relevant testing programs in Canada. Canadian Journal of Microbiology. 2015;61(10):701-721

[0135] 9. Skirrow MB. Campylobacter enteritis: A “new” disease. British Medical Journal. 1977;2(6078):9-11.

[0136] 10. Park SF. The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. International Journal of Food Microbiology. 2002;74(3):177-188.

[0137] 11. Bronowski C, James CE, Winstanley C. Role of environmental survival in transmission of Campylobacter jejuni. FEMS Microbiology Letters. 2014;356(1): 8-19.

[0138] 12. Kim S-H, Chelliah R, Ramakrishnan SR, Perumal AS, Bang W-S, Rubab M, et al. Review on stress tolerance in Campylobacter jejuni. Frontiers in cellular and infection. Microbiology. 2021;10.

[0139] 13. Патент RU 2 055 595 C1, 10.03.1996 г.

[0140] 14. Campylobacter jejuni Strain CG8421: A Refined Model for the Study of Campylobacteriosis and Evaluation of Campylobacter Vaccines in Human Subject / Tribble et al (David R. Tribble,1,2 Shahida Baqar,1,2 Marya P. Carmolli,3 Chad Porter,1 Kristen K. Pierce,3 Katrin Sadigh,3 Patricia Guerry,1 Catherine J. Larsson,3 David Rockabrand,1 Cassandra H. Ventone,3 Frederic Poly,1 Caroline E. Lyon,3 Sandra Dakdouk,1 Ann Fingar,3 Theron Gilliland, Jr,1 Patrick Daunais,3 Erika Jones,1 Stacia Rymarchyk,3 Christopher Huston,3 Michael Darsley,4 and Beth D. Kirkpatrick3) / / Clinical Infectious Diseases. 2009, 49(10):1512-9.

[0141] 15. Analysis of the Campylobacter jejuni Genome by SMRT DNA Sequencing Identifies Restriction-Modification Motifs Jason L. O’Loughlin1 , Tyson P. Eucker1 , Juan D. Chavez2 , Derrick R. Samuelson1 , Jason Neal-McKinney1 , Christopher R. Gourley1 , James E. Bruce2 , Michael E. Konkel1 * / / PLOS ONE | DOI:10.1371 / journal.pone.0118533 February 19, 2015.

[0142] 16. Patent SU 9.273,102 B2 Mar. 1, 2016.

[0143] 17. Patent RU 2796348 C1, 05 / 22 / 2023.

[0144] 18. Hoult J., Krieg N. Bergey's Guide to Bacteria. In 2 volumes. Moscow: Mir, 1997

[0145] 19. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR / M. Lund, S. Nordentoft, K. Pedersen, M. Madsen / / Journal of Clinical Microbiology. - 2004. - Vol. 42, No. 11. - P. 5125-5132.

[0146] Table 1

[0147] Biochemical properties of the bacterial strain "Campylobacter jejuni / 723"

[0148] Item No. Test (indicators) The bacterial strain "Campylobacter jejuni / 723" (proposed invention) According to Bergey's definition 1 Mobility + + 2 Oxidase + + 3 Catalase + + 4 Nitrate reduction + + 5 Esterase + + 6 Hippurate + + 7 γ-glutamyl transferase + + 8 Reduction of triphenyltetrazolium chloride + + 10 Sodium succinate "+" + + 11 Sodium cefazolin + + 12 Formation of H2S "-" - - 13 Pyrrolidone arylamidase - - 14 L-arginine arylamidase - - 15 L-aspartate arylamidase - - 17 D-glucose - - 18 Nalidixic acid - - 19 Sodium acetate - - 20 Propionic acid - - 21 Malic acid - - 22 Sodium citrate - - 23 Sensitivity to erythromycin - +

[0149] Note: "+" - positive result,

[0150] «-» - negative result.

[0151] Table 2

[0152] Biomarkers of the bacterial strain "Campylobacter jejuni / 723"

[0153] № m / z (Da) Peak intensity Signal / Noise 1 2624.779 4195 71 2 2750.846 3190 54 3 3080.767 1922 32 4 3519.721 3187 54 5 3534.891 3267 55 6 3543.139 3566 60 7 4366.267 5222 89 8 4778.420 3821 65 9 4846.624 2713 46 10 5140.532 2483 42 11 5164.533 1996 34 12 5246.791 5520 94 13 5499.059 4279 73 14 6158.302 2543 43 15 7036.129 3745 64 16 7067.280 2769 47 17 7082.783 2833 48 18 9551.568 2440 41

[0154] Table 3

[0155] Nucleotide sequences of primers and probe for detection

[0156] region of the Campylobacter spp. genome.

[0157] Name Sequence (5'- 3') camp2 Forward: CACGTGCTACAATGGCATAT Reverse: GGCTTCATGCTCTCGAGTT Probe: FAM-CAGAGAACAATCCGAACTGGGACA-RTQ1

[0158] --->

[0159] <?xml version="1.0" encoding="UTF-8"?>

[0160] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0161] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0162] <st26sequencelisting dtdversion="V1_3" filename="723.xml"

[0163] softwarename="WIPO Sequence" softwareversion="2.3.0"

[0164] productiondate="2025-10-10">

[0165] <applicationidentification>

[0166] <ipofficecode> RU< / ipofficecode>

[0167] <applicationnumbertext> 0< / applicationnumbertext>

[0168] <filingdate> 2025-10-10< / filingdate>

[0169] < / applicationidentification>

[0170] <applicantfilereference> 662< / applicantfilereference>

[0171] <earliestpriorityapplicationidentification>

[0172] <ipofficecode> RU< / ipofficecode>

[0173] <applicationnumbertext> 0< / applicationnumbertext>

[0174] <filingdate> 2025-10-10< / filingdate>

[0175] < / earliestpriorityapplicationidentification>

[0176] <applicantname languagecode="ru">Federal State Budgetary Institution "Federal Security Center"

[0177] Animal health"< / applicantname>

[0178] <applicantnamelatin>Federal State-Financed Institution Federal

[0179] Centre for Animal Health (FGBI ARRIAH)< / applicantnamelatin>

[0180] <inventorname languagecode="ru">Shadrova Natalia

[0181] Borisovna< / inventorname>

[0182] <inventornamelatin> Shadrova Natalya Borisovna< / inventornamelatin>

[0183] <inventiontitle languagecode="ru">The bacterial strain "Campylobacter"

[0184] jejuni / 723" for use as a control strain in RT-PCR

[0185] and for the identification of bacteria of the genus Campylobacter using

[0186] Time-of-flight mass spectrometry< / inventiontitle>

[0187] <sequencetotalquantity> 3< / sequencetotalquantity>

[0188] <sequencedata sequenceidnumber="1">

[0189] <insdseq>

[0190] <INSDSeq_length> 20< / INSDSeq_length>

[0191] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0192] <INSDSeq_division> PAT< / INSDSeq_division>

[0193] <INSDSeq_feature-table>

[0194] <insdfeature>

[0195] <INSDFeature_key>source< / INSDFeature_key>

[0196] <INSDFeature_location>1..20< / INSDFeature_location>

[0197] <INSDFeature_quals>

[0198] <insdqualifier>

[0199] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0200] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0201] < / insdqualifier>

[0202] <insdqualifier id="q2">

[0203] <INSDQualifier_name>organism< / INSDQualifier_name>

[0204] <INSDQualifier_value>Campylobacter

[0205] jejuni< / INSDQualifier_value>

[0206] < / insdqualifier>

[0207] < / INSDFeature_quals>

[0208] < / insdfeature>

[0209] < / INSDSeq_feature-table>

[0210] <INSDSeq_sequence> cacgtgctacaatggcatat< / INSDSeq_sequence>

[0211] < / insdseq>

[0212] < / sequencedata>

[0213] <sequencedata sequenceidnumber="2">

[0214] <insdseq>

[0215] <INSDSeq_length> 19< / INSDSeq_length>

[0216] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0217] <INSDSeq_division> PAT< / INSDSeq_division>

[0218] <INSDSeq_feature-table>

[0219] <insdfeature>

[0220] <INSDFeature_key>source< / INSDFeature_key>

[0221] <INSDFeature_location>1..19< / INSDFeature_location>

[0222] <INSDFeature_quals>

[0223] <insdqualifier>

[0224] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0225] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0226] < / insdqualifier>

[0227] <insdqualifier id="q4">

[0228] <INSDQualifier_name>organism< / INSDQualifier_name>

[0229] <INSDQualifier_value>Campylobacter

[0230] jejuni< / INSDQualifier_value>

[0231] < / insdqualifier>

[0232] < / INSDFeature_quals>

[0233] < / insdfeature>

[0234] < / INSDSeq_feature-table>

[0235] <INSDSeq_sequence> ggcttcatgctctcgagt< / INSDSeq_sequence>

[0236] < / insdseq>

[0237] < / sequencedata>

[0238] <sequencedata sequenceidnumber="3">

[0239] <insdseq>

[0240] <INSDSeq_length> 24< / INSDSeq_length>

[0241] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0242] <INSDSeq_division> PAT< / INSDSeq_division>

[0243] <INSDSeq_feature-table>

[0244] <insdfeature>

[0245] <INSDFeature_key>source< / INSDFeature_key>

[0246] <INSDFeature_location>1..24< / INSDFeature_location>

[0247] <INSDFeature_quals>

[0248] <insdqualifier>

[0249] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0250] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0251] < / insdqualifier>

[0252] <insdqualifier id="q6">

[0253] <INSDQualifier_name>organism< / INSDQualifier_name>

[0254] <INSDQualifier_value>Campylobacter

[0255] jejuni< / INSDQualifier_value>

[0256] < / insdqualifier>

[0257] < / INSDFeature_quals>

[0258] < / insdfeature>

[0259] < / INSDSeq_feature-table>

[0260] <INSDSeq_sequence> cagagacaatccgaactgggaca< / INSDSeq_sequence>

[0261] < / insdseq>

[0262] < / sequencedata>

[0263] < / st26sequencelisting>

[0264] <---

Citation Information

Patent Citations

  • Campylobacter jejuni bacterial strain for microbiological studies related to the determination of sensitivity of microorganisms to antibacterial drugs

    RU2796348C1