Nucleic acid conjugates as well as preparation method therefor and use thereof

Abstract

Provided in the present invention are compounds for forming conjugates with oligonucleotides, the compounds having structures shown as formula (I). Further provided in the present disclosure are corresponding conjugates, and the use of the conjugates in the preparation of drugs for preventing and / or treating related diseases. The conjugates disclosed by the present disclosure have the advantages of cheap raw materials, simple synthesis, easy process development and the like, and have good oligonucleotide synthesis efficiency and biological activity in small animals.

Description

Nucleic acid conjugate, preparation method and use Technical Field

[0001] The present disclosure belongs to the field of nucleic acid delivery, and specifically relates to a nucleic acid conjugate, a preparation method and uses. Background Art

[0002] siRNA is a negatively charged macromolecule composed of two oligonucleotide chains. It cannot effectively target target tissues in the body or enter cells on its own. siRNA requires specialized delivery vehicles to enrich siRNA in target organs and allow it to enter cells to exert its therapeutic effects.

[0003] Lipid nanoparticles (LNPs) can encapsulate siRNA and effectively deliver it to the liver. The drug Onpattro, which utilizes LNP technology, is already on the market. However, the clinical application of LNP technology still has many drawbacks, such as the short shelf life of LNP preparations and the potential for immune responses during use, which often requires the coadministration of immunosuppressants such as dexamethasone, complicating the clinical application of LNPs.

[0004] Targeted drug delivery to the interior of cells through cell surface receptor-mediated endocytosis is an effective strategy. The asialoglycoprotein receptor (ASGPR) is a receptor that is highly specifically expressed on the surface of hepatic parenchymal cells and has the characteristics of high abundance and high receptor recycling efficiency. By covalently coupling ligands that can specifically recognize ASGPR, such as monosaccharide and polysaccharide molecules such as galactose, galactosamine, and N-acetylgalactosamine (GalNAc), with siRNA, siRNA can be targeted and delivered to hepatic parenchymal cells, allowing siRNA to exert a gene silencing effect on the target gene. Therefore, the development of targeting ligands suitable for siRNA delivery is of great significance for the clinical application of siRNA.

[0005] Currently, there has been some progress in the global research on achieving effective liver-targeted delivery of siRNA by targeting ASGPR. Representative delivery molecules include Alnylam Pharmaceuticals' L96 (its structural formula is shown below), which has been used in four marketed siRNA drugs and has shown good delivery activity and selectivity in both in vitro and in vivo experiments. However, there are still problems such as the in vivo biological activity and efficacy of siRNA that can be further improved, the complex CMC (chemical composition production and control) process and technology of the delivery molecules, and high production costs.

[0006] Summary of the Invention

[0007] The delivery compounds and corresponding nucleic acid conjugates disclosed herein utilize natural amino acids, such as serine and threonine, as the core linker backbone, resulting in a novel class of GalNAc conjugates. Compared to existing delivery technologies, these compounds offer advantages such as simpler molecular structure, readily available and inexpensive raw materials, and easy CMC process development. Furthermore, they exhibit excellent oligonucleotide synthesis efficiency and in vivo biological activity.

[0008] In a first aspect, the present disclosure provides a compound having a structure shown in formula (I):

[0009] in,

[0010] A0 represents a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells or

[0011] represents a group formed by replacing all or part of the hydroxyl groups in the ligand with KCOO- groups, wherein each K is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl and alkylphenyl;

[0012] The ligands are preferably each independently selected from any one of the following: D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D- Galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy -2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranose heptanoside ethyl ester, 2,5-anhydro-D-allosenitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose;

[0013] b is an integer in the range of 1-4, preferably 1, 2 or 3, more preferably 1 or 3;

[0014] L1 and L2 independently represent a combination of one or more groups selected from the group consisting of formula A1-A11:

[0015] Wherein, j1 is an integer of 1-20; j2 is an integer of 1-20; R' is C1-C 10 Alkyl;

[0016] M represents the structural formula shown in formula (A12):

[0017] Wherein, m represents an integer of 0-6, preferably 0, 1 or 2; * represents a bond connected to G1,

[0018] Q represents the structural formula shown in formula (A13):

[0019] Among them, the one connected to O represents a bond connected to G1; R2 and R3 are the same or different and are independently selected from H, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl, preferably H, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl;

[0020] Z does not exist or represents C1-C 10 Alkylene, preferably C1-C3 alkylene;

[0021] X represents the formula (A14-1) or (A14-2) or the structural formula shown:

[0022] Wherein R4, R5 are the same or different and are independently selected from H, fluorine, hydroxyl, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl, preferably H, fluorine, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; p is an integer from 1 to 6, preferably 1, 2 or 3; optionally, R4 and R5 are directly linked to form a three- to six-membered saturated carbocyclic ring;

[0023] E represents the structural formula shown in formula (A15):

[0024] in, Representative C3-C 18 Cycloalkyl or C3-C 18 Heterocyclyl, preferably represents C4-C8 cycloalkyl or C3-C8 heterocyclyl, more preferably represents C3-C6 heterocyclyl, more preferably four to six membered nitrogen-containing saturated cycloalkyl, and R1 is selected from H, fluorine, hydroxyl, cyano, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl, preferably selected from H, fluorine, hydroxy, cyano, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl;

[0025] G1 and G2 each represent a phosphoramidite functional group or a hydroxyl protecting group having a structure represented by formula (G-1), provided that at least one of G1 and G2 has a structure represented by formula (G-1), and the hydroxyl protecting group is selected from any one of trityl, 4-methoxytrityl, 4,4'-bismethoxytrityl (DMTr) and 4,4',4'-trimethoxybenzyl, preferably 4,4'-bismethoxytrityl;

[0026] Wherein, B1 is selected from a substituted or unsubstituted C1-C5 hydrocarbon group, optionally, B1 is methyl, ethyl or isopropyl; B2 is selected from one of a C1-C5 alkyl group, acetonitrile, propionitrile and butyronitrile, optionally, B2 is cyanoethyl;

[0027] In this article, Indicates the site of covalent attachment of a group.

[0028] In a second aspect, the present invention provides a nucleic acid conjugate, wherein the conjugate contains one or more structures represented by formula (II), preferably two, three or four consecutively connected structures represented by formula (II), linked to any position on the oligonucleotide sequence:

[0029] Among them, R p and R q Each is H or has a structure represented by formula A16, provided that R p and R q At least one of them has a structure represented by Formula A16;

[0030] Wherein, E1 is OH, SH or BH2,

[0031] A0, b, L1, L2, M, Z, X, and E are the same as those in formula (I) and are not described again here.

[0032] In a third aspect, the present invention provides a method for preparing the nucleic acid conjugate of the second aspect.

[0033] In a fourth aspect, the present invention provides use of the nucleic acid conjugate of the present invention in preparing a medicament for treating and / or preventing a hepatic disease.

[0034] In a fifth aspect, the present invention provides a method for treating a pathological condition or disease caused by gene expression in hepatocytes, the method comprising administering the nucleic acid conjugate of the second aspect to a patient suffering from the disease.

[0035] In a sixth aspect, the present invention provides a kit comprising the nucleic acid conjugate of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] FIG1 shows the activity test results of the siRNA conjugates in mice in Example 10; in FIG1 , ** represents P less than 0.01, and *** represents P less than 0.001. DETAILED DESCRIPTION

[0037] The following describes the specific embodiments of the present disclosure in detail. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present disclosure, and are not intended to limit the present disclosure.

[0038] definition

[0039] It should be noted that, unless otherwise defined, the technical or scientific terms used in this application should have the common meanings understood by those skilled in the art.

[0040] In the present disclosure, the compound represented by the general formula (I) includes its tautomers, racemates, enantiomers, diastereomers, mixtures thereof and the like.

[0041] As used herein, a hyphen ("-") that is not between two letters or symbols is used to indicate the position of the point of attachment of a substituent.

[0042] As used herein, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not. For example, "optionally substituted alkyl" includes "alkyl" and "substituted alkyl" as defined below. It will be understood by those skilled in the art that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is sterically impractical, synthetically unfeasible, and / or inherently unstable.

[0043] As used herein, "alkyl" refers to straight and branched chains having the specified number of carbon atoms. When reference is made to an alkyl residue having a specific number of carbon atoms, it is intended to encompass all branched and straight chain forms having that number of carbon atoms; thus, for example, "butyl" is meant to include n-butyl, sec-butyl, isobutyl, and tert-butyl. Alkylene is a subset of alkyl and refers to residues identical to alkyl, but with two points of attachment.

[0044] As used herein, "alkenyl" refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon double bond, wherein the carbon-carbon double bond is obtained by losing a hydrogen atom from each of the adjacent carbon atoms of the parent alkyl group. The group can be in the cis or trans configuration of the double bond. Typical alkenyl groups include, but are not limited to, vinyl; propenyl, such as prop-1-ene-1-yl, prop-1-ene-2-yl, prop-2-ene-1-yl (allyl), prop-2-ene-2-yl; butenyl, such as but-1-ene-1-yl, but-1-ene-2-yl, 2-methylprop-1-ene-1-yl, but-2-ene-1-yl, but-2-ene-2-yl, but-1,3-diene-1-yl, but-1,3-diene-2-yl, etc. Alkenylene is a subset of alkenyl and refers to a residue that is identical to alkenyl but has two points of attachment.

[0045] As used herein, "alkynyl" refers to an unsaturated branched or straight chain alkyl group having at least one carbon-carbon triple bond, wherein the carbon-carbon triple bond is obtained by losing two hydrogen atoms from adjacent carbon atoms of the parent alkyl group. Typical alkynyl groups include, but are not limited to, ethynyl; propynyl, such as prop-1-yn-1-yl, prop-2-yn-1-yl; butynyl, such as but-1-yn-1-yl, but-1-yn-3-yl, but-3-yn-1-yl, etc.

[0046] As used herein, "alkoxy" refers to an alkyl group of the specified number of carbon atoms attached through an oxygen bridge, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentoxy, 2-pentoxy, isopentoxy, neopentoxy, hexoxy, 2-hexyloxy, 3-hexyloxy, 3-methylpentoxy, etc. The alkoxy group typically has 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms attached through the oxygen bridge.

[0047] As used herein, "cycloalkyl" refers to a non-aromatic carbocyclic ring, typically having 3 to 7 cyclic carbon atoms. The ring can be saturated or have one or more carbon-carbon double bonds. Examples of cycloalkyl include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl and cyclohexenyl, as well as bridged and caged ring groups such as norbornane.

[0048] As used herein, "halogen substituent" or "halo" refers to fluoro, chloro, bromo and iodo, and the term "halogen" includes fluoro, chloro, bromo and iodine.

[0049] As used herein, "haloalkyl" refers to an alkyl group with a specified number of carbon atoms that is substituted with one or more halogen atoms up to the maximum permitted number. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, 2-fluoroethyl, and pentafluoroethyl.

[0050] "Heterocyclyl" refers to a stable 3 to 18-membered non-aromatic ring radical containing 2 to 12 carbon atoms and 1 to 6 heteroatoms selected from nitrogen, oxygen, and sulfur. Unless otherwise specified in the specification, a heterocyclyl is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system that may include fused or bridged ring systems. The heteroatoms in the heterocyclyl may optionally be oxidized. One or more nitrogen atoms, if present, may optionally be quaternized. The heterocyclyl may be partially saturated or fully saturated. The heterocyclyl may be connected to the remainder of the molecule via any of the ring atoms. Examples of such heterocyclic groups include, but are not limited to, dioxanyl, thienyl[1,3]dithianyl, decahydroisoquinolinyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxapiperazinyl, 2-oxapiperidinyl, 2-oxapyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuranyl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxothiomorpholinyl, and 1,1-dioxothiomorpholinyl.

[0051] Various hydroxy protecting groups can be used in the present disclosure. In general, protecting groups make chemical functional groups insensitive to specific reaction conditions and can be attached and removed on the functional group in the molecule without substantially damaging the rest of the molecule. Representative hydroxy protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed, John Wiley & Sons, New York, 1991, which are incorporated herein by reference in their entirety. In some embodiments, the protecting group is stable under alkaline conditions, but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxy protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), TMTr (4,4',4"-trimethoxytrityl), and tert-butyldimethylsilyl (TBS or TBDMS). Non-exclusive examples of hydroxyl protecting groups that can be used herein include alkyl acyl groups.

[0052] The term "subject," as used herein, refers to any animal, such as a mammal or marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, and any type of poultry.

[0053] As used herein, "treat," "treat," "alleviate," or "amortize" are used interchangeably herein. These terms refer to an approach for obtaining beneficial or desired results, including but not limited to therapeutic benefit. "Therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. Furthermore, a therapeutic benefit is achieved by eradication or amelioration of one or more physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, even though the subject may still be afflicted with the underlying disorder.

[0054] As used herein, "prevent" and "prevention" are used interchangeably. These terms refer to an approach for obtaining a beneficial or desired result, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit," a conjugate or composition can be administered to a subject at risk for a particular disease, or to a subject reporting one or more pathological symptoms of a disease, even though a diagnosis of the disease may not have yet been made.

[0055] According to a first aspect of the present invention, there is provided a compound having a structure shown in formula (I):

[0056] in,

[0057] A0 represents a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells or

[0058] represents a group formed by replacing all or part of the hydroxyl groups in the ligand with KCOO- groups, wherein each K is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl and alkylphenyl;

[0059] The ligands are preferably each independently selected from any one of the following: D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucose, β-D-glucose, Glucose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine Galactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside heptanoside ethyl ester, 2,5-anhydro-D-allosenitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose;

[0060] b is an integer in the range of 1-4, preferably 1, 2 or 3, more preferably 1 or 3;

[0061] L1 and L2 independently represent a combination of one or more groups selected from the group consisting of formula A1-A11:

[0062] Wherein, j1 is an integer of 1-20; j2 is an integer of 1-20; R' is C1-C 10 Alkyl;

[0063] M represents the structural formula shown in formula (A12):

[0064] Wherein, m represents an integer of 0-6, preferably 0, 1 or 2; * represents a bond connected to G1,

[0065] Q represents the structural formula shown in formula (A13):

[0066] Among them, the one connected to O represents a bond connected to G1; R2 and R3 are the same or different and are independently selected from H, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl, preferably H, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl;

[0067] Z does not exist or represents C1-C 10 Alkylene, preferably C1-C3 alkylene;

[0068] X represents the formula (A14-1) or (A14-2) or the structural formula shown:

[0069] Wherein R4, R5 are the same or different and are independently selected from H, fluorine, hydroxyl, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl, preferably H, fluorine, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; p is an integer from 1 to 6, preferably 1, 2 or 3; optionally, R4 and R5 are directly linked to form a three- to six-membered saturated carbocyclic ring;

[0070] E represents the structural formula shown in formula (A15):

[0071] in, Representative C3-C 18 Cycloalkyl or C3-C 18Heterocyclyl, preferably represents C4-C8 cycloalkyl or C3-C8 heterocyclyl, more preferably represents C3-C6 heterocyclyl, more preferably four to six membered nitrogen-containing saturated cycloalkyl, and R1 is selected from H, fluorine, hydroxyl, cyano, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl, preferably selected from H, fluorine, hydroxy, cyano, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl;

[0072] G1 and G2 each represent a phosphoramidite functional group or a hydroxyl protecting group having a structure represented by formula (G-1), provided that at least one of G1 and G2 has a structure represented by formula (G-1), and the hydroxyl protecting group is selected from any one of trityl, 4-methoxytrityl, 4,4'-bismethoxytrityl (DMTr) and 4,4',4'-trimethoxybenzyl, preferably 4,4'-bismethoxytrityl;

[0073] in, It represents the site of covalent attachment of a group;

[0074] B1 is selected from substituted or unsubstituted C1-C5 hydrocarbon groups, optionally, B1 is methyl, ethyl or isopropyl; B2 is selected from one of C1-C5 alkyl, acetonitrile, propionitrile and butyronitrile, optionally, B2 is cyanoethyl.

[0075] In some embodiments, L1 or L2 are independently selected from one or more combinations of A1, A2, A4, A6, A7, A8, A9, and A10. In some embodiments, L1 or L2 are independently selected from one or more combinations of A1, A2, A4, A8, A9, and A10. In some embodiments, wherein L1 or L2 are independently selected from one or more combinations of A1, A4, A8, A9, and A10. In some embodiments, the length of L1 or L2 is independently 1-25 atoms, and the length of L1 or L2 refers to the number of chain atoms in the longest straight chain. In some embodiments, the length of L1 or L2 is independently 1-20 atoms.

[0076] In some embodiments, each j1 is independently an integer from 1 to 10, and each j2 is independently an integer from 1 to 10.

[0077] In some embodiments, each j1 is independently an integer from 1 to 8, and each j2 is independently an integer from 1 to 8.

[0078] In some embodiments, A0 is an N-acetylgalactosamine (GalNAc) group as shown below, or a group formed by replacing all or part of its hydroxyl groups with KCOO- groups, wherein each K is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and alkylphenyl groups:

[0079] In some embodiments, the compound has the structure (I-1) shown below:

[0080] In some embodiments, L is A10, wherein j1 is an integer from 2 to 8, or A11, wherein j2 is an integer from 1 to 7.

[0081] In some embodiments, m is 0, 1, or 2.

[0082] In some embodiments, n is 0, 1, 2, or 3.

[0083] In some embodiments, represents a four to eight-membered all-carbon or nitrogen-containing saturated ring. In some embodiments, It is a four-, five- or six-membered saturated cycloalkyl group containing one or two nitrogen atoms.

[0084] In one embodiment, the compounds of the present disclosure have any one of the following structures:

[0085] According to a second aspect of the present invention, a nucleic acid conjugate is provided, wherein the conjugate contains one or more structures represented by formula (II) linked to any position on the oligonucleotide sequence, preferably two, three or four consecutively linked structures represented by formula (II):

[0086] Among them, R p and R q Each is H or has a structure represented by formula A16, provided that R p and R q At least one of them has a structure represented by Formula A16;

[0087] Wherein, E1 is OH, SH or BH2,

[0088] A0 represents a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells or

[0089] represents a group formed by replacing all or part of the hydroxyl groups in the ligand with KCOO- groups, wherein each K is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl and alkylphenyl;

[0090] The ligands are preferably each independently selected from any one of the following: D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucose, β-D-glucose, Glucose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine Galactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside heptanoside ethyl ester, 2,5-anhydro-D-allosenitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose;

[0091] b is an integer in the range of 1-4, preferably 1, 2 or 3, more preferably 1 or 3;

[0092] L1 and L2 independently represent a combination of one or more groups selected from the group consisting of formula A1-A11:

[0093] Wherein, j1 is an integer from 1 to 20;

[0094] j2 is an integer from 1 to 20;

[0095] R' is C1-C 10 Alkyl;

[0096] M represents the structural formula shown in formula (A12):

[0097] Wherein, m represents an integer of 0-6, preferably 0, 1 or 2; * represents the same as R p The connected keys,

[0098] Q represents the structural formula shown in formula (A13):

[0099] Among them, the one connected to O Represents R p R2, R3 are the same or different and are independently selected from H, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl, preferably H, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl;

[0100] Z does not exist or represents C1-C 10 Alkylene, preferably C1-C3 alkylene;

[0101] X represents the formula (A14-1) or (A14-2) or the structural formula shown:

[0102] Wherein R4, R5 are the same or different and are independently selected from H, fluorine, hydroxyl, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl, preferably H, fluorine, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; p is an integer from 1 to 6, preferably 1, 2 or 3; optionally, R4 and R5 are directly linked to form a three- to six-membered saturated carbocyclic ring;

[0103] E represents the structural formula shown in formula (A15):

[0104] in, It represents the site of covalent attachment of a group; Representative C3-C 18 Cycloalkyl or C3-C 18 Heterocyclyl, preferably represents C4-C8 cycloalkyl or C3-C8 heterocyclyl, more preferably represents C3-C6 heterocyclyl, more preferably four to six membered nitrogen-containing saturated cycloalkyl, and R1 is selected from H, fluorine, hydroxyl, cyano, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C20 Alkenyl, C2-C 20 Alkynyl is preferably selected from H, fluorine, hydroxy, cyano, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl.

[0105] In a third aspect, the present invention provides a nucleic acid conjugate, wherein the conjugate contains one or more structures represented by formula (II-A) linked to any position on the oligonucleotide sequence:

[0106] in,

[0107] a represents an integer of 0-7, preferably an integer of 0-3, more preferably an integer of 0, 1, 2 or 3;

[0108] Rp and Rq are each H or have a structure represented by Formula A16, and at least one of them has a structure represented by Formula A16;

[0109] The structure of W is shown below:

[0110] Wherein, E1 is OH, SH or BH2,

[0111] A0, b, L1, L2, M, Z, X, and E are equivalent to formula (II) and will not be repeated here.

[0112] In some embodiments, L1 or L2 are independently selected from one or more combinations of A1, A2, A4, A6, A7, A8, A9, and A10. In some embodiments, L1 or L2 are independently selected from one or more combinations of A1, A2, A4, A8, A9, and A10. In some embodiments, wherein L1 or L2 are independently selected from one or more combinations of A1, A4, A8, A9, and A10. In some embodiments, the length of L1 or L2 is independently 1-25 atoms, and the length of L1 or L2 refers to the number of chain atoms in the longest straight chain. In some embodiments, the length of L1 or L2 is independently 1-20 atoms.

[0113] In some embodiments, each j1 is independently an integer from 1 to 10, and each j2 is independently an integer from 1 to 10.

[0114] In some embodiments, each j1 is independently an integer from 1 to 8, and each j2 is independently an integer from 1 to 8.

[0115] In some embodiments, A0 is an N-acetylgalactosamine (GalNAc) group as shown below, or a group formed by replacing all or part of its hydroxyl groups with KCOO- groups, wherein each K is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and alkylphenyl groups:

[0116] In the context of this disclosure, unless otherwise indicated, "conjugation" refers to the covalent attachment of two or more chemical moieties, each with a specific function, to one another; accordingly, a "conjugate" refers to a compound formed by covalent attachment of these chemical moieties. Furthermore, a "nucleic acid conjugate" refers to a compound formed by covalently attaching one or more chemical moieties with a specific function to an oligonucleotide. Hereinafter, the nucleic acid conjugates of the present disclosure may also be referred to as "conjugates."

[0117] In a specific embodiment of the present invention, the nucleic acid conjugate of the present invention has any one of the following structures:

[0118] Where Y is O or S, For oligonucleotides.

[0119] In some embodiments of the present disclosure, the oligonucleotide is selected from one of small interfering RNA, microRNA, anti-microRNA, microRNA antagonist, microRNA mimetic, decoy oligonucleotide, immunostimulant, G-quadrupole, alternative splicing body, single-stranded RNA, antisense nucleic acid, nucleic acid aptamer, stem-loop RNA, mRNA fragment, and activating RNA; optionally, the oligonucleotide is a single-stranded oligonucleotide or a double-stranded oligonucleotide; optionally, the oligonucleotide is a single-stranded oligonucleotide, the P atom in formula (A16) is connected to the end of the single-stranded oligonucleotide, and the end of the single-stranded oligonucleotide refers to the first 4 nucleotides from one end of the single-stranded oligonucleotide; optionally, the P atom in formula (A16) is connected to the end of the single-stranded oligonucleotide; optionally, the P atom in formula (A16) is connected to the 3' end of the single-stranded oligonucleotide;

[0120] Optionally, the oligonucleotide is a double-stranded oligonucleotide, comprising a sense strand and an antisense strand, the P atom in the formula (A16) is connected to the end of the double-stranded oligonucleotide, and the end of the double-stranded oligonucleotide refers to the first 4 nucleotides from one end of the sense strand or the antisense strand; optionally, the P atom in the formula (A16) is connected to the end of the sense strand or the antisense strand; optionally, the P atom in the formula (A16) is connected to the 5' end of the antisense strand; optionally, the P atom in the formula (A16) is connected to the 2', 3' or 5' position of the nucleotide in the nucleic acid conjugate by forming a phosphodiester bond.

[0121] In some embodiments, the "target sequence" is a target mRNA. In the context of the present disclosure, "target mRNA" refers to mRNA corresponding to a gene abnormally expressed in hepatocytes. It can be mRNA corresponding to an overexpressed gene or an underexpressed gene. Since most diseases arise from overexpression of mRNA, in the present disclosure, target mRNA specifically refers to mRNA corresponding to an overexpressed gene. In some embodiments of the present disclosure, corresponding to the above-mentioned abnormally expressed genes, the target mRNA can be mRNA corresponding to genes such as ApoB, ApoC, ANGPTL3, PCSK9, SCD1, TIMP-1, Col1A1, FVII, STAT3, p53, HBV, and HCV. In some embodiments, the target mRNA can be mRNA transcribed from the corresponding HBV gene, or mRNA corresponding to the ANGPTL3 gene, or mRNA corresponding to the APOC3 gene.

[0122] As is well known to those skilled in the art, siRNAs contain nucleotide groups as basic structural units, which include a phosphate group, a ribose group, and a base. Typically, active, i.e., functional, siRNAs are about 12-40 nucleotides in length, and in some embodiments, about 15-30 nucleotides in length. Each nucleotide in the siRNA can independently be a modified or unmodified nucleotide. To increase stability, at least one nucleotide in the siRNA is a modified nucleotide.

[0123] The inventors of the present disclosure have discovered that the siRNA described in the following embodiments has higher activity and / or stability, and thus can serve as the inventive object of the siRNA in the present disclosure.

[0124] In some embodiments, each nucleotide in the siRNA in the siRNA conjugate of the present disclosure (hereinafter also referred to as the siRNA of the present disclosure) is independently a modified or unmodified nucleotide, and the siRNA contains a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence 1, the antisense strand comprises a nucleotide sequence 2, the nucleotide sequence 1 and the nucleotide sequence 2 are both 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, and are at least partially reverse-complemented to form a complementary double-stranded region, and at least a portion of the nucleotide sequence 2 is complementary to a first nucleotide sequence, which is a nucleotide sequence in the target mRNA.

[0125] In some embodiments, nucleotide sequence 1 is equal in length to the first nucleotide sequence and differs by no more than 3 nucleotides; nucleotide sequence 2 is equal in length to nucleotide sequence B and differs by no more than 3 nucleotides; and nucleotide sequence B is a nucleotide sequence that is completely reverse complementary to the first nucleotide sequence. Without wishing to be bound by these limitations, these specific nucleotide differences do not significantly reduce the target gene inhibition ability of the siRNA conjugate, and siRNA conjugates containing these specific nucleotide differences are also within the scope of protection of this disclosure.

[0126] In some embodiments, the nucleotide sequence 1 and the nucleotide sequence 2 are substantially reverse complementary, substantially completely reverse complementary, or completely reverse complementary.

[0127] In some embodiments, the nucleotide sequence 1 differs from the first nucleotide sequence by no more than one nucleotide, and / or the nucleotide sequence 2 differs from the nucleotide sequence B by no more than one nucleotide. In some embodiments, the nucleotide difference between the nucleotide sequence 2 and the nucleotide sequence B comprises a difference in the position of the first nucleotide Z' in the nucleotide sequence 2, as viewed from the 5' end to the 3' end. In some embodiments, the last nucleotide Z in the nucleotide sequence 1, as viewed from the 5' end to the 3' end, is complementary to Z'.

[0128] In some embodiments, the sense strand further comprises a nucleotide sequence 3, and the antisense strand further comprises a nucleotide sequence 4, wherein the nucleotide sequence 3 and the nucleotide sequence 4 are of equal length and are both 1-4 nucleotides, the nucleotide sequence 3 is connected to the 5' end of the nucleotide sequence 1, and the nucleotide sequence 4 is connected to the 3' end of the nucleotide sequence 2, and the nucleotide sequence 4 is complementary to the second segment of nucleotide sequence, which refers to a nucleotide sequence in the target mRNA that is adjacent to the first segment of nucleotide sequence and has the same length as the nucleotide sequence 4. In some embodiments, the nucleotide sequence 3 and the nucleotide sequence 4 are substantially completely reverse complementary or completely reverse complementary. Therefore, the length of the sense strand and the antisense strand can be 19-23 nucleotides.

[0129] In some embodiments, the siRNA of the present disclosure further comprises a nucleotide sequence 5 having a length of 1 to 3 nucleotides and attached to the 3' end of the antisense strand, thereby constituting a 3' overhang of the antisense strand; in some embodiments, the nucleotide sequence 5 has a length of 1 or 2 nucleotides. Thus, in some embodiments, the ratio of the lengths of the sense strand to the antisense strand of the siRNA of the present disclosure can be 19 / 20, 19 / 21, 20 / 21, 20 / 22, 21 / 22, 21 / 23, 22 / 23, 22 / 24, 23 / 24, or 23 / 25.

[0130] In one embodiment, the nucleotide sequence 5 is 2 nucleotides in length, and from the 5' end to the 3' end, the nucleotide sequence 5 is 2 consecutive deoxythymidine nucleotides, 2 consecutive uracil nucleotides, or is complementary to a third nucleotide sequence, wherein the third sequence is a nucleotide sequence in the target mRNA that is adjacent to the first nucleotide sequence or adjacent to the second nucleotide sequence and has a length equal to that of the nucleotide sequence 5. In one embodiment, the ratio of the length of the sense strand to the antisense strand of the siRNA of the present disclosure is 19 / 21 or 21 / 23. In this case, the siRNA of the present disclosure has better hepatocyte mRNA silencing activity.

[0131] In some embodiments, the nucleotides in the siRNA of the present disclosure are each independently a modified or unmodified nucleotide. In some embodiments, the siRNA of the present disclosure does not contain a modified nucleotide group; in some embodiments, the siRNA of the present disclosure contains a modified nucleotide group.

[0132] Currently, there are a variety of methods available in the art for modifying siRNA, including backbone modification (also known as internucleotide linkage modification, such as phosphate group modification), ribose group modification, and base modification (for example, see Watts, JK, GF Deleavey and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55, the entire contents of which are incorporated herein by reference).

[0133] In the context of the present disclosure, the term "modified nucleotide" refers to a nucleotide whose ribose group is modified, such as a nucleotide or nucleotide analog formed by replacing the 2' hydroxyl group with other groups, or a nucleotide whose base is a modified base.

[0134] In some embodiments of the present disclosure, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and / or at least one phosphate group is a phosphate group having a modified group. In other words, at least a portion of the phosphate groups and / or ribose groups in the phosphate-sugar backbone of at least one single strand in the sense strand and the antisense strand is a phosphate group having a modified group and / or a ribose group having a modified group (or a modified phosphate group and / or a modified ribose group). In some embodiments of the present disclosure, all nucleotides in the sense strand and / or the antisense strand are modified nucleotides.

[0135] In some embodiments, each nucleotide in the sense strand and the antisense strand is independently a fluorinated modified nucleotide or a non-fluorinated modified nucleotide.

[0136] The fluorinated modified nucleotide refers to a nucleotide in which the hydroxyl group at the 2'-position of the ribose group of the nucleotide is substituted with fluorine, and has a structure represented by the following formula (17).

[0137] A non-fluorinated modified nucleotide refers to a nucleotide or nucleotide analogue in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by a non-fluorinated group. In some embodiments, each non-fluorinated modified nucleotide is independently selected from a nucleotide or nucleotide analogue in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by a non-fluorinated group.

[0138] Nucleotides in which the hydroxyl group at the 2' position of the ribose group is replaced by a non-fluorinated group are well known to those skilled in the art. These nucleotides can be selected from 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides.

[0139] In some embodiments, the 2'-alkoxy modified nucleotide is a methoxy modified nucleotide (2'-OMe), as shown in formula (18). The 2'-substituted alkoxy modified nucleotide, for example, can be a 2'-O-methoxyethyl modified nucleotide (2'-MOE), as shown in formula (19). In some embodiments, the 2'-amino modified nucleotide (2'-NH2) is as shown in formula (20). In some embodiments, the 2'-deoxynucleotide (DNA) is as shown in formula (21).

[0140] Nucleotide analogs are groups that can replace nucleotides in nucleic acids but have a structure different from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, or thymine. In some embodiments, the nucleotide analogs can be, for example, isonucleotides, bridged nucleic acid (BNA) nucleotides, or acyclic nucleotides.

[0141] BNA nucleotides are constrained or inaccessible nucleotides. BNAs can contain five-, six-, or seven-membered rings with a "fixed" C3'-endo sugar condensed bridge structure. The bridge is typically incorporated into the 2'- and 4'-positions of the ribose ring to provide a 2',4'-BNA nucleotide, such as LNA, ENA, and cET BNA, where LNA is shown in Formula (22), ENA is shown in Formula (23), and cET BNA is shown in Formula (24).

[0142] Acyclic nucleotides are a type of nucleotides formed by opening the sugar ring of a nucleotide, such as unlocked nucleic acid (UNA) nucleotides or glycerol nucleic acid (GNA) nucleotides, where UNA is shown in formula (25) and GNA is shown in formula (26).

[0143] Wherein, R is selected from H, OH or alkoxy (O-alkyl).

[0144] Isonucleotides are compounds formed by a change in the position of the base on the ribose ring of a nucleotide, for example, a compound formed by the base moving from the 1'-position to the 2'-position or the 3'-position of the ribose ring, as shown in formula (27) or (28).

[0145] Wherein, Base represents a base, such as A, U, G, C or T; R is selected from H, OH, F or the non-fluorinated groups as described above.

[0146] In some embodiments, the nucleotide analog is selected from one of an isonucleotide, LNA, ENA, cET, UNA, and GNA. In some embodiments, each non-fluorinated modified nucleotide is a methoxy-modified nucleotide, wherein the methoxy-modified nucleotide is a nucleotide in which the 2'-hydroxyl group of the ribose group is replaced by a methoxy group.

[0147] In the above and below, “fluorinated nucleotides”, “2’-fluorinated nucleotides”, “nucleotides in which the 2’-hydroxyl group of the ribose group is replaced by fluorine” and “2’-fluororibosyl” have the same meaning, and all refer to compounds in which the 2’-hydroxyl group of the nucleotide is replaced by fluorine, and have the structure shown in formula (17); “methoxy-modified nucleotides”, “2’-methoxy-modified nucleotides”, “nucleotides in which the 2’-hydroxyl group of the ribose group is replaced by methoxy” and “2’-methoxyribosyl” have the same meaning, and all refer to compounds in which the 2’-hydroxyl group of the ribose group of the nucleotide is replaced by methoxy, and have the structure shown in formula (18).

[0148] In some embodiments, the siRNA disclosed herein is an siRNA having the following modifications: both the sense strand and the antisense strand contain fluorinated-modified nucleotides and non-fluorinated-modified nucleotides, the fluorinated-modified nucleotides are located in the aforementioned nucleotide sequence 1 and nucleotide sequence 2, the number of fluorinated-modified nucleotides in the nucleotide sequence 1 is no more than 5, and, from the 5' end to the 3' end, the 7th, 8th, and 9th nucleotides of the nucleotide sequence 1 are fluorinated-modified nucleotides; the number of fluorinated-modified nucleotides in the nucleotide sequence 2 is no more than 7, and, from the 5' end to the 3' end, the 2nd, 6th, 14th, and 16th nucleotides of the nucleotide sequence 2 are fluorinated-modified nucleotides. In some embodiments, the siRNA of the present invention is an siRNA with the following modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 7, 8, and 9 of the nucleotide sequence 1 in the sense strand of the siRNA are fluoro-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides; in the antisense strand, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence 2 are fluoro-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides; in some embodiments, the siRNA of the present invention is an siRNA with the following modifications: or in the direction from the 5' end to the 3' end, the nucleotides at positions 5, 7, 8, and 9 of the nucleotide sequence 1 in the sense strand of the siRNA are fluoro-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides. The nucleotides are methoxy-modified nucleotides; in the antisense strand, the nucleotides at positions 2, 6, 8, 9, 14, and 16 of the nucleotide sequence 2 are fluorinated-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides; in some embodiments, the siRNA of the present invention is an siRNA with the following modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 7, 8, and 9 of the nucleotide sequence 1 in the sense strand of the siRNA are fluorinated-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides, and, in the direction from the 5' end to the 3' end, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence 2 in the antisense strand of the siRNA are fluorinated-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides.

[0149] In some embodiments of the siRNA disclosed herein, the nucleotides are modified with a phosphate group. In the context of the present disclosure, the phosphate group modification is, in one embodiment, a phosphorothioate modification as shown in formula (11), i.e., a non-bridging oxygen atom in a phosphodiester bond is substituted with a sulfur atom, thereby replacing the phosphodiester bond with a phosphorothioate diester bond. In some embodiments, this modification can stabilize the structure of the siRNA, maintaining high specificity and high affinity for base pairing.

[0150] According to some embodiments of the present disclosure, in the siRNA, the phosphorothioate linkage is present in at least one of the group consisting of the following positions: between the first and second nucleotides at either end of the sense strand or the antisense strand; between the second and third nucleotides at either end of the sense strand or the antisense strand; or any combination thereof. In some embodiments, the phosphorothioate linkage is present at all of the above positions except the 5' end of the sense strand. In some embodiments, the phosphorothioate linkage is present at all of the above positions except the 3' end of the sense strand. In some embodiments, the phosphorothioate linkage is present at at least one of the following positions:

[0151] the connection between the first nucleotide and the second nucleotide at the 5' end of the sense strand;

[0152] the connection between the second nucleotide and the third nucleotide at the 5' end of the sense strand;

[0153] the connection between the first nucleotide and the second nucleotide at the 3' end of the sense strand;

[0154] the connection between the second nucleotide and the third nucleotide at the 3' end of the sense strand;

[0155] the connection between the first nucleotide and the second nucleotide at the 5' end of the antisense strand;

[0156] the connection between the second nucleotide and the third nucleotide at the 5' end of the antisense strand;

[0157] the connection between the first nucleotide and the second nucleotide at the 3' end of the antisense strand; and

[0158] The connection between the second nucleotide and the third nucleotide at the 3' end of the antisense strand.

[0159] According to some embodiments of the present disclosure, the 5'-terminal nucleotide of the antisense strand sequence of the siRNA molecule is a 5'-phosphate nucleotide or a 5'-phosphate analog-modified nucleotide.

[0160] In some embodiments, the 5'-phosphate nucleotide may have the structure shown in formula (12):

[0161] Meanwhile, the types of commonly used 5'-phosphate analogue-modified nucleotides are well known to those skilled in the art, for example, Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3): 238-48 disclose the following four nucleotides as shown in formulas (13) to (16):

[0162] wherein R represents a group selected from the group consisting of H, OH, F and methoxy;

[0163] Base represents a base selected from A, U, C, G or T.

[0164] In some embodiments, the 5'-phosphate nucleotide or 5'-phosphate analog modified nucleotide is a nucleotide containing vinyl phosphate (E-vinylphosphonate, E-VP) as shown in formula (13), a 5'-phosphate modified nucleotide as shown in formula (12), or a 5'-thiophosphate modified nucleotide as shown in formula (15).

[0165] In some embodiments of the present disclosure, the double-stranded oligonucleotide is siRNA.

[0166] According to the third aspect of the present invention, a method for preparing the nucleic acid conjugate disclosed in the present invention is provided, comprising oxidizing the phosphoramidite functional group in the compound of formula (I) of the present invention to a structure represented by formula (W), then combining with an oligonucleotide, and then cleaving and removing the protecting group to obtain the conjugate.

[0167] in, It represents the site of covalent attachment of a group;

[0168] E1 is OH, SH or BH2.

[0169] Any reasonable synthetic route can be used to prepare the nucleic acid conjugates of the present disclosure.

[0170] For example, the preparation method of the nucleic acid conjugate disclosed herein may include: under the conditions of phosphoramidite solid-phase synthesis, sequentially linking nucleoside monomers in the 3' to 5' direction according to the nucleotide types and sequence of the functional oligonucleotide, wherein the linking of each nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization.

[0171] In some embodiments of the present disclosure, the coupling reaction is carried out in the presence of an activator, such as one or more selected from 1H-tetrazole, 5-ethylthio 1H-tetrazole, and 5-benzylthio 1H-tetrazole, and in some embodiments, 5-ethylthio 1H-tetrazole.

[0172] In some embodiments of the present disclosure, the oxidation reaction conditions include a temperature of 0-50°C, in some embodiments 15-35°C, a reaction time of 1-100 seconds, in some embodiments 5-50 seconds, and the oxidizing agent in some embodiments is iodine (in further embodiments, provided in the form of iodine water).

[0173] According to a fourth aspect of the present invention, there is provided a use of the nucleic acid conjugate disclosed in the present invention in preparing a medicament for treating and / or preventing hepatic diseases.

[0174] According to a fifth aspect of the present invention, there is provided a method for treating a pathological condition or disease caused by gene expression in hepatocytes, the method comprising administering the nucleic acid conjugate disclosed in the present invention to a patient suffering from the disease.

[0175] According to a sixth aspect of the present invention, a kit is provided, comprising the nucleic acid conjugate disclosed in the present invention.

[0176] The following examples are merely illustrative of the present invention and are not intended to be limiting. Unless otherwise specified, the raw materials, reagents, etc. used in the following examples are all commercially available products.

[0177] Example 1 Preparation of Compound I-1-1

[0178] 1.1 Preparation of Intermediate 1-1

[0179] Compound 1-Cbz-4-hydroxymethylpiperidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (40.1 mmol, 10.0 g) was placed in a clean, dry reaction flask, 100 mL of pyridine was added, and 4,4'-bismethoxytrityl chloride (1.2 equiv, 48.1 mmol, 16.3 g) was added at room temperature, followed by stirring at room temperature for 1 hour. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1-4 / 1) to obtain compound 1-1 (21.7 g, 39.3 mmol, 98% yield) as a light yellow oil. Compound 1-1 molecular formula: C 35 H 37 O5N, molecular weight: 551.3, LC-MS measured: 552.4 (M+H). 1 H NMR (400MHz, DMSO-d6): δ7.31– 7.22(m,9H),7.17(d,J=8.6Hz,5H),6.82(d,J=8.7Hz,4H),4.99(s,2H),3.93(d,J=12.6Hz,2H),3 .66(s,6H),2.78–2.61(m,4H),2.44(s,1H),1.62(d,J=12.6Hz,2H),0.97(qd,J=12.7,3.6Hz,2H).

[0180] 1.2 Preparation of intermediate 1-2

[0181] Compound 1-1 (39.3 mmol, 21.7 g) was placed in a clean, dry reaction flask, and 150 mL of methanol was added. Palladium on carbon (wet basis, 10% Pd / C) (10% wt, 2.2 g) was then added under hydrogen at room temperature. Stirring was continued at room temperature for 12 hours. After the reaction, the palladium on carbon was removed by filtration, and the filtrate was concentrated to obtain the crude product, compound 1-2 (16.1 g, 38.5 mmol, 98% yield), as a white solid. This was used directly in the next reaction without purification. Compound 1-2 Molecular formula: C 27 H 31 O3N, molecular weight: 417.2, LC-MS measured: 418.4 (M+H).

[0182] 1.3 Preparation of intermediate 1-3

[0183] Compound N-benzyloxycarbonyl-L-serine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (35.0 mmol, 8.4 g) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 52.5 mmol, 19.9 g), compound 1-2 (1.1 equiv, 38.5 mmol, 16.1 g) and N,N-diisopropylethylamine (3.0 equiv, 105.0 mmol, 13.5 g) were added at room temperature, followed by stirring at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 10 / 1-2 / 3) to obtain a white solid compound 1-3 (14.9 g, 23.5 mmol, 67% yield). Compound 1-3 molecular formula: C 38 H 42 O7N2, molecular weight: 638.3, LC-MS measured: 639.4 (M+H). 1 H NMR (400MHz, DMSO-d6): δ7.42–7.26(m,9H),7.23(d,J=8.7Hz,5H),6.89(d,J=8.8Hz,4H),5.03–4.96(m,2H), 4.79(dt,J=25.7,5.4Hz,1H),4.55–4.48(m,1H),4.36(d,J=10.7Hz,1H),4.01(dt,J=24.8,8.8Hz,1H),3.73( s,6H),3.56(ddd,J=18.7,12.7,5.8Hz,1H),3.43–3.38(m,1H),3.00(t,J=12.3Hz,1H),2.85–2.79(m,2H),2. 69(s,1H),2.56(d,J=10.2Hz,1H),1.88(d,J=21.0Hz,1H),1.69(dd,J=36.5,11.3Hz,2H),1.19–0.98(m,2H).

[0184] 1.4 Preparation of Intermediates 1-4

[0185] Compound 1-3 (23.5 mmol, 14.9 g) was placed in a clean, dry reaction flask, and 100 mL of methanol was added. Palladium on carbon (wet basis, 10% Pd / C) (10% wt, 1.5 g) was then added under hydrogen at room temperature. Stirring was continued at room temperature for 12 hours. After the reaction, the palladium on carbon was removed by filtration, and the filtrate was concentrated to obtain the crude product, compound 1-4 (11.6 g, 23.0 mmol, 98% yield), as a white solid. This was used directly in the next reaction without purification. Compound 1-4 Molecular formula: C 30 H 36 O5N2, molecular weight: 504.2, LC-MS measured: 527.6 (M+Na). 1 H NMR (400MHz, DMSO-d6): δ7.36(d,J=7.5Hz,2H),7.31(t,J=7.6Hz,2H),7.23(d,J=8 .8Hz,5H),6.89(d,J=8.8Hz,4H),4.39(t,J=12.2Hz,1H),3.97(d,J=13.0Hz,1H),3. 73(s,6H),3.69(t,J=6.3Hz,1H),3.43–3.36(m,5H),3.01–2.92(m,2H),2.83(d,J=6 .1Hz,2H),1.84(dd,J=11.6,8.1Hz,1H),1.72(d,J=12.0Hz,2H),1.17–0.91(m,2H).

[0186] 1.5 Preparation of Intermediate 1-5

[0187] Compound 5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (commercially available, purchased from Noganlin Biopharmaceutical Technology (Suzhou) Co., Ltd.) (9.3 g, 20.9 mmol) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 31.3 mmol, 11.9 g) was added at room temperature and stirred for ten minutes. Subsequently, compound 1-4 (1.1 equiv, 23.0 mmol, 11.6 g) and N,N-diisopropylethylamine (3.0 equiv, 62.7 mmol, 8.1 g) were added to the reaction system, and stirring was continued at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 50 / 1-20 / 1) to obtain a white solid compound 1-5 (15.4 g, 16.5 mmol, 79% yield). Compound 1-5 molecular formula: C 49 H 63 O 13 N5, molecular weight: 933.4, LC-MS measured: 932.5 (MH). 1 HNMR (400MHz, DMSO-d6): δ7.93(dd,J=24.8,8.3Hz,1H),7.80(dd,J=8.8,5.3Hz,1H),7.36(d,J=7.8Hz,2H),7.31(t,J=7.6Hz,2H),7.23(d,J=8.7 Hz,5H),6.89(d,J=8.8Hz,4H),5.21(d,J=3.3Hz,1H),4.97(dd,J=11.2,3.4Hz,1H),4.79(d,J=4.7Hz,1H),4.47(dd,J=8.0,3.6Hz,1H),4.37(d,J= 12.7Hz,1H),4.05–4.00(m,5H),3.87(dd,J=20.2,10.3Hz,1H),3.73(s,6 H),3.57–3.50(m,1H),3.14(qd,J=7.3,4.3Hz,1H),2.99(t,J=14.2Hz,1H ),2.82(d,J=3.8Hz,2H),2.10(s,5H),1.99–1.98(m,6H),1.89(s,3H),1. 76(d,J=9.2Hz,4H), 1.25(dd,J=12.6,6.5Hz,5H), 1.17(t,J=7.1Hz,3H).

[0188] 1.6 Preparation of Compound I-1-1

[0189] Compound 1-5 (16.5 mmol, 15.4 g) was placed in a clean, dry reaction flask and 50 mL of anhydrous dichloromethane was added. Under argon protection at room temperature, 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 33.0 mmol, 9.9 g) and 4,5-dicyanoimidazole (1.5 equiv, 24.7 mmol, 2.9 g) were added and stirred at room temperature for one hour. After the reaction, 50 mL of dichloromethane was added to the reaction mixture, which was then washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The resulting crude product was purified by chromatography on a C18 reverse-phase column (specification: 30 μm; Commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (MeCN:H2O=75%:25%) to prepare white solid I-1-1 (11.6 g, 10.2 mmol, 62% yield). Compound I-1-1 molecular formula: C 58 H 80 O 15 N6P, molecular weight: 1133.5, LC-MS measured: 1132.4 (MH). 1H NMR (400MHz, DMSO-d6): δ8.22–8.04(m,1H),7.79(t,J=8.2Hz,1H),7.35(d,J= 2.3Hz,2H),7.30(t,J=7.6Hz,2H),7.22(d,J=8.5Hz,5H),6.88(d,J=8.7Hz,4H ),5.21(d,J=3.3Hz,1H),4.93(ddd,J=18.3,11.7,4.3Hz,2H),4.49–4.45(m,1 H),4.40–4.30(m,1H),3.99(p,J=8.9Hz,4H),3.85(dt,J=13.0,6.6Hz,2H),3.7 3(s,6H),3.71(s,2H),3.68–3.62(m,2H),3.49(ddd,J=15.7,13.6,6.6Hz,2H) ,3.42–3.36(m,1H),3.00(t,J=14.4Hz,1H),2.82–2.79(m,2H),2.77–2.72(m, 1H),2.69–2.64(m,1H),2.60–2.54(m,1H),2.10(s,5H),1.98(dd,J=8.7,3.5H z,3H),1.89(s,4H),1.77–1.63(m,5H),1.50–1.37(m,4H),1.19–1.10(m,12H). 31 P NMR (162MHz, DMSO-d6): δ147.90,147.30.

[0190] Example 2 Preparation of Compound I-1-7

[0191] 2.1 Preparation of Intermediate 2-1

[0192] Compound (R)-(+)-N-benzyl-3-hydroxypyrrolidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (16.9 mmol, 3.0 g) and imidazole (3.0 equiv, 50.7 mmol, 3.45 g) were placed in a clean, dry reaction flask, 50 mL of acetonitrile was added, and tert-butyldimethylsilyl chloride (1.3 equiv, 21.9 mmol, 3.31 g) was slowly added at room temperature, followed by stirring at room temperature for 12 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1-5 / 1) to obtain compound 2-1 (4.9 g, 16.8 mmol, 99% yield) as a colorless oil. Compound 2-1 Molecular formula: C17 H 29 ONSi, molecular weight: 291.2, LC-MS measured: 292.4 (M+H).

[0193] 2.2 Preparation of intermediate 2-2

[0194] Compound 2-1 (16.8 mmol, 4.9 g) was placed in a clean, dry reaction flask, 100 mL of methanol was added, and palladium on carbon (wet basis, 10% Pd / C) (10% wt, 490.0 mg) was added under hydrogen at room temperature. Stirring was continued at room temperature for 12 hours. After the reaction, the palladium on carbon was removed by filtration, and the filtrate was concentrated to obtain the crude product, compound 2-2 (3.31 g, 16.5 mmol, 98% yield), as a white solid. It was used directly in the next reaction without purification. Compound 2-2 Molecular formula: C 10 H 23 ONSi, molecular weight: 201.1, LC-MS measured: 202.3 (M+H).

[0195] 2.3 Preparation of intermediate 2-3

[0196] The compound N-benzyloxycarbonyl-L-serine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (15.0 mmol, 3.58 g) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 22.5 mmol, 8.53 g), compound 2-2 (1.1 equiv, 16.5 mmol, 3.31 g) and N,N-diisopropylethylamine (3.0 equiv, 45.0 mmol, 5.78 g) were added at room temperature, followed by stirring at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 10 / 1-1 / 3) to obtain a white solid compound 2-3 (4.5 g, 10.65 mmol, 63% two-step yield). Compound 2-3 molecular formula: C 21 H 34 O5N2Si, molecular weight: 422.2, LC-MS measured: 423.3 (M+H). 1H NMR (400MHz, CDCl3): δ7.35–7.29(m,5H),5.96(dd,J=14.3,8.3Hz,1H),5.10(s,2H),4.61–4.40(m,2H),3.85–3.68(m,2H),3.65–3.4 9(m,2H),3.41(d,J=12.7Hz,1H),3.31(s,1H),1.95(qdd,J=15.0,11.8,5.3Hz,2H),1.77(s,1H),0.86(s,9H),0.06(d,J=3.1Hz,6H).

[0197] 2.4 Preparation of Intermediate 2-4

[0198] Compound 2-3 (10.65 mmol, 4.5 g) was placed in a clean, dry reaction flask, 100 mL of pyridine was added, and 4,4'-bismethoxytrityl chloride (1.2 equiv, 12.78 mmol, 4.32 g) was added at room temperature, followed by stirring at room temperature for 12 hours. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1-1 / 1) to obtain compound 2-4 (7.56 g, 10.43 mmol, 98% yield) as a light yellow oil. Compound 2-4 molecular formula: C 42 H 52 O7N2Si, molecular weight: 724.3, LC-MS measured: 747.4 (M+Na). 1 H NMR (400MHz, CDCl3): δ7.35–7.31(m,1H),7.28(d,J=4.7Hz,4H),7.27–7.23(m,2H),7.23–7.14(m,5H), 7.13–7.11(m,2H),6.80–6.78(m,1H),6.76(dd,J=7.7,5.4Hz,4H),5.72(dd,J=22.7,8.3Hz,1H),5.08– 4.99(m,2H),4.69–4.59(m,1H),4.35–4.30(m,1H),3.73(dd,J=4.5,3.7Hz,6H),3.65–3.44(m,2H),3.3 6–3.20(m,3H),1.86–1.81(m,1H),1.70(s,1H),0.80(d,J=13.1Hz,9H),-0.02(dd,J=14.9,4.2Hz,6H).

[0199] 2.5 Preparation of Intermediate 2-5

[0200] Compound 2-4 (10.43 mmol, 7.56 g) was placed in a clean, dry reaction flask, and 100 mL of methanol was added. Palladium on carbon (wet basis, 10% Pd / C) (10% wt, 750.0 mg) was then added under hydrogen at room temperature. Stirring was continued at room temperature for 12 hours. After the reaction, the palladium on carbon was removed by filtration, and the filtrate was concentrated to obtain the crude product, compound 2-5 (6.0 g, 10.22 mmol, 98% yield), as a white solid. This was used directly in the next reaction without purification. Compound 2-5 molecular formula: C 34 H 46 O5N2Si, molecular weight: 590.3, LC-MS measured: 591.6 (M+H).

[0201] 2.6 Preparation of Intermediate 2-6

[0202] Compound 5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (commercially available, purchased from Noganlin Biopharmaceutical Technology (Suzhou) Co., Ltd.) (2.06 g, 4.62 mmol) was placed in a clean, dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 6.93 mmol, 2.63 g) was added at room temperature and stirred for ten minutes. Subsequently, compound 2-5 (1.1 equiv, 5.08 mmol, 3.0 g) and N,N-diisopropylethylamine (3.0 equiv, 13.86 mmol, 17.91 g) were added to the reaction system, and stirring was continued at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 50 / 1-10 / 1) to obtain a white solid compound 2-6 (3.58 g, 3.51 mmol, 76% yield). Compound 2-6 molecular formula: C 53 H 73 O 15 N3Si, molecular weight: 1019.3, LC-MS measured: 1018.3 (MH).

[0203] 2.7 Preparation of Intermediate 2-7

[0204] Compound 2-6 (3.51 mmol, 3.58 g) was placed in a clean, dry reaction flask, 50 mL of pyridine was added, and triethylamine hydrofluoride (5.0 equiv, 17.55 mmol, 2.97 g) was added at room temperature, followed by stirring at room temperature for 12 hours. After the reaction, 100 mL of ethyl acetate was added to the reaction solution, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 50 / 1-10 / 1) to obtain compound 2-7 (2.4 g, 2.65 mmol, 76% yield) as a light yellow oil. Compound 2-7 molecular formula: C 47 H 59 O 15 N3, molecular weight: 905.3, LC-MS measured: 904.4 (MH). 1 HNMR (400MHz, CDCl3): δ7.30(dd,J=4.2,1.9Hz,1H),7.29–7.25(m,5H),7.19–7.15(m,4H),6.85–6.81(m,4H),5.40–5.34(m,1H),5. 30(s,1H),5.26–5.19(m,1H),5.13(ddd,J=14.5,10.9,3.3Hz,1H),4.85–4.78(m,1H),4.75–4.71(m,1H),4.68–4.61(m,1H),4.50(d, J=11.5Hz,1H),4.18–4.11(m,2H),4.06–3.97(m,1H),3.90(dt,J=10.6,6.8Hz,2H),3.80(s,6H),3.67–3.46(m,4H),3.25–3.19(m,2 H),2.34–2.23(m,1H),2.17–2.15(m,3H),2.10–2.03(m,5H),1.98(dt,J=12.9,2.4Hz,4H),1.76–1.61(m,4H),1.37(t,J=7.3Hz,3H).

[0205] 2.8 Preparation of Compound I-1-7

[0206] Compound 2-7 (2.65 mmol, 2.4 g) was placed in a clean, dry reaction flask and 50 mL of anhydrous dichloromethane (commercially available from Shanghai Titan Technology Co., Ltd.) was added. Under argon protection at room temperature, 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 5.3 mmol, 1.6 g) and 4,5-dicyanimidazole (1.5 equiv, 3.97 mmol, 470.0 mg) were added and stirred at room temperature for one hour. After the reaction, 50 mL of dichloromethane was added to the reaction solution and washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered and concentrated. The crude product was purified by C18 reverse phase column (specification: 30 μm; Commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (MeCN:H2O=75%:25%) to prepare white solid I-1-7 (2.03 g, 1.84 mmol, 70% yield). Compound I-1-7 molecular formula: C 56 H 76 O 15 N6P, molecular weight: 1105.5, LC-MS measured: 1128.4 (M+Na). 1 H NMR (400MHz, DMSO-d6): δ8.12–8.06(m,1H),7.78(dd,J=9.1,2.0Hz,1H),7.35–7.28(m,4H),7.23–7.17(m,5H),6.88(d,J=7.5Hz,4H) ,5.21(d,J=3.3Hz,1H),4.97(dd,J=11.2,3.0Hz,1H),4.86–4.75(m,1H),4.52(s,1H),4.47(d,J=8.5Hz,1H),4.04–3.98(m,3H),3.91 –3.83(m,1H),3.74(s,6H),3.70–3.60(m,3H),3.58–3.47(m,3H),3.39(t,J=11.7Hz,2H),3.31(d,J=4.1Hz,1H),3.19(qd,J=8.7,3.8 Hz,1H),3.02(dt,J=19.9,6.8Hz,1H),2.78–2.70(m,1H),2.60(td,J=5.8,1.8Hz,1H),2.09(s,5H),1.98(s,4H),1.89(s,3H),1.73(s, 3H),1.44(s,4H),1.20–0.88(m,14H). 31 P NMR (162MHz, DMSO-d6): δ148.22 (s), 146.82 (t, J = 35.8Hz).

[0207] Example 3 Preparation of Compound I-1-5

[0208] According to the synthesis method of Example 2, a white solid I-1-5 (3.0 g, 2.68 mmol, 72% yield) was prepared from the starting material N-benzyl-4-hydroxypiperidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.). Compound I-1-5 molecular formula: C 57 H 78 O 15 N6P, molecular weight: 1119.5, LC-MS measured: 1142.4 (M+Na). 1 H NMR (400MHz, DMSO-d6): δ8.14–8.08(m,1H),7.80(d,J=9.2Hz,1H),7.35(d,J=7.6Hz,2H),7.29(t,J=7.6Hz,2H),7.22(d,J=7.5Hz,5 H),6.87(d,J=7.8Hz,4H),5.22(d,J=3.3Hz,1H),5.02–4.96(m,2H),4.49(d,J=8.4Hz,1H),4.02(tt,J=7.9,3.8Hz,4H),3.88(dd,J=1 9.8,8.9Hz,1H),3.74(s,6H),3.72–3.66(m,3H),3.63–3.54(m,3H),3.38(dd,J=11.9,7.7Hz,3H),3.32–3.31(m,1H),3.19(t,J=7.2 Hz,1H),3.06(s,1H),2.77–2.74(m,2H),2.14–2.07(m,5H),1.98(s,3H),1.90(s,3H),1.75(s,4H),1.46(s,6H),1.27–1.05(m,13H). 31 P NMR (162MHz, DMSO-d6): δ148.24 (s), 145.47 (dd, J = 15.7, 11.5Hz).

[0209] Example 4 Preparation of Compound I-1-2

[0210] According to the synthesis method of Example 1, a white solid I-1-2 (1.2 g, 1.05 mmol, 56% yield) was prepared from the starting material L-threonine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.). Compound I-1-2 molecular formula: C 59 H 82 O 15N6P, molecular weight: 1147.5, LC-MS measured: 1170.3 (M+Na). 1 H NMR (400MHz, DMSO-d6): δ7.79(dt,J=12.8,4.5Hz,1H),7.37–7.29(m,4H),7.22(d,J=7.6Hz,5H),6.88(d,J=7.7Hz,4H),5.21(d,J=3.3Hz,1H),4.9 7(dd,J=11.0,3.3Hz,1H),4.88(dt,J=11.6,4.7Hz,1H),4.47(dd,J=10.6 ,5.5Hz,1H),4.41–4.32(m,1H),4.16–4.08(m,1H),4.04–3.99(m,3H),3.9 2–3.82(m,1H),3.73(s,6H),3.70–3.63(m,2H),3.30–3.24(m,5H),2.90( dd,J=10.7,5.2Hz,1H),2.82(dt,J=9.3,5.6Hz,2H),2.76–2.66(m,1H),2 .34–2.32(m,1H),2.20–2.14(m,2H),2.10(s,3H),2.01–1.96(m,4H),1.8 9–1.81(m,4H),1.77–1.65(m,5H),1.53–1.38(m,5H),1.23–0.94(m,17H). 31 P NMR (162MHz, DMSO-d6): δ148.02.

[0211] Example 5 Preparation of Compound I-1-9

[0212] According to the synthesis method of Example 2, a white solid I-1-9 (3.02 g, 2.77 mmol, 83% yield) was prepared from the starting material 1-benzyloxycarbonyl-3-hydroxyazetidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.). Compound I-1-9 molecular formula: C 55 H 74 O 15 N6P, molecular weight: 1091.4, LC-MS measured: 1114.3 (M+Na). 1H NMR (400MHz, DMSO-d6): δ8.09–8.02(m,1H),7.78(d,J=9.1Hz,1H),7.37–7 .29(m,4H),7.24–7.19(m,5H),6.89(d,J=8.9Hz,4H),5.21(d,J=3.4Hz,1H) ,4.97(dd,J=11.2,3.1Hz,1H),4.77–4.61(m,1H),4.57–4.50(m,1H),4.47 (dd,J=8.5,2.6Hz,1H),4.24–4.06(m,2H),4.04–3.98(m,3H),3.92–3.81(m ,1H),3.78(dd,J=6.7,3.8Hz,1H),3.69(ddd,J=9.9,5.5,2.7Hz,2H),3.61 –3.51(m,2H),3.40–3.35(m,1H),3.16(q,J=7.7Hz,1H),3.04–2.98(m,1H), 2.80–2.74(m,2H),2.21–2.06(m,5H),1.98(s,3H),1.89(s,3H),1.74(d,J =2.5Hz,3H),1.51–1.37(m,4H),1.18–1.10(m,12H),1.06(d,J=6.7Hz,2H). 31 P NMR (162MHz, DMSO-d6): δ146.95 (dd, J=65.4, 20.5Hz).

[0213] Example 6 Preparation of Compound I-1-8

[0214] 6.1 Preparation of Intermediate 6-1

[0215] Serinol (commercially available, purchased from Adamas, Shanghai Titan Technology Co., Ltd.) (54.9 mmol, 5.0 g) was placed in a clean reaction flask and dissolved in 90 mL of water. Sodium carbonate (3.4 equiv, 183.8 mmol, 19.5 g) was added at room temperature. Triphosgene (0.33 equiv, 18.3 mmol, 5.4 g) was slowly added portionwise under an ice-water bath and stirred at room temperature for 24 hours. The solvent was removed by concentration under reduced pressure, and ethanol was added and stirred for 2 hours. The mixture was filtered and concentrated. The crude product was purified by silica gel column chromatography (dichloromethane / methanol = 100 / 1 to 9 / 1) to obtain compound 6-1 (4.6 g, 39.3 mmol, 72% yield) as a white solid. Compound 6-1 has the molecular formula: C₄H₇NO₃, molecular weight: 117.1, and LC-MS measured: 118.4 (M+H). 1H NMR (400MHz, DMSO-d6): δ7.58(s,1H),4.31(t,J=8.6Hz,1H),4.05(dd,J=8.5,5.0Hz,1H),3.78–3.72(m,1H),3.36(d,J=5.0Hz,2H).

[0216] 6.2 Preparation of Intermediate 6-2

[0217] Compound 6-1 (47.0 mmol, 5.5 g) was placed in a clean, dry reaction flask, and 300 mL of dichloromethane and DMAP (2.0 equiv, 93.9 mmol, 11.5 g) were added. TsCl (1.1 equiv, 51.7 mmol, 9.8 g) was slowly added in portions under an ice-water bath, and then stirred at room temperature for 2 hours. After the reaction, the reaction solution was washed with 100 mL of 1M HCl, 100 mL of water, and 100 mL of saturated brine, dried, and spin-dried to obtain a white powder 6-2 (12.3 g, 45.3 mmol, 97% yield). The crude product was directly used in the next reaction without purification. Compound 6-2 Molecular formula: C 11 H 13 NO5S, molecular weight: 271.1, LC-MS measured: 272.4 (M+H).

[0218] 6.3 Preparation of Intermediate 6-3

[0219] Compound 6-2 (45.5 mmol, 12.3 g) was placed in a clean, dry reaction flask, dissolved in 50 mL of tetrahydrofuran, and then 4-piperidinemethanol (3.0 equiv, 136.6 mmol, 15.7 g) was added. The mixture was heated to reflux for 16 h. The reaction solution was concentrated, and the resulting crude product was purified by silica gel column chromatography (dichloromethane / methanol = 100 / 1-9 / 1) to obtain compound 6-3 (7.9 g, 36.8 mmol, 81% yield) as a colorless syrup. Compound 6-3 Molecular formula: C 10 H 18 N2O3, molecular weight: 214.1, LC-MS measured: 215.3 (M+H). 1H NMR (400MHz, DMSO-d6): δ7.61(s,1H),4.38(d,J=5.3Hz,1H),4.33(t,J=8.2Hz,1H),3.97(dd,J=8.3,5.5Hz,1H),3.94–3.87(m,1H),3.22(t,J=5. 7Hz,2H),2.82(t,J=10.5Hz,2H),2.37–2.28(m,2H),1.97–1.86(m,2H), 1.59(d,J=12.4Hz,2H),1.34–1.23(m,1H),1.10(pd,J=12.3,3.9Hz,2H).

[0220] 6.4 Preparation of Intermediate 6-4

[0221] Compound 6-3 (23.3 mmol, 5.0 g) was placed in a clean, dry reaction flask, 50 mL of pyridine was added, and 4,4'-bismethoxytrityl chloride (1.2 equiv, 28.0 mmol, 9.5 g) was added at room temperature, followed by stirring at room temperature for 1 hour. After the reaction, 150 mL of ethyl acetate was added to the reaction solution, which was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine, respectively. The organic phase was dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 100 / 0-100 / 3) to obtain compound 6-4 (8.2 g, 15.9 mmol, 68% yield) as an off-white foamy solid. Compound 6-4 molecular formula: C 31 H 36 N2O5, molecular weight: 516.2, LC-MS measured: 515.3 (MH). 1 H NMR (400MHz, DMSO-d6): δ7.61 (s, 1H), 7.38–7.35 (m, 2H), 7.30 (t, J = 7.7Hz, 2H), 7.24–7 .21(m,5H),6.88(d,J=8.9Hz,4H),4.32(t,J=8.2Hz,1H),3.96(dd,J=8.2,5.4Hz,1H),3. 89(dt,J=13.2,6.8Hz,1H),3.73(s,6H),2.80(t,J=9.2Hz,4H),2.37–2.27(m,2H),1.94 (dd,J=26.3,11.7Hz,2H),1.63(d,J=12.3Hz,2H),1.56–1.50(m,1H),1.23–1.08(m,2H).

[0222] 6.5 Preparation of Intermediate 6-5

[0223] Compound 6-4 (15.9 mmol, 8.2 g) was placed in a clean, dry reaction flask and dissolved in 82 mL of ethanol. A 41 mL aqueous solution of potassium hydroxide (3.0 equiv, 47.6 mmol, 2.7 g) was added at room temperature and the temperature was raised to 85°C for overnight reaction. The solvent was concentrated to remove the residue, and 100 mL of ethyl acetate was added to the reaction solution. The mixture was washed with 60 mL of saturated sodium bicarbonate solution. The aqueous phase was back-extracted with 50 mL of ethyl acetate. The organic phases were combined, dried, filtered, and concentrated to obtain 6-5 (7.6 g, 15.5 mmol, 98% yield) as a white foamy solid. The crude product was directly used in the next reaction without purification. Compound 6-5 Molecular Formula: C 30 H 38 N2O4, molecular weight: 490.2, LC-MS measured: 491.3 (M+H).

[0224] 6.6 Preparation of Intermediate 6-6

[0225] Compound 5-(((2R,3R,4R,5R,6R)-3-acetylamino-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (commercially available, purchased from Noganlin Biopharmaceutical Technology (Suzhou) Co., Ltd.) (6.9 g, 15.5 mmol) was placed in a clean dry reaction bottle, 80 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.0 equiv, 15.5 mmol, 5.9 g) was added at room temperature and stirred for ten minutes. Subsequently, compound 6-5 (1.0 equiv, 15.5 mmol, 7.6 g) and N,N-diisopropylethylamine (2.0 equiv, 31.0 mmol, 4.0 g) were added to the reaction system, and then stirring was continued at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 100 / 1-10 / 1) to obtain compound 6-6 (7.7 g, 8.4 mmol, 54% yield) as a white foamy solid. Compound 6-6 Molecular formula: C 49 H 65 N3O 14 , molecular weight: 919.4, LC-MS measured: 918.3 (MH). 1HNMR (400MHz, DMSO-d6): δ7.81(dd,J=9.2,3.1Hz,1H),7.45(d,J=6.0Hz,1H),7.36(d,J=7.3Hz,2H),7.30(t,J=7.7Hz,2H),7.24–7.21(m, 5H),6.88(d,J=8.9Hz,4H),5.21(d,J=3.4Hz,1H),4.97(dd,J=11.2,3.0Hz,1H),4.48(dd,J=8.4,1.4Hz,1H),4.04–3.98(m,3H),3.87(dd,J =19.9,9.3Hz,2H),3.73(s,6H),3.71–3.67(m,1H),3.43–3.35(m,2H),2.84(dd,J=17.8,8.8Hz,4H),2.10(s,3H),2.05(t,J=6.7Hz,2H),1 .98(d,J=1.4Hz,4H),1.89(s,3H),1.77(s,3H),1.65(d,J=9.9Hz,2H),1.53–1.41(m,5H),1.26–1.23(m,1H),1.14(dt,J=22.4,9.2Hz,2H).

[0226] 6.7 Preparation of Compound I-1-8

[0227] Compound 6-6 (2.2 mmol, 2.0 g) was placed in a clean, dry reaction flask and 20 mL of anhydrous dichloromethane was added. Under argon protection at room temperature, 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 4.4 mmol, 1.3 g) and 4,5-dicyanoimidazole (1.5 equiv, 3.3 mmol, 0.38 g) were added and stirred at room temperature for one hour. After the reaction, 20 mL of dichloromethane was added to the reaction solution, which was then washed with 50 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was purified by chromatography on a C18 reverse phase column (specification: 30 μm; Commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (MeCN:H2O=75%:25%) to prepare white solid I-1-8 (1.1 g, 1.0 mmol, 45% yield). Compound I-1-8 molecular formula: C 58 H 82 O 15 N5P, molecular weight: 1119.5, LC-MS measured: 1118.4 (MH). 1H NMR (400MHz, DMSO-d6): δ7.83(d,J=9.2Hz,1H),7.36(d,J=7.3Hz,2H),7.31(dd,J=9.2,6.0Hz,2H),7.22(d,J=8.6Hz,5H),6.88(dd ,J=8.8,1.5Hz,4H),5.21(d,J=3.2Hz,1H),4.97(dd,J=11.3,3.3Hz,1H),4.48(d,J=8.4Hz,1H),4.06–3.96(m,4H),3.87(dd,J=20.0 ,9.0Hz,1H),3.73(s,6H),3.72–3.69(m,2H),3.59–3.52(m,1H),2.81(d,J=6.0Hz,3H),2.73(dt,J=9.7,6.0Hz,2H),2.09(s,3H),2 .07–2.03(m,2H),1.99–1.98(m,4H),1.88(d,J=5.1Hz,4H),1.77(s,3H),1.69–1.59(m,2H),1.48–1.40(m,5H),1.23–1.11(m,12H). 31 P NMR (162MHz, DMSO-d6): δ146.45.

[0228] Example 7 Preparation of Compound I-1-13

[0229] According to the synthesis method of Example 2, a white solid I-1-13 (2.32 g, 2.1 mmol, 81% yield) was prepared from the starting material N-benzyloxycarbonyl-DL-serine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.). Compound I-1-13 molecular formula: C 56 H 76 O 15 N6P, molecular weight: 1105.5, LC-MS measured: 1128.6 (M+Na). 1H NMR (400MHz, DMSO-d6): δ8.09–8.03(m,1H),7.75(dd,J=9.1,2.0Hz,1H),7.32–7.25(m,4H),7.17(ddd,J=13.7,8.2,2.3Hz,5H),6.85(d,J =7.5Hz,4H),5.18(d,J=3.3Hz,1H),4.94(dd,J=11.2,3.0Hz,1H),4.83–4.72(m,1H),4.49–4.43(m,2H),4.01–3.95(m,3H),3.88–3.80(m, 1H),3.71(s,6H),3.67–3.44(m,6H),3.36(t,J=11.7Hz,2H),3.28(d,J=4.1Hz,1H),3.16(qd,J=8.7,3.8Hz,1H),2.99(dt,J=19.9,6.8Hz, 1H),2.75–2.67(m,1H),2.57(td,J=5.8,1.8Hz,1H),2.06(s,5H),1.95(s,4H),1.86(s,3H),1.70(s,3H),1.41(s,3H),1.16–0.96(m,16H). 31 PNMR (162MHz, DMSO-d6): δ147.08,146.82,146.78,146.64.

[0230] Example 8 Preparation of Compound I-1-15

[0231] According to the synthesis method of Example 2, a white solid I-1-15 (2.1 g, 1.88 mmol, 78% yield) was prepared from the starting materials N-benzyl-4-hydroxypiperidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) and N-benzyloxycarbonyl-DL-serine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.). Compound I-1-15 molecular formula: C 57 H 78 O 15 N6P, molecular weight: 1119.5, LC-MS measured: 1142.6 (M+Na). 1H NMR (400MHz, DMSO-d6): δ8.10–8.05(m,1H),7.76(d,J=9.2Hz,1H),7.32(d,J=7.6Hz,2H),7.25(t,J=7.6Hz,2H),7.18(d,J=7.5 Hz,5H),6.84(d,J=7.8Hz,4H),5.18(d,J=3.3Hz,1H),4.98–4.92(m,2H),4.45(d,J=8.4Hz,1H),4.01–3.95(m,4H),3.84(dd,J=1 9.8,8.9Hz,1H),3.70(s,6H),3.69–3.63(m,3H),3.59–3.50(m,2H),3.34(dd,J=11.9,7.7Hz,2H),3.28(d,J=1.6Hz,1H),3.16( t,J=7.2Hz,2H),2.73–2.70(m,2H),2.11–2.03(m,5H),1.95(s,3H),1.86(s,3H),1.72(s,4H),1.43(s,6H),1.12–1.09(m,15H). 31 P NMR (162MHz, DMSO-d6): δ145.56, 145.49, 145.46, 145.39.

[0232] Example 9 Preparation of siRNA Conjugates

[0233] By solid-phase phosphoramidite method, using the special modified compounds prepared in the above steps and commercially purchased conventional modified monomers (phosphoramidite monomers for synthesizing modified nucleotides dT, Am, Cm, Gm, Um, Af, Cf, Gf, and Uf, all purchased from Shanghai Zhaowei Technology Development Co., Ltd.), nucleoside monomers are connected one by one from the 3'-5' direction according to the order of nucleotide arrangement. The specially modified anti-off-target compound is placed in the seed region of the antisense chain (any position from the 4th to the 8th starting from the 5' end), and the delivery monomer compound is freely set to be placed at the 3' end or the 5' end according to the common monomer. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization. The synthesis conditions used for the sense chain and antisense chain.

[0234] Instrument model: MerMade 12 Oligonucleotide syntheizer solid phase synthesizer, Beijing Haijing 6mL synthesis column, Si Tuofan SourceTM 15Q 4.6 / 100PE purification column.

[0235] The reagents used to synthesize siRNA conjugates were purchased from Suzhou Kelema Biotechnology Co., Ltd.

[0236] The synthesis is briefly described as follows:

[0237] The single-strand synthesis reaction process is extended from 3' to 5' and is completed on a solid phase synthesizer. It includes four main reaction steps:

[0238] a. DMTr removal reaction: Use dichloroacetic acid to remove the DMTr protecting group on the nucleotide to obtain the 5'-hydroxyl end;

[0239] b. Coupling reaction: The protected nucleotide phosphoramidite monomer is mixed with the activator ethylthiotetrazolium. The phosphoramidite group is activated, and the 5'-hydroxyl group, still protected by DMTr, undergoes a condensation reaction with the 5'-hydroxyl group attached to the solid support to form a phosphite triester.

[0240] c. Oxidation reaction: Under the action of iodine, the phosphite triester obtained in the previous condensation reaction is converted into a more stable phosphate ester (i.e., trivalent phosphorus is oxidized to pentavalent phosphorus);

[0241] d. Sulfurization reaction: Under the action of the thio reagent PADS (phenylacetyl disulfide), the phosphite triester obtained in the previous condensation reaction is converted into a thiophosphate (oxidation or thiolation is selected according to the sequence design).

[0242] e. Capping reaction: There may be a very small number of 5'-hydroxyl groups (less than 2%) that do not participate in the condensation reaction. They are reacted with acetic anhydride and 1-methylimidazole to form acetate end-capping that cannot participate in subsequent reactions, preventing further reactions. This short fragment can be separated during purification.

[0243] Repeat the above four steps until the desired sequence is synthesized. The main chemical reaction equation is as follows

[0244] After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase support is cut, deprotected, purified, desalted, and then freeze-dried to obtain the sense chain and antisense chain, wherein:

[0245] Cleavage and deprotection conditions were as follows: First, prepare the aminolysis solution (a mixture of ammonia and ethanol in a ratio of 3:1 to a volume of 2 mL), add the solid support to the reaction flask, and shake thoroughly to mix well. Aminolysis was carried out in a constant temperature water bath at 50°C for 16 hours. After 16 hours of aminolysis, the water bath was cooled to a temperature of 25°C ± 2°C, filtered through a fritted funnel, and the filtrate was collected in a round-bottom flask. The residue was rinsed with 50% aqueous ethanol. The filtrate was collected and concentrated on a rotary evaporator, then transferred to a glass bottle. A small sample of the crude product was sent to the analytical department for analysis by LC-MS. The purity and molecular weight of the sense and antisense strands were determined using a Waters Acquity UPLC-LTQ LCMS (column: ACQUITY UPLC BEH C18). The measured values ​​were consistent with the theoretical values ​​(see Table 1).

[0246] Purification and desalting conditions are as follows: purification using an ion exchange chromatography column and desalting using a Stovepane HiPrep™ 26 / 10 Desalting gel column, followed by single-strand lyophilization. After lyophilization, the single-stranded product is sampled for LC-MS analysis.

[0247] Finally, the obtained sense and antisense strands need to be annealed into double strands.

[0248] Annealing was performed as follows: the purified sense and antisense strands were dissolved in water for injection to prepare solutions ranging from 0.1 mg / mL to 40 mg / mL. The mixture was calibrated with a Thermo Scientific Nanodrop Eight at an equal molar ratio and heated at 90°C for 5 minutes. The mixture was then cooled naturally to allow hydrogen bonding to form a double-stranded structure. Samples were taken for SEC purity testing (see Table 2). The double-stranded samples were lyophilized.

[0249] Table 1 Delivery molecule conjugated siRNA number and sequence information

[0250] Table 2 Double-stranded SEC-HPLC purity

[0251] Example 10 Testing the activity of siRNA conjugates in mice

[0252] Select 6-8 week old SPF grade female C57BL / 6J mice, the weight of the mice is 20±2g. Before administration, the above mice were weighed and observed, and animals with uniform weight and normal status were randomly divided into groups of 4, wherein the experimental group mice were given the conjugate, and the vehicle group mice were given phosphate buffered saline (PBS), and the dose of 1mg / kg conjugate was given subcutaneously to each mouse. 20 days after administration, the animals were euthanized, and liver tissue was taken. According to conventional methods, the liver was cut into pieces and placed in RNALater (Invitrogen, AM7021M) for subsequent RNA extraction. The liver tissue was placed in a lysate (Changchun Zhiang Biotechnology Co., Ltd., MNTR / FX96) and ground (Shanghai Jingxin Industrial Development Co., Ltd., JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B). The expression level of the target gene complement C5 mRNA was detected by fluorescence qPCR (Vazyme, Q711).

[0253] Target gene primers:

[0254] Forward primer: CCAGCCCAATCAAGTTCCTAGAG;

[0255] Reverse primer: CGGCGTGTAAACAGGTTTGTC;

[0256] Primers for internal reference gene GAPDH:

[0257] Forward primer: TGCACCACCAACTGCTTAG;

[0258] Reverse primer: GATGCAGGGATGATGTTC;

[0259] The results are expressed as the residual expression level in the siRNA-administered group compared to the vehicle group (vehicle group = 100%). The siRNA sequences of the conjugates used for injection are shown in Table 1. As shown in Figure 1 and Table 3, compared to the positive conjugate SD003317, the conjugate SD003974 exhibited comparable target gene complement C5 mRNA silencing activity; the conjugates SD004119, SD004122, and SD004125 exhibited significantly superior complement C5 mRNA silencing activity against the target gene than the conjugate SD003317.

[0260] Table 3 Relative residual expression levels of target gene complement C5 mRNA 20 days after administration of the test conjugate

[0261] In the sequences mentioned above and in Table 1, the symbols are used to represent the following modified nucleotides:

[0262] A = adenosine 3'-phosphate; C = cytidine 3'-phosphate; G = guanosine 3'-phosphate; U = uridine 3'-phosphate; dT = thymidine deoxynucleotide; Am = 2'-O-methyladenosine 3'-phosphate; Ams = 2'-O-methyladenosine 3'-phosphorothioate; Cm = 2'-O-methylcytidine 3'-phosphate; Cms = 2'-O-methylcytidine 3'-phosphorothioate; Gm = 2'-O-methylguanosine 3'-phosphate; Gms = 2'-O-methylguanosine 3'-phosphorothioate; Um = 2'-O-methyluridine-3'-phosphate; Ums = 2'-O-methyluridine-3'-phosphorothioate; Af = 2'-fluoroadenosine-3'-phosphate; Afs = 2'-fluoroadenosine-3'-phosphorothioate; Cf = 2'-fluorocytidine-3'-phosphate; Cfs = 2'-fluorocytidine-3'-phosphorothioate; Gf = 2'-fluoroguanosine-3'-phosphate; Gfs = 2'-fluoroguanosine-3'-phosphorothioate; Uf = 2'-fluorouridine-3'-phosphate; Ufs = 2'-fluorouridine-3'-phosphorothioate

[0263] Example embodiments have been disclosed herein, and although specific terms are employed, they are used and described in a generic and descriptive sense only and not for purposes of limitation. In some cases, as will be apparent to those skilled in the art upon filing this application, features, characteristics, and / or elements described in connection with a particular embodiment may be used alone or in combination with features, characteristics, and / or elements described in connection with other embodiments, unless expressly indicated otherwise. Accordingly, it will be understood by those skilled in the art that various changes in form and detail may be made without departing from the spirit and scope of the invention as set forth in the claims.

Claims

1. A compound having a structure shown in formula (I): in, A0 represents a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells, or represents a group formed by replacing all or part of the hydroxyl groups in the ligand with KCOO- groups, wherein each K is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halogenated phenyl and alkylphenyl; b is an integer in the range of 1-4; L1 and L2 independently represent a combination of one or more selected from the group consisting of formula A1-A11: Wherein, j1 is an integer of 1-20; j2 is an integer of 1-20; R' is C1-C 10 The alkyl group; M represents a structural formula as shown in formula (A12): Wherein, m represents an integer from 0 to 6; * represents a bond connected to G1, Q represents the structural formula shown in formula (A13): Among them, the represents a bond connected to G1; R2 and R3 are the same or different and are independently selected from H, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl; Z does not exist or represents C1-C 10 Alkylene; X represents the formula (A14-1) or (A14-2) or the structural formula shown: Wherein R4, R5 are the same or different and are independently selected from H, fluorine, hydroxyl, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl; p is an integer of 1-6; optionally, R4 and R5 are directly linked to form a three- to six-membered saturated carbocyclic ring; E represents the structural formula shown in formula (A15): in, Represents C3-C 18 Cycloalkyl or C3-C 18 heterocyclic group, and R1 is selected from H, fluorine, hydroxyl, cyano, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl; G1 and G2 each represent a phosphoramidite functional group or a hydroxyl protecting group having a structure represented by formula (G-1), provided that at least one of G1 and G2 has a structure represented by formula (G-1), and the hydroxyl protecting group is selected from any one of trityl, 4-methoxytrityl, 4,4'-bismethoxytrityl (DMTr) and 4,4',4'-trimethoxybenzyl; Wherein, B1 is selected from substituted or unsubstituted C1-C5 hydrocarbon groups; Indicates the site of covalent attachment of a group.

2. The compound according to claim 1, wherein L1 or L2 is independently selected from a combination of one or more of A1, A2, A4, A6, A7, A8, A9, A10, and A11; The ligands are each independently selected from any one of the following: D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine Glucose amine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2 , 3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside heptanoside ethyl ester, 2,5-anhydro-D-allose nitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose; b is 1, 2, or 3; m is 0, 1 or 2; R2 and R3 are independently selected from H, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; Z is absent or represents C1-C3 alkylene; R4 and R5 are independently selected from H, fluorine, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; p is 1, 2 or 3; represents a C4-C8 cycloalkyl group or a C3-C8 heterocyclyl group; and R1 is selected from H, fluorine, hydroxyl, cyano, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; B1 is methyl, ethyl or isopropyl; B2 is selected from one of C1-C5 alkyl, acetonitrile, propionitrile and butyronitrile.

3. The compound according to claim 2, wherein b is 1 or 3; represents a C3-C6 heterocyclic group; A0 is an N-acetylgalactosamine (GalNAc) group as shown below, or a group in which all or part of its hydroxyl group is replaced by a KCOO- group, wherein: Each K is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl and alkylphenyl: The hydroxyl protecting group is 4,4'-bismethoxytrityl; The length of L1 or L2 is independently 1-25 atoms, and the length of L1 or L2 refers to the number of atoms in the longest straight chain; Each j1 is independently an integer of 1-10, and each j2 is independently an integer of 1-10.

4. The compound according to claim 3, wherein represents a four- to six-membered nitrogen-containing saturated cycloalkyl group; The length of L1 or L2 is independently 1-20 atoms; Each j1 is independently an integer from 1 to 8, and each j2 is independently an integer from 1 to 8.

5. The compound according to claim 2, wherein L1 or L2 is independently selected from a combination of at least two of A1, A2, A4, A8, A9, A10, and A11. The compound according to claim 2 , wherein L1 or L2 is independently selected from a combination of at least two of A1, A4, A8, A10, and A11.

7. The compound according to claim 1, wherein the compound has the structure (I-1) shown below: in, L is A10, wherein j1 is an integer from 2 to 8, or A11, wherein j2 is an integer from 1 to 7; m is 0, 1 or 2; n is 0, 1, 2 or 3; Q represents the structural formula shown in formula (A13): in, represents the site where the group is covalently bonded; R2 and R3 are independently selected from H, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; X represents the formula (A14-1) or (A14-2) or the structural formula shown: wherein R4 and R5 are independently selected from H, fluorine, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; p is 1, 2 or 3; optionally, R4 and R5 are directly connected to form a three- to six-membered saturated carbocyclic ring; represents a four- to eight-membered all-carbon or nitrogen-containing saturated ring, R1 is selected from H, fluorine, hydroxyl, cyano, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; in, The hydroxyl groups in the formula (A) are all or partly substituted by KCOO- groups, wherein each K is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halogenated phenyl and alkylphenyl.

8. The compound according to claim 1, wherein It is a four-, five- or six-membered saturated cycloalkyl group containing one or two nitrogen atoms.

9. The compound according to claim 1, wherein the compound has any one of the structures shown below:

10. A nucleic acid conjugate, wherein the conjugate contains one or more structures represented by formula (II) linked to any position on an oligonucleotide sequence: in, R p and R q Each is H or has a structure represented by formula A16, provided that R p and R q At least one of them has a structure shown in Formula A16; in, It indicates the site of covalent attachment of a group; E1 is OH, SH or BH2, A0 represents a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells or represents a group formed by replacing all or part of the hydroxyl groups in the ligand with KCOO- groups, wherein each K is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halogenated phenyl and alkylphenyl; b is an integer in the range of 1-4; L1 and L2 independently represent a combination of one or more selected from the group consisting of formula A1-A11: Wherein, j1 is an integer of 1-20; j2 is an integer of 1-20; R' is C1-C 10 The alkyl group; M represents a structural formula as shown in formula (A12): in, Indicates the site where the group is covalently bonded; m represents an integer from 0 to 6; * indicates the site where the group is covalently bonded p The connected keys, Q represents the structural formula shown in formula (A13): in, Indicates the site of covalent bond attachment of the group, connected to O Represents R p R2, R3 are the same or different and are independently selected from H, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl, preferably H, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; Z does not exist or represents C1-C 10 Alkylene; X represents the formula (A14-1) or (A14-2) or the structural formula shown: Wherein R4, R5 are the same or different and are independently selected from H, fluorine, hydroxyl, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl, preferably H, fluorine, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; p is an integer from 1 to 6; optionally, R4 and R5 are directly linked to form a three- to six-membered saturated carbocyclic ring; E represents the structural formula shown in formula (A15): in, It indicates the site of covalent attachment of a group; Represents C3-C 18 Cycloalkyl or C3-C 18 heterocyclic group, and R1 is selected from H, fluorine, hydroxyl, cyano, C1-C 20 Alkyl, C1-C 20 Alkoxy, C2-C 20 Alkenyl, C2-C 20 Alkynyl.

11. The nucleic acid conjugate according to claim 10, wherein the conjugate contains one or more structures represented by formula (II-A) linked to any position on the oligonucleotide sequence: in, a represents an integer from 0 to 7; The structure of W is shown below: in, Indicates the site of covalent bond attachment of the group; E1 is OH, SH or BH2. The nucleic acid conjugate according to claim 11 , wherein a represents an integer of 0, 1, 2 or 3. 13 .

13. The nucleic acid conjugate according to claim 10 or 11, wherein L1 or L2 is independently selected from one or more of A1, A2, A4, A6, A7, A8, A9, A10, A11; The ligands are each independently selected from any one of the following: D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine Glucose amine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2 , 3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside heptanoside ethyl ester, 2,5-anhydro-D-allose nitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose; b is 1, 2, or 3; m is 0, 1 or 2; R2 and R3 are independently selected from H, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; Z is absent or represents C1-C3 alkylene; R4, R5 are independently selected from H, fluorine, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; p is 1, 2 or 3; represents a C4-C8 cycloalkyl group or a C3-C8 heterocyclyl group; and R1 is selected from H, fluorine, hydroxyl, cyano, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl; B1 is methyl, ethyl or isopropyl; B2 is selected from one of C1-C5 alkyl, acetonitrile, propionitrile and butyronitrile.

14. The nucleic acid conjugate according to claim 13, wherein b is 1 or 3; represents a C3-C6 heterocyclic group; A0 is an N-acetylgalactosamine (GalNAc) group as shown below, or a group in which all or part of its hydroxyl group is replaced by a KCOO- group, wherein: Each K is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl and alkylphenyl: The hydroxyl protecting group is 4,4'-bismethoxytrityl; The length of L1 or L2 is independently 1-25 atoms, and the length of L1 or L2 refers to the number of atoms in the longest straight chain; Each j1 is independently an integer of 1-10, and each j2 is independently an integer of 1-10.

15. The nucleic acid conjugate according to claim 14, wherein represents a four- to six-membered nitrogen-containing saturated cycloalkyl group; The length of L1 or L2 is independently 1-20 atoms; Each j1 is independently an integer from 1 to 8, and each j2 is independently an integer from 1 to 8. The nucleic acid conjugate according to claim 10 or 11, wherein L1 or L2 is independently selected from a linked combination of at least two of A1, A2, A4, A8, A9, and A10. The nucleic acid conjugate according to claim 10 or 11, wherein L1 or L2 is independently selected from a linked combination of at least two of A1, A4, A8, and A10.

18. The nucleic acid conjugate according to claim 10 or 11, which has any one of the following structures: Where Y is O or S, For oligonucleotides.

19. The nucleic acid conjugate according to claim 10 or 11, wherein The oligonucleotide is selected from one of small interfering RNA, microRNA, anti-microRNA, microRNA antagonist, microRNA mimetic, decoy oligonucleotide, immunostimulant, G-quadrupole, alternative splicing, single-stranded RNA, antisense nucleic acid, nucleic acid aptamer, stem-loop RNA, mRNA fragment, and activating RNA; optionally, the oligonucleotide is a single-stranded oligonucleotide or a double-stranded oligonucleotide; optionally, the oligonucleotide is a single-stranded oligonucleotide, the P atom in formula (A16) is connected to the end of the single-stranded oligonucleotide, and the end of the single-stranded oligonucleotide refers to the first 4 nucleotides from one end of the single-stranded oligonucleotide; optionally, the P atom in formula (A16) is connected to the end of the single-stranded oligonucleotide; optionally, the P atom in formula (A16) is connected to the 3' end of the single-stranded oligonucleotide; Optionally, the oligonucleotide is a double-stranded oligonucleotide comprising a sense strand and an antisense strand, and the P atom in formula (A16) is connected to the end of the double-stranded oligonucleotide, and the end of the double-stranded oligonucleotide refers to the first 4 nucleotides from one end of the sense strand or the antisense strand; optionally, the P atom in formula (A16) is connected to the end of the sense strand or the antisense strand; optionally, the P atom in formula (A16) is connected to the 5' end of the antisense strand; optionally, the P atom in formula (A16) is connected to the 2', 3' or 5' position of the nucleotide in the nucleic acid conjugate by forming a phosphodiester bond.

20. The nucleic acid conjugate according to claim 19, wherein The double-stranded oligonucleotide is siRNA.

21. A method for preparing a nucleic acid conjugate according to any one of claims 10 to 20, comprising oxidizing the phosphoramidite functional group in the compound of formula (I) according to claims 1 to 9 to a structure represented by formula (W), then combining it with an oligonucleotide, and then cleaving and removing the protecting group to obtain the conjugate; in, It indicates the site of covalent attachment of a group; E1 is OH, SH or BH2.

22. Use of the nucleic acid conjugate according to any one of claims 10 to 20 in the preparation of a medicament for treating and / or preventing a hepatic disease.

23. A method for treating a pathological condition or disease caused by the expression of a gene in a hepatocyte, the method comprising administering the nucleic acid conjugate of any one of claims 10 to 20 to a patient suffering from the disease.

24. A kit comprising the nucleic acid conjugate according to any one of claims 10 to 20.

Images