Gene therapy vector nucleic acid construct for allergic diseases, and usage method thereof

Abstract

A gene therapy vector nucleic acid construct for allergic diseases, and a usage method thereof. Specifically, the present invention relates to an expression cassette. The expression cassette comprises the following elements: a promoter, optionally a first signal peptide encoding sequence, a sequence encoding the heavy chain of an anti-IgE antibody, optionally a linker sequence, optionally a second signal peptide encoding sequence, and a sequence encoding the light chain of the anti-IgE antibody. Further provided is an adeno-associated virus vector comprising the expression cassette. The gene expression framework of the adeno-associated virus vector can realize high-level expression of a target gene, and the the adeno-associated virus vector can be used for treating allergic conditions such as allergic asthma and chronic spontaneous urticaria.

Description

A gene therapy vector nucleic acid construct for allergic diseases and its use method

[0001] This application claims priority to Chinese patent application No. 202310849120.8, filed on July 11, 2023. This application incorporates the entire text of the aforementioned Chinese patent application. Technical Field

[0002] This application relates to the field of biomedical technology, specifically to a gene therapy vector nucleic acid construct for allergic diseases and its use method. This gene sequence construct can be used for gene therapy of allergic diseases such as chronic spontaneous urticaria and allergic asthma. This gene sequence construct can be used to produce adeno-associated virus gene therapy vectors for gene therapy of these allergic diseases with higher efficiency and lower cost. Background Art

[0003] Allergic asthma is a chronic respiratory disease associated with reversible airflow obstruction and associated with mucus excess and airway remodeling. It is common in children, with a reported prevalence of 5–15%. Over the past few decades, the prevalence and mortality of asthma have been increasing worldwide, with approximately 250,000 deaths annually and affecting 300 million people worldwide. The disease is caused by immune dysfunction, primarily influenced by effector T cell subsets, and is characterized by chronic airway inflammation involving multiple cellular components (such as eosinophils, mast cells, T lymphocytes, neutrophils, and airway epithelial cells). This chronic inflammation is associated with airway remodeling and airway hyperresponsiveness, often manifesting as widespread and variable reversible expiratory airflow limitation, leading to recurrent symptoms of wheezing, shortness of breath, chest tightness, and / or cough, which vary in intensity over time. It is a heterogeneous disease with diverse phenotypes. Allergic asthma patients present with a phenotype characterized by elevated serum allergen IgE levels, in addition to airway eosinophilia-induced inflammation, increased Th2 cells, and excessive secretion of type 2 cytokines IL-4, IL-5, and IL-13. While most patients respond well to safe and evidence-based stepwise drug therapy, less than 5% of asthma patients exhibit a severe, treatment-resistant asthma phenotype.

[0004] Studies have shown that the autoimmune mechanism in most patients with allergic asthma involves the high-affinity receptor FcεRI for the Fc region of IgE. IgE is the primary immunoglobulin mediating type I allergic reactions. When IgE binds to the high-affinity receptor FcεRI on the surface of mast cells or basophils, it causes mast cell or basophil degranulation, followed by the release of bioactive mediators such as histamine, proteases, and cytokines, as well as platelet-activating factor and other arachidonic acid metabolites (prostaglandin D2, leukotrienes C4, D4, and E4). These mediators can cause airway smooth muscle contraction, capillary dilation and increased permeability, and increased glandular secretions, collectively inducing both early and late allergic reactions and significantly negatively impacting the quality of life of asthma patients.

[0005] Because elevated serum specific IgE levels are a hallmark of allergic asthma and a key factor in the pathogenesis of allergic diseases like asthma, reducing specific IgE levels in asthma patients has become a key research focus in asthma prevention and treatment. Anti-IgE therapy holds promise as a new and effective treatment option for asthma patients. In 2003, omalizumab, the first humanized monoclonal antibody for anti-IgE therapy, was approved in the United States for the treatment of moderate to severe persistent allergic asthma. Omalizumab binds to the constant region (Cε3) of the IgE molecule, preventing free IgE from binding to its receptor and reducing the release of bioactive mediators. Simultaneously, reduced serum free IgE leads to downregulation of FcεRI surface expression on effector cells, further suppressing their response to allergens. In controlled clinical studies, the correlation between free IgE levels and asthma symptoms suggests that greater IgE suppression leads to better clinical benefit. Ligelizumab (QGE031) is another fully humanized monoclonal IgG1 antibody targeting human IgE. It binds to the Cε3 domain of IgE with higher affinity than omalizumab. Compared with omalizumab, ligelizumab has a stronger and more sustained inhibitory effect on free IgE on the surfaces of mast cells and basophils, which helps to better block the allergic cascade and improve the clinical efficacy of asthma treatment. In addition to the two anti-IgE monoclonal antibodies mentioned above, current treatment strategies for allergic asthma also include antihistamines, leukotriene receptor antagonists, β2-adrenergic receptor agonists, and glucocorticoids. The latter only provide temporary relief by suppressing the inflammatory response and have certain side effects.

[0006] Therefore, there is an urgent need in the art to develop a more effective, safe and long-lasting method for treating or preventing allergic asthma and even other allergic diseases.

[0007] Summary of the Invention

[0008] The purpose of this application is to provide a more effective, safe and long-lasting method for treating or preventing allergic asthma and even other allergic diseases.

[0009] In the first aspect of the present application, an expression cassette is provided, which comprises the following elements: a promoter, an optional first signal peptide coding sequence, an anti-IgE antibody heavy chain coding sequence, an optional linker sequence, an optional second signal peptide coding sequence, and an anti-IgE antibody light chain coding sequence.

[0010] In another preferred embodiment, the linker comprises one or more selected from the group consisting of: a self-cleavage linker, a Furin cleavage site, and an IRES linker.

[0011] In another preferred embodiment, the anti-IgE antibody is selected from the group consisting of ligelizumab, omalizumab, or a combination thereof.

[0012] In another preferred embodiment, the expression cassette has a structure shown in Formula I from the 5' end to the 3' end:

[0013] Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8-Z9 (Formula I)

[0014] wherein each “-” is independently a bond or a nucleotide linking sequence;

[0015] Z1 is the promoter;

[0016] Z2 is an optional first signal peptide coding sequence;

[0017] Z3 is the heavy chain coding sequence of the anti-IgE antibody;

[0018] Z4 is the Furin cleavage site;

[0019] Z5 is the coding sequence of the self-cleaving linker;

[0020] Z6 is an optional second signal peptide coding sequence; and

[0021] Z7 is the light chain coding sequence of the IgE antibody;

[0022] Z8 is an optional woodchuck hepatitis virus regulatory element WPRE element;

[0023] Z9 is an optional polyadenylation signal (polyA).

[0024] In another preferred embodiment, the expression cassette has a structure shown in Formula II from the 5' end to the 3' end:

[0025] Z1-Z2-Z3-Z4'-Z6-Z7-Z8-Z9 (Formula I)

[0026] Wherein, Z1, Z2, Z3, Z6, Z7, Z8, and Z9 are defined as above, and Z4' is an IRES element;

[0027] Each "-" is independently a bond or a nucleotide linking sequence.

[0028] In another preferred embodiment, the promoter is an enhanced promoter, including: CMV, CBH, EF1α, CAG, CAGG, CASI, desmin, TMCK, MCK, MHCK7, PGK, and TTR.

[0029] In another preferred embodiment, the nucleotide sequence of the CBH promoter has ≥95% identity with the nucleotide sequence shown in SEQ ID NO. 1, preferably ≥98%, and more preferably ≥99%.

[0030] In another preferred embodiment, the nucleotide sequence of the CBH promoter is shown in SEQ ID NO.: 1.

[0031] In another preferred example, the first signal peptide and the second signal peptide are each independently selected from the following group: SAP signal peptide, IHC signal peptide, ILC signal peptide, AP signal peptide, CSP signal peptide, IL2 signal peptide, TPA signal peptide, L1 signal peptide, H7 signal peptide, or a combination thereof.

[0032] In another preferred example, the nucleotide sequence of the heavy chain coding sequence of the IgE antibody is as shown in SEQ ID NO: 2, or has a sequence identity of more than 90% (preferably more than 95%, more preferably more than 96%, more than 97%, more than 98% or more than 99%) thereto.

[0033] In another preferred example, the amino acid sequence of the heavy chain of the IgE antibody is as shown in SEQ ID NO.: 3, or has a sequence identity of more than 90% (preferably more than 95%, more preferably more than 96%, more than 97%, more than 98% or more than 99%) thereto.

[0034] In another preferred example, the nucleotide sequence of the light chain encoding sequence of the IgE antibody is as shown in SEQ ID NO: 4, or has a sequence identity of more than 90% (preferably more than 95%, more preferably more than 96%, more than 97%, more than 98% or more than 99%) thereto.

[0035] In another preferred example, the amino acid sequence of the light chain of the IgE antibody is as shown in SEQ ID NO: 5, or has a sequence identity of more than 90% (preferably more than 95%, more preferably more than 96%, more than 97%, more than 98% or more than 99%) thereto.

[0036] In another preferred embodiment, the heavy chain coding sequence of the IgE antibody is a codon-optimized sequence.

[0037] In another preferred embodiment, the light chain coding sequence of the IgE antibody is a codon-optimized sequence.

[0038] In another preferred embodiment, the self-cleaving linker is selected from the group consisting of T2A, F2A, E2A, P2A, or a combination thereof.

[0039] In another preferred embodiment, the poly(A) is the polyadenylation signal of SV40 virus, and its nucleotide sequence is ≥95% identical to the nucleotide sequence shown in SEQ ID NO.: 6, preferably ≥98%, and more preferably ≥99%.

[0040] In another preferred embodiment, the nucleotide sequence of the poly(A) is shown in SEQ ID NO.: 6.

[0041] In another preferred embodiment, the length of each nucleotide linker sequence is 0-30 nt, preferably 1-15 nt.

[0042] In another preferred embodiment, the nucleotide sequence of the expression cassette is selected from the following group:

[0043] (a) the nucleotide sequence shown in SEQ ID NO: 7;

[0044] (b) a nucleotide sequence having a sequence identity of ≥95% (preferably ≥98%, more preferably ≥99%) to the nucleotide sequence shown in SEQ ID NO: 7; and

[0045] (c) a nucleotide sequence complementary to the nucleotide sequence described in (a) or (b).

[0046] In another preferred embodiment, the nucleotide sequence includes a DNA sequence, a cDNA sequence, or an mRNA sequence.

[0047] In another preferred embodiment, the nucleotide sequence includes a single-stranded sequence and a double-stranded sequence.

[0048] The second aspect of the present application provides a vector, which contains the expression cassette as described in the first aspect of the present application.

[0049] In another preferred embodiment, the vector comprises one or more promoters, which are operably connected to the nucleic acid sequence, enhancer, intron, transcription termination signal, polyadenylation sequence, replication origin, selective marker, nucleic acid restriction site, and / or homologous recombination site.

[0050] In another preferred embodiment, the vector includes a plasmid or a viral vector.

[0051] In another preferred embodiment, the vector is selected from the group consisting of a lentiviral vector, an adenoviral vector, an adeno-associated viral vector (AAV), a DNA viral vector, a retroviral vector, or a combination thereof.

[0052] In another preferred embodiment, the vector is an adeno-associated virus AAV vector.

[0053] In another preferred embodiment, the vector is an AAV vector containing or inserted with nucleotide sequences encoding IgE antibody heavy and light chains.

[0054] In another preferred embodiment, the vector is used to express the heavy chain and light chain of IgE antibody.

[0055] The third aspect of the present application provides an adeno-associated viral vector, which contains the expression cassette described in the first aspect of the present application.

[0056] In another preferred embodiment, the adeno-associated virus is AAV6 or AAV8.

[0057] In another preferred embodiment, the adeno-associated viral vector is used to treat allergic diseases.

[0058] In another preferred embodiment, the allergic disease is selected from the group consisting of allergic asthma, chronic spontaneous urticaria, or a combination thereof.

[0059] In another preferred embodiment, the adeno-associated viral vector has a structure of Formula III:

[0060] A1-Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8-Z9-A2 (Formula III)

[0061] in,

[0062] Each "-" is independently a bond or a nucleotide linking sequence;

[0063] A1 is the L-ITR sequence;

[0064] Z1 is the promoter;

[0065] Z2 is an optional first signal peptide coding sequence;

[0066] Z3 is an optional IgE antibody heavy chain coding sequence;

[0067] Z4 is the Furin cleavage site;

[0068] Z5 is the coding sequence of the self-cleaving linker;

[0069] Z6 is an optional second signal peptide coding sequence; and

[0070] Z7 is the IgE antibody light chain coding sequence;

[0071] Z8 is an optional woodchuck hepatitis virus regulatory element WPRE element;

[0072] Z9 is an optional polyadenylation signal (polyA);

[0073] A2 is the R-ITR sequence.

[0074] In another preferred embodiment, the adeno-associated viral vector has a structure of Formula IV:

[0075] A1-Z1-Z2-Z3-Z4'-Z6-Z7-Z8-Z9-A2 (Formula IV)

[0076] in,

[0077] Each "-" is independently a bond or a nucleotide linking sequence;

[0078] A1, Z1, Z2, Z3, Z6, Z7, Z8, Z9, and A2 are defined as above, and Z4' is an IRES element.

[0079] In another preferred embodiment, the L-ITR nucleotide sequence is shown in SEQ ID NO.: 8.

[0080] In another preferred embodiment, the R-ITR nucleotide sequence is shown as SEQ ID NO.: 9.

[0081] In another preferred example, the sequence of the adeno-associated virus backbone vector comprises the sequence shown in SEQ ID NO.: 10 (ie, the nucleotide sequence of the vector without the target gene inserted).

[0082] In another preferred embodiment, the sequence of the adeno-associated virus vector is shown in SEQ ID NO.: 11 (ie, the nucleotide sequence of the vector after the target gene is inserted).

[0083] The fourth aspect of the present application provides a host cell containing the vector described in the second aspect of the present application or the adeno-associated virus vector described in the third aspect of the present application, or an exogenous expression cassette as described in the first aspect of the present application integrated into its chromosome.

[0084] In another preferred embodiment, the host cell is a mammalian cell, and the mammal includes human and non-human mammals.

[0085] In another preferred embodiment, the host cell is selected from the following group: 293T cells, 293 cells, or a combination thereof.

[0086] The fifth aspect of the present application provides a use of the vector described in the second aspect of the present application, the adeno-associated virus vector described in the third aspect of the present application, or the host cell described in the fourth aspect of the present application for preparing a preparation or composition for treating allergic diseases.

[0087] In another preferred embodiment, the allergic disease is selected from the group consisting of allergic asthma, chronic spontaneous urticaria, or a combination thereof.

[0088] The sixth aspect of the present application provides a pharmaceutical preparation, which contains (a) the vector described in the second aspect of the present application or the adeno-associated virus vector described in the third aspect of the present application or the host cell described in the fourth aspect of the present application, and (b) a pharmaceutically acceptable carrier or excipient.

[0089] In another preferred embodiment, the dosage form of the pharmaceutical preparation is selected from the following group: a lyophilized preparation, a liquid preparation, or a combination thereof.

[0090] In another preferred embodiment, the content of the carrier in the pharmaceutical preparation is 1×109-1×1016 viruses / ml, preferably 1×1012-1×1014 viruses / ml.

[0091] In another preferred embodiment, the pharmaceutical preparation is used to treat allergic diseases.

[0092] In another preferred embodiment, the allergic disease is selected from the group consisting of allergic asthma, chronic spontaneous urticaria, or a combination thereof.

[0093] In another preferred embodiment, the pharmaceutical preparation can be used alone or in combination for the treatment of allergic diseases.

[0094] In another preferred embodiment, the combined use includes: combined use with other drugs for treating allergic diseases.

[0095] The seventh aspect of the present application provides a treatment method, which comprises administering the vector described in the second aspect of the present application, the adeno-associated virus vector described in the third aspect of the present application, or the host cell described in the fourth aspect of the present application to a subject in need.

[0096] In another preferred embodiment, the subject in need includes humans and non-human mammals.

[0097] In another preferred embodiment, the non-human mammals include rodents and primates, preferably mice, rats, rabbits, and monkeys.

[0098] In another preferred embodiment, the administration dose of the vector described in the second aspect of the present application, the adeno-associated virus vector described in the third aspect of the present application, or the host cell described in the fourth aspect of the present application is 1×1012-1×1014 / kg body weight, preferably 5×1012-5×1013 / kg body weight.

[0099] In another preferred embodiment, the administration frequency of the vector described in the second aspect of the present application, the adeno-associated virus vector described in the third aspect of the present application, or the host cell described in the fourth aspect of the present application is a single treatment.

[0100] The eighth aspect of the present application provides a method for preparing a recombinant adeno-associated virus vector, comprising culturing the host cell described in the fourth aspect of the present application, thereby obtaining the recombinant adeno-associated virus vector.

[0101] A ninth aspect of the present application provides a medicine kit, comprising:

[0102] (i) a first container, and an active ingredient (a) in the first container, wherein the active ingredient (a) is the vector described in the second aspect of the present application, the adeno-associated virus vector described in the third aspect of the present application, the host cell described in the fourth aspect of the present application, or the pharmaceutical preparation described in the sixth aspect of the present application;

[0103] (ii) an optional second container, and an active ingredient (b) in the second container, wherein the active ingredient (b) is another drug for treating allergic diseases or an active ingredient thereof.

[0104] In another preferred embodiment, the kit further comprises instructions for administering the active ingredients (a) and (b) to treat allergic diseases.

[0105] In another preferred embodiment, the first container and the second container are the same or different containers.

[0106] It should be understood that within the scope of this application, the above-mentioned technical features of this application and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0107] Figure 1 shows the electrophoresis of Ligelizumab-pUC plasmid.

[0108] FIG2 shows the electrophoresis of Ligelizumab-pUC plasmid digestion.

[0109] FIG3 shows the electrophoresis of restriction enzyme digestion of pAAV-CBH-MCS plasmid.

[0110] FIG4 shows the electrophoresis of bacterial solution PCR identification.

[0111] FIG5 shows the plasmid map of pAAV-CBH-MCS of the present application.

[0112] FIG6 shows the design of the expression cassette of the nucleic acid construct expressing Ligelizumab.

[0113] FIG7A shows the design of a nucleic acid construct (adeno-associated virus vector) expressing Ligelizumab.

[0114] Figure 7B shows a map of nucleic acid constructs expressing Ligelizumab.

[0115] FIG8 shows the results of Western Blot detection of ligelizumab expression after cells were transduced with adeno-associated virus expressing ligelizumab.

[0116] FIG9 shows the binding of purified ligelizumab to IgE.

[0117] FIG10 shows the trend of changes in serum ligelizumab antibody concentration after BALB / c mice were injected with adeno-associated virus expressing ligelizumab.

[0118] FIG11 shows the number of total leukocytes in bronchoalveolar lavage fluid of mice.

[0119] FIG12 shows the number of eosinophils in bronchoalveolar lavage fluid of mice.

[0120] Figure 13 shows the plasmid map of pKL-lenti-kan-CBH-WPRE.

[0121] FIG14 shows a lentiviral gene therapy vector for the human IgE neutralizing antibody ligelizumab.

[0122] Figure 15 shows the expression of ligelizumab in the supernatant after lentiviral transduction of cells by SDS-PAGE, wherein: 1, supernatant of cells expressing ligelizumab; 2, flow-through of cell supernatant; 3, 5 μg of purified ligelizumab (the sample was added to a loading buffer without β-mercaptoethanol); 4, 5 μg of purified ligelizumab (the sample was added to a loading buffer containing β-mercaptoethanol). DETAILED DESCRIPTION

[0123] After extensive and in-depth research and a large amount of screening, the applicant has developed for the first time a gene therapy adeno-associated virus vector that can effectively treat allergic diseases. Specifically, the present application provides an expression cassette for gene therapy of allergic diseases, which can be used for gene therapy of allergic diseases such as chronic spontaneous urticaria and allergic asthma. The expression cassette is used to produce adeno-associated virus gene therapy vectors for gene therapy of the above-mentioned allergic diseases with higher efficiency and lower cost. Experimental results show that the gene expression framework of the adeno-associated virus vector of the present application can achieve high-level expression of the target gene, and can be used for the treatment of allergic diseases such as allergic asthma and chronic spontaneous urticaria. On this basis, the applicant completed the present application.

[0124] the term

[0125] In order to more easily understand the present disclosure, some terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms should have the meaning given below. Other definitions are set forth throughout the application.

[0126] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0127] As used herein, the terms "comprising" or "including" may be open, semi-closed, or closed. In other words, the terms also include "consisting essentially of" or "consisting of."

[0128] Sequence identity is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0129] As used herein, the terms "subject" and "subject in need thereof" refer to any mammal or non-mammal. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, cows, horses, dogs, cats, pigs, sheep, and goats.

[0130] Ligelizumab

[0131] Ligelizumab is another fully humanized monoclonal IgG1 antibody targeting human IgE. It binds to the Cε3 domain of IgE. Ligelizumab has a strong and lasting inhibitory effect on free IgE on the surface of mast cells and basophils, which helps to better block the allergic cascade reaction and improve the clinical effect of treating asthma. It includes the heavy chain and light chain of ligelizumab (also known as ligalizumab).

[0132] Furin cleavage site

[0133] In this application, the furin cleavage site is an amino acid site that can be cleaved by the furin protease, typically Arg-X-(Arg / Lys)-Arg. Furin protease cleaves proteins downstream of this typical furin cleavage site. Furin-2A-mediated vector cleavage is very efficient, with the advantage of high self-cleavage efficiency, ensuring the same light and heavy chain expression levels within the same open reading frame.

[0134] IRES

[0135] In this application, "IRES linker" and "IRES" are used interchangeably and both refer to the internal ribosome entry site (IRES). Located at the 5' end of a gene, IRES is a short RNA sequence (approximately 150-250 bp) that folds into a structure similar to that of the initiator tRNA, thereby mediating ribosomal RNA binding and initiating protein translation. The IRES element has the ability to independently recruit ribosomes, independent of the cap structure, and can thus initiate translation of downstream genes.

[0136] Nucleic acid coding sequence

[0137] The present application provides an AAV viral vector that expresses the heavy chain and light chain of an anti-IgE antibody.

[0138] Exemplarily, the present application provides an AAV viral vector expressing the heavy and light chains of ligelizumab, the nucleotide sequence of which is shown in SEQ ID NO.: 11. In another preferred embodiment, the nucleotide sequence is ≥95% identical to the nucleotide sequence shown in SEQ ID NO.: 11, preferably ≥98%, and more preferably ≥99%.

[0139] The polynucleotide of the present application may be in the form of DNA or RNA. In another preferred embodiment, the nucleotide is DNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. DNA may be single-stranded or double-stranded. DNA may be a coding chain or a non-coding chain. The AAV viral vector of the present application expresses the heavy chain and light chain of Ligelizumab, the amino acid sequence of the heavy chain is shown in SEQ ID NO.: 3, the nucleotide sequence is shown in SEQ ID NO.: 2, the amino acid sequence of the light chain is shown in SEQ ID NO. 5, the nucleotide sequence is shown in SEQ ID NO. 4, and the structure is shown in Figure 6.

[0140] The nucleic acid sequence can be DNA, RNA, cDNA or PNA. The nucleic acid sequence can be genomic, recombinant or synthetic. The nucleic acid sequence can be isolated or purified. The nucleic acid sequence can be single-stranded or double-stranded. Preferably, the nucleic acid sequence will encode the heavy and light chains of Ligelizumab as described herein. The nucleic acid sequence can be derived by cloning, for example, using standard molecular cloning techniques including restriction enzyme digestion, ligation, gel electrophoresis, such as described in Sambrook et al. (Molecular Cloning: A laboratory manual, Cold Spring Harbour Laboratory Press). The nucleic acid sequence can be isolated, for example, using PCR technology. Isolation means separating the nucleic acid sequence from any impurities and from other nucleic acid sequences and / or proteins that are naturally found associated with the nucleic acid sequence in its source. Preferably, it will also be free of cellular material, culture medium or other chemicals from the purification / production process. The nucleic acid sequence can be synthetic, for example, produced by direct chemical synthesis. The nucleic acid sequence can be provided as naked nucleic acid, or can be provided in complex with proteins or lipids.

[0141] The nucleotide full-length sequence of the present application or its fragment can be obtained with the method for PCR amplification, recombination or artificial synthesis usually.For PCR amplification, can be according to disclosed relevant nucleotide sequence, especially open reading frame sequence is designed primer, and with commercially available cDNA library or the cDNA library prepared by conventional method well known to those skilled in the art as template, increase and obtain relevant sequence.When sequence is long, usually need to carry out twice or multiple PCR amplifications, and then the fragment that each amplification goes out is spliced ​​together in correct order.At present, can obtain the dna sequence dna of encoding the present application polypeptide (or its fragment, or its derivative) fully by chemical synthesis.Then this dna sequence dna can be introduced into various existing dna molecules (or as carrier) and cell as known in the art.

[0142] The present application also relates to vectors comprising the polynucleotides of the present application, and host cells produced by genetic engineering using the vectors or polypeptide coding sequences of the present application. The above-mentioned polynucleotides, vectors or host cells may be isolated.

[0143] As used herein, "isolated" means a substance that has been separated from its original environment (in the case of a naturally occurring substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state within a living cell are not isolated and purified. However, the same polynucleotide or polypeptide is isolated and purified if it is separated from other substances with which it is naturally present.

[0144] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0145] In addition, the sequences can also be synthesized by artificial synthesis, especially when the fragment length is shorter. Usually, a long fragment can be obtained by synthesizing multiple small fragments and then connecting them.

[0146] The method of using PCR technology to amplify DNA / RNA is preferably used to obtain the genes of the present application. The primers used for PCR can be appropriately selected based on the sequence information of the present application disclosed herein and can be synthesized using conventional methods. The amplified DNA / RNA fragments can be separated and purified using conventional methods such as gel electrophoresis.

[0147] The present application also relates to a vector comprising the polynucleotide of the present application, a host cell produced by genetic engineering using the vector or protein coding sequence of the present application, and a method of expressing the heavy and light chains of ligelizumab using the host cell by recombinant technology.

[0148] The polynucleotide sequences of the present application can be used to obtain host cells (such as mammalian cells) that express the heavy and light chains of the ligelizumab of the present application through conventional recombinant DNA techniques. Generally, the process comprises the steps of: transducing the expression cassette of the first aspect of the present application, the vector of the second aspect of the present application, or the adeno-associated virus vector of the third aspect of the present application into the host cells.

[0149] Methods well known to those skilled in the art can be used to construct expression vectors containing the DNA sequence encoding the polypeptide of the present application and appropriate transcriptional / translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, etc. The DNA sequence can be operatively linked to an appropriate promoter in the expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0150] In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0151] A vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform an appropriate host cell to enable it to express the polypeptide.

[0152] Host cells can be prokaryotic cells, lower eukaryotic cells, or higher eukaryotic cells, such as mammalian cells (including human and non-human mammals). Representative examples include animal cells such as CHO, NS0, COS7, or 293 cells. In a preferred embodiment of the present application, 293T cells or 293 cells are selected as host cells.

[0153] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2, using procedures well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0154] The transformant obtained can be cultivated with conventional methods to express the protein encoded by the gene of the present application. Depending on the host cell used, the culture medium used in the cultivation can be selected from various conventional culture media. Cultivate under conditions suitable for host cell growth. After the host cells grow to an appropriate cell density, induce the promoter of choice with a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0155] The polypeptide in the above method can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If necessary, the protein can be separated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

[0156] Adeno-associated virus

[0157] Because adeno-associated virus (AAV) is smaller than other viral vectors, has no pathogenicity, and can transfect both dividing and non-dividing cells, AAV-based gene therapy methods for the eye, especially hereditary retinal degenerative diseases, have received widespread attention.

[0158] Adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus Dependivirus in the family Parvoviridae. It is the simplest single-stranded DNA defective virus discovered to date and requires a helper virus (usually an adenovirus) for replication. It encodes the cap and rep genes, located in inverted repeat sequences (ITRs) at its two terminals. The ITRs play a crucial role in viral replication and packaging. The cap gene encodes the viral capsid protein, and the rep gene is involved in viral replication and integration. AAV can infect a variety of cell types.

[0159] Recombinant adeno-associated virus (rAAV) vectors, derived from the non-pathogenic wild-type adeno-associated virus, are considered one of the most promising gene transfer vectors due to their safety, broad host cell range (dividing and non-dividing cells), low immunogenicity, and prolonged in vivo expression of foreign genes. They are widely used in gene therapy and vaccine research worldwide. After more than a decade of research, the biological properties of rAAV have been thoroughly understood, particularly with extensive data on their efficacy in various cell types, tissues, and in vivo experiments. In medical research, rAAV has been used in gene therapy studies for a variety of diseases (both in vitro and in vivo). As a unique gene transfer vector, it is also widely used in gene function studies, disease model development, and the generation of knockout mice.

[0160] In a preferred embodiment of the present application, the vector is a recombinant AAV vector. AAV is a relatively small DNA virus that can be integrated into the genome of the cells they infect in a stable and site-specific manner. They are able to infect a large range of cells without any effect on cell growth, morphology or differentiation, and they do not seem to be involved in human pathology. The AAV genome has been cloned, sequenced and characterized. AAV contains an inverted terminal repeat (ITR) region of approximately 145 bases at each end, which serves as the origin of viral replication. The rest of the genome is divided into two important regions with encapsidation functions: the left part of the genome containing the rep gene involved in viral replication and viral gene expression; and the right part of the genome containing the cap gene encoding the viral capsid protein.

[0161] AAV vectors can be prepared using standard methods in the art. Adeno-associated viruses of any serotype are suitable. Methods for purifying vectors can be found in, for example, U.S. Patent Nos. 6,566,118, 6,989,264, and 6,995,006, the disclosures of which are incorporated herein by reference in their entirety. The preparation of hybrid vectors is described, for example, in PCT Application No. PCT / US2005 / 027091, the disclosures of which are incorporated herein by reference in their entirety. The use of vectors derived from AAV for transporting genes in vitro and in vivo has been described (see, for example, International Patent Application Publication Nos. WO91 / 18088 and WO93 / 09239; U.S. Patent Nos. 4,797,368, 6,596,535, and 5,139,941, and European Patent No. 0488528, all of which are incorporated herein by reference in their entirety). These patent publications describe various AAV-derived constructs in which the rep and / or cap genes are deleted and replaced with genes of interest, and the use of these constructs to deliver genes of interest in vitro (into cultured cells) or in vivo (directly into an organism). Replication-deficient recombinant AAV can be prepared by co-transfecting a cell line infected with a human helper virus (e.g., adenovirus) with a plasmid containing the nucleic acid sequence of interest flanked by two AAV inverted terminal repeat (ITR) regions and a plasmid carrying the AAV encapsidation genes (rep and cap genes). The resulting AAV recombinant is then purified by standard techniques.

[0162] In some embodiments, the recombinant vector is encapsidated into a viral particle (e.g., an AAV viral particle including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16). Thus, the present disclosure includes recombinant viral particles (recombinant in that they contain a recombinant polynucleotide) containing any of the vectors described herein. Methods for producing such particles are known in the art and are described in U.S. Patent No. 6,596,535.

[0163] Expression vectors and host cells

[0164] The present application also provides an expression vector for expressing the heavy chain and light chain of Ligelizumab (also known as Ligelizumab).

[0165] Given the sequence information, a skilled artisan can use available cloning techniques to generate nucleic acid sequences or vectors suitable for transduction into cells.

[0166] Preferably, the nucleic acid sequence of the heavy chain and light chain of Ligelizumab (also known as Ligelizumab) encoding liglizumab is provided as a vector, preferably an expression vector. Preferably, it can be provided as a gene therapy vector preferably suitable for transduction and expression in 293T cells. The vector can be viral or non-viral (e.g., plasmid). Viral vectors include those derived from the following viral vectors: adenovirus, adeno-associated virus (AAV) including a mutated form, retrovirus, slow virus, herpes virus, vaccinia virus, MMLV, GaLV, simian immunodeficiency virus (SIV), HIV, pox virus, and SV40. Preferably, the viral vector is replication defective, although it is envisioned that it can be replication deficient, capable of replication or conditional replication. The viral vector can generally maintain an extrachromosomal state and not be integrated into the genome of the 293T cells. The preferred viral vector for introducing nucleic acid sequences encoding the heavy and light chains of Ligelizumab (also known as Ligelizumab) into 293T cells is an AAV vector, such as a self-complementary adeno-associated virus (scAAV). Selective targeting can be achieved using specific AAV serotypes (AAV serotype 2 to AAV serotype 12) or modified versions of any of these serotypes (including AAV4YF and AAV7m8 vectors).

[0167] In another preferred embodiment, the adeno-associated virus used in the present application is AAV8, and preferably, the adeno-associated virus is single-stranded AAV8.

[0168] The viral vector can be modified to delete any non-essential sequence. For example, in AAV, the virus can be modified to delete all or part of the IX gene, Ela and / or Elb gene. For wild-type AAV, without the presence of a helper virus such as adenovirus, replication is very inefficient. For recombinant adeno-associated viruses, preferably, the replication gene and capsid gene are provided in trans (in the pRep / Cap plasmid), and only the 2ITR of the AAV genome is retained and packaged into the virion, while the required adenoviral genes are provided by adenovirus or another plasmid. Similar modifications can also be made to lentiviral vectors.

[0169] Viral vectors have the ability to enter cells. However, non-viral vectors such as plasmids can be combined with agents to facilitate the uptake of viral vectors by target cells. Such agents include polycationic agents. Alternatively, delivery systems such as liposome-based delivery systems can be used. The carriers used in this application are preferably suitable for use in vivo or in vitro, and are preferably suitable for use in humans.

[0170] The vector will preferably contain one or more regulatory sequences to direct expression of the nucleic acid sequence in the retinal target cells. Regulatory sequences may include promoters, introns, enhancers, transcription termination signals, polyadenylation sequences, replication origins, nucleic acid restriction sites, and homologous recombination sites operably linked to the nucleic acid sequence. The vector may also include a selective marker, for example, to determine expression of the vector in a growth system (e.g., bacterial cells) or in the retinal target cells.

[0171] "Operably linked" means that a nucleic acid sequence is functionally related to the sequence to which it is operably linked so that they are linked in a manner that allows them to affect the expression or function of each other. For example, a nucleic acid sequence operably linked to a promoter will have an expression pattern affected by the promoter.

[0172] The promoter mediates the expression of the nucleic acid sequence connected thereto. The promoter can be constitutive or inducible. The promoter can direct ubiquitous expression in inner retinal cells, or neuron-specific expression. In the latter case, the promoter can direct cell type-specific expression, for example, to optic ganglion cells. Suitable promoters will be known to those skilled in the art. For example, suitable promoters can be selected from the group consisting of: L7, thy-1, recovery protein, calcium-binding protein, human CMV, GAD-67, chicken actin, hSyn, Grm6, Grm6 enhancer SV40 fusion protein. Targeting can be achieved using cell-specific promoters, for example, Grm6-SV40 is used for selective targeting to optic nerve cells. The Grm6 promoter is a fusion of the 200 base pair enhancer sequence of the Grm6 gene and the SV40 eukaryotic promoter. The Grm6 gene encodes the metabotropic glutamate receptor mGluR6 specific to optic nerve cells. The preferred sources of the Grm6 gene are mice and humans. Ubiquitous expression can be achieved using a pan-neuronal promoter, examples of which are known and available in the art. One such example is CAG. The CAG promoter is a fusion of the CMV early enhancer and the chicken actin promoter.

[0173] An example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence that can drive any polynucleotide sequence high-level expression that can be operably connected thereto. Another example of a suitable promoter is elongation growth factor-1α (EF-1α). However, other constitutive promoter sequences can also be used, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr (Epstein-Barr) virus immediate early promoter, Rous sarcoma virus promoter and human gene promoter, such as but not limited to actin promoter, myosin promoter, heme promoter and creatine kinase promoter. Further, the application should not be limited to the application of constitutive promoters. Inducible promoters are also considered to be a part of the application. The use of an inducible promoter provides a molecular switch that can turn on expression of a polynucleotide sequence operably linked to the inducible promoter when such expression is desired, or turn off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

[0174] An example of a suitable promoter is the CBH promoter.

[0175] Many expression vectors can be used to express the heavy and light chains of Ligelizumab (also known as Ligelizumab) in mammalian cells (preferably human, more preferably human 293T cells). In this application, adeno-associated virus is preferably used as an expression vector.

[0176] The present application also provides a method for constructing a recombinant adeno-associated virus vector containing the heavy chain and light chain coding sequences of ligelizumab (also known as ligalizumab). This method can quickly and easily construct a recombinant adeno-associated virus vector carrying the heavy chain and light chain coding sequences of ligalizumab (also known as ligalizumab), and package it to obtain a complex defective adeno-associated virus vector.

[0177] In another preferred example, the sequence of the adeno-associated virus vector carrying the heavy chain and light chain coding sequences of Ligelizumab (also known as Ligelizumab) described in the present application is shown in SEQ ID NO.: 11.

[0178] Gene therapy vectors

[0179] The gene therapy vector in this application is a viral expression vector. According to this application, the viral expression vector is an adeno-associated virus (AAV) vector, which is better suited for high-efficiency transduction in the tissue of interest. During transfection, AAV only induces a mild immune response (if any) in the host. In a preferred embodiment of this application, the gene therapy vector is an AAV serotype 8 vector.

[0180] At present, recombinant adeno-associated virus (rAAV) is one of the important viral vectors in the field of gene therapy. Its safety and effectiveness have been verified in many clinical trials and it has broad application prospects. In order to develop an ideal gene therapy product for the treatment of allergic diseases, we have selected a recombinant adeno-associated virus (rAAV) vector with the characteristics of a wide host range, the ability to infect dividing cells and non-dividing cells, high viral titer, strong specificity, low toxicity and immunogenicity, no integration into chromosomes, and the ability to express exogenous genes for a long time. This patent uses the rAAV8 vector to carry the ligelizumab encoding gene, which is injected intramuscularly into the IgE / FcεRI double humanized BALB / c asthma model mice, which can significantly reduce the proportion of eosinophils in the total white blood cells in the alveolar lavage fluid, and at the same time reduce the secretion of Th2 cytokines, thereby alleviating asthma symptoms. The present application provides a gene therapy drug for allergic diseases, and no related reports have been seen at home or abroad so far.

[0181] The AAV vector of the present application is a single-stranded AAV, and recombinant viral vectors can be produced according to standard techniques. For example, recombinant adeno-associated viral vectors can be packaged in human 293T cells (which provide trans E1A and E1B properties) to achieve a titer within the range of 1010-1013 virus particles / mL. Before in vivo use, the viral vector can be affinity purified and purified by subsequent filtration. Purification reduces potential harmful effects in the main body of the drug delivery vehicle. The administered virus is substantially free of wild-type virus and replicable virus. The purity of the virus can be demonstrated by a suitable method, such as sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by silver staining, or HPLC.

[0182] Suitable dosages of AAV for use in humans are in the range of about 1×10 12 -1×10 14 vg / kg.

[0183] Gene therapy vectors can be administered by injection.

[0184] The present application also provides a host cell for packaging an adeno-associated virus containing the heavy and light chain genes of ligelizumab. Preferably, the host cell is a mammalian cell (preferably a human, more preferably a human 293T cell), and then the adeno-associated virus containing the heavy and light chain genes of ligelizumab is used to infect the cell or animal to express the ligelizumab antibody in vitro and in vivo.

[0185] In a preferred embodiment, this application provides an adeno-associated viral vector for gene therapy of allergic diseases. Experimental results show that the gene expression framework of this adeno-associated viral vector can achieve high-level expression of the target gene. This gene sequence construct can be used to treat allergic conditions such as allergic asthma and chronic spontaneous urticaria. The following are the cis-acting elements, replication origin, and polyadenylation signal used in this vector:

[0186] 1. The cis-acting element CBH (CMV Enhancer + chicken β-actin promoter + hybrid intron) is located upstream of the antibody gene sequence and is involved in regulating the expression of the antibody gene sequence. Experimental results show that this element can effectively enhance gene expression.

[0187] 2. SV40 polyadenylation signal. Polyadenylation is a mechanism that covalently links polyadenylic acid residues to messenger RNA (mRNA) molecules during protein biosynthesis. The polyadenylic acid tail (or poly A tail) protects mRNA from exonucleases and is crucial for transcription termination, nuclear export of mRNA, and subsequent translation.

[0188] 3.pBR322_origin is the replication region sequence of plasmid pBR322. In E. coli, plasmid replication starts from this site.

[0189] 4. Ligelizumab codon optimization. Codon optimization is an important step in optimizing gene expression, involving multiple aspects such as codon usage preference, rare codons, mRNA secondary structure, GC content distribution, and splicing sites.

[0190] The experimental data of this application show that the adeno-associated virus vector pAAV-CBH-ligelizumab can be used for efficient gene therapy of allergic diseases such as allergic asthma and chronic spontaneous urticaria.

[0191] Formulations and compositions

[0192] The present application provides a preparation or composition, which contains (a) the vector described in the second aspect of the present application or the adeno-associated virus vector described in the third aspect of the present application, and (b) a pharmaceutically acceptable carrier or excipient.

[0193] In another preferred embodiment, the pharmaceutical preparation is used to treat allergic diseases.

[0194] To facilitate clinical application, the pharmaceutical composition of the present application can be contained in an injection device (such as an injection needle), which can contain a single dose of the pharmaceutical composition. The injection device can be contained in a medicine box for easy storage and use. During transportation, the small container containing the drug suspension needs to be placed in dry ice. It should be stored in a -80°C refrigerator.

[0195] The medicine box or test kit described in the present application may also include instructions for use to facilitate those skilled in the art to use it in the correct manner.

[0196] The "active ingredient" in the pharmaceutical composition described in this application refers to the vector described in this application, such as a viral vector (including an adeno-associated viral vector). The "active ingredient", preparation and / or composition described in this application can be used to treat eye diseases. "Safe and effective amount" means: the amount of active ingredient is sufficient to significantly improve the condition or symptoms without causing serious side effects. "Pharmaceutically acceptable carrier or excipient" refers to: one or more compatible solid or liquid fillers or gel substances, which are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with the active ingredients of this application and with each other without significantly reducing the efficacy of the active ingredients.

[0197] The composition can be a liquid or solid, such as a powder, gel or paste. Preferably, the composition is a liquid, preferably an injectable liquid. Suitable excipients will be known to those skilled in the art.

[0198] In the present application, the carrier is provided as an injectable liquid. Preferably, the injectable liquid is provided as a capsule or a syringe.

[0199] Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as ), wetting agents (such as sodium lauryl sulfate), colorants, flavorings, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0200] The composition may comprise a physiologically acceptable sterile aqueous or anhydrous solution, dispersion, suspension or emulsion, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0201] The nucleic acid or fusion nucleic acid encoding the heavy chain and light chain of Ligelizumab (also known as Ligelizumab) provided in the present application can produce the heavy chain and light chain of Ligelizumab (also known as Ligelizumab) in vitro or in vivo, and the preparation containing the heavy chain and light chain of Ligelizumab (also known as Ligelizumab) can be used to prepare drugs for treating allergic diseases.

[0202] Treatment

[0203] The present application provides a method for treating an allergic disease, comprising introducing into the body a vector comprising a nucleic acid sequence encoding the heavy and light chains of Ligelizumab (also known as Ligelizumab). The method may comprise administering the nucleic acid vector into the body.

[0204] The present application provides a nucleic acid vector for use in a method for treating an allergic disease, comprising nucleic acid sequences encoding the heavy and light chains of ligelizumab (also known as ligalizumab). The composition of the present application can be administered alone or in combination with other therapeutic agents (e.g., formulated in the same pharmaceutical composition).

[0205] As used herein, treating a disease means administering a nucleic acid or vector as described herein to ameliorate or alleviate one or more symptoms of the disease.

[0206] The method of the present application comprises introducing nucleic acid sequences encoding the heavy and light chains of Ligelizumab (also known as Ligelizumab) into the body. Preferably, the method comprises contacting a cell with a vector (preferably a virus, more preferably an adeno-associated virus) comprising nucleic acid sequences encoding the heavy and light chains of Ligelizumab (also known as Ligelizumab). Preferably, the cell is an animal or a human. When the nucleic acid sequence is provided in multiple (two or more) doses, these doses may be separated by a suitable time interval, for example, 30 seconds to several hours or 1 day or more days.

[0207] Each dose may contain an effective amount of nucleic acid sequence or viral vector. The effective dose of nucleic acid sequence or viral vector may be in the range of 1×10 12 -1×10 14 vg / kg virus per treatment regimen.

[0208] Pharmaceutical composition and kit

[0209] As used herein, the term "comprising" is inclusive of "containing," "consisting essentially of," and "consisting of.

[0210] As used herein, the term "consisting essentially of..." means that the pharmaceutical composition, in addition to the effective active ingredients or auxiliary ingredients, may also contain minor ingredients and / or impurities that do not affect the effective ingredients.

[0211] To facilitate clinical application, the pharmaceutical composition of the present application can be contained in an injection device (such as an injection needle), which can contain a single dose of the pharmaceutical composition. The injection device can be contained in a medicine box for easy storage and use. During transportation, the small container containing the drug suspension needs to be placed in dry ice. It should be stored in a -80°C refrigerator.

[0212] The medicine box or test kit described in the present application may also include instructions for use to facilitate those skilled in the art to use it in the correct manner.

[0213] As used herein, the term "effective amount" or "effective dose" refers to an amount that can produce a function or activity on humans and / or animals and can be accepted by humans and / or animals.

[0214] The effective amount of the active ingredients described herein may vary depending on the mode of administration and the severity of the disease to be treated. The preferred effective amount can be determined by a person of ordinary skill in the art based on various factors (e.g., through clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated, the patient's weight, the patient's immune status, the route of administration, etc. For example, depending on the urgency of the treatment, several divided doses may be administered daily, or the dose may be reduced proportionally.

[0215] As used herein, a "pharmaceutically acceptable" ingredient is a substance that is suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity), ie, at a reasonable benefit / risk ratio.

[0216] The term "pharmaceutically acceptable carrier" refers to a carrier used for the administration of therapeutic agents, including various excipients and diluents, that is, a pharmaceutical carrier that is not necessarily an active ingredient and is not overly toxic after administration.

[0217] Suitable pharmaceutically acceptable carriers are well known to those skilled in the art. A comprehensive description of pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991). Pharmaceutically acceptable carriers in the composition may include liquids such as water, BBS (Balanced Salt Solution), Ringer's solution, physiological saline, balanced salt solution, glycerol, or sorbitol.

[0218] In addition, these carriers may also contain auxiliary substances, such as lubricants, glidants, wetting agents or emulsifiers, pH buffer substances and stabilizers.

[0219] In an embodiment of the present application, the pharmaceutical composition is in liquid dosage form; preferably an injection.

[0220] The pharmaceutical composition of the present application can be used alone or in combination for the treatment of allergic diseases. Such combination includes use with other drugs for treating allergic diseases. Such other drugs for treating allergic diseases include antihistamines, leukotriene receptor antagonists, β2-adrenergic receptor agonists, and glucocorticoids.

[0221] Furthermore, this application describes a gene therapy construct for allergic diseases based on a recombinant adeno-associated virus (rAAV) vector. The heavy and light chains of the IgE-neutralizing antibody ligelizumab are fused and expressed via F2A, forming a simple and efficient expression framework. Experimental results demonstrate that the expression framework achieves high expression efficiency after delivery via a rAAV vector.

[0222] The purpose of this application is to provide a nucleic acid construct for gene therapy of allergy-related diseases, so as to solve the problems in the prior art.

[0223] To achieve the above objectives, the present application provides a nucleic acid construct comprising nucleotides encoding Ligelizumab.

[0224] The present application also provides an adeno-associated virus vector system, which includes the nucleic acid construct and a helper plasmid.

[0225] The present application also provides an adeno-associated virus, which is formed by viral packaging of the nucleic acid construct.

[0226] The present application also provides a cell line, which is the cell line required for packaging the adeno-associated virus.

[0227] The present application also provides the use of the nucleic acid construct, adeno-associated virus, adeno-associated virus vector system, cell line, etc. in preparing products for preventing and treating asthma and other related allergic diseases.

[0228] As described above, the nucleic acid construct for gene therapy of allergic-related diseases disclosed herein has the following beneficial effects: This application creates a nucleic acid construct containing a ligelizumab expression framework that can be used to efficiently express active ligelizumab both in vivo and in vitro, providing therapeutic strategies for gene therapy of allergic diseases such as allergic asthma and chronic spontaneous urticaria. The construct disclosed herein can be delivered via viral or non-viral vectors and can be used for gene therapy of allergic asthma-related diseases.

[0229] In addition, the present application also prepared a nucleic acid construct, in which the heavy and light chains of the ligelizumab monoclonal antibody are connected in series via a cleavable 2A peptide and then subcloned into an rAAV expression vector. The construct includes, from 5' to 3', the following: the 5' inverted terminal repeat sequence (5'ITR) of AAV, a promoter, the heavy chain of the antibody (including a signal peptide), a short F2A peptide, the light chain of the antibody (including a signal peptide), WPRE, a polyadenylation signal (polyA), and the 3' inverted terminal repeat sequence (3'ITR) of AAV. Among them, the promoter can be CMV (GenBank: MN996867.1, 235-818), CBH (SEQ ID NO.: 1), EF1α (GenBank: KY447299.1, 529-1710), CAG (GenBank: KC152483.1, 200-1096), CAGG (GenBank: GU299216.1, 63-1664), CASI (GenBank: ON512571.1, 80-1104), desmin (GenBank: M63391.1, 2194-3233), TMCK (SEQ ID NO.: 12), MCK (SEQ ID NO.: 13), MHCK7 (SEQ ID NO.: 14), PGK (GenBank: JF313343.1, 683-1192), TTR (SEQ ID NO.:15). The signal peptide can be any one of SAP signal peptide (SEQ ID NO.:16), IHC signal peptide (SEQ ID NO.:17), ILC signal peptide (SEQ ID NO.:18), AP signal peptide (SEQ ID NO.:19), CSP signal peptide (SEQ ID NO.:20), IL2 signal peptide (SEQ ID NO.:21), TPA signal peptide (SEQ ID NO.:22), L1 signal peptide (SEQ ID NO.:23), and H7 signal peptide (SEQ ID NO.:24). The 2A peptide connecting the heavy chain and the light chain is any one of T2A, F2A, E2A, and P2A. The construct is co-transfected with two other AAV packaging plasmids, pAAV-RC and phelper, into 293T cells to obtain an infectious rAAV vector. After purification, the viral vector can be injected into the patient's body through muscle or vein to express Ligelizumab continuously for a long time. The expressed antibodies can neutralize the allergenic IgE in the patient's body, thereby treating allergic diseases such as allergic asthma and chronic spontaneous urticaria.The capsid used to package AAV in this application can be derived from any one of AAV1, AAV2, AAV3, AAV4, AAV7, AAV8, AAV9, AAVrh.10, AAVDJ / 8, and AAV6.2FF.

[0230] The specific implementation method is to construct an antibody molecule and clone it into an rAAV vector. In 293T cells, it is packaged into the corresponding adeno-associated virus, and the 293T cells and differentiated muscle cell lines are infected with a certain biological titer of virus. The antibody molecules produced in the cell supernatant are quantitatively and qualitatively detected, and ordinary BALB / c mice are injected intramuscularly with a certain biological titer of virus to detect the expression of Ligelizumab. Finally, the adeno-associated virus is injected intramuscularly into the IgE / FcεRI double humanized BALB / c asthma model mice to detect the proportion of eosinophils in the alveolar lavage fluid to the total white blood cells.

[0231] The main advantages of this application include:

[0232] (1) The present application provides for the first time an adeno-associated virus vector for gene therapy that can effectively treat allergic diseases. Specifically, the present application provides an expression cassette for gene therapy of allergic diseases, which can be used for gene therapy of allergic diseases such as chronic spontaneous urticaria and allergic asthma. The expression cassette is used to produce adeno-associated virus gene therapy vectors for gene therapy of the above-mentioned allergic diseases with higher efficiency and lower cost. Experimental results show that the gene expression framework of the adeno-associated virus vector of the present application can achieve high-level expression of the target gene, and can be used to treat allergic diseases such as allergic asthma and chronic spontaneous urticaria.

[0233] (2) The present application is for in vivo production of antibodies. The traditional treatment method is to use genetic engineering technology to recombinantly express anti-IgE antibodies in vitro, and then administer them by subcutaneous injection to neutralize the allergenic IgE in the body and control symptoms. However, the half-life of antibodies in the body is short, and they need to be injected once a month, which is expensive and inconvenient for patients. The present application constructs anti-IgE antibody molecules into rAAV vectors, and then packages them into infectious rAAV in vitro, and delivers them to the patient's body, so that they can produce IgE antibodies in the body for a long time, achieving a one-time administration and long-term effective effect.

[0234] (3) The present application is a muscle tissue-specific expression vector. The viral vector packaged by the construct of the present application can be targeted for expression in muscle. Since the rAAV viral vector does not integrate into the genome in cells but exists in the form of free bodies, it is very easy to lose the rAAV viral vector for cells with fast differentiation or vigorous division, thereby losing the corresponding function. Muscle cells almost do not differentiate throughout their lives. This characteristic is very suitable for the long-term continuous expression of rAAV gene therapy vectors, thereby exerting long-term therapeutic functions.

[0235] (4) This application describes a nucleic acid construct containing a ligelizumab expression framework that can be used to efficiently express active ligelizumab both in vitro and in vivo, providing a therapeutic strategy for gene therapy of allergic diseases such as allergic asthma and chronic spontaneous urticaria. The construct of this application can be delivered via viral or non-viral vectors and can be used for gene therapy of allergic asthma-related diseases.

[0236] (5) This application optimizes the amino acid expression frame of ligelizumab according to the principles of human codon usage preference, mRNA secondary structure, appropriate GC content (avoiding excessive GC content), avoiding various cis elements involved in the transcription and translation process, avoiding the appearance of rare codons, and splicing sites, thereby greatly improving the expression level and stability of the target protein.

[0237] The present application will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present application only and are not intended to limit the scope of the present application. The experimental methods in the following examples, for which specific conditions are not specified, are generally based on conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are percentages by weight and parts by weight.

[0238] Unless otherwise specified, the materials and reagents in this application specification are commercially available products.

[0239] Example 1 Construction of rAAV8-Ligelizumab Vector (Detailed description of the construction process of the vector, taking the structure of Figure 3 as an example)

[0240] The entire construction process is as follows:

[0241] 1. GenScript's synthetic IgE neutralizing antibody Ligelizumab

[0242] Ligelizumab structure: From the N-terminus to the C-terminus of the protein molecule, it consists of: heavy chain signal peptide (using the TPA signal peptide as an example, sequence: MDAMKRGLCCVLLLCGAVFVSP SEQ ID NO.: 22) - antibody heavy chain (HC) molecule (using Ligelizumab HC as an example) - Furin cleavage site - F2A self-cleavage 2A sequence - light chain signal peptide (using the L1 signal peptide, sequence: MDMRVPAQLLGLLLLWLSGARC SEQ ID NO.: 23) - antibody light chain (LC) molecule (using Ligelizumab LC as an example) (see Figure 6). The heavy chain (HC) and light chain (LC) molecules shown in the sequence carry their own signal peptide sequences, and the Furin cleavage site and self-cleavage 2A sequence connect the heavy chain (SEQ ID NO. 2) and light chain (Sequence ID No.: 4) of the antibody molecule. The coding sequences of the antibody light and heavy chains are codon-optimized sequences.

[0243] 2. After the plasmid containing the ligelizumab gene (ligelizumab-pUC57) and bacterial solution arrive, resuscitate the bacterial solution containing the plasmid in 5 ml of culture medium containing the corresponding antibiotics and culture at 37°C, 200 rpm, shaking overnight.

[0244] 3. Extract the plasmid ligelizumab-pUC57. Plasmid electrophoresis (Marker: 1 kb DNA Ladder) is shown in Figure 1.

[0245] 4. Enzyme digestion of target gene fragment and vector fragment.

[0246] 1) Obtaining the target gene. Ligelizumab-pUC57 was triple-digested with AgeI, SalI, and ScaI to obtain the intact ligelizumab structure. The fragments after digestion should be 2.2 kb, 0.9 kb, and 1.8 kb. The 2.2 kb fragment was recovered. The enzyme-digested electrophoresis (marker: 1 kb DNA ladder) is shown in Figure 2.

[0247] 2) Obtaining the Vector. The plasmid pAAV-CBH-MCS (structure shown in Figure 5) was double-digested with AgeI and SalI. The size of the digested bands should be 3.9 kb and 0.9 kb. Recover the 3.9 kb fragment.

[0248] pAAV-CBH-MCS nucleotide sequence:

[0249] Enzyme digestion electrophoresis (Marker: 1 kb DNA Ladder) is shown in Figure 3.

[0250] 5. The target gene fragment and the vector part were ligated using Solution I, and then heat-shocked and transformed into DH5α medium, and cultured at 37°C overnight.

[0251] 6. Pick a single colony for PCR verification.

[0252] Pick a single colony from the transformed plate and add it to 400 μl of LB medium containing the corresponding antibiotics, and culture it at 37°C with shaking at 200 rpm for 2 h.

[0253] Use the following two primers, shake culture 2 hours after the bacterial liquid as a template, and use Mix for PCR verification.

[0254] Upstream primer: ZY005-VL-F (5'→3': GGATAGCAAGGACAGCACATACTC)

[0255] Downstream primer: pBR322-R (5'→3':GTGAGCTATGAGAAAGCGCC)

[0256] The band size after PCR should be 736 bp.

[0257] PCR electrophoresis (Marker: DL2000 DNA Marker) is shown in FIG4 .

[0258] 7. The bacterial solution containing the plasmid with the correct band size was sent for sequencing. The sequencing results showed that the plasmid was successfully constructed (see Figures 7A and 7B).

[0259] The target gene sequence in the above vectors can be translated as a complete precursor molecule in cells. Enzymatic cleavage at the autolytic 2A sequence and Furin cleavage site occurs in the cytoplasm, producing highly precise heavy and light chain molecules. These heavy and light chains are then secreted out of the cell and assembled into a fully functional monoclonal antibody molecule in the cell supernatant.

[0260] Furthermore, the present application found that similar effects could be achieved by replacing the self-cleavage 2A sequence and the Furin cleavage site with IRES.

[0261] Example 2: Packaging and purification of adeno-associated virus expressing Ligelizumab

[0262] The antibody gene AAV vector (pAAV-CBH-Ligelizumab) constructed in Example 1, the envelope plasmid AAV8, whose nucleotide sequence is shown in SEQ ID NO: 25) and the auxiliary plasmid (pHelper, whose nucleotide sequence is shown in SEQ ID NO: 26) were mixed and co-transfected into 293T cells, and the AAV vector was packaged in the 293T cell line. The transfection method was PEI cationic polymer-mediated transient transfection of eukaryotic cells. The transfection operation was carried out with reference to the manufacturer's recommended standardized operation, and the transfection scale was 15 cm cell culture dish. 7 hours after transfection, the supernatant was discarded and replaced with 25 ml of toxin-producing medium. Five days after the transfection was completed, the supernatant and cells were collected and centrifuged at 4200 rpm / min for 10 minutes. After centrifugation, the supernatant and cells were separated, lysate and ribozyme were added to the cells, lysed and digested for 1 hour, and centrifuged at 10000 g / min for 10 minutes to obtain the lysate supernatant. The lysate supernatant and the culture medium supernatant were purified by affinity chromatography and then aliquoted and frozen at -80 ° C for use.

[0263] Example 3: Expression detection after pAAV-CBH-Ligelizumab infected cells

[0264] The packaged AAV was used to infect 293T cells. The culture supernatant of AAV-infected cells was subjected to SDS-PAGE electrophoresis, and the expressed antibody was transferred to a PVDF membrane. Western blotting was performed using an HRP-labeled goat anti-human IgG Fc antibody as a secondary antibody. The experimental results (see Figure 8) showed that AAV-transduced cells efficiently expressed ligelizumab in vitro and secreted the mature ligelizumab antibody protein into the cell culture supernatant.

[0265] Example 4: Functional Verification of rAAV-Expressed Ligelizumab

[0266] Western Blot verification of the binding of Ligelizumab to IgE

[0267] ① Dilute the purchased omalizumab (42.1 μg / μl) to 1 μg / μl

[0268] ② Dilute the purchased human IgE protein (1μg / μl) to 20ng / μl

[0269] ③ Remove Protein G Agarose, mix thoroughly, and pipette 100 μl into three 1.5 ml centrifuge tubes. Wash three times with Binding Buffer (pH 5.0) (by gravity sedimentation, then carefully discard the supernatant).

[0270] Then, IgE, omalizumab, purified ligelizumab, and PBS were added according to Table 1 below, and 60 μl of Binding Buffer was added to each cell, and binding was carried out at room temperature.

[0271] Mix gently every 0.5 h, and then allow Protein G Agarose to bind by gravity for a total of 2 h.

[0272] Table 1: Sample addition data

[0273] After 2 hours, the sample was loaded. The loading volume was 20 μl (if IgE was not bound, it was equivalent to adding 20 ng of IgE. The volume of the medium was negligible.)

[0274] ④ Block with 5% skim milk and wash three times

[0275] ⑤ Add mouse anti-human IgE (Fc) secondary antibody for incubation and wash three times

[0276] ⑥Exposure.

[0277] The experimental results (see Figure 9) show that the purified Ligelizumab has the same effect as the purchased omalizumab, both can bind to human IgE, and can be used as a standard in subsequent experiments.

[0278] 3. Expression of pAAV-CBH-ligelizumab in mouse muscle cells C2C12.

[0279] The packaged pAAV-CBH-ligelizumab virus was used to infect C2C12 cells at different MOIs. The virus-infected supernatant was collected and purified ligelizumab was used as a standard to detect the ligelizumab content in the C2C12 supernatant.

[0280] The specific steps are as follows:

[0281] Commercially available human IgE was used to coat the ELISA plate, and expression supernatant and purified ligelizumab standard were used as primary antibodies. HRP-conjugated goat anti-human IgG Fc was used as the secondary antibody. TMB was used for color development, and the OD value at 450 nm was measured on a microplate reader. The experimental results (Table 2) showed that pAAV-CBH-ligelizumab virus effectively expressed neutralizing anti-human IgE antibodies after in vitro transduction of C2C12 cells, and the mature ligelizumab antibody protein was secreted into the cell culture supernatant.

[0282] Table 2: Expression levels of Ligelizumab after infection of cells at different MOIs

[0283] Example 5: Expression of pAAV-CBH-ligelizumab viral vector in normal BALB / c mice

[0284] BALB / c mice were administered the pAAV-CBH-ligelizumab viral vector (EG) and the saline group (NG) via intramuscular injection. Blood was collected from the mouse orbits weekly to obtain serum. Ligelizumab expression in the serum was assayed using an ELISA. The results (see Figure 10, Table 3) showed that in vivo, the pAAV-CBH-ligelizumab virus was able to express ligelizumab in mice, with expression levels significantly higher than those in the saline group.

[0285] Table 3: Ligelizumab antibody concentrations in serum of normal BALB / c mice

[0286] Example 6: Therapeutic Effect of pAAV-CBH-ligelizumab Viral Vector on Asthma Model Animals

[0287] The pAAV-CBH-ligelizumab viral vector was injected intramuscularly into IgE / FcεRI dual-humanized BALB / c mice 7 days before the initial induction of the model (Day-7). Three days before induction (Day-3), 150 μL of whole blood was collected from the humanized mice, and serum was separated. After three sensitization cycles (intraperitoneal injection of OVA and aluminum hydroxide gel suspension) and seven challenges (OVA aerosol challenge) to induce the asthma model, the mice were sacrificed on Day 28. Serum and bronchoalveolar lavage fluid were collected and assayed for IL-4, IL-5, IL-13, OVA-specific IgE, and total IgE. In addition, white blood cells and eosinophils in the bronchoalveolar lavage fluid were counted.

[0288] The specific plan is shown in Table 4:

[0289] Table 4: Main research agenda

[0290] The animals were randomly divided into 3 groups and administered according to Table 5:

[0291] Table 5: Animal grouping and drug administration

[0292] The experimental results (see Figure 11 and Figure 12) showed that after administration, the number of eosinophils and total leukocytes in the alveolar lavage fluid of mice was significantly reduced, the secretion of Th2 cytokines was reduced, and the asthma symptoms were alleviated.

[0293] Based on the above embodiments, the present application fuses the heavy chain and light chain of the neutralizing antibody Ligelizumab against human IgE through F2A to form a simple and efficient expression framework. The experimental results show that the pAAV-CBH-ligelizumab viral vector can be efficiently expressed in cells or mice, and its product can bind to human IgE. In vivo experiments showed that the pAAV-CBH-ligelizumab viral vector showed effective blood drug concentrations in model mice, and also showed a positive effect of reducing the number of eosinophils and the secretion of Th2 cytokines in animals.

[0294] Example 7 Construction of pKL-lenti-kan-CBH-ligelizumab vector

[0295] The synthetic IgE neutralizing antibody ligelizumab expression cassette gene sequence was amplified by PCR using the plasmid ligelizumab-pUC57 as a template and ligated via homologous recombination between the MluI and EcoRV residues of the lentiviral vector pKL-lenti-kan-CBH-WPRE (Figure 13), synthesized by Kanglin Bio. After completion and sequencing confirmation, the construct was named pKL-lenti-kan-CBH-ligelizumab (Figure 14).

[0296] Example 8 Lentivirus pKL-lenti-kan-CBH-ligelizumab packaging, purification, and titer detection

[0297] The ligelizumab gene lentiviral expression vector pKL-lenti-kan-CBH-ligelizumab, the envelope plasmid (Vsvg), and the packaging plasmids (Rev, GagPol) constructed in Example 7 were co-transfected into 293T cells (purchased from the American Type Culture Collection (ATCC), with the accession number CRL-3216). The coagulation factor VIII gene therapy lentiviral vector was packaged in this 293T cell line. The transfection method was PEI cationic polymer-mediated transient transfection of eukaryotic cells. The PEI cationic polymer was PEI-Max transfection reagent purchased from Polysciences (Cat. No. 24765-1). The transfection procedure was performed according to the manufacturer's recommended standardized procedures. The transfection scale was 10 cm2 cell culture dishes.

[0298] 48 hours after transfection, the lentiviral vector (transfected cell culture supernatant) was harvested. Cell debris was removed by centrifugation at 4000 rpm for 5 minutes on a benchtop swing-bucket centrifuge. Viral particles were then precipitated by centrifugation at 10,000 g for 4 hours at 4°C. After removal of the supernatant, 1 ml of DMEM complete medium was added to the viral pellet. The viral particles were resuspended using a microinjector and the prepared viral resuspension was aliquoted and frozen at -80°C for later use.

[0299] Different volumes of lentiviral vector were inoculated into the MT4 cell line (purchased from Shanghai Suer Biotechnology Co., Ltd.), a human CD4+ T cell line pre-plated in a 96-well cell culture plate. The cell culture supernatant was infected with the reporter gene lentiviral vector EGFP (lentiviral vector packaged with pCCL-sin-pGK-EGFP according to the above method) as a positive control. The infection titer of the initial lentiviral vector harvest was calculated by quantitative PCR and flow cytometry data based on the GFP signal using methods well known in the art. The primer and probe sequences used for quantitative PCR are:

[0300] LTR-For primer:CTGTTGTGTGACTCTGGTAACT(SEQ ID NO:27)

[0301] LTR probe: 5'-AAATCTCTAGCAGTGGCGCCCG-3'(SEQ ID NO:28)

[0302] LTR-Rev primer: TTCGCTTTCAAGTCCCTGTT (SEQ ID NO: 29)

[0303] HK Forward primer5'-GCTGTCATCTCTTGTGGGCTGT-3'(SEQ ID NO:30)

[0304] HK probe5'-CCGTTCATGCCCACACAAATCTCTCC-3'(SEQ ID NO:31)

[0305] HK Reverse primer5'-ACTCATGGGAGCTGCTGGTTC-3'(SEQ ID NO:32)

[0306] The LTR probe has a 6FAM fluorescent group at the 5' end and an MGB fluorescent group at the 3' end;

[0307] The HK probe has a CY5 fluorescent group at the 5' end and a BHQ2 fluorescent group at the 3' end.

[0308] The titer of lentivirus pKL-lenti-kan-CBH-ligelizumab was tested to be 1.09E+09TU / mL.

[0309] Example 9 Lentivirus pKL-lenti-kan-CBH-ligelizumab transduction cell expression detection

[0310] The lentivirus pKL-lenti-kan-CBH-ligelizumab was transduced into suspended 293T cells at a certain MOI (5). After 72 hours of culture, the supernatant was collected and the protein was purified using Protein A medium. After elution, the protein was concentrated. After concentration, the solution was replaced with PBS so that the solvent was basically replaced with PBS. The concentration was then measured using a BCA kit and adjusted to 250ug / ml. The cells were aliquoted and frozen in a -80 refrigerator for later use. After purification, SDS-PAGE analysis was performed. The results are shown in Figure 15. The results of Figure 15 indicate that the lentiviral vector can express ligelizumab in large quantities.

[0311] Example 10 Comparison of different 2A peptides in lentiviral vectors

[0312] The heavy and light chains of the pKL-lenti-kan-CBH-ligelizumab vector were connected by the Furin cleavage site and the F2A (SEQ ID NO: 33) self-cleavage peptide sequence. We also tested the effects of T2A (SEQ ID NO: 34), E2A (SEQ ID NO: 35), and P2A (SEQ ID NO: 36) as self-cleavage peptides on ligelizumab expression.

[0313] F2A: VKQTLNFDLLKLAGDVESNPGP(SEQ ID NO:33)

[0314] T2A:EGRGSLLTCGDVEENPGP(SEQ ID NO:34)

[0315] E2A:QCTNYALLKLAGDVESNPGP(SEQ ID NO:35)

[0316] P2A:ATNFSLLKQAGDVEENPGP(SEQ ID NO:36)

[0317] By universal homologous recombination, F2A in pKL-lenti-kan-CBH-ligelizumab was replaced with T2A, E2A, and P2A, respectively. After construction, the vectors were named pKL-lenti-kan-CBH-ligelizumab-T2A, pKL-lenti-kan-CBH-ligelizumab-E2A, and pKL-lenti-kan-CBH-ligelizumab-P2A, respectively. Lentivirus pKL-lenti-kan-CBH-ligelizumab, lentivirus pKL-lenti-kan-CBH-ligelizumab-T2A, pKL-lenti-kan-CBH-ligelizumab-E2A, and pKL-lenti-kan-CBH-ligelizumab-P2A were packaged using the method described in Example 8.

[0318] The four viruses were inoculated into 293T cells (24-well plates, 1.0E+5 cells / well). Each virus was transduced in four gradients: 10μl, 20μl, 40μl, 60μl, 80μl, and 100μl. The supernatant and cells were harvested after 72 hours. The cells were lysed, and the vector copy number (VCN) of the lentivirus infected 293T cells was calculated using quantitative PCR data using methods well known in the art. Transduction supernatants with a consistent VCN (approximately 4) were selected for ELISA testing (see Example 4 for specific detection methods). The results are shown in Table 6. F2A and T2A were consistent in their efficacy, followed by E2A, and P2A was the worst.

[0319] Table 6: Comparison of expression of ligelizumab expression cassette by different self-cleaving 2A peptides

[0320] Partial sequence information

[0321] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of this application, those skilled in the art may make various changes or modifications to this application, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. An expression cassette, characterized in that The expression cassette comprises the following elements: a promoter, an optional first signal peptide coding sequence, an anti-IgE antibody heavy chain coding sequence, an optional linker sequence, an optional second signal peptide coding sequence, and an anti-IgE antibody light chain coding sequence.

2. The expression cassette according to claim 1, characterized in that The linker includes one or more selected from the following group: a self-cleavage linker, a Furin cleavage site, and an IRES linker.

3. The expression cassette according to claim 1, characterized in that The anti-IgE antibody is selected from the group consisting of Ligelizumab, Omalizumab, or a combination thereof.

4. The expression cassette according to claim 1, characterized in that The expression cassette has a structure shown in Formula I from the 5' end to the 3' end: Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8-Z9 (Formula I) Wherein, each "-" is independently a bond or a nucleotide linking sequence; Z1 is the promoter; Z2 is an optional first signal peptide coding sequence; Z3 is the heavy chain coding sequence of the anti-IgE antibody; Z4 is the Furin cleavage site; Z5 is the coding sequence of the self-cleaving linker; Z6 is an optional second signal peptide coding sequence; and Z7 is the light chain coding sequence of the IgE antibody; Z8 is an optional woodchuck hepatitis virus regulatory element WPRE element; Z9 is an optional polyadenylation signal (polyA).

5. The expression cassette according to claim 1, characterized in that The expression cassette has a structure shown in Formula II from the 5' end to the 3' end: Z1-Z2-Z3-Z4'-Z6-Z7-Z8-Z9 (Formula I) Wherein, Z1, Z2, Z3, Z6, Z7, Z8, and Z9 are defined as above, and Z4' is an IRES element; Each "-" is independently a bond or a nucleotide linking sequence. In another preferred embodiment, the nucleotide sequence of the expression cassette is selected from the following group: (a) the nucleotide sequence shown in SEQ ID NO:7; (b) a nucleotide sequence having a sequence identity of ≥95% (preferably ≥98%, more preferably ≥99%) to the nucleotide sequence shown in SEQ ID NO: 7; and (c) a nucleotide sequence complementary to the nucleotide sequence described in (a) or (b).

6. A carrier, characterized in that The vector contains the expression cassette according to claim 1.

7. The vector according to claim 6, characterized in that The vector is an adeno-associated virus AAV vector.

8. An adeno-associated virus vector, characterized in that: The adeno-associated virus vector contains the expression cassette of claim 1.

9. A host cell, characterized in that Contains the vector according to claim 6 or the adeno-associated virus vector according to claim 8, or an exogenous expression cassette according to claim 1 integrated into its chromosome.

10. Use of the vector according to claim 6, the adeno-associated virus vector according to claim 8, or the host cell according to claim 9, characterized in that: Used for preparing a preparation or composition for treating allergic diseases.

11. The use according to claim 10, characterized in that The allergic disease is selected from the group consisting of allergic asthma, chronic spontaneous urticaria, or a combination thereof.

12. A pharmaceutical preparation, characterized in that The preparation contains (a) the vector according to claim 6 or the adeno-associated virus vector according to claim 8 or the host cell according to claim 9, and (b) a pharmaceutically acceptable carrier or excipient.

13. A method for preparing a recombinant adeno-associated virus vector, characterized in that: The method comprises culturing the host cell according to claim 9, thereby obtaining the recombinant adeno-associated virus vector.

14. A medicine box, characterized in that: include: (i) a first container, and an active ingredient (a) in the first container, wherein the active ingredient (a) is the vector according to claim 6, the adeno-associated virus vector according to claim 8, the host cell according to claim 9, or the pharmaceutical preparation according to claim 12; (ii) an optional second container, and an active ingredient (b) in the second container, wherein the active ingredient (b) is other drugs for treating allergic diseases or their active ingredients.

Images