Composition for prevention or treatment of periodontal diseases

Abstract

The present invention relates to a composition for the prevention or treatment of inflammatory diseases, particularly inflammatory periodontal diseases, the composition comprising a steroid sulfatase inhibitor as an active ingredient. The compound of the present invention has the effect of regenerating periodontal tissues by inhibiting inflammatory responses due to periodontal diseases and, at the same time, effectively inhibiting the destruction of inflammatory periodontal tissues, and thus can be usefully administered for the treatment of periodontal diseases.

Description

Composition for the prevention or treatment of periodontal disease

[0001] The present invention relates to a functional composition for preventing, improving or treating periodontal disease.

[0002] Periodontal disease (PD) is an infectious oral disease that causes inflammation of the periodontal tissues, which consist of the root cementum, alveolar bone matrix, and periodontal ligament. It is an inflammatory disease accompanied by destruction of the periodontal tissues. This inflammatory response leads to edema, leukocyte infiltration, and the release of inflammatory mediators, which in turn lead to periodontal pocket formation, connective tissue detachment, and alveolar bone resorption, ultimately resulting in tooth loss. Periodontitis progressively destroys the periodontal supporting tissues, leading to tooth loss, impaired masticatory function, and a decline in aesthetic appearance. It is also a major cause of implant failure. Periodontal disease, which leads to tooth loss, is particularly characterized by localized bone resorption.

[0003] Treatment of periodontal disease involves removing dental plaque, the main cause, using antibacterial agents, and systemically utilizing several candidate substances, including statins, probiotics, monoclonal antibodies targeting the receptor activator of nuclear factor kappa-B ligand, or bisphosphonates, to control periodontal inflammation. However, these have proven insufficient for clinical application (Balta, Papathanasiou, Blix, & Van Dyke, 2021), and bisphosphonates, in particular, have been found to cause osteonecrosis (Otomo-Corgel, 2012). While many treatments have been developed to soothe inflammatory symptoms caused by periodontal disease, such as bleeding / abscesses and gum redness / swelling, research on periodontal disease treatments that function to regenerate the underlying inflammation and tissue destruction caused by it is lacking.

[0004] The present inventors, having made great efforts to find a substance that effectively suppresses the progression of inflammation caused by periodontal disease and regenerates already destroyed periodontal tissue, have discovered a new substance that treats the underlying inflammation caused by periodontal disease and simultaneously regenerates periodontal tissue destroyed by periodontal disease, leading to the present invention.

[0005] One object of the present invention is to provide a composition that can effectively prevent, improve or treat periodontal disease.

[0006] Another object of the present invention is to provide a composition that effectively promotes the regeneration of periodontal tissue destroyed by periodontal disease or the attachment of periodontal ligaments to teeth.

[0007] Another object of the present invention is to provide a composition that effectively promotes implant osseointegration.

[0008]

[0009] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.

[0010] According to one embodiment of the present invention, the present invention relates to a composition for preventing, improving or treating an inflammatory disease, comprising a steroid sulfatase inhibitor as an active ingredient.

[0011] In the present invention, the "steroid sulfatase" regulates the local production of estrogens and androgens from precursors in some tissues. This enzyme catalyzes the hydrolysis of the sulfate ester group of 3-hydroxy steroids corresponding to the precursor form. In the present invention, the "steroid sulfatase inhibitor" blocks the local production of estrogens and androgens.

[0012] In the present invention, the steroid sulfatase inhibitor may be at least one selected from the group consisting of irosustat, 2-(hydroxyphenyl) indole sulfate, 5-androstene-3,17-diol-3 sulfate, estrone-3-O-methylthiophosphonate (E1-3-MTP), estrone-3-O-sulfamate (EMATE), 4-methylcoumarin 7-O-sulfamate (COUMATE), KW-2581, STX213, morpholino, and salts, hydrates, or solvates thereof, but specifically, irosustat However, it is not limited to these.

[0013] In the present invention, the irosustat may be represented by the structure of the following chemical formula 1, the compound name may be (6-oxo-8,9,10,11-tetrahydro-7H-cyclohepta[c]chromen-3-yl) sulfamate, and the CAS number may be 288628-05-7.

[0014] [Chemical Formula 1]

[0015]

[0016] The present invention may include a pharmaceutically acceptable salt form of a steroid sulfatase inhibitor, preferably irosustat. A pharmaceutically acceptable salt should have low toxicity to the human body and should not adversely affect the biological activity and physicochemical properties of the parent compound. The pharmaceutically acceptable salt may include, but is not limited to, an acid addition salt of a pharmaceutically acceptable free acid and the steroid sulfatase inhibitor, preferably irosustat.

[0017] Preferred salt forms of the compound according to the present invention include salts with inorganic acids or organic acids. In this case, inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, perchloric acid, and hydrobromic acid can be used. In addition, organic acids such as acetic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, fumaric acid, maleic acid, malonic acid, phthalic acid, succinic acid, lactic acid, citric acid, citric acid, gluconic acid, tartaric acid, salicylic acid, malic acid, oxalic acid, benzoic acid, embonic acid, aspartic acid, and glutamic acid can be used. Organic bases that can be used for preparing organic base addition salts include tris(hydroxymethyl)methylamine and dicyclohexylamine. Amino acids that can be used for preparing amino acid addition salts include natural amino acids such as alanine and glycine. It will be apparent to those skilled in the art that other acids or bases may be used in addition to the inorganic acids, organic acids, organic bases and amino acids exemplified above.

[0018] In the present invention, the salt form can be prepared by a conventional method. For example, the above-mentioned steroid sulfatase inhibitor, preferably irosustat, can be prepared by dissolving it in a water-miscible solvent such as methanol, ethanol, acetone, or 1,4-dioxane, adding a free acid or free base, and then crystallizing the resulting solution.

[0019] Meanwhile, the compounds according to the present invention may also be included in the scope of the present invention in the form of a hydrate or solvate of a steroid sulfatase inhibitor, preferably irosustat.

[0020] In the present invention, the term "inflammatory disease" refers to a disease in which an internal normal cell or tissue of an organism is damaged by an inflammatory reaction, and encompasses a disease in which an inflammatory reaction, such as the infiltration of inflammatory cytokines or inflammatory cells, is excessively activated as a response to tissue damage or pathogen infection. As shown in the examples described below, it was confirmed that the composition of the present invention effectively improves the inflammatory reaction by significantly reducing the number of inflamed areas and inflammatory cells in the tissue.

[0021] In the present invention, the inflammatory disease may be at least one selected from the group consisting of periodontal disease, rheumatoid arthritis, reactive arthritis, multiple sclerosis, idiopathic fibrosing alveolitis, polymyositis, dermatomyositis, localized scleroderma, systemic scleroderma, colitis, inflammatory bowel disease, cystitis, vasculitis, primary biliary sclerosis, primary sclerosing cholangitis, ulcerative colitis, Crohn's disease, atopic dermatitis, and inflammatory brain disease, and may be specifically periodontal disease, but is not limited thereto.

[0022] In the present invention, the above "periodontal disease" refers to an inflammatory disease accompanied by destruction of periodontal tissue due to a mixed infection of bacteria, and exhibits various clinical symptoms such as gingival bleeding and swelling, formation of periodontal pockets, loss of attached gingiva, destruction of alveolar bone, and bad breath. It is a chronic inflammatory disease characterized by destruction of connective tissue and cementum supporting teeth, bone resorption, leukocyte infiltration, and formation of periodontal pockets. When periodontal disease is limited to the gums, it is called gingivitis, and when such inflammation progresses to the gums and the surrounding alveolar bone, it is called periodontitis. As periodontitis progresses, it damages the periodontal ligament and further the alveolar bone. An example of alveolar bone damage is alveolar bone osteodystrophy, which is further subdivided into alveolar bone osteoporosis, alveolar bone osteomalacia, and alveolar bone osteopenia. Damage to the alveolar bone ultimately leads to tooth loss.

[0023] In the present invention, the periodontal disease may be at least one disease selected from the group consisting of gingivitis; periodontitis; and diseases caused by destruction of periodontal tissue due to gingivitis or periodontitis, but is not limited thereto.

[0024] In the present invention, the above "periodontal tissue" refers to four types of tissues surrounding the teeth: gingiva, cementum, periodontal ligament, and alveolar bone, and refers to tissues that physically support the teeth, sense the movement of the teeth, and supply necessary blood flow to the teeth. Structurally, teeth are supported by the alveolar bone, which is the hardest hard tissue in the human body. The alveolar bone is firmly attached to the basal bone of the maxilla, and the 2-3 mm portion immediately adjacent to the tooth root is sometimes referred to as the periodontal bone, but generally, the alveolar bone refers to all hard tissues including the periodontal bone. The alveolar bone in the oral cavity attaches and supports the teeth by a layer of undifferentiated mesenchymal cells called the periodontal ligament, which has an average thickness of about 0.2 mm, and distributes force to the alveolar bone so that the teeth can act as a buffer when masticating food, and also transmits the sensation of the teeth to the alveolar bone through the periodontal ligament. The periodontal ligament, a layer of undifferentiated mesenchymal cells, is structured to adapt to pressure while continuously remodeling bone without losing the structure and function of the entire fiber. Undifferentiated mesenchymal cells within the periodontal ligament migrate toward adjacent tissues, moving toward the alveolar bone to remodel it. On the other hand, they migrate toward the tooth, producing collagen fibers that continuously remodel the bone to further strengthen the tooth's hold.

[0025] In the present invention, the periodontal tissue may be at least one tissue selected from the group consisting of gingiva, cementum, periodontal ligament (PDL), and alveolar bone, but is not limited thereto.

[0026] In the present invention, the disease caused by destruction of periodontal tissue due to gingivitis or periodontitis may be at least one selected from the group consisting of destruction of gingival fiber attachment, destruction of periodontal ligament attachment, formation of periodontal pocket due to apical migration of gingival junctional epithelium, alveolar bone breakage, alveolar bone osteodystrophy, alveolar bone osteoporosis, alveolarbone osteomalacia, alveolar bone osteopenia, gingival swelling, gingival bleeding, gingival itching, gingival redness, and gingival pain, but is not limited thereto.

[0027] In the present invention, the term “prevention” means suppressing the occurrence of a disease or condition in a subject who has not been diagnosed as having the disease or condition but is susceptible to such disease or condition.

[0028] The above "improvement" of the present invention means any act of improving or beneficially changing a disease or symptom state, and for the purpose of the present invention, the composition means improving the symptoms of inflammatory periodontal disease.

[0029] The "treatment" of the present invention means (a) suppressing the development of a disease, condition, or symptom; (b) alleviating the disease, condition, or symptom; or (c) eliminating the disease, condition, or symptom. For the purposes of the present invention, "treatment" serves to suppress the development of symptoms caused by excessive or unwanted immune responses or inflammation, eliminating them, or alleviating them by suppressing the expression of inflammatory cytokines. Therefore, the composition of the present invention may be a composition for treating these diseases on its own, or may be administered together with other pharmacological ingredients having an anti-inflammatory effect and used as a therapeutic adjuvant for the diseases. Accordingly, "treatment" or "therapeutic agent" in the present invention may include the meaning of "therapeutic adjuvant" or "therapeutic adjuvant."

[0030] The composition of the present invention can be used as a pharmaceutical composition or a food composition, and its form is not particularly limited.

[0031] The pharmaceutical composition of the present invention may be characterized as being in the form of a capsule, tablet, granule, injection, ointment, powder or beverage, and the pharmaceutical composition may be characterized as being intended for humans.

[0032] The pharmaceutical composition of the present invention is not limited thereto, but may be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, etc., external preparations, suppositories, and sterile injection solutions, each according to a conventional method. The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a coloring agent, a fragrance, etc. for oral administration, and may include a mixture of a buffer, a preservative, an analgesic, a solubilizer, an isotonic agent, a stabilizer, and a stabilizer for injection, and may include a base, an excipient, a lubricant, a preservative, etc. for topical administration.

[0033] The pharmaceutical composition of the present invention can be prepared in various forms by mixing it with a pharmaceutically acceptable carrier as described above. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injections, it can be prepared in the form of unit dose ampoules or multiple doses. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained-release preparation, etc.

[0034] Examples of carriers, excipients, and diluents suitable for the formulation of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, or mineral oil. In addition, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, and the like may be additionally included.

[0035] The routes of administration of the pharmaceutical composition of the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Oral or parenteral administration is preferred. In the present invention, the "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. In addition, the pharmaceutical composition may be administered in the form of a suppository for rectal administration.

[0036] The pharmaceutical composition of the present invention may vary depending on various factors including the activity of the specific compound used, age, body weight, general health, sex, dosage form, administration time, administration route, excretion rate, drug combination, and severity of the specific disease to be prevented or treated, and the dosage of the pharmaceutical composition may vary depending on the patient's condition, body weight, degree of disease, form of medicine, administration route, and period, but may be appropriately selected by those skilled in the art, and may be administered at 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg per day. The administration may be administered once a day or divided into several times. The dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as a pill, a dragee, a capsule, a liquid, a gel, a syrup, a slurry, or a suspension.

[0037] In the present invention, “administration” means directly administering a therapeutically effective amount of the composition of the present invention to a subject so that the same amount is formed in the body of the subject.

[0038] In the present invention, the subject includes, without limitation, a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, monkey, chimpanzee, baboon, or rhesus macaque. Specifically, the subject of the present invention may be a human, but is not limited thereto.

[0039] In the present invention, the term "therapeutically effective amount" means the content of a composition containing a pharmacological ingredient in the composition sufficient to provide a therapeutic or preventive effect to a subject to whom the pharmaceutical composition of the present invention is to be administered, and includes a "prophylactically effective amount."

[0040] The food composition of the present invention can be manufactured in the form of various foods, such as beverages, gum, tea, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, etc.

[0041] When the composition of the present invention is included in a food composition, the amount may be added in a ratio of 0.1 to 50% of the total weight, but is not limited thereto.

[0042] When the food composition of the present invention is manufactured in the form of a beverage, there are no special limitations other than including the food composition in the indicated ratio, and various flavoring agents or natural carbohydrates, etc. may be contained as additional ingredients like in a typical beverage. Specifically, the natural carbohydrates may include monosaccharides such as glucose, disaccharides such as fructose, sucrose, and other polysaccharides, dextrin, cyclodextrin, and other typical sugars, and sugar alcohols such as xylitol, sorbitol, and erythritol. The flavoring agents may include natural flavoring agents (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.).

[0043] The food composition of the present invention may further include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.

[0044] The ingredients included in the food composition of the present invention may be used independently or in combination. The proportion of the additives is not a key element of the present invention, but may be selected within the range of 0.1 to about 50 parts by weight per 100 parts by weight of the food composition of the present invention, but is not limited thereto.

[0045] The composition of the present invention suppresses the inflammatory response of inflammatory periodontal diseases such as gingivitis or periodontitis, thereby suppressing destruction of periodontal tissue, and has the effect of regenerating periodontal tissue caused by gingivitis or periodontitis and the effect of attaching periodontal ligaments to teeth, and thus can be usefully used as a therapeutic composition for various inflammatory diseases, particularly inflammatory periodontal diseases.

[0046]

[0047] According to another embodiment of the present invention, the present invention relates to a composition for periodontal tissue regeneration comprising a steroid sulfatase inhibitor as an active ingredient.

[0048] According to another embodiment of the present invention, the present invention relates to a composition for promoting tooth attachment of periodontal ligament, comprising a steroid sulfatase inhibitor as an active ingredient.

[0049] According to another embodiment of the present invention, the present invention relates to a composition for promoting osseointegration of an implant, comprising a steroid sulfatase inhibitor as an active ingredient.

[0050] In the present invention, the description of the steroid sulfatase inhibitor, periodontal tissue, periodontal ligament, etc. is the same as described above, and thus is omitted to avoid excessive complexity of the present specification.

[0051] In the present invention, the implant osseointegration refers to the process in which bone cells proliferate and bind to the implant surface, and refers to the process in which an artificial tooth root, which acts as a root, binds to the alveolar bone and is firmly fixed. As shown in the examples described below, the composition of the present invention was confirmed to have the effect of significantly reducing the number of inflamed areas and inflammatory cells in the tissue, effectively improving the inflammatory response, suppressing alveolar bone destruction, and attaching the periodontal ligament to the tooth. Furthermore, it was confirmed to have the effect of promoting osseointegration through periodontal tissue regeneration during implant surgery to restore teeth lost due to periodontal disease.

[0052] The composition for periodontal tissue regeneration, the composition for promoting tooth attachment of periodontal ligament, and the composition for promoting osseointegration of implants provided in the present invention may each be used as a pharmaceutical composition or a food composition, but are not limited thereto.

[0053]

[0054] According to another embodiment of the present invention, there is provided a method for preventing, improving or treating an inflammatory disease, comprising administering to a subject in need of administration an effective amount of a composition comprising a steroid sulfatase inhibitor as an active ingredient.

[0055]

[0056] According to another embodiment of the present invention, there is provided a method for regenerating periodontal tissue, comprising administering to a subject in need of administration an effective amount of a composition comprising a steroid sulfatase inhibitor as an active ingredient.

[0057]

[0058] According to another embodiment of the present invention, there is provided a method for promoting tooth attachment of periodontal ligament, comprising the step of administering to a subject in need of administration an effective amount of a composition comprising a steroid sulfatase inhibitor as an active ingredient.

[0059]

[0060] According to another embodiment of the present invention, there is provided a method for promoting osseointegration of an implant, comprising administering to a subject in need of administration an effective amount of a composition comprising a steroid sulfatase inhibitor as an active ingredient.

[0061]

[0062] In the method for preventing, improving or treating the inflammatory disease of the present invention, the method for regenerating periodontal tissue, the method for promoting tooth attachment of periodontal ligament and the method for promoting osseointegration of implants, the contents regarding the steroid sulfatase inhibitor, the inflammatory disease, periodontal tissue, periodontal ligament, osseointegration of implants, etc. are the same as those described above, and thus are omitted to avoid excessive complexity of the present specification.

[0063] In the present invention, the term “administration” means providing a predetermined composition of the present invention to a subject by any appropriate method.

[0064] In the present invention, the "subject" requiring the administration may include both mammals and non-mammals. Here, examples of mammals include, but are not limited to, humans, non-human primates such as chimpanzees, other apes, or monkey species; livestock animals such as cows, horses, sheep, goats, and pigs; farmed animals such as rabbits, dogs, or cats; and laboratory animals such as rodents such as rats, mice, or guinea pigs. In addition, examples of non-mammals in the present invention may include, but are not limited to, birds or fish.

[0065] The inhibitor included as an active ingredient in the composition of the present invention can be combined with a carrier to enhance the efficacy of treating inflammatory diseases. Any carrier that is biocompatible and capable of achieving the desired effects of the present invention may be used without limitation. Examples include, but are not limited to, serum albumin, peptides, immunoglobulins, hemocyanins, and polysaccharides.

[0066] In the present invention, the formulation of the composition administered as described above is not particularly limited, and may be administered as a solid formulation, a liquid formulation, or an aerosol formulation for inhalation, and may be administered as a solid formulation intended to be converted into a liquid formulation for oral or parenteral administration immediately before use, and may be administered by being formulated in the form of, for example, oral formulations such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and sterile injectable solutions, but is not limited thereto.

[0067] In addition, in the present invention, an adjuvant may be further added together with the composition of the present invention during the administration, and any adjuvant known in the art as a pharmaceutical or immunological substance may be used without limitation. For example, sugars or amino acids may be used as stabilizers, and mineral oil, vegetable oil, alum, aluminum phosphate, bentonite, silica, muramyl dipeptide derivatives, thymosin, interleukin, etc. may be used as adjuvants.

[0068] In addition, in the present invention, a pharmaceutically acceptable carrier may be additionally administered together with the composition of the present invention during the administration. Here, the pharmaceutically acceptable carrier may include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a fragrance, etc. for oral administration, and may include a mixture of a buffer, a preservative, an analgesic, a solubilizer, an isotonic agent, a stabilizer, etc. for injections, and may include a base, an excipient, a lubricant, a preservative, etc. for topical administration. The formulation of the composition of the present invention may be prepared in various ways by mixing it with the pharmaceutically acceptable carrier described above. For example, the composition may be prepared in the form of a tablet, troche, capsule, elixir, suspension, syrup, wafer, etc. for oral administration, and may be prepared in the form of a unit dosage ampoule or a multiple dosage form for injections. It can be formulated as a solution, suspension, tablet, capsule, sustained-release preparation, etc.

[0069] Meanwhile, examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, or mineral oil. In addition, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, and the like may be additionally included.

[0070] Routes of administration of the composition according to the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Oral or parenteral administration is preferred.

[0071] In the present invention, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. The composition of the present invention may also be administered in the form of a suppository for rectal administration.

[0072] As used herein, a "pharmaceutically effective amount" refers to a sufficient amount of an agent to produce a desired biological result. This result may be a reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration in a biological system. For example, an "effective amount" for preventive or therapeutic use is the amount of a composition disclosed herein required to produce a clinically significant reduction in a disease. The appropriate "effective" amount in any individual case can be determined by one skilled in the art using routine experimentation. Accordingly, the expression "effective amount" generally refers to an amount of an active agent that produces a therapeutic effect. In the present invention, the active agent is a steroid sulfatase inhibitor and is an agent for the prevention, improvement, or treatment of an inflammatory disease.

[0073] The dosage of the compound used in the composition of the present invention may vary depending on various factors including the activity of the specific compound, age, body weight, general health, sex, diet, administration time, administration route, excretion rate, drug combination, and severity of the specific disease to be prevented or treated. The dosage of the compound may vary depending on the patient's condition, body weight, degree of disease, drug form, administration route, and period, but may be appropriately selected by those skilled in the art, and may be administered at 0.0001 to 100 mg / kg or 0.001 to 100 mg / kg per day. The dosage may be administered once a day or divided into several times. The dosage does not limit the scope of the present invention in any way. The compound according to the present invention may be formulated as a pill, a dragee, a capsule, a liquid, a gel, a syrup, a slurry, or a suspension.

[0074] The composition of the present invention can be used alone or in combination with methods using surgery, hormone therapy, chemotherapy, and biological response modifiers.

[0075] The composition provided by the present invention suppresses the inflammatory response of inflammatory periodontal diseases such as gingivitis or periodontitis, thereby inhibiting periodontal tissue destruction. In addition, it has the effect of regenerating periodontal tissue destroyed by gingivitis or periodontitis and promoting the attachment of periodontal ligaments to teeth. The composition of the present invention can be usefully utilized as a therapeutic composition for various inflammatory diseases, particularly inflammatory periodontal diseases.

[0076] Figures 1a and 1b show the results of immunohistochemical staining for IL-1β and IL-6 to confirm the effect of regulating the expression of inflammatory cytokines when Irosert is administered to an animal model of an inflammatory disease in one embodiment of the present invention.

[0077] Figure 2a shows the results of confirming the degree of inflammatory cell infiltration into periodontal tissue after administering Irosustat or vehicle to a rat model induced with periodontitis in one embodiment of the present invention.

[0078] Figure 2b shows the results of confirming the change in mRNA expression of TNF-α (Tumor necrosis factor alpha), an inflammatory cytokine, through qRT-PCR after administering Irosustat or vehicle to a rat model induced by periodontitis in one embodiment of the present invention.

[0079] Figures 3a and 3b are graphs showing the results of measuring the amount of apical migration of the junctional epithelium, the amount of periodontal attachment loss at the proximal surface, and the percentage of periodontal attachment area at the furcation site in rats after administering Irosustat or vehicle to a rat model induced by periodontitis in one embodiment of the present invention, and quantifying these results.

[0080] Figure 4 shows the results of measuring the bone-implant contact area ratio, bone density within the implant spiral gap, and the number of Haversian canals within the implant spiral gap in a rat model of dental implant placement after administering Irosustat or vehicle in one embodiment of the present invention. Here, the measurement site corresponds to the area between the second to fifth spirals from the top of the implant, which corresponds to the inside of an imaginary line connecting the end of the second screw to the end of the fifth spiral.

[0081] One embodiment of the present invention relates to a pharmaceutical composition for preventing or treating an inflammatory disease, comprising a steroid sulfatase inhibitor as an active ingredient.

[0082] Another embodiment of the present invention relates to a food composition for preventing or improving inflammatory diseases, comprising a steroid sulfatase inhibitor as an active ingredient.

[0083] Another embodiment of the present invention relates to a pharmaceutical composition for periodontal tissue regeneration comprising a steroid sulfatase inhibitor as an active ingredient.

[0084] Another embodiment of the present invention relates to a pharmaceutical composition for promoting tooth attachment of periodontal ligament, comprising a steroid sulfatase inhibitor as an active ingredient.

[0085] Another embodiment of the present invention relates to a pharmaceutical composition for promoting osseointegration of an implant, comprising a steroid sulfatase inhibitor as an active ingredient.

[0086] Another embodiment of the present invention relates to a method for preventing, improving or treating an inflammatory disease, comprising administering to a subject in need of administration an effective amount of a composition comprising a steroid sulfatase inhibitor as an active ingredient.

[0087] Another embodiment of the present invention relates to a method for regenerating periodontal tissue, comprising administering to a subject in need of administration an effective amount of a composition comprising a steroid sulfatase inhibitor as an active ingredient.

[0088] Another embodiment of the present invention relates to a method for promoting periodontal ligament attachment to teeth, comprising administering to a subject in need of administration an effective amount of a composition comprising a steroid sulfatase inhibitor as an active ingredient.

[0089] Another embodiment of the present invention relates to a method for promoting osseointegration of an implant, comprising the step of administering to a subject in need of administration an effective amount of a composition comprising a steroid sulfatase inhibitor as an active ingredient.

[0090] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0091]

[0092] Example

[0093] Experimental method

[0094] Preparation of Irosustat

[0095] A compound of (6-oxo-8,9,10,11-tetrahydro-7H-cyclohepta[c]chromen-3-yl) sulfamate represented by the following chemical formula 1 (hereinafter referred to as 'Irosustat') was purchased and prepared.

[0096] [Chemical Formula 1]

[0097]

[0098]

[0099] Preparation of rat model

[0100] The protocol and animal selection and care of this study were reviewed and approved by the Animal Care and Use Committee of Yonsei Medical Center, Seoul, South Korea (Approval Number: 2021-0298), and the results of this study were reported in accordance with the Animal Research: Reporting of In Vivo Experiment (ARRIVE) guidelines. 1) To determine the preventive or therapeutic effect on periodontitis, an inflammation caused by periodontal disease, a total of 16 8-week-old female Sprague-Dawley rats weighing 300 to 400 g were used. To induce osteoporosis, the rats were ovariectomized by a veterinarian from the vendor (Central Lab. Animal Inc., Seoul, Korea) before being brought into the experimental facility. They were housed under standard laboratory conditions at an indoor temperature of 15 to 20°C and a humidity of 30% or higher, and were fed appropriately. In addition, 2) to confirm the effect of suppressing periodontal tissue destruction caused by periodontal disease, periodontal ligament attachment, and further the effect of promoting implant osseointegration in tooth loss caused by periodontal disease, 32 8-week-old female Sprague-Dawley rats were ovariectomized, and 8 weeks later, 16 rats underwent surgery to induce periodontitis and 16 rats underwent dental implant placement surgery. Periodontitis was induced by ligating a non-absorbable suture to the cervical region of the maxillary second molars on both the right and left sides of the experimental animals to induce plaque deposition. For the dental implant experiment, two implants were placed one each on the tibia of the right and left sides of the experimental animals.

[0101]

[0102] Study design and group classification

[0103] 1) Eight weeks after ovariectomy, all animals were randomly assigned to one of two groups before periodontitis was induced in the maxillary second molars: the group receiving isoserstat (N=8) and the control group (N=8) that did not receive isoserstat. To induce periodontitis, general anesthesia was administered by intraperitoneal injection of tiletamine / zolazepam (0.66 mL / kg; Zoletil 50, Virbac, Carros, France) and xylazine (0.43 mL / kg; Rompun, Elanco, Greenfield, IN, USA) and isoflurane inhalation (Foran, Jungwoo Pharmaceutical, Seoul, Korea) through the nose. The mesial and distal interproximal contacts of the maxillary second molars were gently released with a dental probe to achieve mild subluxation, and then non-absorbable braided sutures (4-0 Black Silk, Ailee, Busan, Korea) were ligated around the teeth. Tartar accumulation eventually induced periodontal inflammation for 5 weeks. 2) After periodontitis-induced surgery and dental implant placement surgery, the experimental animals were randomly divided into 4 groups (8 rats induced with periodontitis and administered irostat, 8 rats induced with periodontitis and not administered irostat, 8 rats administered with implant placement and 8 rats not administered irostat) and administered drugs. The group administered irostat was mixed with feed and administered so that irostat was consumed at approximately 10 mg / kg per day, and the group not administered irostat was provided with feed without irostat. There was no statistical difference in the amount of feed consumed between the groups. The 16 rats that underwent dental implant placement surgery had implant placement performed 8 weeks after ovariectomy. On the day of surgery, general anesthesia was administered using tiletamine / zolazepam (0.66 ml / kg; Zoletil50, Virbac, Carros, France) and xylazine (0.After intraperitoneal injection of 43 ml / kg; Rompun, Elanco, Greenfield, IN, USA), the implants were inhaled. Isoflurane (Forane, Jungwoo Pharmaceutical, Seoul, Korea) was administered intranasally, and two implants were placed with an appropriate insertion torque (20–30 Ncm), one on each side. The muscles and skin of the surgical site were first sutured with 4-0 absorbable suture (Monosyn 4-0 Glyconate Monofilment, B. Braun, Tuttlingen, Germany) to allow underwater healing, and the implants were placed for 5 weeks. The dental implants used were rat-specific SLA surface implant fixtures (2 mm in length, 2 mm in diameter; Dentium, Suwon, Korea).

[0104]

[0105] This is how to create a mixed diet.

[0106] Following a previous study using the same experimental design, the yerosustat mixed diet was prepared as follows: the feed was first ground into a powder, then yerosustat (253 mg / kg) dissolved in dimethyl sulfoxide was added and mixed to obtain a uniform pellet. After drying for 12 to 15 hours, the pellets were packaged and sterilized. Since each rat typically consumes approximately 15 g of feed, it is estimated that each rat consumes approximately 10 mg / kg of yerosustat daily.

[0107]

[0108] Meals by group classification

[0109] For 10 weeks after disease induction, all rats received food according to group classification. Rats in the group administered with isostat were fed a mixed diet containing isostat, and rats in the control group were continuously fed a regular diet without isostat.

[0110]

[0111] Euthanasia of laboratory animals

[0112] In rats with periodontitis, drugs were administered for 10 weeks after surgery to induce periodontitis. All rats were sacrificed using carbon dioxide gas. The maxillary jaws, including the teeth and peridental tissues, were isolated and fixed in 10% neutral formalin. After 10 days of fixation, the samples were dehydrated in ethanol, embedded in methacrylate, sectioned, and stained with hematoxylin and eosin.

[0113]

[0114] cDNA synthesis from RNA obtained from periodontal tissue and qRT-PCR using cDNA

[0115] The periodontal tissue of the periodontitis-induced rats prepared in the above preparation example was lysed using a homogenizer bead and Trizol (Invitrogen, #15596018), and total RNA was isolated. 4 µg of total RNA isolated from the tissue, oligo dT, and RevertAid reverse transcriptase (Thermo scientific, #EP0441) were added to a tube and reverse transcribed into cDNA by reacting at 65 °C for 5 minutes and 42 °C for 1 hour. 100 ng of the reverse-transcribed cDNA was reacted with SensiFAST SYBR Lo-ROX Kit (Meridian, #BIO-94005) and target-specific primers to perform qRT-PCR. The primer sequences used in the experiment are shown in Table 1 below.

[0116] Gene primer sequence (5'→3')β-actinF: GGAGATTACTGCCCTGGCTCCTAR: GACTCATCGTACTCCTGCTTGCTGTNF-αF: TTCCAATGGGCTTTCGGAACR: AGACATCTTCAGCAGCCTTGTGAG

[0117] The Ct value of a specific target obtained through qRT-PCR reaction was quantitatively analyzed by subtracting the Ct value of β-actin from the Ct value of the target using the 2^-ddCt method and normalizing it to 1 for a healthy sample.

[0118]

[0119] Histological and histomorphometric analysis

[0120] The dissected maxillae were fixed in 10% neutral-buffered formalin for 10 days, dehydrated in ethanol, and embedded in methacrylate. The maxillary second molars were then sectioned mesially using a diamond saw (EXAKT, Apparatebau, Norderstedt, Germany), and hematoxylin-eosin staining was performed. The following parameters were measured using a light microscope equipped with a camera (BX-50, Olympus Optical, Tokyo, Japan): apical location of junctional epithelium at proximal area (JEL, mm), level of alveolar bone crest at proximal area (BCL, mm), and areal percentage of alveolar bone within the furcation (PBF, %). Here, the apical migration amount of the junctional epithelium (JEL) refers to the linear distance from the cementoenamel junction (CEJ) to the apical border of the junctional epithelium, the proximal periodontal attachment loss (BCL) refers to the linear distance from the CEJ to the top of the proximal alveolar bone, and the percentage of furcation periodontal attachment area (PBF) refers to the ratio of the area of ​​alveolar bone within the furcation to the total area of ​​the furcation. Among the above-mentioned variables, JEL and BCL were measured at the mesial and distal surfaces, respectively, and the average values ​​for each tooth were calculated. Then, after collecting all measurements for the periodontally diseased teeth of each rat, the average JEL, BCL, and PBF were estimated and used as the representative values ​​for each experimental animal for further statistical analysis.

[0121]

[0122] In the case of dental implant-placed rats, drugs were administered for 4 weeks starting from 1 week after implant placement, and then the rats were sacrificed using carbon dioxide, and the tibia including the implant was isolated and fixed in 10% neutral formalin. After 10 days of fixation, the samples were dehydrated with ethanol, embedded in methacrylate, sectioned, and stained with Goldner trichrome. The bone-implant contact ratio (%), bone density within the implant spiral cleft, and the number of Haversian canals within the implant spiral cleft were measured as follows using a microscope equipped with a camera (BX-50, Olympus Optical, Tokyo, Japan). The region of interest (ROI) was set to 3 middle spiral clefts located in the cancellous bone area among the 5 total spiral clefts of the implant screw. Here, the bone-implant contact area ratio (%) refers to the ratio of the implant surface length in contact with the bone to the total length of the implant screw surface within the ROI, the bone density within the implant spiral gap (%BD) refers to the ratio of the bone area within the implant spiral gap to the total area within the implant spiral gap within the ROI, and the number of Haversian canals within the implant spiral gap refers to the number of Haversian canals observed within the implant spiral gap within the ROI.

[0123]

[0124] Statistical analysis

[0125] All data were statistically analyzed using computer software (SPSS version 23, IBM, Armonk, NY, USA). Each animal was considered a statistical unit, and the mean values ​​of JEL, BCL, and PBF of the maxillary second molar of each rat were used for statistical analysis. Because the sample size was small, the Mann-Whitney U test was used for comparisons between groups. In addition, the mean values ​​of %BIC, %BD, and Havers' canal count of the two implants were used as representative values ​​for each rat. Since normality was confirmed through the Shapiro-Wilk test (p > 0.05), an independent t-test was performed to compare %BIC, %BD, and Havers' canal count between the groups administered with erosetat and the control group, and all statistical significance was set at p < 0.05.

[0126]

[0127] Experimental results

[0128] Anti-inflammatory effects in rheumatoid arthritis (1)

[0129] BALB / c-Zap70m1Saka / Jcl (SKG) mice were injected with curdlan to induce inflammatory disease. Test and control substances were administered to the mice 10 days after inducing the immune response. The mice were divided into groups according to the arthritis index and administered orally once daily. After the 13th week, the test was terminated by sacrificing the joint tissues of each group, and the joint tissues were analyzed. For immunochemical analysis, the joint tissues were stained using specific IL-1β and IL-6 antibodies, and photographs were taken under a microscope at 100x magnification. The dab positive areas expressing each cytokine were extracted using ImageJ software (Wayne Rasband, NIH, USA) and analyzed as a % of the total area.

[0130] As a result, it was confirmed that the positive area % of inflammatory cytokines IL-1β and IL-6 in the synovium of joint tissue was reduced in the Iroserstat-administered group compared to the Vehicle-administered group. In the inflammatory disease model induced by curdlan, it was observed that the infiltration of IL-1β and IL-6 expressing cells in joint tissue was reduced by administration of the test substance Iroserstat (see Figures 1a and 1b).

[0131]

[0132] Anti-inflammatory effects in periodontitis caused by periodontal disease (2)

[0133] In order to further confirm the anti-inflammatory effect in the periodontal tissue of the periodontitis-induced rats prepared in the above preparation example, the maxillary jaws including the teeth and peridental tissues of the rats were separated after the periodontitis-induced surgery and the drug was administered for 10 weeks, and hematoxylin-eosin staining was performed. As a result, signs of inflammation were observed in the gingival tissue below the residual suture, and it was confirmed that the signs of inflammation were more prominent in the group that was not administered with erostat than in the group that was administered with erostat to the periodontitis-induced rats. In the group that was not administered with erostat, the inflammatory connective tissue area affected by the inflammation was distributed over a wider area, and more inflammatory cells and blood vessels were observed within the area (see Fig. 2a). Through this, it can be confirmed that erostat has an effect in treating periodontitis that occurs in the periodontal tissue due to periodontal disease.

[0134] In the above preparation example, periodontal tissues from the palate and cheek were collected from the periodontitis-induced sites of the rats and qRT-PCR was performed. As a result, it was confirmed that TNF-α mRNA expression increased in rats with periodontitis compared to the healthy control group, but was significantly reduced when Iroserstat was administered (see Fig. 2b). As such, TNF-α, an inflammatory cytokine, increased in tissues with periodontitis, and the increased expression level of TNF-α was significantly reduced by Iroserstat administration, suggesting that administration of the drug Iroserstat can alleviate the representative phenotype of periodontitis.

[0135]

[0136] Effects on regeneration of alveolar bone destruction caused by periodontal disease and promotion of periodontal ligament attachment (3)

[0137] Referring to Figures 3a and 3b, the amount of apical migration of the junctional epithelium was statistically significantly less in the group administered with isostat (0.24 ± 0.07 mm (n = 8) compared to the group not administered with isostat (0.36 ± 0.10 mm (n = 8) in the periodontitis-induced rats (p < 0.05), and the amount of loss of adjacent periodontal attachment was also statistically significantly less in the group administered with isostat (0.51 ± 0.06 mm (n = 8) compared to the group not administered with isostat (0.70 ± 0.14 mm (n = 8) in the periodontitis-induced rats (p < 0.05). The percentage of periodontal attachment area at the furcation site was statistically significantly higher in the Iroserstat-administered group (46.50 ± 5.15% (n = 8)) than in the group not administered Iroserstat (34.68 ± 7.14% (n = 8)) in periodontitis-induced rats (p < 0.05).

[0138]

[0139] Implant osseointegration promotion effect (4)

[0140] Referring to Fig. 4, the bone-implant contact area ratio was 60.8 ± 5.7% in the group administered witherosestat to dental implant rats, which was significantly higher than 39.3 ± 22.4% in the group not administered witherosestat (p < 0.05). The bone density within the implant spiral gap was 44.4 ± 13.2% in the group administered witherosestat to dental implant rats, which was significantly higher than 16.3 ± 8.9% in the group not administered witherosestat (p < 0.01). The number of Haver's canals within the implant spiral gap was 5.8 ± 4.0% in the group administered witherosestat to dental implant rats, which was significantly higher than 0.5 ± 0.9% in the group not administered witherosestat (p < 0.01).

[0141]

[0142] Although the above results have been described in detail with respect to the present invention, the scope of the present invention is not limited thereto, and it will be apparent to those skilled in the art that various modifications and variations are possible within a scope that does not depart from the technical spirit of the present invention described in the claims.

[0143] The present invention can be very effectively used for the prevention or treatment of periodontal disease because it suppresses the inflammatory response caused by periodontal disease, effectively suppresses destruction of periodontal tissue caused by inflammation, and has the effect of regenerating periodontal tissue.

Claims

1. A pharmaceutical composition for preventing or treating inflammatory diseases, comprising a steroid sulfatase inhibitor as an active ingredient.

2. In paragraph 1, A pharmaceutical composition wherein the steroid sulfatase inhibitor is at least one selected from the group consisting of irosustat, 2-(hydroxyphenyl) indole sulfate, 5-androstene-3,17-diol-3 sulfate, estrone-3-O-methylthiophosphonate (E1-3-MTP), estrone-3-O-sulfamate (EMATE), 4-methylcoumarin 7-O-sulfamate (COUMATE), KW-2581, STX213, morpholino, and salts, hydrates, or solvates thereof.

3. In paragraph 1, A pharmaceutical composition, wherein the inflammatory disease is at least one selected from the group consisting of periodontal disease, rheumatoid arthritis, reactive arthritis, multiple sclerosis, idiopathic fibrosing alveolitis, polymyositis, dermatomyositis, localized scleroderma, systemic scleroderma, colitis, inflammatory bowel disease, cystitis, vasculitis, primary biliary sclerosis, primary sclerosing cholangitis, ulcerative colitis, Crohn's disease, atopic dermatitis, and inflammatory encephalopathy.

4. In paragraph 3, A pharmaceutical composition wherein the above inflammatory disease is periodontal disease.

5. In paragraph 4, A pharmaceutical composition, wherein the periodontal disease is at least one selected from the group consisting of gingivitis; periodontitis; and diseases caused by destruction of periodontal tissue due to gingivitis or periodontitis.

6. In paragraph 5, A pharmaceutical composition wherein the periodontal tissue is at least one selected from the group consisting of gingiva, cementum, periodontal ligament (PDL), and alveolar bone.

7. In paragraph 5, A pharmaceutical composition, wherein the disease caused by destruction of periodontal tissue due to the above gingivitis or periodontitis is at least one selected from the group consisting of destruction of gingival fiber attachment, destruction of periodontal ligament attachment, formation of periodontal pocket due to apical migration of gingival junctional epithelium, alveolar bone breakage, alveolar bone osteodystrophy, alveolar bone osteoporosis, alveolarbone osteomalacia, alveolar bone osteopenia, gingival swelling, gingival bleeding, gingival itching, gingival redness, and gingival pain.

8. A food composition for preventing or improving inflammatory diseases, comprising a steroid sulfatase inhibitor as an active ingredient.

9. In paragraph 8, A food composition wherein the steroid sulfatase inhibitor is at least one selected from the group consisting of irosustat, 2-(hydroxyphenyl) indole sulfate, 5-androstene-3,17-diol-3 sulfate, estrone-3-O-methylthiophosphonate (E1-3-MTP), estrone-3-O-sulfamate (EMATE), 4-methylcoumarin 7-O-sulfamate (COUMATE), KW-2581, STX213, morpholino, and salts, hydrates, or solvates thereof.

10. A pharmaceutical composition for periodontal tissue regeneration, comprising a steroid sulfatase inhibitor as an active ingredient.

11. In paragraph 10, A pharmaceutical composition wherein the steroid sulfatase inhibitor is at least one selected from the group consisting of irosustat, 2-(hydroxyphenyl) indole sulfate, 5-androstene-3,17-diol-3 sulfate, estrone-3-O-methylthiophosphonate (E1-3-MTP), estrone-3-O-sulfamate (EMATE), 4-methylcoumarin 7-O-sulfamate (COUMATE), KW-2581, STX213, morpholino, and salts, hydrates, or solvates thereof.

12. A pharmaceutical composition for promoting tooth attachment to the periodontal ligament, comprising a steroid sulfatase inhibitor as an active ingredient.

13. In paragraph 12, A pharmaceutical composition wherein the steroid sulfatase inhibitor is at least one selected from the group consisting of irosustat, 2-(hydroxyphenyl) indole sulfate, 5-androstene-3,17-diol-3 sulfate, estrone-3-O-methylthiophosphonate (E1-3-MTP), estrone-3-O-sulfamate (EMATE), 4-methylcoumarin 7-O-sulfamate (COUMATE), KW-2581, STX213, morpholino, and salts, hydrates, or solvates thereof.

14. A pharmaceutical composition for promoting osseointegration of an implant, comprising a steroid sulfatase inhibitor as an active ingredient.

15. In paragraph 14, A pharmaceutical composition wherein the steroid sulfatase inhibitor is at least one selected from the group consisting of irosustat, 2-(hydroxyphenyl) indole sulfate, 5-androstene-3,17-diol-3 sulfate, estrone-3-O-methylthiophosphonate (E1-3-MTP), estrone-3-O-sulfamate (EMATE), 4-methylcoumarin 7-O-sulfamate (COUMATE), KW-2581, STX213, morpholino, and salts, hydrates, or solvates thereof.

Images