Viral gene therapy vector for removing hepatitis b viruses and use

Abstract

The present invention relates to a viral gene therapy vector for removing hepatitis B viruses, a preparation method therefor, and the use thereof, aiming to solve the problem in which existing viral gene therapy vectors can only inhibit the replication of hepatitis B viruses, but cannot remove virus cccDNA. The vector comprises a promoter, an intron, an enhancer, a nuclear localization signal (NLS) functional domain encoding gene of PGLYRP2 protein, an HBV DNA binding domain encoding gene of the PGLYRP2 protein, a secretory signal peptide functional domain encoding gene of the PGLYRP2 protein, an HBV nucleocapsid-binding functional domain encoding gene of the PGLYRP2 protein, and an IRES fragment. The viral gene therapy vector can remarkably promote the removal of HBVs in the liver of mice and is used for treatment of hepatitis B virus infection.

Description

A viral gene therapy vector for eliminating hepatitis B virus and its application Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a gene therapy vector and a preparation method and application thereof. Background Art

[0002] Adeno-associated virus (AAV) is a single-stranded virus with an icosahedron. Recombinant adeno-associated virus (rAAV) is composed of the same capsid sequence and structure as found in wild-type adeno-associated virus. Compared with other viral delivery systems, rAAV has the advantages of long-term expression level, extremely low immunogenicity, a wide range of infected hosts, strong infection spread ability, and strong specificity. However, there are still many problems in clinical application, such as the overexpression of rAAV's exogenous genes in the liver, which causes the expression level of the target protein to reach above the body's physiological safety threshold, resulting in more serious liver toxicity. How to achieve long-term and controllable expression of rAAV within the safety threshold is a key issue that needs to be solved in the current clinical application of rAAV.

[0003] Hepatitis B virus (HBV) is the pathogen that causes hepatitis B (abbreviated as HBV), which belongs to the genus Hepadnavirus. HBV mainly infects human liver cells, and its infection can significantly increase the incidence of cirrhosis and liver cancer. For HBV-infected patients, the main clinical treatments are interferon α and nucleoside analogs, or polyclonal antibodies against its surface antigens. Patent CN101906417A discloses a recombinant adeno-associated virus gene therapy vector, which uses gene recombination technology to clone shRNA that has an inhibitory effect on hepatitis B virus into the backbone plasmid of the adeno-associated virus vector, and co-transfect the packaging cells with the auxiliary plasmid to obtain the recombinant adeno-associated virus. Although the recombinant adeno-associated virus can effectively inhibit the replication and expression of hepatitis B virus, it cannot eliminate viral cccDNA and can only slow down the progression of the disease, resulting in easy relapse after drug withdrawal.

[0004] Summary of the Invention

[0005] The present invention aims to solve the problem that existing viral gene therapy vectors can only inhibit hepatitis B virus replication but cannot eliminate viral cccDNA, and provides a viral gene therapy vector and application for eliminating hepatitis B virus.

[0006] The present invention provides a viral gene therapy vector for eliminating hepatitis B virus, comprising a promoter, an intron, an enhancer, a gene encoding a PGLYRP2 protein nuclear localization signal NLS functional domain, a gene encoding an HBV DNA binding domain of the PGLYRP2 protein, a gene encoding a secretion signal peptide functional domain of the PGLYRP2 protein, a gene encoding an HBV nucleocapsid binding functional domain of the PGLYRP2 protein, and an IRES fragment.

[0007] The promoter is a truncated version M of the PGLYRP2 gene promoter, and its nucleotide sequence is shown in SEQ ID NO: 1 in the sequence listing.

[0008] The enhancers are CMV enhancer and HBV EnII element. The nucleotide sequence of the CMV enhancer is shown in SEQ ID NO: 2 in the sequence listing, and the nucleotide sequence of the HBV EnII element is shown in SEQ ID NO: 3 in the sequence listing.

[0009] The PGLYRP2 protein nuclear localization signal NLS functional domain encoding gene is the C-terminal 550-576 amino acid encoding gene of the PGLYRP2 protein, and its nucleotide sequence is shown in SEQ ID NO: 4 in the sequence listing.

[0010] The nucleotide sequence of the gene encoding the HBV DNA binding domain of the PGLYRP2 protein is shown in SEQ ID NO: 5 in the sequence listing.

[0011] The nucleotide sequence of the gene encoding the secretory signal peptide functional domain of the PGLYRP2 protein is shown in SEQ ID NO: 6 in the sequence listing.

[0012] The nucleotide sequence of the gene encoding the HBV nucleocapsid binding domain of the PGLYRP2 protein is shown in SEQ ID NO: 7 in the sequence listing.

[0013] Furthermore, the vector backbone of the viral gene therapy vector is an adeno-associated virus vector, an adenovirus vector, a lentivirus vector or a retrovirus vector; the adeno-associated virus vector is an AAV2, AAV5, AAV7, AAV8, AAV9 or AAV-DJ type adeno-associated virus vector.

[0014] The present invention also provides the use of the viral gene therapy vector in the preparation of a drug for treating hepatitis B virus infection.

[0015] Beneficial effects of the present invention:

[0016] The viral gene therapy vector of the present invention includes the gene therapy delivery vector pAAV-EnII-EnCMV-M. The gene therapy delivery vector pAAV-EnII-EnCMV-M constructed by the present invention has the characteristics of long-term expression and liver tissue-specific expression in mice, and has a self-feedback mechanism, which gives the gene therapy product better safety.

[0017] The present invention identifies four functional domains of PGLYRP2 protein, namely the HBV DNA binding domain of PGLYRP2, the nuclear localization signal NLS, the secretion signal peptide SP and the nucleocapsid functional domain, which are functionally combined to form two new fusion proteins. The viral gene therapy vector of the present invention can simultaneously express two fusion proteins in hepatocytes - the HBV DNA binding domain of PGLYRP2 + the nuclear localization signal NLS fusion protein (PGLYRP2 209～377aa -NLS) and the secretory signal peptide SP+nucleocapsid binding domain fusion protein of PGLYRP2 (SP-PGLYRP2 PGRP ). Targeting HBV cccDNA, chromosomally integrated DNA, and HBV nucleocapsid, respectively, exerting the functions of HBV cccDNA and chromosomally integrated DNA transcription inhibitors and HBV capsid assembly regulators, achieving a dual mechanism and synergistic effect of HBV viral clearance in host cells, and significantly promoting HBV clearance in mouse livers. The viral gene therapy vector of the present invention can significantly clear cccDNA within 14 weeks, indicating that this method has great potential to achieve a complete cure for hepatitis B. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 is a schematic diagram of the pAAV-EnII-EnCMV-M vector;

[0019] Figure 2 shows the identification of the promoter and enhancer EnII-EnCMV-M in improving the expression capacity of the vector;

[0020] Figure 3 shows that the gene therapy delivery vector pAAV-EnII-EnCMV-M is specifically and highly expressed in hepatocytes;

[0021] Figure 4 shows the positive regulatory effect of PGLYRP2 protein on the backbone vector pAAV-EnCMV-M;

[0022] FIG5 shows the self-feedback regulatory effect of PGLYRP2 protein on the gene therapy delivery vector pAAV-EnII-EnCMV-M;

[0023] Figure 6 shows the silver staining results of rAAV-EnII-EnCMV-M-Luciferase virus;

[0024] Figure 7 shows the relative luciferase activities of different cells infected with rAAV-EnII-EnCMV-M-Luciferase virus;

[0025] FIG8 shows the in vivo imaging results of mice injected with rAAV-EnII-EnCMV-M-Luciferase virus through the tail vein;

[0026] FIG9 is the nuclear localization of PGLYRP2 protein observed by confocal microscopy;

[0027] FIG10 is a confocal microscopy analysis of the role of the nuclear localization signal domain NLS of PGLYRP2 protein;

[0028] FIG11 is a confocal microscopy analysis of the role of the secretory signal peptide domain SP of PGLYRP2 protein;

[0029] Figure 12 is a flow chart of the Flag pull-down technique for cell culture supernatant;

[0030] FIG13 shows the Flag pull-down results of cell culture supernatant;

[0031] FIG14 shows HBV DNA-strep pull-down that recognizes the HBV DNA binding domain of PGLYRP2;

[0032] FIG15 is an analysis of the HBV replication inhibitory function of PGLYRP2209-377, the HBV DNA binding domain of PGLYRP2;

[0033] FIG16 is a graph showing the binding of PGLYRP2 protein to HBV nucleocapsid detected by co-immunoprecipitation and non-denaturing protein electrophoresis;

[0034] FIG17 is an immunoprecipitation analysis of the interaction between the PGLYRP2PGRP domain of PGLYRP2 protein and HBV core antigen;

[0035] FIG18 is a schematic diagram of four PGLYRP2 functional domains identified in the present invention;

[0036] FIG19 is a schematic diagram of an adeno-associated virus gene therapy vector of the present invention;

[0037] FIG20 shows the HBV virus clearance effect of adeno-associated virus gene therapy vectors in a mouse infection model;

[0038] FIG21 shows the expression of target genes in the liver of mice 14 weeks after tail vein injection of adeno-associated virus gene therapy vector-packaged viruses;

[0039] FIG22 shows the relative content of hepatitis B cccDNA in the liver of mice 14 weeks after tail vein injection of adeno-associated virus gene therapy vector-packaged viruses;

[0040] Figure 23 shows the HBsAg content in mouse serum 14 weeks after the adeno-associated virus gene therapy vector-packaged virus was injected into the tail vein of mice. DETAILED DESCRIPTION

[0041] The following embodiments of the present invention are described in detail. The following embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation plans and specific operating processes are given, but the protection scope of the present invention is not limited to the following embodiments.

[0042] The present invention first constructs a gene therapy delivery vector pAAV-EnII-EnCMV-M, which is a gene therapy vector with liver-specific expression and self-feedback inhibition overexpression function. Then, on this basis, an adeno-associated virus gene therapy vector is constructed, which expresses four PGLYRP2 functional domains, namely the HBV DNA binding domain of PGLYRP2 and the nuclear localization signal NLS fusion protein (HBV cccDNA and chromosomal integrated DNA transcription inhibitor), and the secretion signal peptide SP of PGLYRP2 and the nucleocapsid binding functional domain fusion protein (HBV capsid assembly regulator). The tissue specificity and safety of the adeno-associated virus gene therapy vector are achieved through the specific interaction between the above-mentioned vector and the PGLYRP2 gene or its functional domain truncated expression product. The gene therapy drug can express the PGLYRP2 truncated functional domain fusion protein in a long-term, specific and controllable manner in HBV virus-infected hepatocytes, targeting HBV cccDNA and HBV nucleocapsid, respectively, and synergistically playing the role of HBV cccDNA inhibitor and HBV capsid assembly regulator.

[0043] The PGLYRP2 gene is constitutively expressed at a high level in normal human hepatocytes, but is expressed at a low level in hepatocytes with a high hepatitis B virus index. The present invention uses a self-feedback element that carries a partial PGLYRP2 gene promoter element and PGLYRP2 protein regulation to target hepatocytes for self-feedback expression of the PGLYRP2 protein functional domain fusion protein, thereby restoring the moderately high level of the PGLYRP2 protein functional domain in virus-infected hepatocytes. Therefore, the present invention is theoretically safe.

[0044] Example 1: Construction and expression identification of gene therapy delivery vector pAAV-EnII-EnCMV-M

[0045] The luciferase gene was amplified using primers BamHI-luciferase F and HindIII-luciferase R, and plasmid PGL4-PGLYRP2 (1--2005) as a template. Upstream primer BamHI-luciferase F: CGGGATCCCGATGGAAGACGCCAAAAACATAAAGAAA, downstream primer HindIII-luciferase R: CCAAGCTTGGTTACACGGCGATCTTTCCGCCCTTC. The nucleotide sequence of the luciferase gene is shown in SEQ ID NO: 9 in the sequence listing.

[0046] The PGLYRP2 gene promoter truncation M was amplified using primers MluI-MF and NcoI-MR, using plasmid PGL4-PGLYRP2 (1--2005) as a template. Upstream primer MluI-MF: CGACGCGTCGGTGGCGCATGCCTGTAACCTGA, downstream primer NcoI-MR: CATGCCATGGCATGGATTTCAAGCCACCAGCAGTAGCTG. The nucleotide sequence of the PGLYRP2 gene promoter truncation M is shown in SEQ ID NO: 1 in the sequence listing.

[0047] The plasmid PGL4-PGLYRP2 (1--2005) used to amplify the Luciferase gene and the PGLYRP2 gene promoter truncation M has been disclosed in the article Hepatology. 2020 May; 71(5): 1626-1642.

[0048] The HBV EnII element was amplified using primers MluI-HBV-EnII F and SacI-HBV-EnII R, and plasmid pBB4.5-HBV1.2, genotype C, as a template. The upstream primer MluI-HBV-EnII F is CGACGCGTCGTCCTGCCCAAGGTCTTACATAA, and the downstream primer SacI-HBV-EnII R is CGAGCTCCGCAGCTCCTCCCAGTCCTTAAAC. The nucleotide sequence of the HBV EnII element is shown in SEQ ID NO: 3 in the sequence listing.

[0049] The plasmid pBB4.5-HBV1.2, genotype C used to amplify the HBV EnII element was donated by others and has been published in the article Emerg Microbes Infect. 2022 Dec; 11(1): 1356-1370. The AAV-MCS empty vector was purchased from Miaoling Plasmid Platform (P0244, containing CMV promoter).

[0050] The AAV-MCS empty vector was double-digested with restriction endonucleases MluI and NcoI, the CMV promoter was removed, the CMV enhancer was retained, and the PGLYRP2 gene promoter truncation M was connected to obtain pAAV-EnCMV-M. The nucleotide sequence of EnCMV is shown in SEQ ID NO: 2 in the sequence listing; pAAV-EnCMV-M was then double-digested with restriction endonucleases MluI and SacI, and the HBV EnII element was connected to finally construct the pAAV-EnII-EnCMV-M vector. The vector schematic diagram is shown in Figure 1.

[0051] After vector sequencing verified the inserted sequence information, the gene therapy delivery vector pAAV-EnII-EnCMV-M was double-digested with the restriction endonucleases BamHI and HindIII, and then the Luciferase gene sequence was ligated to generate the pAAV-EnII-EnCMV-M-Luciferase recombinant for expression level evaluation of the gene therapy delivery vector. The hepatocyte cell line Huh7 was transfected with the same molar number of the control pAAV-Basic-Luciferase (Con group) plasmid or the pAAV-EnII-EnCMV-M-Luciferase recombinant. Twelve hours after transfection, the cells were lysed, and the luciferase substrate was added to the cell lysate at a 1:1 volume ratio. The luciferase intensity was measured using a fluorimeter. Luciferase reporter gene assay analysis indicated that the pAAV-EnII-EnCMV-M-Luciferase group expressed significantly higher luciferase activity in Huh7 hepatocytes compared with the promoter-less and enhancer-less control group pAAV-Basic-Luciferase (Con group) (Figure 2). Moreover, in cells derived from different tissues, the same dose of pAAV-EnII-EnCMV-M-Luciferase recombinant and sea cucumber luciferase plasmid were transfected. The cells were lysed 12 hours after transfection, and luciferase substrate was added to the cell lysate at a 1:1 volume ratio. The luciferase intensity was detected using a fluorescence meter. The results showed that pAAV-EnII-EnCMV-M-Luciferase was more specifically expressed in hepatocytes than in non-hepatocytes (Figure 3).

[0052] Example 2: Analysis of the hepatocyte-specific expression and self-feedback regulation of PGLYRP2 protein on the gene therapy delivery vector pAAV-EnII-EnCMV-M

[0053] First, the gene therapy delivery vectors pAAV-EnII-EnCMV-M-Luciferase and pAAV-EnCMV-M-Luciferase were shaken overnight and plasmids were extracted (according to the kit instructions, Omega, D6943-02). The obtained plasmid was purified as follows: 1 / 10 volume of sodium acetate (3M, pH5.2) and 7 / 10 volume of isopropanol were added to the extracted plasmid, mixed and placed at room temperature for 5 minutes, and centrifuged at 12000rpm for 10 minutes. At this time, white DNA precipitate was visible, and 1mL of 70% ethanol was added, centrifuged at 12000rpm for 10 minutes, the supernatant was discarded, and after drying the residual ethanol, about 500μL of saline was added to dissolve the DNA, and the concentration was measured and marked. The plasmid pLVSIN-PGLYRP2 used for co-transfection has been disclosed in the article Hepatology.2020May;71(5):1626-1642. Huh7 cells cultured in 12-well cell culture plates were divided into two groups, designated Group 1 and Group 2. Each group consisted of three experimental wells and one control well. Group 1 was transfected with 0.5 μg of pAAV-EnII-EnCMV-M-Luciferase per well, while Group 2 was transfected with 0.5 μg of pAAV-EnCMV-M-Luciferase per well. The control wells in each group were transfected with 0.5 μg of PLVSIN empty plasmid (purchased from TAKARA). The experimental wells in each group were transfected with 0.1 μg, 0.2 μg, and 0.4 μg of pLVSIN-PGLYRP2 plasmid, respectively. After 24 hours, luciferase intensity was detected using a luciferase reporter gene kit.

[0054] Results: As shown in Figure 4, PGLYRP2 protein promoted the protein expression activity of the backbone vector pAAV-EnCMV-M-Luciferase in a dose-dependent manner, and low-dose PGLYRP2 protein had a certain expression-promoting effect on the backbone vector; considering that PGLYRP2 protein has the characteristics of hepatocyte-specific expression, it suggests that the vector backbone has the ability of hepatocyte-specific expression.

[0055] On the basis of the backbone vector pAAV-EnCMV-M, the PGLYRP2 protein negative regulatory element EnII was added to form the complete gene therapy delivery vector pAAV-EnII-EnCMV-M. The expression results in hepatocytes showed that under the condition of low expression of PGLYRP2 protein, the expression regulation of PGLYRP2 protein on the gene therapy delivery vector pAAV-EnII-EnCMV-M was mainly positive; while the high expression of PGLYRP2 protein, due to its inhibitory effect on EnII, significantly reduced the protein expression level of the gene therapy delivery vector, and played a negative regulatory role on the gene therapy delivery vector. Therefore, PGLYRP2 protein has a bidirectional feedback regulatory effect on the regulation of the gene therapy delivery vector pAAV-EnII-EnCMV-M. Given that this bidirectional regulatory mechanism is derived from PGLYRP2 protein, PGLYRP2 promoter M, and PGLYRP2 regulatory elements, it is called self-feedback regulation (as shown in Figure 5).

[0056] Example 3: Viral packaging of gene therapy delivery vector rAAV-EnII-EnCMV-M-Luciferase, viral titer detection, and protein silver staining detection of viral characteristics

[0057] (1) Viral packaging of gene therapy delivery vector rAAV-EnII-EnCMV-M-Luciferase

[0058] Plate HEK 293T cells one day in advance. At the time of packaging, the cell density should be 85%-90%, and the cells should be evenly distributed and in good condition. Change the cell culture medium to serum-free DMEM (1% HEPES and 1% P / S) one hour in advance. When changing the medium, keep the pipette close to the inner wall of the culture dish but do not touch it. Add DMEM slowly to avoid blowing away cells that have already adhered. Also, be careful not to contaminate the culture medium and cells with the pipette during the change. Add DMEM to a centrifuge tube in sequence. Add phelper, RC8, pAAV-EnII-EnCMV-M-Luciferase plasmid, and PEI transfection reagent (phelper and RC8 purchased from Addgene, catalog numbers 112867 and 112864, respectively) in a 1:1:1 molar ratio. Vortex to mix thoroughly and let stand at room temperature for 30 minutes. Add the above-mentioned liquid after standing evenly to the HEK293T cells and mark them. When adding, add it slowly and adhere to the wall to avoid blowing the cells up. Shake and mix well after adding (horizontal cross mixing). Culture the cells in a 37°C, 5% CO2 incubator and change the medium after 10 hours. After 72 hours, collect the virus-producing cells together with the culture medium into a 15ml centrifuge tube. When collecting cells, tilt the culture plate at a certain angle to scrape the cells into the culture medium. Centrifuge at 1000rpm / min for 3 minutes to separate the cells and supernatant, store the supernatant separately, and resuspend the cells with 1ml PBS. Transfer the cell suspension repeatedly between an ultra-low temperature refrigerator (-80°C) and room temperature, and freeze and thaw 3 times. Shake after each thawing. Centrifuge at 8000rpm for 1h, discard the supernatant, and dissolve the virus precipitate with an appropriate amount of PBS solution. After complete dissolution, filter with a 0.45μm filter head and take the filtrate, which is the concentrated AAV virus.

[0059] Prepare 15%, 25%, 40%, and 60% iodixanol buffer according to Table 1 below. Take an ultracentrifuge tube (BECKMAN catalog number 331372) and add different concentrations of iodixanol layer by layer. First add 4.2 ml of the 60% layer, then add 5 ml of the 40% layer, then add 6 ml of the 25% layer, and finally add 9 ml of the 15% layer. Add the treated crude virus solution to the upper layer. When adding the virus, be careful and add it slowly, and cover the tube. Before centrifugation, the relative ultracentrifuge tubes should be balanced, and the error should be controlled within 0.02g. Select the SW41Ti rotor and centrifuge at 36300 rpm at 16°C for 3 hours.

[0060] Table 1 Preparation method of iodixanol buffer with different concentrations and dosage per tube

[0061] Use a needle to penetrate the high-speed centrifuge tube wall from the outside, with the syringe needle direction perpendicular to the centrifuge tube wall. Draw the "white line" portion between 40% iodixanol and 60% iodixanol, transfer the aspirated liquid to a clean 50ml centrifuge tube, and place it on ice. Because the virus in the PEG8000 precipitation supernatant has the possibility of contamination, PBS + 0.001% PF68 is diluted to 15ml and filtered with a 0.45μm filter membrane to achieve the purpose of sterilization. The filtered liquid is placed in a 15ml ultrafiltration tube (100KDa) and centrifuged at 3500rcf for 4°C for 30min. The remaining liquid in the ultrafiltration tube was repeatedly pipetted and then aspirated into the virus storage tube. A certain volume of PBS + 0.001% PF68 was added to the concentration tube. After repeated pipetting and mixing, the liquid was aspirated. Generally, after the AAV concentration centrifugation is completed, the remaining liquid was aspirated and washed twice with PBS + 0.001% PF68, each time with about 150μl of PBS + 0.001% PF68. The virus liquid was divided into 200μl EP tubes in units of 50μl, and the name and date were marked on the wall of the virus collection tube.

[0062] (2) Virus titer detection

[0063] Take 5 μl of virus solution for virus titer detection, add 45 μl ddH2O to 5 μl of virus stock solution to obtain 10-fold diluted AAV, recorded as AAV1; take 5 μl of 10-fold diluted virus solution and add 45 μl ddH2O to obtain 100-fold diluted AAV, recorded as AAV2; take 5 μl of 100-fold diluted virus solution and add 45 μl ddH2O to obtain 1000-fold diluted AAV, recorded as AAV3. The DNA concentration of pAAV-EnCMV-M-Luciferase was tested, and the number of copies of pAAV-EnCMV-M-Luciferase per μl was calculated according to the following formula. The number of copies of pAAV-EnCMV-M-Luciferase per μl calculated according to the following formula is 7.8×10 10 copies / μl.

[0064] (6.02×10 23 )×(ng / μl×10 -9 ) / (DNA length×660)=copies / μl

[0065] Take 2 μl of pAAV-EnCMV-M-Luciferase plasmid stock solution and add 18 μl of ddH2O to obtain a copy number of 10 9 The same method was used to prepare the plasmid dilution solution with a copy number of 10 3 -10 9 The plasmid dilution solution is ready for use.

[0066] Absolute quantitative PCR was used to determine the virus titer. Virus solutions and plasmids with different dilution ratios were used as templates for real-time quantitative PCR detection. The upstream primer used in PCR was: 5'-GATGAGCACTTTTAAAGTTCT-3', and the downstream primer was: 5'-GTTGTCAGAAGTAAGTTGG-3'. The reaction system was as follows: 5 μL of 2×traSYBR Mixture (CW0655M), 1 μL of 10 μM upstream and downstream primer mixture, 2 μL of deionized water, and 2 μL of template. The reaction program was set according to the instructions for use of the ABI high-throughput quantitative PCR analysis system (VIIA7), and the sample name, the name of the gene to be detected, and the name of the internal reference gene were set. The program was run and the results were exported. A standard curve was prepared based on the copy number and Ct value of the plasmids with different dilution ratios, and the copy number of the virus solution was calculated by entering the virus Ct.

[0067] (3) Protein silver staining detection method for rAAV-EnII-EnCMV-M-Luciferase virus characteristics

[0068] A 12% stacking gel was prepared according to the following recipe: sodium dodecyl sulfate / sulfonate (SDS), 30% acrylamide (mass ratio of acrylamide to methylenebisacrylamide = 29:1), tetramethylethylenediamine (TEMED), 3-hydroxyaminomethane hydrochloric acid buffer (Tris-HCl) for stacking gel, ddH₂O, and ammonium persulfate (APS). A 10% separating gel was prepared according to the following recipe: SDS, 30% acrylamide (mass ratio of acrylamide to methylenebisacrylamide = 29:1), TEMED, separating gel Tris-HCl, ddH₂O, and APS. Virus samples were silver stained at various dilutions (according to the kit instructions, BioSharp, BL620A).

[0069] Results: The standard curve was drawn and the copy number of the virus solution was calculated to be 3.3×10 11 The silver staining results of viral protein characteristics are shown in Figure 6. The VP1, VP2, and VP3 proteins of the virus are clearly visible, indicating that the recombinant adeno-associated virus was successfully packaged.

[0070] Example 4: Detection of specific and long-term expression of rAAV-EnII-EnCMV-M-Luciferase virus

[0071] Prepare 24-well cell culture plates and seed HEK293T cells and Huh7 cells. When the cell confluence reaches 50%-70%, that is, the cell number is around 2.5×10 5 to 3.5×10 5After removing the culture medium, wash the cells with culture medium without fetal bovine serum. Use trypsin to digest the cells in the reserved wells. After stopping the digestion and counting the cells, use the MOI value (the number of virus particles that infect one cell) of 10 5 Calculate the volume of rAAV required to be added. That is, 2.5-3.5 μl of virus solution is mixed with 250 μl of culture medium in a sterilized 1.5 ml centrifuge tube. Add the above virus-culture medium mixture to the different cells in each well in turn. After adding the virus mixture, place the 24-well plate back in a cell culture incubator at 37°C and 5% CO2 for culture. After 2 hours, add 250 μl of complete culture medium to each well and place it in the incubator again. After 12 hours, aspirate the culture medium in the 24-well plate and add 500 μl of fresh complete culture medium to each well. Observe the cell status under a microscope every day. 60 hours after the cells are infected with adeno-associated virus, collect the supernatant and cells for luciferase reporter gene experiments.

[0072] C57BL / 6J mice were selected and the number of rAAV-EnII-EnCMV-M-Luciferase viruses injected into the tail vein of each mouse was 1×10 11 10 μl of virus solution was diluted with PBS to a volume of 100 μl. After the virus was injected into the mouse through the tail vein, the distribution of the virus-expressed protein in the mouse was detected at different times after the virus injection using the PE IVIS Spectrum small animal in vivo imaging instrument. When performing small animal in vivo imaging, sterile DPBS (w / o Mg 2+ , Ca 2+ Prepare a 15 mg / mL stock solution of luciferin and mix thoroughly. Sterilize by filtering through a 0.2 μm filter. Use immediately or store in aliquots at -20°C in the dark, avoiding repeated freeze-thaw cycles. Inject at a concentration of 150 mg / kg luciferin per body weight. Perform imaging analysis 10-15 minutes after injection (when the light signal reaches its strongest and most stable plateau).

[0073] Results: The luciferase intensity of different cells infected with rAAV-EnII-EnCMV-M-Luciferase virus is shown in Figure 7. The luciferase intensity in Huh7 cells is significantly higher than that in HEK293T cells (p<0.001), indicating that the packaged rAAV-EnII-EnCMV-M-Luciferase virus has good hepatocyte specificity. The results of in vivo imaging of mice injected with virus tail vein are shown in Figure 8. Figure 1 is an injection of 1×10 11 AAV virus with the highest copy number, #2 was injected with 0.5×10 11In vivo imaging results showed that the packaged rAAV-EnII-EnCMV-M-Luciferase virus had good liver tissue localization and long-term expression in mice.

[0074] Example 5: Identification of the nuclear localization signal domain of PGLYRP2 protein

[0075] Laser confocal microscopy was used to observe the nuclear localization of PGLYRP2 protein in stably transfected Huh7 / PGLYRP2 cells. Bioinformatics was then used to predict the nuclear localization signal of PGLYRP2 protein. The predicted nuclear localization signal was fused to two red fluorescent proteins (2*RFP). The subcellular localization of the 2*RFP-NLS fusion protein was then observed using laser confocal microscopy to identify the function of the PGLYRP2 protein nuclear localization signal NLS domain. The nucleotide sequence of the gene encoding the PGLYRP2 protein nuclear localization signal NLS domain is shown in SEQ ID NO: 4 in the sequence listing.

[0076] Results: In Huh7 / PGLYRP2 stably transfected hepatocytes, laser confocal microscopy revealed that PGLYRP2 protein was primarily localized in the nucleus (Figure 9). Bioinformatics predicted that the nuclear localization signal for PGLYRP2 protein was located at amino acids 550-576 at the C-terminus of PGLYRP2 protein. Furthermore, laser confocal microscopy analysis of the nuclear localization function of NLS revealed that 2*RFP protein was primarily localized in the cytoplasm, while the 2*RFP-NLS fusion protein was primarily localized in the nucleus (Figure 10). This finding clearly identifies the C-terminal amino acids 550-576 of PGLYRP2 as the nuclear localization signal domain of PGLYRP2 protein.

[0077] Example 6: Identification of the secretory signal peptide domain of PGLYRP2 protein

[0078] Bioinformatics was used to predict the secretory signal peptide domain (SP) of the PGLYRP2 protein, which was then fused to the green fluorescent protein (EGFP)-3*Flag to form an SP-EGFP-3*Flag fusion protein. Laser confocal microscopy was used to analyze the fluorescence level of green fluorescent protein in HEK293 cells transfected with pAAV-SP-EGFP-3*Flag and pAAV--EGFP-3*Flag. Immunoprecipitation (Flag pull-down) was used to analyze the content of the SP-EGFP-3*Flag fusion protein in the cell culture supernatant of HEK293 cells transfected with the two plasmids. The nucleotide sequence of the gene encoding the secretory signal peptide domain of the PGLYRP2 protein is shown in SEQ ID NO: 6 in the sequence listing.

[0079] Results: Laser confocal microscopy revealed that the intracellular green fluorescent protein level in HEK293 cells transfected with the two plasmids was higher in the pAAV-EGFP-3*Flag group than in the pAAV-SP-EGFP-3*Flag group (Figure 11), suggesting that SP-EGFP-3*Flag may be secreted into the cell culture supernatant. The Flag pull-down process is shown in Figure 12. The results showed that the level of SP-EGFP-3*Flag fusion protein in the cell culture supernatant of HEK293 cells transfected with the two plasmids was significantly higher than that of EGFP-3*Flag fusion protein (Figure 13), further clarifying the role of the secretory signal peptide domain SP of the PGLYRP2 protein.

[0080] Example 7: Identification of the HBV DNA binding domain of the PGLYRP2 protein

[0081] The HBV DNA binding domain of PGLYRP2 was identified using the HBV core promoter DNA-strep pull-down technique, and then the HBV DNA binding domain of PGLYRP2 was analyzed using the HBV promoter luciferase reporter gene assay system. 209-377 The nucleotide sequence of the gene encoding the HBV DNA binding domain of the PGLYRP2 protein is shown in SEQ ID NO: 5 in the sequence listing.

[0082] Results: HBV core promoter DNA-strep pull-down technique detected PGLYRP2 protein and its truncated PGLYRP2 209-377 It can recognize and bind to HBV core promoter DNA (Figure 14), suggesting that PGLYRP2 209-377 The functional domain is the HBV DNA binding domain of PGLYRP2 protein. Further analysis of the regulatory effect of PGLYRP2 protein and its truncated forms on HBV viral replication using the luciferase reporter gene assay system of the HBV promoter revealed that the HBV DNA binding domain of PGLYRP2 protein 209-377 The protein has a clear inhibitory effect on HBV viral replication ( FIG15 ).

[0083] Example 8: Identification of the HBV nucleocapsid binding domain of the PGLYRP2 protein

[0084] Methods: HEK293 cells were co-transfected with PGLYRP2-Flag and HA-wild-type (WT) HBc or its mutants HA-HBc mutC61G (preferring to form nucleocapsid) and HA-HBc mutY132A (HBc hexamer rather than nucleocapsid) expression plasmids. Immunoprecipitation and non-denaturing protein electrophoresis were used to identify the binding of PGLYRP2 protein to HBV nucleocapsid. PGRP -Flag expression plasmid, and immunoprecipitation was used to analyze PGLYRP2 protein and its truncated PGLYRP2 PGRP Interaction with HBV core antigen HBc. The nucleotide sequence of the gene encoding the HBV nucleocapsid binding functional domain of the PGLYRP2 protein is shown in SEQ ID NO: 7 in the sequence listing.

[0085] Results: Through immunoprecipitation and non-denaturing protein electrophoresis analysis, PGLYRP2 protein has the ability to bind to HA-HBc WT and its mutant HA-HBc mutC61G with HBV nucleocapsid form, but has no binding ability to HA-HBc mutY132A mutant without nucleocapsid form (Figure 16), indicating that the binding of PGLYRP2 protein to HBV core antigen HBc is HBV nucleocapsid dependent. PGRP The interaction between PGLYRP2 and HBV core antigen HBc was found PGRP The functional domain is the HBV nucleocapsid binding functional domain ( FIG. 17 ).

[0086] Example 9: Construction of adeno-associated virus gene therapy vector.

[0087] The nuclear localization signal NLS and secretion signal peptide SP of PGLYRP2 protein can be used to locate the functional domain of PGLYRP2 in the cell nucleus and extracellular environment respectively. Among them, NLS and HBV DNA binding domain PGLYRP2 209-377 Functional domain fusion is beneficial for the fusion protein PGLYRP2 209～377aa -NLS binding to HBV DNA and its inhibitory effect on HBV replication; SP binding to the HBV nucleocapsid domain PGLYRP2 PGRP The fusion of SP-PGLYRP2 is beneficial to the PGRPInhibits the assembly of HBV nucleocapsid and HBV nucleic acid. The pLVSIN-PGLYRP2 vector used to amplify the four functional domain genes of PGLYRP2 has been disclosed in the article Hepatology. 2020 May; 71(5): 1626-1642. A schematic diagram of the gene therapy delivery vector pAAV-EnII-EnCMV-M is shown in Figure 1.

[0088] The gene therapy delivery vector pAAV-EnII-EnCMV-M was double-digested with restriction enzymes ClaI and BamHI and ligated with PGLYRP2. 209～377aa -NLS-3flag fragment, transformed to obtain pAAV-EnII-EnCMV-M-PGLYRP2 209～377aa -NLS-3flag recombinant;

[0089] The PGLYRP2 209～377aa -NLS-3flag fragment is ClaI-PGLYRP2 209～377aa -NLS-3flag F and BamHI-PGLYRP2 209～377aa -NLS-3flag R was used as primer and amplified with pLVSIN-PGLYRP2 vector as template, wherein the upstream primer ClaI-PGLYRP2 209～377aa -NLS-3flag F: CCATCGATGGATGAAATCCCCCCCTACCAT; downstream primer BamHI-PGLYRP2 209～377aa -NLS-3flag R: CGGGATCCCGTTACTTGTCATCGTCATCCTTG;

[0090] pAAV-EnII-EnCMV-M-PGLYRP2 was cleaved using restriction enzymes BamHI and SalI. 209～377aa -NLS-3flag recombinant was double-digested and ligated with IRES fragment to obtain pAAV-EnII-EnCMV-M-PGLYRP2 after transformation. 209～377aa -NLS-3flag-IRES recombinant;

[0091] The IRES fragment was amplified using BamHI-IRES F and SalI-IRES R as primers and plasmid pIRES (purchased from Miaoling Plasmid Platform, product number P0786) as a template, wherein the upstream primer BamHI-IRES F: CGGGATCCCGGTAAGTATCAAGGTTACAAGACA; the downstream primer SalI-IRES R: ACGCGTCGACGTCGGCCATAGCGGCCGCGGAATTATCATCGTGTTTTTCAAAGG; the nucleotide sequence of the IRES fragment is shown in SEQ ID NO: 8 in the sequence listing.

[0092] Then use restriction enzymes SalI and BglII to pAAV-EnII-EnCMV-M-PGLYRP2 209～377aa -NLS-3flag-IRES recombinant was double-digested and ligated with SP-PGLYRP2 PGRP -3flag fragment, transformed to obtain pAAV-EnII-EnCMV-M-PGLYRP2 209～377aa -NLS-IRES-SP-PGLYRP2 PGRP The recombinant is an adeno-associated virus gene therapy vector.

[0093] The SP-PGLYRP2 PGRP -3flag fragment is SalI-SP-PGLYRP2 PGRP -3flag F and BglII-SP-PGLYRP2 PGRP -3flag R was used as primer and amplified with pLVSIN-PGLYRP2 vector as template, wherein the upstream primer SalI-SP-PGLYRP2 PGRP -3flag F: ACGCGTCGACGTCGGCCATAGCGGCCGCGGAAATGGCCCAGGGCGTGCTCTGGATT; downstream primer BglII-SP-PGLYRP2 PGRP -3flag R:GAAGATCTTCTTACTTGTCATCGTCATCCTTG.

[0094] Results: The schematic diagram of the four PGLYRP2 functional domains identified by the present invention is shown in Figure 18. HBV gene therapy drug recombinant pAAV-EnII-EnCMV-M-PGLYRP2 209～377aa -NLS-IRES-SP-PGLYRP2 PGRP The schematic diagram is shown in Figure 19.

[0095] Example 10: Expression of adeno-associated virus gene therapy vector in mouse liver tissue and analysis of virus clearance effect.

[0096] Using 1×10 11 AAV / 1.2*HBV virus with a high copy number was injected into the tail vein of C57BL / 6J mice. After 4 weeks of modeling, HBV-positive mice were screened for subsequent gene therapy studies. The adeno-associated virus gene therapy vector pAAV-EnII-EnCMV-M-PGLYRP2 of the present invention was then selected. 209～377aa -NLS-IRES-SP-PGLYRP2 PGRP The recombinant adeno-associated virus was packaged, and the virus packaging process was the same as in Example 3. The HBV gene therapy drug virus was injected into the tail vein of the above HBV-positive C57BL / 6J mice (1×10 11 HBV viral titers (HBV DNA copies / mouse) were measured in the blood of mice 1, 2, 3, 7, and 14 weeks after virus injection. Fourteen weeks after virus injection, mouse livers were harvested, and expression of the adeno-associated virus gene therapy vector was assessed using immunoblotting. Fourteen weeks after virus injection, extrachromosomal DNA (cccDNA) was extracted from the livers using the Hirt method. HBV cccDNA was then treated with ExoI / ExoIII / T5 exonucleases. The purified HBV cccDNA was analyzed using real-time quantitative PCR using primers: cccDNA-specific primer_F: GTCTGTGCCTTCTCATCTGC, cccDNA-specific primer_R: ACAAGAGATGATTAGGCAGAGG. Fourteen weeks after virus injection, blood was collected from the mice by tail clipping, and serum HBsAg levels were assessed using ELISA (Sangon Biotech, D711407).

[0097] Results: The viral inhibition effect of the adeno-associated virus gene therapy vector was detected in the HBV mouse model. It was found that the HBV virus titer (HBV DNA copy number) in the mouse blood was as shown in Figure 20 1, 2, 3, 7, and 14 weeks after virus injection. Curve a represents Con and curve b represents rAAV. Compared with the control group, the HBV DNA copy number in the serum of the mice in the adeno-associated virus gene therapy vector treatment group decreased significantly, indicating that the adeno-associated virus gene therapy vector of the present invention can significantly inhibit viral replication. 14 weeks after virus injection, the target gene expression in the mouse liver is shown in Figure 21. The SP-PGLYRP2 fused to SP in the control group was significantly decreased. PGRP The protein is secreted outside the cell and its intracellular content is relatively low. However, PGLYRP2 fused with NLS 209～377aa-NLS protein had a high intracellular content; the adeno-associated virus gene therapy vector virus group of the experimental group with double fusion proteins contained the above two fusion protein bands.

[0098] 1×10 11 The AAV virus with the highest copy number was injected into C57BL / 6J mice. Ten mice injected with the virus showed no death or obvious discomfort within 14 days, indicating that the adeno-associated virus gene therapy vector of the present invention is safe.

[0099] Fourteen weeks after virus injection, the rAAV group (pAAV-EnII-EnCMV-M-PGLYRP2) showed a significantly higher level of cytokines compared to the Con group (pAAV-CMV). 209～377aa -NLS-IRES-SP-PGLYRP2 PGRP ) in the liver of mice treated with rAAV (pAAV-EnII-EnCMV-M-PGLYRP2 209～377aa -NLS-IRES-SP-PGLYRP2 PGRP ) has a significant effect on the clearance of viral cccDNA pool in vivo ( FIG22 ).

[0100] Fourteen weeks after virus injection, the rAAV group (pAAV-EnII-EnCMV-M-PGLYRP2) showed a significantly higher level of cytokines compared to the Con group (pAAV-CMV). 209～377aa -NLS-IRES-SP-PGLYRP2 PGRP ) in the blood of mice infected with rAAV (pAAV-EnII-EnCMV-M-PGLYRP2 209～377aa -NLS-IRES-SP-PGLYRP2 PGRP ) has a significant effect on the clearance of viral surface antigens in vivo (Figure 23).

[0101] Current treatment strategies for chronic hepatitis B can effectively inhibit HBV replication, but achieving a complete cure is difficult because free cccDNA in the patient's liver persists in the cell nucleus for a long time, making it difficult for drugs to clear it, and discontinuation of medication often leads to relapse. Therefore, the long-term presence of cccDNA in infected hepatocytes is a key factor in the persistence of viral infection and a major obstacle to the cure of hepatitis B. Drugs that can clear the cccDNA reservoir in the body offer hope for a complete cure.

[0102] The statistical analysis results of the real-time quantitative PCR data of the present invention for detecting the relative cccDNA content in mouse liver tissue 14 weeks after virus injection show that, based on the average renewal cycle of liver cells of 12 weeks, the adeno-associated virus gene therapy vector of the present invention can significantly eliminate cccDNA within 14 weeks, suggesting that the present invention has great potential to achieve a complete cure for hepatitis B.

Claims

1. A viral gene therapy vector for eliminating hepatitis B virus, characterized in that It includes promoter, intron, enhancer, PGLYRP2 protein nuclear localization signal NLS functional domain encoding gene, PGLYRP2 protein HBV DNA binding domain encoding gene, PGLYRP2 protein secretion signal peptide functional domain encoding gene, PGLYRP2 protein HBV nucleocapsid binding functional domain encoding gene and IRES fragment.

2. A viral gene therapy vector for eliminating hepatitis B virus according to claim 1, characterized in that The promoter is a truncated version M of the PGLYRP2 gene promoter, and its nucleotide sequence is shown in SEQ ID NO: 1 in the sequence table.

3. A viral gene therapy vector for eliminating hepatitis B virus according to claim 2, characterized in that The enhancers are CMV enhancer and HBV EnII element. The nucleotide sequence of CMV enhancer is shown in SEQ ID NO: 2 in the sequence list, and the nucleotide sequence of HBV EnII element is shown in SEQ ID NO: 3 in the sequence list.

4. A viral gene therapy vector for eliminating hepatitis B virus according to claim 3, characterized in that The PGLYRP2 protein nuclear localization signal NLS functional domain encoding gene is the C-terminal 550-576 amino acid encoding gene of the PGLYRP2 protein, and its nucleotide sequence is shown in SEQ ID NO: 4 in the sequence list.

5. A viral gene therapy vector for eliminating hepatitis B virus according to claim 4, characterized in that The nucleotide sequence of the gene encoding the HBV DNA binding domain of the PGLYRP2 protein is shown in SEQ ID NO: 5 in the sequence listing.

6. A viral gene therapy vector for eliminating hepatitis B virus according to claim 5, characterized in that The nucleotide sequence of the gene encoding the secretory signal peptide functional domain of the PGLYRP2 protein is shown in SEQ ID NO: 6 in the sequence listing.

7. A viral gene therapy vector for eliminating hepatitis B virus according to claim 5, characterized in that The nucleotide sequence of the gene encoding the HBV nucleocapsid binding domain of the PGLYRP2 protein is shown in SEQ ID NO: 7 in the sequence listing.

8. A viral gene therapy vector for eliminating hepatitis B virus according to claim 1, characterized in that The vector backbone of the viral gene therapy vector is an adeno-associated virus vector, an adenovirus vector, a lentivirus vector or a retrovirus vector; the adeno-associated virus vector is an AAV2, AAV5, AAV7, AAV8, AAV9 or AAV-DJ type adeno-associated virus vector.

9. A drug for treating hepatitis B virus infection, characterized in that: Contains the viral gene therapy vector as described in any one of claims 1 to 8.

10. Use of the viral gene therapy vector according to any one of claims 1 to 8 in the preparation of a drug for treating hepatitis B virus infection.

Images