Method for detecting cancer of the reproductive tract using methylation of GYPC and zscan 12 genes

Abstract

The present invention relates to assays for assessing the presence, absence or development of cancer of the female reproductive tract in an individual, in particular endometrial cancer. The cancer is detected based on methylation of regions in GYPC and ZSCAN12. The invention also relates to in vitro methods of assaying DNA and detecting methylation of the DNA therein, including amplificationbased assay and detection methods such as PCR. The invention also relates to kits and systems for performing the assay and detection methods. The invention also relates to methods of treating and / or preventing cancer of the female reproductive tract in an individual, and methods of monitoring the cancer status and / or the risk of cancer development in an individual wherein the cancer is of the female reproductive tract.

Description

[0001]METHOD FIELD OF THE INVENTION The present invention relates to assays for assessing the presence, absence or development of cancer of the female reproductive tract in an individual. The invention also relates to in vitro methods of assaying DNA and detecting methylation of the DNA therein, including amplification- based assay and detection methods such as PCR. The invention also relates to kits and systems for performing the assay and detection methods. The invention also relates to methods of treating and / or preventing cancer of the female reproductive tract in an individual, and methods of monitoring the cancer status and / or the risk of cancer development in an individual wherein the cancer is of the female reproductive tract. BACKGROUND TO THE INVENTION Endometrial cancer is the fourth most common cancer and its incidence continues to rise. Recent evidence suggests that a delay in endometrial cancer diagnosis has a significant negative impact on survival. No screening exists for endometrial cancer and the lead symptom is abnormal uterine bleeding (AUB). In the US and the UK, approximately 1.4 million and 800,000 cases of AUB, respectively, are reported each year, making this symptom one of the most common reasons for urgent referrals to gynaecological rapid access clinics. However, only 1·2% and 9% of pre- (≥ 45 years of age) and postmenopausal women, respectively, presenting with AUB are eventually diagnosed with endometrial cancer. Ultrasonography [performed transvaginally (TVS), transabdominally (TAS), transrectally (TRS), or based on saline infusion sonography (SIS)] is used to identify those women with AUB who have the highest cancer risk and therefore require a biopsy, which is usually obtained via a pipelle and / or hysteroscopy / endometrial biopsy. Sonographically assessed endometrial thickness in postmenopausal women with a cut-off of > 3mm, ≥ 4 mm or ≥ 5 mm detects endometrial cancer with a sensitivity of 97·9%, 94·8% or 90·8% and a specificity of 35·4%, 52·7% and 62·4%, respectively, although substantially inferior sensitivity / specificity performance is reported in black women. Due to the low specificity of ultrasonography, further invasive testing and stressful diagnostic procedures may need to be conducted more than 50% of women with AUB. An urgent need exists for a test that detects all uterine cancers (i.e., endometrial, endocervical, ectocervical, and uterine metastasis) in patients presenting with AUB and is easy to apply, delivers objective results quickly, and improves on sonography performance parameters. In particular, a test with a much lower false positive test rate amongst women presenting with abnormal uterine bleeding would greatly reduce the number of invasive diagnostic procedures needed. Recent evidence suggests that subjective pattern recognition, which utilises endometrial morphological features and vascular patterns detected on Doppler ultrasound, can improve the specificity of ultrasound. However, at present, most clinics do not have the dedicated equipment or highly trained staff required to apply subjective pattern recognition. In addition, to date, no systematic prospective observational study has captured all parameters required to evaluate the efficacy of the complete diagnostic pathway in order to identify malignancy in women with AUB. Overall, the current index imaging pathway is highly dependent on a healthcare system working at optimal capacity, i.e., supported by good infrastructure and high staffing levels. When the robustness of a healthcare system is challenged by staffing issues and financial constraints as it is currently in several countries, waiting times for diagnostic pathways are adversely affected. This reinforces the urgent need for a test that is easy to apply, can be analysed within a short period of time, and thereby tangibly decreases the time and complexity of diagnosis. SUMMARY OF THE INVENTION The current inventors set out to understand whether DNAme (DNA methylation) profiles may be used to detect the presence or absence of cancer of the female reproductive tract. The inventors also set out to understand whether said DNAme profiles may be associated with the development of cancer, and therefore whether such profiles may be capable of functioning as surrogate markers for individual stratification purposes in connection with cancer. In contrast to existing assays that may be used for assessing the presence, absence or development of cancer of the female reproductive tract in an individual, the present invention provides hugely simplified test for cancer diagnosis or determination of cancer risk. The assay according to the present invention is simplified by requiring the assessment of CpG methylation of at least two genomic regions, yet nevertheless maintaining extremely high sensitivity and specificity. Such a simplified test provides not only cost benefits to individuals and public health organisations, it also allows assessments to be conducted more rapidly and more frequently, thereby allowing women to subject to the appropriate course of further cancer tests (i.e. such as obtaining tissue by means of invasive procedures to make a histological diagnosis), and potentially cancer treatment, without delay. For example, a test according to the present invention has particular advantages in the diagnosis of uterine cancer relative to pre-existing tests. Current strategies for detecting uterine cancer in women presenting with abnormal uterine bleeding (AUB) require women to undergo index imaging tests (i.e. various modalities of ultrasound and other cross- sectional imaging techniques) followed by reference histology tests that fail to detect all cancers. An assessment according to the present invention delivers fast results and shows superior performance compared to a combination of imaging index tests. Triage of women with AUB using an assessment according to the present invention could reduce the number of women requiring histological assessments for identification of potential malignancies. Accordingly, the invention provides an assay for assessing the presence, absence or development of cancer of the female reproductive tract in an individual, the assay comprising: a. providing a sample which has been taken from the individual, the sample comprising a population of DNA molecules; b. determining in the population of DNA molecules in the sample the methylation status of a test panel of two or more CpGs, wherein: i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 18, and wherein the at least one CpG is denoted by [[CG]]; and ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 2 and SEQ ID NO 19, and wherein the at least one CpG is denoted by [[CG]]; and c. assessing the presence, absence or development of cancer of the female reproductive tract in the individual based on the methylation status of the CpGs in the test panel. The invention further provides a system for a PCR assay, the system comprising: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated. The invention further provides a kit comprising: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated and following bisulfite treatment; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 2 in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated and following bisulfite treatment of SEQ ID NO: 2; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated and following bisulfite treatment. The invention further provides an in vitro method of assaying DNA and detecting methylation of the DNA therein, the method comprising measuring a methylation status of a test panel of two or more CpGs, wherein: i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 18, and wherein the at least one CpG is denoted by [[CG]]; and ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 2 and SEQ ID NO 19, and wherein the at least one CpG is denoted by [[CG]]. The invention further provides a method of treating and / or preventing cancer of the female reproductive tract in an individual, the method comprising: i. assessing the presence, absence or development of cancer in the female reproductive tract of an individual according to an assay of the invention; and ii. administering one or more therapeutic or preventative treatments or measures to the individual based on the assessment. The invention further provides a method of monitoring the cancer status and / or the risk of cancer development of an individual, the method comprising: (a) assessing the presence, absence or development of cancer in an individual by performing the assay according to an assay of the invention at a first time point; (b) assessing the presence, absence or development of cancer in the individual by performing the assay according to an assay of the invention at one or more further time points; and (c) monitoring any change in the cancer status and / or the risk of cancer development of the individual, wherein the cancer is of the female reproductive tract. BRIEF DESCRIPTION OF THE FIGURES Figure 1. Study profile UCLH, University College London Hospital; TVS, transvaginal sonography; TAS, transabdominal sonography; TRS, transrectal sonography; SIS, saline contrast sonohysterography; MRI, magnetic resonance imaging. Figure 2. Area under the receiver-operating-characteristic (ROC) curve (AUC). Comparison of sonographically assessed endometrial thickness and WID®-qEC ΣPMR in all participants (A) and in postmenopausal participants only (B). Figure 3. Baseline characteristics of study population For age and BMI ranges are provided in parentheses.1Cancer characteristics: Seven and five stage I and > stage I, respectively; two, four, and six grade 1, 2, and 3, respectively; Eleven primary endometrial and one tubal cancer metastasis in endometrium.2Amongst the 162 patients who had a negative reference histology 32 had a normal endometrium, 10 a simple hyperplasia, 101 a polyp without atypia, 12 benign fibroids, 2 endometritis, 4 an atypical hyperplasia and 1 CIN1.3Individuals without a final diagnosis at timing of study cut-off-date: Five patients were medically unfit for further procedures; four patients were lost to follow up; three patients declined further investigations. Figure 4. Outcome of test positive, test negative, and test inconclusive patients.1Only the 387 with a final diagnosis out of the total 399 women are listed. Note, one patient (uterine metastasis of a tubal cancer) had no reference test, but histology was obtained at hysterectomy. Figure 5. Performance characteristics of sonographic assessments and the WID®-qEC test PPV, positive predictive value; NPV, negative predictive value. Figure 6. Target-specific specificity and sensitivity depending on DNA input amount (COL2A1 CT value). Figure 7. Change in specificity and sensitivity in the presence or absence of GYPC (Chr2: 127413858-127413944) with COL2A1 CT<28. Change of Specificity and Sensitivity in Presence (3 targets) or Absence (2 targets) of GYPC (Chr2:127413858-127413944) with COL2A1 CT<28*. *COL2A1 CT <28 in both technical replicates; targets with CT< target CAT in both replicates for at least one target. Figure 8. Analytical sensitivity in methylation Standard (100% - 0.1% methylated in unmethylated DNA). Higher sensitivity and reproducible detection of 1% methylated DNA can be observed in the GYPC (Chr2: 127413797-127413902) duplex reaction together with COL2A1. Figure 9. Analytical sensitivity in a gBlock Standard (1,000,000 to 1 copy). Higher sensitivity down to 10 copies is observed in the GYPC (Chr2: 127413797-127413902)) duplex reaction with COL2A1 compared to GYPC single reaction, where 10 copies cannot be detected reproducibly. Figure 10. ZSCAN12 (Chr2: 28367535-28367599) in real-life samples in single (ZSCAN12_singl) reaction as well as in a duplex reaction (ZSCAN12_dupl) together with COL2A1 (Chr12: 48381229-48381320) (not shown). Figure 11. GYPC (Chr2: 127413797-127413902) in real-life samples in single reaction (GYPC_singl) as well as in a duplex reaction (GYPC_dupl) together with COL2A1 (Chr12: 48381229-48381320) (not shown). COL2A1 appears to “stabilise” the GYPC reaction in the duplex reaction samples that show low target methylation (FR10280286), whereas CT values for samples with high target methylation (FR15123655) are similarly high. Figure 12. Modelled outcomes for assessment of 100 women presenting with abnormal uterine bleeding. Presented are outcomes for an ultrasound endometrial thickness (ET) cut-off of > 3 mm (A) or WID®-qEC with ΣPMR cutoff of ≥ 0·3 (B). Figure 13. Experimental setup. In 8 women (group A) the cervicovaginal sample was collected using the FLOQSwab (Copan) first and subsequently using the Cervex (ThinPrep) brush and in additional 8 women (group B) the cervicovaginal sample was collected using Cervex brush first and then the FLOQSwab swab. All but one of the 16 women had an active endometrial cancer at the time of sample collection. Figure 14. Comparison of the WID-qEC ∑PMR values obtained from sample collected with the Copan and the ThinPrep system. Note that only the patient with no active disease had a WID-qEC ∑PMR = 0; all 15 women with active endometrial cancer and Copan collected had a WID-qEC ∑PMR > 0,3. The patient without endometrial cancer had a negative WID-qEC test results (WID-qEC ∑PMR = 0). Figure 15. Effect of 7-day storage of the Copan-based eNAT sample. SEQUENCES SEQ ID NO: 1 – differentially methylated region within the human GYPC gene having the chromosomal coordinates Chr2: 127413797-127413902 Positive strand 5’-3’ (design strand): CCTGGCCAGTCCCCGCGGTCTCTGCCCGGGCTGACGCCCAGGAATGTGGTCGACGAGAAGCCCCAA CAGCACGGCGTGGCCTCTCAGCCTCGGTGAGTACCCGCCG Wherein CpG dinucleotides of the sequence of SEQ ID NO: 1 which may be determined to be methylated according to the invention described herein are denoted by [[CG]] as depicted as follows: CCTGGCCAGTCCC[[CG]][[CG]]GTCTCTGCC[[CG]]GGCTGA[[CG]]CCCAGGAATGTGGT [[CG]]ACGAGAAGCCCCAACAGCACGGCGTGGCCTCTCAGCCT[[CG]]GTGAGTACC[[CG]]C [[CG]] SEQ ID NO: 2 – differentially methylated region within the human ZSCAN12 gene having the chromosomal coordinates Chr6: 28367535-28367599 Negative strand 5’-3’ (design strand): AGAGCGGCCGCGGAAGTGCGCCCCGCGCGGGCTGGTTCTTAGACCCCCCGTGGCCGCTTCCGGCC Wherein CpG dinucleotides of the sequence of SEQ ID NO: 2 which may be determined to be methylated according to the invention described herein are denoted by [[CG]] as depicted as follows: AGAG[[CG]]GC[[CG]][[CG]]GAAGTG[[CG]]CCC[[CG]][[CG]][[CG]]GGCTGGTTC TTAGACCCCC[[CG]]TGGC[[CG]]CTTC[[CG]]GCC SEQ ID NO: 3 - control within human COL2A1 gene having the chromosomal coordinates Chr12: 48381229-48381320 Positive strand 5’-3’ (design strand): GGGAAGATGGGATAGAAGGGAATACATCTAGAGGTGGGACAGGCATTGGGCCAGAATGAAGGTTTG GTGGTTGGAGCCCACAACTGTCAGA SEQ ID NO: 4 – region within the human GYPC gene having the chromosomal coordinates Chr2: 127413858-127413944 Negative strand 5’-3’ (design strand): TG[[CG]]GGC[[CG]][[CG]]GCCTCCAGTGGGTCCCCAGGACCCTTCCCCA[[CG]]G[[CG] ]GGTACTCAC[[CG]]AGGCTGAGAGGCCA[[CG]]C[[CG]]TGCTGTTGGG Wherein CpG dinucleotides of the sequence of SEQ ID NO: 14 which may be determined to be methylated according to the invention described herein are denoted by [[CG]] as depicted as follows: TG[[CG]]GGC[[CG]][[CG]]GCCTCCAGTGGGTCCCCAGGACCCTTCCCCA[[CG]]G[[CG] ]GGTACTCAC[[CG]]AGGCTGAGAGGCCA[[CG]]C[[CG]]TGCTGTTGGG SEQ ID NO: 5 – a forward primer for hybridising to a region of the sequence defined by SEQ ID NO: 1 TTTGGTTAGTTTTCGCGGTTTT SEQ ID NO: 6 – a reverse primer for hybridising to a region of the sequence defined by SEQ ID NO: 1 CGACGAATACTCACCGAAACTAAA SEQ ID NO: 7 – a MethyLight probe for hybridising to a region of the sequence defined by SEQ ID NO: 1 TCGGGTTGACGTTTAGGAATGTGGTCG SEQ ID NO: 8 – a forward primer for hybridising to a region of the sequence defined by SEQ ID NO: 2 AGAGCGGTCGCGGAAGT SEQ ID NO: 9 – a reverse primer for hybridising to a region of the sequence defined by SEQ ID NO: 2 AACCGAAAACGACCACGAAA SEQ ID NO: 10 – a MethyLight probe for hybridising to a region of the sequence defined by SEQ ID NO: 2 CGTTTCGCGCGGGTTGGTTTT SEQ ID NO: 11 – a forward primer for hybridising to a region of the sequence defined by SEQ ID NO: 3 TCTAACAATTATAAACTCCAACCACCAA SEQ ID NO: 12 – a reverse primer for hybridising to a region of the sequence defined by SEQ ID NO: 3 GGGAAGATGGGATAGAAGGGAATAT SEQ ID NO: 13 – a MethyLight probe for hybridising to a region of the sequence defined by SEQ ID NO: 3 CCTTCATTCTAACCCAATACCTATCCCACCTCTAAA SEQ ID NO: 14 – a forward primer for hybridising to a region of the sequence defined by SEQ ID NO: 4 TGCGGGTCGCGGTTT SEQ ID NO: 15 – a reverse primer for hybridising to a region of the sequence defined by SEQ ID NO: 4 CCCAACAACACGACGTAACCT SEQ ID NO: 16 – a MethyLight probe for hybridising to a region of the sequence defined by SEQ ID NO: 4 TTTTTTTTACGGCGGGTATTTATCGAGGTTG SEQ ID NO: 16 – synthetic polypeptide CTC ACT TGT AGA ACG GTG ATC AGC CTG TGC TCT AGA GCC TGA TAG TTG AGC GAT ACA CAC AGA GCG GTC GCG GAA GTG CGT TTC GCG CGG GTT GGT TTT TAG ATT TTT CGT GGT CGT TTT CGG TTA GTC GTA GCT CCC ACA ATC ATC GTA GGT GTT TTG GTT AGT TTT CGC GGT TTT TGT TCG GGT TGA CGT TTA GGA ATG TGG TCG ACG AGA AGT TTT AAT AGT ACG GCG TGG TTT TTT AGT TTC GGT GAG TAT TCG TCG CGT CCA AGA CAT ACT GCG TTT ACG TGT CGA GGG AAG ATG GGA TAG AAG GGA ATA TAT TTA GAG GTG GGA TAG GTA TTG GGT TAG AAT GAA GGT TTG GTG GTT GGA GTT TAT AAT TGT TAG ATG ATC GTT GAA GTC GAC CTA CAT CGA GTG CGC ACT ATC AAG AGT GTT CCA GTC ACG CGA T SEQ ID NO: 18 – differentially methylated region within the human GYPC gene having the chromosomal coordinates Chr2: 127413797-127413902 Negative strand 5’-3’: CGGCGGGTACTCACCGAGGCTGAGAGGCCACGCCGTGCTGTTGGGGCTTCTCGTCGACCACATTCC TGGGCGTCAGCCCGGGCAGAGACCGCGGGGACTGGCCAGG Wherein CpG dinucleotides of the sequence of SEQ ID NO: 18 which may be determined to be methylated according to the invention described herein are denoted by [[CG]] as depicted as follows: [[CG]]G[[CG]]GGTACTCAC[[CG]]AGGCTGAGAGGCCACGCCGTGCTGTTGGGGCTTCTCGT [[CG]]ACCACATTCCTGGG[[CG]]TCAGCC[[CG]]GGCAGAGAC[[CG]][[CG]]GGGACTG GCCAGG SEQ ID NO: 19 – differentially methylated region within the human ZSCAN12 gene having the chromosomal coordinates Chr6: 28367535-28367599 Positive strand 5’-3’: GGCCGGAAGCGGCCACGGGGGGTCTAAGAACCAGCCCGCGCGGGGCGCACTTCCGCGGCCGCTCT Wherein CpG dinucleotides of the sequence of SEQ ID NO: 19 which may be determined to be methylated according to the invention described herein are denoted by [[CG]] as depicted as follows: GGC[[CG]]GAAG[[CG]]GCCA[[CG]]GGGGGTCTAAGAACCAGCC[[CG]][[CG]][[CG]] GGG[[CG]]CACTTC[[CG]][[CG]]GC[[CG]]CTCT SEQ ID NO: 20 – region within the human GYPC gene having the chromosomal coordinates Chr2: 127413858-127413944 Positive strand 5’-3’: CCCAACAGCACGGCGTGGCCTCTCAGCCTCGGTGAGTACCCGCCGTGGGGAAGGGTCCTGGGGACC CACTGGAGGCCGCGGCCCGCA Wherein CpG dinucleotides of the sequence of SEQ ID NO: 20 which may be determined to be methylated according to the invention described herein are denoted by [[CG]] as depicted as follows: CCCAACAGCA[[CG]]G[[CG]]TGGCCTCTCAGCCT[[CG]]GTGAGTACC[[CG]]C[[CG]]T GGGGAAGGGTCCTGGGGACCCACTGGAGGC[[CG]][[CG]]GCC[[CG]]CA All sequences are shown in the 5’ to 3’ direction. DETAILED DESCRIPTION OF THE INVENTION The present invention will be described with respect to particular embodiments and with reference to certain drawings but the disclosure is not limited thereto. Any reference signs in the claims shall not be construed as limiting the scope. It should be appreciated that “embodiments” of the disclosure can be specifically combined together unless the context indicates otherwise. The specific combinations of all disclosed embodiments (unless implied otherwise by the context) are further disclosed embodiments of the claimed invention. In addition, as used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a polynucleotide” includes two or more polynucleotides, reference to “a protein” includes two or more proteins, and the like. "About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ± 20 % or ± 10 %, more preferably ± 5 %, even more preferably ± 1 %, and still more preferably ± 0.1 % from the specified value, as such variations are appropriate to perform the disclosed methods. “Polynucleotide”, “nucleotide sequence”, “DNA sequence”, or “nucleic acid molecule(s)” as used herein refers to a polymeric form of nucleotides of any length, which comprises ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA, and RNA. The term “polynucleotide ” as used herein, may be a single or double stranded covalently-linked sequence of nucleotides in which the 3' and 5' ends on each nucleotide are joined by phosphodiester bonds. The polynucleotide may be made up of deoxyribonucleotide bases or ribonucleotide bases. Polynucleotides may be manufactured synthetically in vitro or isolated from natural sources. Polynucleotides may further include modified DNA or RNA, for example DNA or RNA that has been methylated, or RNA that has been subject to post-translational modification, for example 5’- capping with 7-methylguanosine, 3’-processing such as cleavage and polyadenylation, and splicing. Polynucleotides may also include synthetic nucleic acids (XNA), such as hexitol nucleic acid (HNA), cyclohexene nucleic acid (CeNA), threose nucleic acid (TNA), glycerol nucleic acid (GNA), locked nucleic acid (LNA) and peptide nucleic acid (PNA). Chromosomal coordinates with reference to a human polynucleotide sequence are defined with respect to hg19. A Differentially Methylated Region (DMR) refers to a double-stranded polynucleotide sequence, formed of complementary polynucleotide sequences, whereby differential CpG methylation of one or more CpGs may be observed. The DMR may be an isolated double-stranded polynucleotide sequence. The DMR may be a region within a double stranded sequence optionally comprised within a population of DNA molecules. The DMR may be a region within a genome. The skilled person is aware that CpG methylation observed in a first strand of a DMR effectively acts as a surrogate indicator for the presence of CpG methylation at the complementary CpG dinucleotide in the complementary second strand of said DMR. For the purposes of determining the methylation status of CpG in a DMR, the skilled person would therefore be aware that determining CpG methylation in one strand of a DMR is sufficient to define a CpG within a DMR as a whole (i.e. on either strand) as methylated. Described particularly herein are methods for determining methylation status of CpGs in a test panel whereby the methods rely on PCR directed towards one strand of a DMR, in order to thereby determine the methylation status of CpGs within the DMR as a whole. The skilled person would be able to devise a method likewise relying on PCR but directed to the complementary strand in order to determine the methylation status of CpGs within the DMR as a whole. As used herein, a percentage of “sequence identity” will be understood to arise from a comparison of two sequences in which they are aligned together to give a maximum correlation between the sequences. This may include inserting “gaps” in either one or both sequences to enhance the degree of alignment. The percentage of sequence identity may then be determined over the length of each of the sequences being compared. For example, a nucleotide sequence (“subject sequence”) having at least 95% “sequence identity” with another nucleotide sequence (“query sequence”) is intended to mean that the subject sequence is identical to the query sequence except that the subject sequence may include up to five nucleotide alterations per 100 nucleotides of the query sequence. In other words, to obtain a nucleotide sequence of at least 95% sequence identity to a query sequence, up to 5% (i.e. 5 in 100) of the nucleotides in the subject sequence may be inserted or substituted with another nucleotide or deleted. Percentage identity is also used equivalently in relation to protein sequences but in terms of comparing the corresponding amino acids. Assay A CpG as defined herein refers to the CG dinucleotide motif identified in relation to each SEQ ID NO. nucleotide sequence (SEQ ID NOs 1, 2 and 4), wherein the cytosine base of the CG dinucleotide be modified. Thus, by determining the methylation status of any panel of one or more CpGs defined by or identified in a given SEQ ID NO, it is meant that a determination is made as to the methylation status of the cytosine of the CG dinucleotide motif, accepting that variations in the sequence upstream and downstream of any given CpG may exist due to sequencing errors or variation between individuals. The present inventors sought to identify a simple and easy CpG methylation-based assay capable of assessing the presence, absence or development of cancer of the female reproductive tract in an individual with high sensitivity and specificity. Any of the assays described herein for assessing the presence, absence or development of cancer of the female reproductive tract in an individual are capable of being utilised for assessing the presence, absence or development of cancer of the female reproductive tract. Most preferably, the assay is a diagnostic assay for determining the presence or absence of cancer of the female reproductive tract in the individual. The present inventors determined CpG methylation levels in a cervical sample (e.g. a cervicovaginal swab or a cervical liquid-based cytology sample) using an assay according to the present invention and compared the ability of the assay to accurately diagnose individuals with cancer of the female reproductive tract based on their DNA methylation status with a conventional assessment pathway. Determination of positive DNA methylation according to the assay of the invention indicates a higher probability of a cancer of the female reproductive tract diagnosis, especially a uterine cancer, compared to the conventional multi-step and invasive assessment pathway. Accordingly, applying the assay according to the invention would lead to a smaller number of women requiring urgent invasive diagnostic procedures to detect cancer, substantially reducing delays in diagnosis. A negative DNA methylation assessment using the assay of the invention would indicate a very low probability of cancer. The DNA methylation assay of the invention can for example help assess the likelihood that abnormal uterine bleeding is due to cancer, providing an objective means to decide which patients require urgent referral to a tertiary cancer referral centre. These findings led to the establishment of the assay of the present invention. In any of the assays described herein, in a sample which has been taken from an individual, the sample comprises a population of DNA molecules. The individual may be asymptomatic or symptomatic of a cancer of the female reproductive tract. Symptoms of cancers of the female reproductive tract will be well known to a person of skill in the art. A symptom may comprise abnormal uterine bleeding (AUB). Preferably, the individual may have AUB. The sample may preferably be a cervicovaginal sample. The sample may have been self- collected or collected by a clinician. The sample may have been obtained using a swab of the cervical or upper vaginal region, preferably wherein the swab collects fluid drained from the uterine cavity. Preferably the sample has been obtained using a COPAN Diagnostics Inc FLOQSwab immersing the swab into a lysis buffer (COPAN Diagnostics Inc eNAT®). Alternatively, the sample for example has been obtained by contacting the cervix with a brush device which collects epithelial cells and / or fluid from the cervix to thereby obtaining a cervical liquid-based cytology sample, e.g. using a Cervex-Brush® released into ThinPrep (PreservCyte®). Alternatively, the sample may be obtained using a uterine lavage or an aspiration biopsy, for example by way of a pipelle biopsy. Alternatively, a uterine brush may be used to obtain a sample, e.g. a Tao brush. The invention provides an assay for assessing the presence, absence or development of cancer of the female reproductive tract in an individual, the assay comprising: a. providing a sample which has been taken from the individual, the sample comprising a population of DNA molecules; b. determining in the population of DNA molecules in the sample the methylation status of a test panel of two or more CpGs, wherein: i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 18, and wherein the at least one CpG is denoted by [[CG]]; and ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 2 and SEQ ID NO 19, and wherein the at least one CpG is denoted by [[CG]]; and c. assessing the presence, absence or development of cancer of the female reproductive tract in the individual based on the methylation status of the CpGs in the test panel. The assay of the invention may be further defined wherein: a. at least two CpGs denoted by [[CG]] contained within the first DMR, at least three CpGs denoted by [[CG]] contained within the first DMR, at least four CpGs denoted by [[CG]] contained within the first DMR, at least five CpGs denoted by [[CG]] contained within the first DMR defined by SEQ ID NO: 1, all of the CpGs denoted by [[CG]] contained within at least one strand of the first DMR, or all of the CpGs denoted by [[CG]] contained within the first DMR, are in the test panel of CpGs; and / or b. at least two CpGs denoted by [[CG]] contained within the second DMR, at least three CpGs denoted by [[CG]] contained within the second DMR, at least four CpGs denoted by [[CG]] contained within the second DMR, at least five CpGs denoted by [[CG]] contained within the second DMR, all of the CpGs denoted by [[CG]] contained within at least one strand of the second DMR, or all of the CpGs denoted by [[CG]] contained within the second DMR, are in the test panel of CpGs. The assay of the invention may be further defined wherein at least two CpGs denoted by [[CG]] contained within the first DMR are contained within the test panel and at least two CpGs denoted by [[CG]] contained within the second DMR are contained within the test panel. The assay of the invention may be further defined wherein at least three CpGs denoted by [[CG]] contained within the first DMR are contained within the test panel and at least three CpGs denoted by [[CG]] contained within the second DMR are contained within the test panel. The assay of the invention may be further defined wherein at least four CpGs denoted by [[CG]] contained within the first DMR are contained within the test panel and at least four CpGs denoted by [[CG]] contained within the second DMR are contained within the test panel. The assay of the invention may be further defined wherein at least five CpGs denoted by [[CG]] contained within the first DMR are contained within the test panel and at least five CpGs denoted by [[CG]] contained within the second DMR are contained within the test panel. The assay of the invention may be further defined wherein all of the CpGs denoted by [[CG]] contained within at least one strand of the first DMR are contained within the test panel and all of the CpGs denoted by [[CG]] contained within at least one strand of the second DMR are contained within the test panel. The assay of the invention may be further defined wherein all of the CpGs denoted by [[CG]] contained within the first DMR are contained within the test panel and all of the CpGs denoted by [[CG]] contained within the second DMR are contained within the test panel. The test panel of two or more CpGs may comprise one or more, or all, of the CpGs denoted by [[CG]] identified in a third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO: 4. More preferably the test panel may not comprise determining in the population of DNA molecules in the sample the methylation status of one or more CpGs denoted by [[CG]] contained with the third DMR, optionally wherein the assay does not comprise determining the methylation status of any of the CpGs denoted by [[CG]] contained within the third DMR. The test panel of two or more CpGs may consist of the CpGs denoted by [[CG]] contained with the first strand of the first DMR defined according to SEQ ID NO 1 and the denoted by [[CG]] contained within the second strand of the second DMR defined according to SEQ ID NO 2. In the assay of the invention, when the CpGs of the test panel of two or more CpGs are determined to be methylated, the individual may be assessed as having cancer in the female reproductive tract, or as being at risk of development of cancer of the female reproductive tract. The cancer of the female reproductive tract may comprise endometrial cancer, endometrial, endocervical, ectocervical, uterine metastasis, cervical cancer, fallopian tube (tubal) cancer, ovarian cancer, vaginal cancer and vulvar cancer, preferably wherein the cancer of the female reproductive tract is endometrial cancer, ovarian or tubal. Most preferably, the cancer of the female reproductive tract is endometrial cancer. The cancer may be a new cancer, but may also be a recurring cancer. Cancer recurrence is a well understood term in the art, and may mean that the original cancer returns either in the same tissue, in an organ adjacent to the tissue where the cancer originated from (e.g. vagina) or elsewhere in the body. The cancer may be a metastasis of a cancer of the female reproductive tract or a metastasis present in the female reproductive tract yet originating in a cancer of an organ distinct from the female reproductive tract. Described herein are assays that utilise a statistically robust panel of two or more CpGs whose methylation status can be determined to provide a reliable prediction of the presence, absence or development of cancer of the female reproductive tract in an individual. By determining the methylation status of each CpG within the panel of one or more CpGs, the individual’s cancer status or risk of developing cancer can be determined with statistically robust sensitivity and specificity. The skilled person would understand that the methylation status of each CpG within a panel of two or more CpGs can be determined by any suitable means. Any one method, or a combination of methods, may be used to determine the methylation status of each CpG within a panel of two or more CpGs. Various exemplary methods for determining the methylation status of each CpG within a panel of two or more CpGs are described herein. For example, in one method a percent methylated reference (PMR) value of a CpG may be determined. In another method the methylation β-values of a CpG may be determined. In another method, methylation-sensitive enzymes can be employed which digest or cut only in the presence of methylated DNA. Preferably such methods comprising the use of methylation-sensitive enzymes would not comprise subjecting the two or more CpGs in the test panel to bisulfite treatment, and would preferably further comprise digital PCR. Different mechanisms may be employed to determine specific values depending on the circumstances, such as PCR-based mechanisms or array-based mechanisms, and these different methods are discussed further herein in ‘Assessment of methylation status of CpGs’. As described herein, the methods of determining methylation status when applied to the assay of the invention can establish absence of cancer of the female reproductive tract in the individual. Likewise, such methods can determine that an individual’s risk of cancer development or whether the individual has cancer, wherein the cancer is of the female reproductive tract. A skilled person will readily appreciate that methylation status of the test panel of two or more CpGs can indicate a “likelihood” or “risk” or “prediction” of any of the assays of the invention correctly assessing the presence, absence or development of cancer of the female reproductive tract in an individual. This is because the assessment is based upon a correlation between DNA methylation profiles of tissue samples and individual disease status. Nevertheless, as demonstrated by data set out in the Examples and elsewhere herein, the assays of the invention provide such correlations with high statistical accuracy, thus providing the skilled person with a high degree of confidence that the breast cancer index value which is determined for any test individual whose cancer status is required to be tested will provide an accurate correlation with actual disease status for the individual. In the context of the present invention, “likelihood”, “risk” and “prediction” may be used synonymously with each other. Any references herein to sequences, genomic sequences and / or genomic coordinates are derived based upon Homo sapiens (human) genome assembly GRCh37 (hg19). The skilled person would understand variations in the nucleotide sequences of any given sequence, particularly the sequences of SEQ ID NOs 1 to 4, may exist due to sequencing errors and / or variation between individuals. The assay of the invention represents a ‘prediction’ because the determination of any test panel of two or more CpGs in accordance with the invention is unlikely to be capable of diagnosing every individual as having or not having cancer with 100% specificity and 100% sensitivity. Rather, depending on the specific set of CpGs, the false positive and false negative rate will vary. In other words, the inventors have discovered that an assay comprising the determination of a test panel of CpGs wherein at least one CpGs is derived from a first DMR comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 18, and wherein the at least one CpG is denoted by [[CG]], and wherein at least one CpG is derived from a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 2 and SEQ ID NO 19, and wherein the at least one CpG is denoted by [[CG]], assays of the invention can achieve variable levels of sensitivity and specificity for predicting the presence, absence or development of cancer of the female reproductive tract, as defined by receiver operating characteristics. Such sensitivity and specificity can be seen from the data disclosed herein to be achievable at high proportions, demonstrating accurate and statistically-significant discriminatory capability. Assessing the ‘development’ of cancer in the context of the invention may refer to assessing whether an individual is likely or unlikely to develop cancer. The CpGs of the assays of the invention may indicate that cells of the female reproductive tract may eventually transform to cancer. Assessing the development of cancer in accordance with the assays of the invention may refer to assessing progression or worsening of a pre-existing cancer lesion in an individual. Assessment of the development of cancer in accordance with the assays of the invention may refer to predicting the likelihood of recurrence of cancer. In any of the assays described herein, the step of assessing the presence or development of cancer of the female reproductive tract in an individual based may involve the application of a threshold value. This value may typically depend on the method used for determining the methylation status of the CpGs in the test panel of two or more CpGs. Typically, the threshold value will relate to the proportion methylated DNA molecules in the sample having positive methylation at two or more CpGs of the test panel. Determining the methylation status can be performed by any of the suitable methods described herein. In any of such assays of the invention, the assay may be characterised as having a ROC AUC of 0.60 or more, 0.61 or more, 0.62 or more, 0.63 or more, 0.64 or more, 0.65 or more, 0.66 or more, 0.67 or more, 0.68 or more, 0.69 or more, 0.70 or more, 0.71 or more, 0.72 or more, 0.73 or more, 0.74 or more, 0.75 or more, 0.76 or more, 0.77 or more, 0.78 or more, 0.79 or more, 0.80 or more, 0.81 or more, 0.82 or more, 0.83 or more, 0.84 or more, 0.85 or more, 0.86 or more, 0.87 or more, 0.88 or more, 0.89 or more or 0.90 or more. Preferably, the step of determining the methylation status of the CpGs in the test panel may comprise an amplification-based technique. Amplification may be performed by any suitable method, such as polymerase chain reaction (PCR), polymerase spiral reaction (PSR), loop mediated isothermal amplification (LAMP), nucleic acid sequence based amplification (NASBA), self- sustained sequence replication (3SR), rolling circle amplification (RCA), strand displacement amplification (SDA), multiple displacement amplification (MDA), ligase chain reaction (LCR), helicase dependant amplification (HDA), ramification amplification method (RAM), recombinase polymerase amplification (RPA) etc. Preferably, amplification is performed by polymerase chain reaction (PCR). Optionally, wherein the PCR comprises quantification, further optionally wherein the PCR comprises real time quantitative PCR and / or digital PCR. The step of determining the methylation status of the CpGs contained within the first DMR and the second DMR by PCR preferably comprises: a. a duplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by [[CG]] in the first DMR, preferably in the strand defined by SEQ ID NO: 1 and a control sequence within the same reaction vessel, preferably wherein the control sequence does not comprise any CpG dinucleotides, denoted by CG; and b. a singleplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by [[CG]] in the second DMR, preferably in the strand defined by SEQ ID NO: 2, preferably wherein the singleplex PCR reaction is in a different reaction vessel to the duplex reaction of (a). Prior to PCR, the two or more CpGs in the test panel may preferably be subject to bisulfite treatment. Bisulfite treatment of nucleic acid molecules is a well-known procedure to the skilled person. In particular the skilled person would be aware of how to treat nucleic acid molecules with bisulfite in order to ensure that all unmethylated cytosines in the nucleic acid molecule are converted to uracil. The PCR reaction comprising PCR amplification of regions comprising one or more CpGs in the first DMR is preferably a duplex reaction further comprising PCR amplification of a control sequence, and preferably wherein said reactions are within the same reaction vessel. The control sequence preferably does not comprise any CpG dinucleotides. The control sequence is preferably defined according to SEQ ID NO: 3. When the assay comprises PCR that is quantified, sufficient input DNA material may preferably be used in the PCR reactions of the assay such that the cycle threshold (CT) of a region of the control sequence is less than 28, preferably wherein the control sequence comprises or consists of a sequence defined by SEQ ID NO: 3. Preferred methods for determining methylation status in the context of PCR may comprise amplification using forward and reverse primers together with a detection system. The detection system may comprise a probe for annealing to any one of the DMRs are sequences assayed according to the invention. The probe may comprise a detection moiety, or the probe may comprise a portion of sequence capable of hybridising to a component of the system comprising a detection moiety. The system may for example be a MethyLight system or a QuARTS (Quantitative allele- specific real-time target and signal amplification) system. Detection systems, including MethyLight and QuARTS, for use as part of a PCR assay for determining methylation status are well-known in the art. A preferred method for determining methylation status in the context of PCR and the assay of the invention is a MethyLight reaction. MethyLight reactions are well-known to the skilled person. MethyLight reactions are PCR reactions in that they comprise the use forward and reverse primers, however the reactions additionally comprise the use of a probe optionally comprising a detection moiety. The probe may for example comprise a nucleic acid sequence able to anneal to a sequence comprised within a sequence defined according to SEQ ID NOs 1-4 following bisulfite treatment, or to the complementary sequence of SEQ ID NOs 1-4 following bisulfite sequence, as described herein. Excitation, and subsequent emission by, said detection moiety indicates the presence and amplification of a sequence comprising a complementary sequence to said probe nucleic acid sequence. Preferably prior to such a PCR reaction, such as a MethyLight reaction, the two or more CpGs in the test panel have been subject to bisulfite treatment. Yet more preferably, the PCR can be further characterised wherein: a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and preferably the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 7; and / or b. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; preferably the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 10; and / or c. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 12, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 13. The PCR can be further characterised wherein: a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and preferably the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 7; and b. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and preferably the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 10; and c. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, wherein the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 12, and wherein the probe comprises or consists of a sequence defined according to SEQ ID NO: 13. The PCR may further comprise a negative control. The negative control may be any suitable negative control known in the art. Preferably, the negative control is a PCR reaction absent any template nucleic acid sequence and optionally absent any PCR primer or probes. The negative control may be water. The PCR can be further characterised wherein: a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and wherein the probe comprises or consists of a sequence defined according to SEQ ID NO: 7; and b. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 10; and c. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 12, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 13; and d. a negative control The assay may comprise assessing of the presence, absence or development of cancer of the female reproductive tract in the individual based on methylation of the CpGs in the test panel comprises determination of mean percent of fully methylated reference (PMR) values for each DMR based on the methylation status of the CpGs from each DMR comprised in the test panel. The sum of the PMR values for each DMR (ΣPMR) may be used to assess the presence, absence or development of cancer of the female reproductive tract in the individual. As described herein, there are many methods known to the skilled person that could be applied to determine methylation status of the test panel of two or more CpGs. However, an exemplary preferred approach for the determination of the methylation status of each CpG within the panel of two or more CpGs in the assay of the invention comprises PCR and wherein the PCR is characterised wherein: a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 7; and b. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 10; and c. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 12, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 13, and wherein the assay further comprises determination of mean percent of fully methylated reference (PMR) values for each strand based on the methylation status of the CpGs from each strand comprised in the test panel. The ΣPMR is thereby preferably used to assess the presence, absence or development of cancer of the female reproductive tract in the individual. The individual may have AUB, and may be pre- or post-menopausal. The AUC for the described exemplary preferred assay of the invention is at least about 0.90, about 0.91, about 0.92, about 0.93 or about 0.94. Preferably, the ΣPMR for assessing the individual as having cancer of the female reproductive tract, optionally wherein the individual has AUB, is 0.3 or more, preferably wherein the cancer is uterine, endometrial, cervical or ovarian. The cancer may also be assessed to be a metastasis of a female reproductive tract cancer. Determining the ΣPMR by the same method of determining methylation status by PMR, a ΣPMR of more than 0.03 but less than 0.3 is assessed as being at high risk of having cancer of the female reproductive tract and may be subject to repeat assays according to the invention, or treatment or screening methods as described herein. Determining the ΣPMR by the same method of determining methylation status by PMR, a ΣPMR of less than 0.03 is indicative of an absence of cancer of the female reproductive tract in the individual. Whilst the preferred exemplary PMR-based assessment of methylation status of the CpGs in the test panel, and the subsequent assessment of risk by ΣPMR and specified thresholds can be used in accordance with the invention to assess the presence, absence or development of cancer of the female reproductive tract in an individual, the skilled person would appreciate that alternative methods for determining methylation status can be utilised as described herein and the presence, absence or development of cancer of the female reproductive tract in the individual may be determined accordingly. A particularly preferred embodiment of the invention is therefore an assay for assessing the absence or development of cancer of the female reproductive tract in an individual, the assay comprising: a. providing a sample which has been taken from the individual, the sample comprising a population of DNA molecules; b. determining in the population of DNA molecules in the sample the methylation status of a test panel of two or more CpGs, the panel comprising all of the CpGs denoted by [[CG]] contained within strand of the first DMR having the sequence set forth in SEQ ID NO 1, and all of the CpGs denoted by [[CG]] contained within the strand of the second DMR having the sequence set forth in SEQ ID NO 2; and c. assessing the presence, absence or development of cancer of the female reproductive tract in the individual based on the methylation status of the CpGs in the test panel, wherein the step of determining comprises PCR, and wherein the PCR is characterised wherein: i. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 7; and ii. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 10; and iii. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment; and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 12, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 13, wherein prior to the PCR, the population of DNA molecules is treated with bisulfite; and wherein the cycle threshold (CT) of a region of the control sequence is less than 28; and and wherein the assay further comprises determination of mean percent of fully methylated reference (PMR) values for each DMR based on the methylation status of the CpGs from each DMR comprised in the test panel, and optionally wherein the ΣPMR is determined and the individual is assessed as: A. having cancer of the female reproductive tract, optionally wherein the individual has AUB, when SUM-PMR is 0.3 or more, preferably wherein the cancer is uterine, endometrial, cervical or ovarian; B. being at high risk of having cancer of the female reproductive tract, optionally wherein the individual has AUB, when SUM-PMR is 0.03 but less than 0.3; C. not having cancer of the female reproductive tract, optionally wherein the individual has AUB, when the SUM-PMR is about 0.03 or less. The invention also provides a variety of assays, each comprising any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more (or any range derivable therein) of a variety of steps and in no particular order, including methods of the following: measuring in a sample; analyzing a sample; assessing a sample; evaluating a sample; measuring nucleic acids in a sample; assessing nucleic acids in a sample; detecting nucleic acids in a sample; measuring methylation in nucleic acids in a sample; analyzing nucleic acids in a sample; assessing nucleic acids in a sample; measuring methylation at two or more CpG dinucleotides in a sample; detecting methylation at two or more CpG dinucleotides in a sample; assaying methylation at two or more CpG dinucleotides in a sample; assessing methylation at two or more CpG dinucleotides in a sample; measuring a methylation status in a sample; assaying a methylation status in a sample; detecting methylation status in a sample; determining methylation status in a sample; identifying methylation status in a sample; measuring two or more DNA methylation markers in a sample; assessing two or more DNA methylation markers in a sample; detecting two or more DNA methylation markers in a sample; measuring the presence of methylation at two or more markers in a sample; detecting the presence of methylation at two or more markers in a sample; assessing the presence of methylation at two or more markers in a sample; assaying the presence of one of more markers in a sample; measuring two or more DNA methylation markers in a sample but excluding the measuring of two or more other DNA methylation markers in the sample; assessing two or more DNA methylation markers in a sample but excluding the assessing of two or more other DNA methylation markers in the sample; analyzing two or more DNA methylation markers in a sample but excluding the analyzing of two or more other DNA methylation markers in the sample; detecting two or more DNA methylation markers in a sample but excluding the detecting of two or more other DNA methylation markers in the sample; measuring methylation status in nucleic acids from a sample from tissue from tissue of an individual suspected of, or at risk for, being cancerous; detecting methylation status in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; analyzing methylation status in nucleic acids from a sample from tissue from an individual from the individual suspected of, or at risk for, being cancerous; assessing methylation status in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; measuring methylation at two or more CpG dinucleotides in a sample but excluding the measuring of methylation at two or more CpG dinucleotides in the sample; assessing methylation at two or more CpG dinucleotides in a sample but excluding the assessing of methylation at two or more CpG dinucleotides in the sample; analyzing methylation at two or more CpG dinucleotides in a sample but excluding the analyzing of methylation at two or more CpG dinucleotides in the sample; detecting methylation at two or more CpG dinucleotides in a sample but excluding the detecting of methylation at two or more CpG dinucleotides in the sample; measuring methylation at two or more CpG dinucleotides in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; detecting methylation at two or more CpG dinucleotides in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; analyzing methylation at two or more CpG dinucleotides in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; assessing methylation at two or more CpG dinucleotides in nucleic acids from a sample from tissue from an individual suspected of, or at risk for, being cancerous; treating an individual for cancer when the individual has been determined to have a methylation status at two or more methylation markers; treating an individual for cancer when the individual has been determined to have methylation at two or more CpG dinucleotides; wherein any of the aforementioned methods, or any other methods encompassed by the disclosure, may comprise any two or more of the following method steps: measuring methylation status, wherein the measuring identifies the methylation status of two or markers from nucleic acids in a sample; measuring methylation status, wherein the measuring identifies the presence of two or more markers from nucleic acids in a sample; measuring the presence of two or more methylation markers from a sample; providing DNA from a sample; providing nucleic acids from a sample; determining whether two or more methylation markers from nucleic acids from a sample are methylated; measuring whether two or more methylation markers from nucleic acids from a sample are methylated; performing a sequencing step on nucleic acids from a sample; determining a sequence of nucleic acids from a sample; performing bisulphite conversion on two or more markers; performing bisulphite conversion on two or more CpG dinucleotides; hybridizing DNA to an array comprising probes capable of determining methylated versus non-methylated markers; hybridizing DNA to an array comprising probes capable of determining methylated versus non-methylated CpG dinucleotides; hybridizing DNA to an array comprising probes capable of discriminating between methylated and non-methylated markers; hybridizing DNA to an array comprising probes capable of discriminating between methylated and non-methylated CpG dinucleotides; performing an amplification step on sequence from nucleic acids from a sample; performing an amplification step on sequence from nucleic acids using methylation-specific primers; performing amplification of sequence comprising two or more regions suspected of having methylation or in need of determination of a methylation status; performing PCR on sequence comprising two or more regions suspected of having methylation or in need of determination of a methylation status; performing a capturing step; performing a binding step; performing a purification step; performing a capturing step comprising binding of polynucleotides comprising two or more methylation markers to binding molecules specific to the two or more methylation markers and collecting complexes thereof; stratifying the grade of a cancer; determining the risk of cancer; determining the risk of recurrence of cancer; obtaining a sample from an individual; obtaining DNA from a sample from an individual; administering a treatment to an individual; providing DNA from a sample; determining whether two or more methylation markers from a panel of methylation markers comprises a specific sequence; and / or obtaining data that identifies whether each one of a group of methylation markers from a panel comprises a specific sequence. Moreover, in some aspects of the invention, an individual who is administered a therapy or treatment has been subjected to any of the methods and steps described herein. Assessment of methylation status of CpGs Methylation of DNA is a recognised form of epigenetic modification which has the capability of altering the expression of genes and other elements such as microRNAs. In cancer development and progression, methylation may have the effect of e.g. silencing tumor suppressor genes and / or increasing the expression of oncogenes. Other forms of dysregulation may occur as a result of methylation. Methylation of DNA occurs at discrete loci which are predominately dinucleotides consisting of a CpG motif, but may also occur at CHH motifs (where H is A, C, or T). During methylation, a methyl group is added to the fifth carbon of cytosine bases to create methylcytosine. Methylation can occur throughout the genome and is not limited to regions with respect to an expressed sequence such as a gene. Methylation typically, but not always, occurs in a promoter or other regulatory region of an expressed sequence such as enhancer elements. Most typically, the methylation status of CpGs is clustered in CpG islands, for example CpG islands present in the regulatory regions of genes, especially in their promoter regions. Typically, an assessment of DNA methylation status involves analysing the presence or absence of methyl groups in DNA, for example methyl groups on the 5 position of one or more cytosine nucleotides. Preferably, the methylation status of one or more cytosine nucleotides present as a CpG dinucleotide (where C stands for Cytosine, G for Guanine and p for the phosphate group linking the two) is assessed. A variety of techniques are available for the identification and assessment of CpG methylation status, as will be outlined briefly below. The assays described herein encompass any suitable technique for the determination of CpG methylation status. Methyl groups are lost from a starting DNA molecule during conventional in vitro handling steps such as PCR. To avoid this, techniques for the detection of methyl groups commonly involve the preliminary treatment of DNA prior to subsequent processing, in a way that preserves the methylation status information of the original DNA molecule. Such preliminary techniques involve three main categories of processing, i.e. bisulphite modification, restriction enzyme digestion and affinity-based analysis. A bisulfite-free preliminary technique may comprise TET-assisted pyridine borane sequencing (TAPS) combined with ten-eleven translocation (TET) oxidation of 5mC and 5hmC to 5-carboxylcytosine (5caC), and subsequent pyridine borane reduction of 5caC to dihydrouracil (DHU) for the detection of DNA methylation. Products of these techniques can then be coupled with sequencing or array-based platforms for subsequent identification or qualitative assessment of CpG methylation status. Techniques involving bisulphite modification of DNA have become the most common assays for detection and assessment of methylation status of CpG dinucleotides. Treatment of DNA with bisulphite, e.g. sodium bisulphite, converts cytosine bases to uracil bases, but has no effect on 5-methylcytosines. Thus, the presence of a cytosine in bisulphite-treated DNA is indicative of the presence of a cytosine base which was previously methylated in the starting DNA molecule. Such cytosine bases can be detected by a variety of techniques. For example, primers specific for unmethylated versus methylated DNA can be generated and used for PCR-based identification of methylated CpG dinucleotides. DNA may be amplified, either before or after bisulphite conversion. A separation / capture step may be performed, e.g. using binding molecules such as complementary oligonucleotide sequences. Standard and next-generation DNA sequencing protocols can also be used. Accordingly, in any of the methods described and defined herein, steps of determining in the population of DNA molecules in the sample the methylation status of CpGs in a test panel may be performed by methods which comprise subjecting CpGs to bisulfite treatment, e.g. subjecting the population of DNA molecules in the sample to bisulfite treatment. Any such method may further comprise an amplification step, preferably a PCR amplification step, such as any PCR amplification step described and defined herein. Quantitative allele-specific real-time target and signal amplification (QuARTS) may also be applied to the invention described herein in order to determine in the population of DNA molecules in the sample the methylation status of a test panel of two or more CpGs. QuARTS is known in the art. QuARTS combines a polymerase-based target amplification with an invasive cleavage-based signal amplification. The fluorescence signal is detected in a fashion similar to real-time PCR. Accordingly, in any of the methods described and defined herein, steps of determining in the population of DNA molecules in the sample the methylation status of CpGs in a test panel may be performed by methods which comprise subjecting CpGs to bisulfite treatment, e.g. subjecting the population of DNA molecules in the sample to bisulfite treatment. Any such method may further comprise a PCR amplification step, preferably wherein the PCR amplification step comprises the use of a forward primer, a reverse primer and a detection system, wherein the detection system may comprise a probe for annealing to any one of the DMRs or sequences assayed according to the invention, wherein the probe may comprise a portion of sequence capable of hybridising to a component of the system comprising a detection moiety. In other approaches, methylation-sensitive enzymes can be employed which digest or cut only in the presence of methylated DNA. Such enzyme-based approaches optionally do not require bisulfite treatment of the DNA being assayed. Analysis of resulting fragments is commonly carried out using microarrays. Affinity-based techniques exploit binding interactions to capture fragments of methylated DNA for the purposes of enrichment. Binding molecules such as anti-5-methylcytosine antibodies are commonly employed prior to subsequent processing steps such as PCR and sequencing. Olkhov-Mitsel and Bapat (2012) provide a comprehensive review of techniques available for the identification and assessment of biomarkers involving methylcytosine. For the purposes of assessing the methylation status of the CpG-based biomarkers characterised and described herein, any suitable assay can be employed. Assays described herein may comprise determining methylation status of CpGs by bisulphite converting the DNA. Preferred assays involve bisulphite treatment of DNA, including amplification of the identified CpG loci for methylation specific PCR and / or sequencing and / or assessment of the methylation status of target loci using methylation-discriminatory microarrays. Amplification of CpG loci can be achieved by a variety of approaches. Preferably, CpG loci are amplified using PCR. A variety of PCR-based approaches may be used. For example, methylation-specific primers may be hybridized to DNA containing the CpG sequence of interest. Such primers may be designed to anneal to a sequence derived from either a methylated or non- methylated CpG locus. Following annealing, a PCR reaction is performed and the presence of a subsequent PCR product indicates the presence of an annealed CpG of identifiable sequence. In such assays, DNA is bisulphite converted prior to amplification. Such techniques are commonly referred to as methylation specific PCR (MSP) In other techniques, PCR primers may anneal to the CpG sequence of interest independently of the methylation status, and further processing steps may be used to determine the status of the CpG. Assays are designed so that the CpG site(s) are located between primer annealing sites. This assay scheme is used in techniques such as bisulphite genomic sequencing, COBRA, Ms-SNuPE. In such assay, DNA can be bisulphite converted before or after amplification. Small-scale PCR approaches may be used. Such approaches commonly involve mass partitioning of samples (e.g. digital PCR). These techniques offer robust accuracy and sensitivity in the context of a highly miniaturised system (pico-liter sized droplets), ideal for the subsequent handling of small quantities of DNA obtainable from the potentially small volume of cellular material present in biological samples, particularly urine samples. A variety of such small-scale PCR techniques are widely available. For example, microdroplet-based PCR instruments are available from a variety of suppliers, including RainDance Technologies, Inc. (Billerica, MA; http: / / raindancetech.com / ) and Bio-Rad, Inc. (http: / / www.bio-rad.com / ). Digital PCR from Qiagen and Thermofisher may also be suitable. Microarray platforms may also be used to carry out small- scale PCR. Such platforms may include microfluidic network-based arrays e.g. available from Fluidigm Corp. (www.fluidigm.com). Following amplification of CpG loci, amplified PCR products may be coupled to subsequent analytical platforms in order to determine the methylation status of the CpGs of interest. For example, the PCR products may be directly sequenced to determine the presence or absence of a methylcytosine at the target CpG or analysed by array-based techniques. Any suitable sequencing techniques may be employed to determine the sequence of target DNA. In the assays of the present invention the use of high-throughput, so-called “second generation”, “third generation” and “next generation” techniques to sequence bisulphite-treated DNA can be used. In second generation techniques, large numbers of DNA molecules are sequenced in parallel. Typically, tens of thousands of molecules are anchored to a given location at high density and sequences are determined in a process dependent upon DNA synthesis. Reactions generally consist of successive reagent delivery and washing steps, e.g. to allow the incorporation of reversible labelled terminator bases, and scanning steps to determine the order of base incorporation. Array-based systems of this type are available commercially e.g. from Illumina, Inc. (San Diego, CA; http: / / www.illumina.com / ). Third generation techniques are typically defined by the absence of a requirement to halt the sequencing process between detection steps and can therefore be viewed as real-time systems. For example, the base-specific release of hydrogen ions, which occurs during the incorporation process, can be detected in the context of microwell systems (e.g. see the Ion Torrent system available from Life Technologies; http: / / www.lifetechnologies.com / ). Similarly, in pyrosequencing the base- specific release of pyrophosphate (PPi) is detected and analysed. In nanopore technologies, DNA molecules are passed through or positioned next to nanopores, and the identities of individual bases are determined following movement of the DNA molecule relative to the nanopore. Systems of this type are available commercially e.g. from Oxford Nanopore (https: / / www.nanoporetech.com / ). In an alternative assay, a DNA polymerase enzyme is confined in a “zero-mode waveguide” and the identity of incorporated bases are determined with florescence detection of gamma-labeled phosphonucleotides (see e.g. Pacific Biosciences; http: / / www.pacificbiosciences.com / ). In other assays sequencing steps may be omitted. For example, amplified PCR products may be applied directly to hybridization arrays based on the principle of the annealing of two complementary nucleic acid strands to form a double-stranded molecule. Hybridization arrays may be designed to include probes which are able to hybridize to amplification products of a CpG and allow discrimination between methylated and non-methylated loci. For example, probes may be designed which are able to selectively hybridize to an CpG locus containing thymine, indicating the generation of uracil following bisulphite conversion of an unmethylated cytosine in the starting template DNA. Conversely, probes may be designed which are able to selectively hybridize to a CpG locus containing cytosine, indicating the absence of uracil conversion following bisulphite treatment. This corresponds with a methylated CpG locus in the starting template DNA. Following the application of a suitable detection system to the array, computer-based analytical techniques can be used to determine the methylation status of a CpG. Detection systems may include, e.g. the addition of fluorescent molecules following a methylation status-specific probe extension reaction. Such techniques allow CpG status determination without the specific need for the sequencing of CpG amplification products. Such array-based discriminatory probes may be termed methylation-specific probes. Any suitable methylation-discriminatory microarrays may be employed to assess the methylation status of the CpGs described herein. One particular methylation-discriminatory microarray system is provided by Illumina, Inc. (San Diego, CA; http: / / www.illumina.com / ). In particular, the Infinium MethylationEPIC BeadChip array and the Infinium HumanMethylation450 BeadChip array systems may be used to assess the methylation status of CpGs for predicting cancer development as described herein. Such a system exploits the chemical modifications made to DNA following bisulphite treatment of the starting DNA molecule. Briefly, the array comprises beads to which are coupled oligonucleotide probes specific for DNA sequences corresponding to the unmethylated form of a CpG, as well as separate beads to which are coupled oligonucleotide probes specific for DNA sequences corresponding to the methylated form of an CpG. Candidate DNA molecules are applied to the array and selectively hybridize, under appropriate conditions, to the oligonucleotide probe corresponding to the relevant epigenetic form. Thus, a DNA molecule derived from a CpG which was methylated in the corresponding genomic DNA will selectively attach to the bead comprising the methylation-specific oligonucleotide probe, but will fail to attach to the bead comprising the non-methylation-specific oligonucleotide probe. Single-base extension of only the hybridized probes incorporates a labeled ddNTP, which is subsequently stained with a fluorescence reagent and imaged. The methylation status of the CpG is determined by calculating the ratio of the fluorescent signal derived from the methylated and unmethylated sites. Infinium HumanMethylation450 and MethylationEPIC BeadChip array systems and custom-built arrays can be used to interrogate CpGs in the assays described herein. Alternative or customised arrays could, however, be employed to interrogate the cancer-specific CpG biomarkers defined herein, provided that they comprise means for interrogating all CpG for a given assay, as defined herein. Techniques involving combinations of the above-described assays may also be used. For example, DNA containing CpG sequences of interest may be hybridized to microarrays and then subjected to DNA sequencing to determine the status of the CpG as described above. In the assays described above, sequences corresponding to CpG loci may also be subjected to an enrichment process if desired. DNA containing CpG sequences of interest may be captured by binding molecules such as oligonucleotide probes complementary to the CpG target sequence of interest. Sequences corresponding to CpG loci may be captured before or after bisulphite conversion or before or after amplification. Probes may be designed to be complementary to bisulphite converted DNA. Captured DNA may then be subjected to further processing steps to determine the status of the CpG, such as DNA sequencing steps. Capture / separation steps may be custom designed. Alternatively, a variety of such techniques are available commercially, e.g. the SureSelect target enrichment system available from Agilent Technologies (http: / / www.agilent.com / home). In this system biotinylated “bait” or “probe” sequences (e.g. RNA) complementary to the DNA containing CpG sequences of interest are hybridized to sample nucleic acids. Streptavidin-coated magnetic beads are then used to capture sequences of interest hybridized to bait sequences. Unbound fractions are discarded. Bait sequences are then removed (e.g. by digestion of RNA) thus providing an enriched pool of CpG target sequences separated from non-CpG sequences. Template DNA may be subjected to bisulphite conversion and target loci amplified by small-scale PCR such as microdroplet PCR using primers which are independent of the methylation status of the CpG. Following amplification, samples may be subjected to a capture step to enrich for PCR products containing the target CpG, e.g. captured and purified using magnetic beads, as described above. Following capture, a standard PCR reaction is carried out to incorporate DNA sequencing barcodes into CpG-containing amplicons. PCR products are again purified and then subjected to DNA sequencing and analysis to determine the presence or absence of a methylcytosine at the target genomic CpG. CpG methylation status may be measured indirectly using a detection system such as fluorescence. A methylation-discriminatory microarray may be used. When calculating the degree of methylation of a given CpG, the Illumina® definition of beta-values may be used. The Illumina® methylation beta-value of a specific CpG site is calculated from the intensity of the methylated (M) and unmethylated (U) alleles, as the ratio of fluorescent signals β=Max(M,0) / [Max(M,0)+Max(U,0)+100]. On this scale, 0<β<1, β values of 1 or close to 1 indicate 100% methylation whereas values of 0 or close to 0 indicate 0% methylation. As explained in more detail in the Examples below, one particular exemplary technique which the inventors have used is a methylation discriminatory array, such as an Illumina InfiniumMethylation EPIC BeadChip. These assays utilise probes directed to methylated and unmethylated CpGs at a given locus. Another exemplary technique which the inventors have used to determine the methylation status of any one or more CpGs is a fluorescence-based PCR technique referred to as MethyLight. These assays utilise forward and reverse PCR primers specific for sequences encompassing a DMR such as those described herein. The methylation status of one or more CpGs contained within said DMRs may therefore be determined by MethyLight analysis. The assays also utilise detectable probes for specific regions within the one or more CpGs that are to be assayed. The detectable probes are typically designed such that they hybridise only to methylated forms of the one or more CpGs to be assayed. Exemplary forward and reverse PCR primers and detectable probes that target regions within DMRs 1 to 3 are defined according to SEQ ID NOs 5 to 13. Other techniques which may be used to determine the methylation status of any one or more CpGs include the use of restriction enzymes. Such methods may employ methylation-sensitive enzymes which only digest unmethylated DNA and / or methylation-dependent enzymes which only cut methylated DNA. Such enzymes may be used to enrich for methylated or unmethylated sequences and provide a read-out of DNA methylation. Accordingly, in any of the methods described and defined herein, steps of determining in the population of DNA molecules in the sample the methylation status of CpGs in a test panel may be performed by methods which comprise subjecting the population of DNA molecules in the sample to endonuclease treatment, such as restriction endonuclease treatment. Any such method may further comprise an amplification step, preferably a PCR amplification step. Bioinformatic tools and statistical metrics for CpG-based assays Software programs which aid in the in silico analysis of bisulphite converted DNA sequences and in primer design for the purposes of methylation-specific analyses are generally available and have been described previously. In risk models for predicting cancer, a receiver-operating-characteristic (ROC) curve analysis is often used, in which the area under the curve (AUC) is assessed. Each point on the ROC curve shows the effect of a rule for turning a risk / likelihood estimate into a prediction of the presence, absence or development of cancer in an individual. The AUC measures how well the model discriminates between case subjects and control subjects. An ROC curve that corresponds to a random classification of case subjects and control subjects is a straight line with an AUC of 50%. An ROC curve that corresponds to perfect classification has an AUC of 100%. In any of the methods described herein, the 95% confidence interval for the ROC AUC may be between 0.60 and 1. In any of the methods described herein, the interval may be defined as a range having as an upper limit any number between 0.60 and 1. The upper limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99 or 1.00. In any of the methods described herein, the interval may be defined as a range having as a lower limit any number between 0.60 and 1. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99 or 1.00. In any of the methods described herein, the interval range may comprise any of the above lower limit numbers combined with any of the above upper limit numbers as appropriate. Preferably, the upper limit number is 1. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 1 and as a lower limit any number between 0.60 and 1. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99 or 1.00. The upper limit number may be 0.99. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.99 and as a lower limit any number between 0.60 and 0.99. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98 or 0.99. The upper limit number may be 0.98. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.98 and as a lower limit any number between 0.60 and 0.98. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97 or 0.98. The upper limit number may be 0.97. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.97 and as a lower limit any number between 0.60 and 0.97. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96 or 0.97. The upper limit number may be 0.96. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.96 and as a lower limit any number between 0.60 and 0.96. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95 or 0.96. The upper limit number may be 0.95. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.95 and as a lower limit any number between 0.60 and 0.95. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94 or 0.95. The upper limit number may be 0.94. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.94 and as a lower limit any number between 0.60 and 0.94. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93 or 0.94. The upper limit number may be 0.93. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.93 and as a lower limit any number between 0.60 and 0.93. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92 or 0.93. The upper limit number may be 0.92. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.92 and as a lower limit any number between 0.60 and 0.92. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91 or 0.92. The upper limit number may be 0.91. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.91 and as a lower limit any number between 0.60 and 0.91. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90 or 0.91. The upper limit number may be 0.90. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.90 and as a lower limit any number between 0.60 and 0.90. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89 or 0.90. The upper limit number may be 0.89. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.89 and as a lower limit any number between 0.60 and 0.89. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88 or 0.89. The upper limit number may be 0.88. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.88 and as a lower limit any number between 0.60 and 0.88. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87 or 0.88. The upper limit number may be 0.87. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.87 and as a lower limit any number between 0.60 and 0.87. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86 or 0.87. The upper limit number may be 0.86. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.86 and as a lower limit any number between 0.60 and 0.86. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85 or 0.86. The upper limit number may be 0.85. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.85 and as a lower limit any number between 0.60 and 0.85. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84 or 0.85. The upper limit number may be 0.84. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.84 and as a lower limit any number between 0.60 and 0.84. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83 or 0.84. The upper limit number may be 0.83. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.83 and as a lower limit any number between 0.60 and 0.83. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82 or 0.83. The upper limit number may be 0.82. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.82 and as a lower limit any number between 0.60 and 0.82. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81 or 0.82. The upper limit number may be 0.81. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.81 and as a lower limit any number between 0.60 and 0.81. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80 or 0.81. The upper limit number may be 0.80. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.80 and as a lower limit any number between 0.60 and 0.80. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79 or 0.80. The upper limit number may be 0.79. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.79 and as a lower limit any number between 0.60 and 0.79. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78 or 0.79. The upper limit number may be 0.78. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.78 and as a lower limit any number between 0.60 and 0.78. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77 or 0.78. The upper limit number may be 0.77. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.77 and as a lower limit any number between 0.60 and 0.77. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76 or 0.77. The upper limit number may be 0.76. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.76 and as a lower limit any number between 0.60 and 0.76. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75 or 0.76. The upper limit number may be 0.75. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.75 and as a lower limit any number between 0.60 and 0.75. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74 or 0.75. The upper limit number may be 0.74. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.74 and as a lower limit any number between 0.60 and 0.74. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73 or 0.74. The upper limit number may be 0.73. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.73 and as a lower limit any number between 0.60 and 0.73. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72 or 0.73. The upper limit number may be 0.72. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.72 and as a lower limit any number between 0.60 and 0.72. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71 or 0.72. The upper limit number may be 0.71. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.71 and as a lower limit any number between 0.60 and 0.71. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70 or 0.71. The upper limit number may be 0.70. Thus, the 95% confidence ROC AUC interval may be defined as a range having an upper limit of 0.70 and as a lower limit any number between 0.60 and 0.70. The lower limit number may be 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69 or 0.70. In vitro DNA methylation methods The invention provides an in vitro method of assaying DNA and detecting methylation of the DNA therein, the method comprising measuring a methylation status of a test panel of two or more CpGs, wherein: i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 18, and wherein the at least one CpG is denoted by [[CG]]; and ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 2 and SEQ ID NO 19, and wherein the at least one CpG is denoted by [[CG]]. The measuring of methylation status may be performed according to the determining step according to the assay of the invention. The test panel of the in vitro method may be defined according to the test panel of the assay of the invention. The in vitro method may in some instances not comprise measuring the methylation status of one or more CpGs denoted by [[CG]] contained with a third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 20, optionally wherein the method does not comprise measuring the methylation status of any of the CpGs denoted by [[CG]] contained within the third DMR. The in vitro method may comprise PCR that is defined in accordance with the PCR of the assay of the invention. Primer and probes may be used in the in vitro method of the invention which are identical to the primer and probes of the assay of the invention. PCR in the in vitro method may comprise the use of a negative control defined according to the assay of the invention. System and kit of parts As explained in more detail herein, provided is a system and a kit. The system is suitable for a PCR assay, preferably providing components when utilised in combination function to provide a PCR assay. The system may comprise a combination of components which may be produced, sold and distributed separately and which together may optionally form a kit, or simply a combination of physical products, for example a combination of products in use, e.g. in a PCR reaction. The system provided herein is for a PCR assay, the system comprising: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated. The system may further comprise a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the forward primer and probe anneals to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment of SEQ ID NO: 3. Most preferably, the system comprises: i. the forward primer, the reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 7; and ii. the PCR comprises amplification using a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 10; and iii. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment of SEQ ID NO: 3; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 12, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 13. The kit comprises: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated and following bisulfite treatment; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated and following bisulfite treatment. The kit may further comprise a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the forward primer and probe anneals to the DMR defined according to SEQ ID NO: 3 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment of SEQ ID NO: 3. Most preferably, the kit comprises: i. the forward primer, the reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 7; and ii. the PCR comprises amplification using a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 10; and iii. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the forward primer and probe anneals to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment of SEQ ID NO: 3; preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 12, and the probe comprises or consists of a sequence defined according to SEQ ID NO: 13. The kit may further comprise instructions for use. Method of treatment and diagnosis The term “treatment” as used herein is intended to refer to any intervention or procedure performed on an individual, including a surgical intervention, or a pharmacological intervention such as the administration of a compound or drug, or screening intervention. Any such treatment may be performed for therapeutic purposes or for preventative or prophylactic purposes. The invention also encompasses the performance of one or more treatment steps following a positive classification of cancer of the female reproductive tract, particularly endometrial or uterine cancer, based on any of the assays described herein. Said treatments may be considered “therapeutic” treatments. The invention also encompasses the performance of one or more treatment steps following a negative classification of cancer of the female reproductive tract or prediction of an individual being at risk of development of cancer of the female reproductive tract, particularly endometrial or uterine cancer, based on any of the methods described herein. Said treatments may be considered “risk prevention”, “preventative” or “prophylactic” treatments. The invention thus encompasses a method of treating a cancer patient comprising administering chemotherapy, radiation, immunotherapy or any cancer therapy described herein to the patient assessed to be positive for cancer of the female reproductive tract based on any of the assays described herein, preferably wherein the cancer is endometrial or uterine. The invention therefore provides a method of treating and / or preventing cancer of the female reproductive tract in an individual, the method comprising: i. assessing the presence, absence or development of cancer in the female reproductive tract of an individual according to the present invention; and ii. administering one or more therapeutic or preventative treatments or measures to the individual based on the assessment. The step of administering one or more treatments may comprise different treatment steps depending on the stratification of an individual on the basis of their cancer status or their risk of having cancer of the female reproductive tract or on the basis of risk of cancer of the female reproductive tract development, particularly endometrial uterine cancer, most preferably endometrial cancer. Particularly the amount of an invasiveness of the treatments administered may vary dependent on the stratification of an individual on the basis of their cancer status or their risk of having cancer or on the basis of their risk of cancer development. The treatments administered to the individual may comprise any treatments considered suitable by a person skilled in the art. For example, when the individual is subject to the assay of the invention, and when the ΣPMR is about < 0.03, the individual is assessed has not having a high risk of developing cancer of the reproductive tract, and the individual is subjected to a repeat assay according to the invention about one year after the previous assay or when symptoms occur or re-occur. For example, when the individual is subject to the assay of the invention, and when the ΣPMR is about > 0.03 but < 0.3, the individual is assessed as having a high risk of developing cancer of the reproductive tract, and the individual is subjected to one or more treatments according to their cancer status and risk, and one or more treatments may comprise any of: a. a transvaginal ultrasound to assess endometrium and / or ovaries; b. intensified screening, preferably wherein the intensified screening comprises one or more of: i. a colposcopy; ii. an HPV test; iii. a cervical cytology test; iv. a test for CA125, preferably wherein the test is repeated six-monthly. Preferably, wherein a transvaginal ultrasound to assess endometrium is performed, thickness of the endometrium is determined. When the thickness is greater than 3 mm in peri and / or postmenopausal women, a hysteroscopy and curettage / biopsy is performed. If the Fallopian Tube / ovary is assessed as abnormal, an MRI is performed and / or a surgical exploration is conducted. In case hysteroscopy and biopsies negative, the assay according to the invention should be repeated in 3-6 months, and histological examination should be performed if the DNA methylation as determined herein e.g. by ΣPMR has increased and / or endometrial thickness has increased. For example, when the individual is subject to the assay of the invention, and when the ΣPMR is about > 0.3, the individual is assessed as having cancer of the female reproductive tract, the individual is subjected to one or more treatments according to their cancer status, and the one or more treatments may comprise any of: a. a hysteroscopy and curettage / biopsy is performed irrespective of the ultrasound result; b. intensified cervical assessment: i. a colposcopy; ii. an HPV test; iii. a cervical cytology test; iv. cervical / vaginal biopsies c. intensified Fallopian Tube / ovarian assessment: i. a test for CA125, preferably wherein the test is repeated three-monthly; ii. Detailed ultrasound of the adnexae iii. MRI of the pelvis iv. Laparoscopic assessment d. a repeat assay according to any of the assays described herein, preferably wherein the repeat assay is performed about 3-6 months after the previous assay; e. administration of one or more of progestogens, particularly wherein the progestogens are delivered locally or systemically, Aspirin, Metformin, aromatase-inhibitors, weight-loss regimen; f. a total hysterectomy and bilateral salpingo-oophorectomy. If endometrial biopsy is negative for cancer, cervix is preferably be assessed via colposcopy / biopsy or tube / ovary via transvaginal and / or MRI. Methods of monitoring The invention also provides methods of monitoring the cancer status and / or the risk of cancer development of an individual. The invention is therefore for monitoring the presence, or risk of the presence of development, of cancer in the individual. The cancer is of the female reproductive tract. “Monitoring” in the context of the present invention may refer to longitudinal assessment of an individual’s cancer status, risk of harbouring cancer or risk of cancer development. This longitudinal assessment may be carried out according to any of the assays of the invention described herein. This longitudinal assessment may involve performance of any of the assays of the invention described herein to predict the presence or development of cancer in an individual at more than one time point over the course of an undetermined time window. The time window may be any period of time whilst the individual is still living. The time window may persist for the lifetime of the individual. The time window may persist until the individual’s cancer status, risk of harbouring cancer or risk of cancer development falls below a certain level. The level may be determined by the methylation status of the two or more CpGs in the test panel. The level may be determined by any of the methods for determining methylation described herein. The level may preferably be determined by a mean percent of fully methylated reference (PMR) values for each DMR based on the methylation status of the CpGs from each DMR comprised in the test panel, preferably wherein the sum of the PMR values for each DMR (ΣPMR) may be used to assess the presence, absence or development of cancer of the female reproductive tract in the individual and therefore the level of risk. The invention therefore provides a method of monitoring the cancer status and / or the risk of cancer development of an individual, the method comprising: (a) assessing the presence, absence or development of cancer in an individual by performing the assay according to the invention at a first time point; (b) assessing the presence, absence or development of cancer in the individual by performing the assay according to the invention at one or more further time points; and (c) monitoring any change in the cancer status and / or the risk of cancer development of the individual, wherein the cancer is of the female reproductive tract. In any of the methods of monitoring described herein, the steps of assessing the presence, absence or development of cancer in an individual based on a threshold cancer risk, for example as described in the method of treatment stratification provided herein. Threshold values can provide an indication of an individual’s cancer status, risk of having cancer or an individual’s risk of cancer development. For example, methylation status of the test panel of CpGs may indicate the presence or absence of cancer, or a high or low risk of harbouring or developing cancer. The invention further encompasses a method of measuring methylation in a patient at multiple time points comprising (a) assessing the presence, absence or development of cancer in an individual by performing any one of the assays of the invention described herein at a first time point; (b) assessing the presence, absence or development of cancer in the individual by performing any one of the assays of the invention described herein at one or more further time points, and (c) detecting differential methylation status between (a) and (b), wherein the cancer is of the female reproductive tract. In any of the methods of monitoring described herein, the individual may already harbour cancer, particularly endometrial and / or ovarian cancer, most preferably endometrial cancer. The individual may not have cancer. The individual may not harbour cancer. The individual may particularly have abnormal uterine bleeding (AUB). The individual may not harbour cancer but may harbour one or more genetic mutations that predispose the individual to an increased risk of cancer development e.g. the individual may have Lynch syndrome, and therefore harbour mutations in one or more mutations of the MLH1, MSH2, MSH6, PMS2, or EPCAM genes. Other mutations may include any mutations in the art that are considered to pre-dispose individuals to cancer. In any of the methods of monitoring described herein, the individual may not harbour cancer but may harbour one or more genetic mutations that pre-dispose the individual to cancer, and this individual may be subjected to any of the methods of monitoring described herein in order to determine their risk of having cancer or of developing cancer. For example, in any of the methods described herein, the individual does not harbour cancer and harbours one or more mutations that predispose the individual to an increased risk of developing cancer, particularly endometrial and / or ovarian cancer, and wherein one or more treatments are administered to the individual in accordance with any of the methods of treatment described herein as a method of prophylaxis. In any of the methods described herein, the individual does not harbour cancer and harbours one or more mutations that predispose the individual to an increased risk of developing cancer, and wherein one or more treatments are administered to the individual in accordance with any of the methods of treatment described herein as a method of prophylaxis, and wherein the one or more treatments administered to the individual comprises one or more doses of progestogens, particularly wherein the progestogens are delivered locally or systemically, Aspirin, Metformin, aromatase-inhibitors, and / or a weight-loss regimen. In any of the methods of monitoring described herein, depending on the risk of the presence or development of cancer in the individual, one or more treatments are administered to the individual according to any one of the methods of treatment encompassed by the invention and described herein, or for example wherein the ΣPMR as described herein is less than about 0.03 no treatment is administered to the individual. Preferably, the ΣPMR is determined wherein the test panel of two or more CpGs comprises or consists of the CpGs contained with the DMRs defined according to SEQ ID NOs 1 to 2. Different treatments may be administered depending on the stratification of an individual on the basis of their cancer status, risk of harbouring cancer or on the basis of their risk of cancer development. The method may further comprise administration of one or more treatments according to the methods of treatment provided herein. Methylation status of the CpGs of the test panel, and therefore cancer risk, may change between any two or more time points. For this reason, longitudinal monitoring of an individual’s CpG methylation status and cancer risk could be of particular benefit to the assessment of, for example, cancer progression, prevention of recurrence of cancer, cancer treatment efficacy, or cancer efficacy. In any of the methods of monitoring described herein, the one or more further time points may be any suitable time point. Preferably the one or more further time points may of suitable distance apart for sufficiently frequent screening in order to predict any particularly early onset cases of presence or development of cancer in an individual. Preferably the one or more further time points may be of suitable distance apart for assessing the efficacy of one or more treatments. Preferably the one or more further time points may be of suitable distance apart for predicting whether an individual remains free of cancer after a successful course of treatment. The one or more further time points may be about monthly, about two monthly, about three monthly, about four monthly, about five monthly, about six monthly, about seven monthly, about eight monthly, about nine monthly, about ten monthly, about eleven monthly, about yearly, about two yearly, or more than two yearly. In any of the methods of monitoring described herein, changes may be made to the one or more treatments wherein a positive or negative responses to the one or more treatments are observed. Treatments may be changed in accordance with the methods of treatments described herein. Treatments may particularly be changed if the individual’s cancer status or risk stratification as described herein with respect to the methods of treatment provided herein. In any of the methods of monitoring encompassed by the invention, the step of predicting the presence or development of cancer in an individual may involve the use of any one of the arrays described herein. EXAMPLES The present invention will now be described with reference to specific Examples, which should not be construed as in any way limiting. EXAMPLE 1 – Comparison with pre-existing assessment pathways Background To detect uterine cancer, simpler and more specific index tests are needed to triage women with abnormal uterine bleeding (AUB) to a reference histology test. This prospective observational study's primary aim was to compare the performance of conventional index imaging tests with the novel WID®-qEC DNA methylation test. Brief methods All women aged ≥ 45 years with AUB attending a tertiary gynaecological diagnostic referral centre in the UK between June and November 2022 were invited to participate. A cervicovaginal sample for the WID®-qEC test was obtained prior to the current diagnostic pathway and performed blinded to the clinical outcome. Patients were followed until diagnostic resolution or until June 12, 2023. The primary outcome was to assess the real world performance of the WID®-qEC test in comparison with transvaginal ultrasound. WID®-qEC predictions were compared with the diagnosis made by standard care with regards to sensitivity, specificity, positive and negative predictive value. EPI-SURE is registered with ISRCTN (ISRCTN 16815568). Findings Four hundred of the eligible 474 women consented to study participation; one patient withdrew. Based on 603 index imaging tests (i.e., sonography), 186 (46·6%) women were recommended for a reference histology test (i.e., biopsy+ / -hysteroscopy). Twelve cancers were diagnosed. 198 reference histology test procedures detected nine cancers and missed two; one further cancer was directly diagnosed at hysterectomy without a prior reference test. Endometrial thickness assessment on ultrasound scan was possible in 379 (95·0%) of the 399 women and a pre- specified cut-off of ≥4·5mm had sensitivity, specificity, positive (PPV) and negative (NPV) predictive values of 90·9% (95% CI: 62·3-98·4), 79·1% (95% CI: 74·5-82·9), 11·8% (95% CI: 6·5- 20·3) and 99·6% (95% CI: 98·0-99·9), respectively. The WID®-qEC test was possible in 390 (97·7%) of the 399 patients with 90·9% sensitivity (95% CI: 62·3-98·4), 92·1% specificity (95% CI: 88·9-94·4), a PPV of 25·6% (95% CI:14·6-41·1) and a NPV of 99·7% (95% CI: 98·3-99·9), when the pre-specified threshold (≥ 0·03) was applied. When a higher threshold (≥ 0·3) was applied the specificity increased to 97·3% (95% CI: 95·1-98·5) without a change in sensitivity. Compared to the WID®-qEC test, the standard index imaging tests recommended 4·3 times more (162 vs 38) reference histology tests for women who eventually turned out to be cancer-free. Interpretation Current strategies for detecting uterine cancer in women presenting with AUB require women to undergo index imaging tests followed by reference histology tests that fail to detect all cancers. The WID®-qEC test delivers fast results and shows superior performance compared to a combination of imaging index tests. Triage of women with AUB using the WID®-qEC test could reduce the number of women requiring histological assessments for identification of potential malignancies. Funding The Eve Appeal, Land Tirol and the European Research Council under the European Union’s Horizon 2020 Research and Innovation Programme (grant agreement No 742432; BRCA- ERC). Introduction Endometrial cancer is the fourth most common cancer1,2and its incidence continues to rise3. Recent evidence suggests that a delay in endometrial cancer diagnosis has a significant negative impact on survival4. No screening exists for endometrial cancer and the lead symptom is abnormal uterine bleeding (AUB)2. In the US and the UK, approximately 1.4 million and 800,000 cases of AUB, respectively, are reported each year5,6, making this symptom one of the most common reasons for urgent referrals to gynaecological rapid access clinics. However, only 1·2%7and 9%8of pre- (≥ 45 years of age) and postmenopausal women, respectively, presenting with AUB are eventually diagnosed with endometrial cancer. Ultrasonography [performed transvaginally (TVS), transabdominally (TAS), transrectally (TRS), or based on saline infusion sonography (SIS)] is used to identify those women with AUB who have the highest cancer risk and therefore require a biopsy, which is usually obtained via a pipelle and / or hysteroscopy / endometrial biopsy1,2. Sonographically assessed endometrial thickness in postmenopausal women with a cut-off of > 3mm, ≥ 4 mm or ≥ 5 mm detects endometrial cancer with a sensitivity of 97·9%, 94·8% or 90·8% and a specificity of 35·4%, 52·7% and 62·4%, respectively9-11, although substantially inferior sensitivity / specificity performance is reported in black women12. Due to the low specificity of ultrasonography, further invasive testing and stressful diagnostic procedures may need to be conducted more than 50% of women with AUB. An urgent need exists for a test that detects all uterine cancers (i.e., endometrial, endocervical, ectocervical, and uterine metastasis) in patients presenting with AUB and is easy to apply, delivers objective results quickly, and improves on sonography performance parameters. In particular, a test with a much lower false positive test rate amongst women presenting with abnormal uterine bleeding would greatly reduce the number of invasive diagnostic procedures needed. Recent evidence suggests that subjective pattern recognition, which utilises endometrial morphological features and vascular patterns detected on Doppler ultrasound, can improve the specificity of ultrasound13-15. However, at present, most clinics do not have the dedicated equipment or highly trained staff required to apply subjective pattern recognition. In addition, to date, no systematic prospective observational study has captured all parameters required to evaluate the efficacy of the complete diagnostic pathway in order to identify malignancy in women with AUB. Overall, the current index imaging pathway is highly dependent on a healthcare system working at optimal capacity, i.e., supported by good infrastructure and high staffing levels. When the robustness of a healthcare system is challenged by staffing issues and financial constraints as it is currently in several countries, waiting times for diagnostic pathways are adversely affected16. This reinforces the urgent need for a test that is easy to apply, can be analysed within a short period of time, and thereby tangibly decreases the time and complexity of diagnosis. Molecular testing of circulating tumour DNA in plasma has limited sensitivity to detect uterine cancers in women with AUB (40%; 95% CI 22·7 – 59·4)17. In contrast, assessment of DNA methylation (DNAme) in samples obtained from the cervicovaginal space by either a tampon18,19or a cervical swab20-23has shown great promise as a simple tool to identify women with uterine cancer. Recently, the WID®-qEC test, which assesses DNAme of two genes – ZSCAN12 and GYPC – in cervicovaginal self- or healthcare professional-collected samples, was validated in several settings and has shown considerable potential to improve uterine cancer detection24,25. In this prospective, single centre study entitled “EPI-SURE” (A comparative study of epigenetic analysis and ultrasonography for endometrial cancer detection in women presenting with AUB) we compared the performance of the WID®-qEC test and ultrasonographic risk assessment for uterine cancer in an unselected population of all women aged ≥ 45 years who were referred to a rapid access clinic operating within tertiary gynaecologic diagnostic unit over a 6-month period due to AUB. Our study addresses one of the top unmet needs for uterine cancer research agreed upon by patients, carers, and clinicians: to identify those women with abnormal uterine bleeding who should be referred for specialist review26. Expanded methods Study conduct and study population This is a prospective observational cohort study of women consecutively referred to the Rapid Access Clinic in the Gynaecology Diagnostic and Outpatient Treatment Unit at University College London Hospital (UCLH). All women aged ≥ 45 years referred due to AUB from June 1 to November 24, 2022 were invited to participate in the study. Written informed consent was obtained from all participants. At enrolment and prior to any procedures, a cervicovaginal smear was obtained, stored, and analysed in one batch after recruitment was completed. All women provided baseline data (age, menopausal status, weight, height, and ethnicity via self-reporting) and underwent the standard assessment utilising index imaging tests [i.e., ultrasound imaging and / or in rare cases MRI (magnetic resonance imaging)] to determine which women required a reference histology test (i.e., a biopsy + / - hysteroscopy) in order to reach a final diagnosis. The study was part of the H2020 FORECEE Research Programme, and research ethics was approved by the Health Research Authority (HRA), UK (REC 14 / LO / 1633; IRAS 53431). A research protocol was published prior to commencing the study (https: / / www.isrctn.com / ISRCTN16815568; Registration date: 31 / 05 / 2022). The results reported herein follow the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) guidelines for cohort studies27. Sample collection A standard Cusco speculum was used to access and visualise the cervix prior to any other interventions. A cervicovaginal sample was obtained by a gynaecologist (registrar or consultant) using a Cervex-Brush® (Rovers Medical Devices). If a woman was unable to tolerate or declined the use of a speculum, a cervicovaginal sample was obtained using a smaller applicator-style vaginal brush designed for self-sampling (Evalyn®Brush - Rovers Medical Devices); all self- samples yielded sufficient DNA to perform the WID®-qEC test. The Cervex-Brush®or the Evalyn®Brush were immersed and rinsed in a ThinPrep®vial filled with 20 ml of PreservCyt®Solution labelled with a unique Participant ID code. Standard Diagnostic Pathway - Index Tests, Reference Standard, and Final Diagnosis This was a single centre study and all experienced operators received training from the same senior gynaecologist, to reduce bias. All women underwent a standard assessment by a gynaecologist trained in gynaecological ultrasound utilising high-level equipment (Voluson E8, GE Healthcare Ultrasound, Milwaukee, WI, USA), furnished with 4-9 MHz trans-vaginal (also utilised for trans-rectal and saline infusion sonography) and 3-8 MHz trans-abdominal probes. All women were evaluated by one or several ultrasound modalities. In cases where a clear sonographic view of the endometrium and uterine cavity was difficult to obtain by TVS, additional sonographic techniques were offered, including TAS and TRS. If further visualisation was required, SIS was performed. SIS involves passing a 3·3 mm soft plastic paediatric nasogastric suction catheter through the cervix into the uterine cavity without grasping the cervix. A volume of 5–10 mL of sterile saline solution is instilled into the uterine cavity and a 3D volume is generated by the automatic sweep of the mechanical transducer. The volumes are stored digitally and analysed using multiplanar visualisation. Sonographic risk assessment included (1) measurement of endometrial thickness; and (2) judgement based on the previously described subjective pattern recognition13,13as to whether the bleeding was triggered by a malignancy of the endometrium and / or the endocervical canal. Ultrasound assessments were systematically performed as described13. Briefly, the cervix and uterine corpus were identified in the transverse plane. The uterine corpus was then assessed by examining a series of parallel scanning planes from the internal cervical os to the top of the uterine fundus. Endometrial thickness was measured in the longitudinal plane using the double-layer measurement technique28. If fluid was present in the endometrial cavity, it was subtracted from the measurement of the endometrial thickness. The cut-off used for clinical decision in this study was ≥ 4·5 mm as described and applied previously13. The diagnosis of endometrial polyp was made when a well-defined focal lesion with clear outline and separate from the surrounding endometrium was present within the uterine cavity. In accordance with the standard clinical practice all polyps detected in symptomatic women were removed hysteroscopically regardless of the accompanying endometrial thickness29. Subjective pattern recognition classified all women with an abnormal endometrium into one of three groups based on endometrial morphological features on grayscale ultrasound and vascular patterns on colour Doppler: (1) uniformly thickened benign endometrium: the endometrium appears uniform with no focal lesions, an intact midline echo and intact endometrial–myometrial junction and on Doppler ultrasound, it appears avascular or poorly vascularised; (2) benign endometrial polyp: there is a well-defined localised lesion with a regular outline within the endometrial cavity and the surrounding endometrium appears regular with an intact endometrial–myometrial junction and on Doppler ultrasound, there is a single dominant vessel with or without branching, or there is no detectable vascularity; or (3) uterine cancer: the endometrium appears heterogeneous or there is an irregular focal lesion and the endometrial–myometrial junction could be intact or is interrupted, which is suggestive of myometrial invasion; on Doppler ultrasound, there are multiple vessels with focal or multifocal origin. In patients where the endometrium could not be adequately visualised, the subjective pattern recognition was deemed to be inconclusive. In the outpatient clinic, endometrial sampling with pipelle biopsy was offered to all women with a suspicion of uterine cancer or with a uniformly thickened endometrium ≥ 4·5 mm. Women with endometrial polyps were offered a hysteroscopic polypectomy. All specimens were histologically assessed. Whenever the decision (based on the assessment of the endometrium) was taken to perform a hysterectomy or a biopsy of an organ distant to the uterus the resulting histological diagnosis was also considered when assigning the final diagnosis. DNA methylation analysis The WID®-qEC test utilises quantitative real-time PCR on bisulfite modified DNA to assess DNAme (MethyLight) and has been performed as previously described24with certain modifications: only one GYPC marker region was assessed and run in a duplex reaction together with the reference gene COL2A1; ZSCAN12 was run as a single-plex. The assay was run in duplicates. GYPC and ZSCAN12 Percentage of fully Methylated Reference (PMR) values were calculated. As before24, the WID®-qEC ΣPMR threshold of 0·03 was applied to signify a positive (≥ 0·03) or negative (< 0·03) test. In the PCR method for assessing DNAme of bisulfite treated DNA described in this example, as a result of performing the method it is confirmed that each one of the CpGs of SEQ ID NOs 1, 2, 4, 18, 19 and 20 which are denoted by [[CG]], as identified further herein, is identified as methylated (prior to bisulfite treatment) in the nucleic acid strand assessed by the method. It is further confirmed that each one of the corresponding CpGs in the nucleic acid strand which is complementary to the assessed strand is methylated prior to bisulfite treatment. Data Handling All performed medical procedures (i.e., index tests) and their results were collected from a hospital medical Electronic Healthcare Record System before any outcome data became available. Histological outcome data were recorded over a 6-month period after recruitment stopped and the database was locked on June 12, 2023. The 399 DNA samples were shipped to the University of Innsbruck for WID®-qEC test analysis. To reduce potential assessment bias, technicians were blinded to clinical outcomes. Protocol Deviations In the original protocol we specified that all diagnostic outcomes would be available within a 1 – 4 week period after first presentation. However, due to organisational issues in the health care system several of the relevant follow up procedures (e.g., hysteroscopy or hysterectomy) were delayed and we therefore extended the follow up period to June 12, 2023. The study was set up to compare the positive predictive value in ultrasound versus WID- qEC in particular, while also establishing real-word sensitivity, specificity, and NPV, assuming a sensitivity and specificity of the WID®-qEC of 99% and 89%, respectively, while ultrasound estimates were 90·5% and 50%. A minimum sample size of 200 was determined to detect a significant difference in ultrasound-estimated PPV of 5.8% and WID-qEC-estimated PPV of 22·2% at a power of 75% and alpha level of 5%, using a single sample binomial comparison. The initial study set-up included 300 individuals to improve power to above 80% and was expanded to 400 when lower-than expected numbers of cancer cases were identified within the first 200 participants. Although we specified in the protocol that in addition to the endometrial thickness, we would also assess the texture / focal lesions in the endometrium, we did not stipulate that we would include Doppler ultrasound, the intention being to complete subjective pattern recognition assessment. Gross anatomical alterations of the cervix completely block or at least severely limit the drainage from the endometrial cavity. Hence, one volunteer who presented with a large endocervical polyp (35 x 30 x 10 mm; subsequently found to be benign on histology) that protruded into the vagina was excluded from the WID®-qEC analysis. Study Outcomes The primary outcome was the direct comparison of the performance of sonography (endometrial thickness) and the WID®-qEC test utilising both prespecified cut-offs (i.e., ≥ 4·5 mm endometrial thickness13and ≥ 0·03 WID®-qEC ΣPMR24) as well as the area under the receiver- operating-characteristic (ROC) curve (AUC) using the numerical values of both parameters in order to predict the final histological diagnosis (i.e., primary or metastatic invasive uterine cancer versus no cancer). The secondary outcomes were the total number of index imaging and reference histology tests, the number of conclusive and inconclusive tests, and the performance of subjective pattern recognition. Statistical methods All statistical analyses were carried out in R version 4.2.2 (2022-10-31). The study was powered to compare PPV between ultrasound and WID®-qEC test (see above). Potential sources of bias were limited by design of a prospective observational cohort, inviting all women aged ≥ 45 referred for diagnostic evaluation to the study. Results of medical procedures (index tests) were collected via electronic healthcare record systems prior to outcome availability, and sample handling bias were mitigated by blinding research technicians to clinical outcomes. We were unable to prospectively collect or analyse data from those that declined consent. During exploratory analysis, we explored the association of data availability with case-control status, which did not indicate bias. No additional statistical steps were employed to address sources of bias. Quantitative variables, including endometrial thickness in mm and WID®-qEC ΣPMR values, were evaluated both in a continuous and dichotomised manner, employing area under the receiver operating characteristic and computation of sensitivity, specificity, positive and negative predictive values at given thresholds, respectively. Cutoffs for analysis of sensitivity, specificity, positive and negative predictive values were based on values used in clinical practice (endometrial thickness in mm; 3 mm, 4·5 mm, or 5 mm), or previous analyses (WID®-qEC; ≥ 0·03 or ≥ 0·3). ROC AUCs and corresponding 95% confidence intervals (DeLong’s method) were generated using the pROC package, version 1.18.0. ROC AUCs were compared using the roc.test method in the pROC package, using DeLong’s test. Sensitivity, specificity, PPV and NPV were obtained from the epi.tests function (epiR package, version 2.0.62), with 95% confidence intervals computed using the Wilson method. Results From June 1, 2022 through November 24, 2022, a total of 474 women aged ≥ 45 years with AUB were consecutively referred to the Rapid Access Clinic in the Gynaecology Diagnostic and Outpatient Treatment Unit at UCLH. Of these, 74 (15·6%) did not accept the invitation to participate in the EPI-SURE study and one woman withdrew after consenting. Therefore, the primary analysis cohort included 399 women (figure 1). Baseline characteristics of the primary analysis cohort are outlined in Figure 3. The mean participant age was 56 years (range 45 to 95 years), and mean body mass index was 26 kg / m2(range 15 to 60 kg / m2). Among the 399 women, 31, 49, and 319 were pre-, peri-, and postmenopausal, respectively, and 135 were receiving HRT. The majority (71·1%) of participants were white. Whereas for most women the cervicovaginal sample was obtained by a Cervex- Brush®, eight women requested the sample to be taken with an Evalyn® Brush. In 20 (5%), 23 (5·8%), and 9 (2·2%) women it was impossible to assess the sonographic endometrial thickness, make a judgement based on subjective pattern recognition, or perform the WID®-qEC test, respectively (Figure 1). 603 imaging tests (TVS, TAS, TRS, SIS, and MRI) were performed (figure 1). Based on these assessments, 213 (53·4%) women were determined to be cancer-free based on endometrial thickness <4·5 mm and absence of any findings suggestive of endometrial cancer. In these patients histological assessment was not recommended. Among the 186 (46·6%) women referred for histology, 56 had an endometrial pipelle biopsy with results as follows: (i) conclusive cancer (n=5), (ii) conclusive no cancer (n=27), and (iii) inconclusive and recommended for a hysteroscopy / biopsy (n=24), which was performed for all but one participant who was assessed as medically unfit for the procedure. A total of 142 women underwent either a hysteroscopy alone (n=5), a biopsy alone (n=11), or a combination of both (n=126), which led to a diagnosis of cancer (n=4) or no cancer (n=137); one woman did not attend the procedure. One woman who underwent an MRI without hysteroscopic assessment was found to have a tubal cancer invading the uterus. Two women with a negative reference histology result were subsequently found to have cancer (figure 1). Endometrial thickness was measurable in 379 (95%) women of which 369 received a final diagnosis. The ROC AUC for detection of uterine cancer based on endometrial thickness in mm was 87·2% (95% CI 71·1-100) overall and 87·3% (95% CI 70.3-100) for postmenopausal women (figure 2). Based on the endometrial thickness cut-off of > 3 mm (as applied in several European countries) the sensitivity and specificity to detect a uterine cancer were 90·9% (95% CI 62·3-98·4) and 45·8% (95% CI 40·7 - 51·0) with a PPV and NPV of 4·9% (95% CI 2·7 - 8·8) 99·4% (95% CI 96·6 - 99·9), respectively (tables 2 & 3). Based on the a priori defined cut-off of ≥ 4·5 mm, the sensitivity and specificity were 90·9% (95% CI 62·3 - 98·4) and 79·1% (95% CI 74·5 - 82·9), respectively, with a PPV and NPV of 11·8% (95% CI 6·5 - 20·3) and 99·6% (95% CI 98·0 - 99·9), respectively. The respective values for a 5 mm endometrial thickness cut-off, which is also commonly applied9, were 72·7% (95% CI 43·4 - 90·3), 81% (95% CI 76·6 - 84·7), 10·5% (95% CI 5·4 - 19·4) and 99% (95% CI 97·0 - 99·7). Test-positivity upon endometrial thickness ≥4·5 and / or a sonographic visible polyp would result in a specificity of 61·7% (95% CI 56·6 - 66·6) with a PPV of 6·8% (95% CI 3·7 - 12·1) (Figure 5). Subjective pattern recognition gave a conclusive result in 376 (94·2%) women, of which 366 received a final diagnosis (Figure 4). Sensitivity and specificity to detect a uterine cancer were 63·6% (95% CI 35·4 - 84·8) and 99·2 (95% CI 97·5 - 99·7), respectively, with a PPV and NPV of 70% (95% CI 39·7 - 89·2) and 98·9 (95% CI 97·1 - 99·6), respectively (Figure 5). Of the 173 women with at least one reference histology test (“hysteroscopy only” is also included), the outcome was ‘test negative’ (i.e., no cancer) for 164 women. Among these women assumed cancer-free after biopsy, one woman had a hysterectomy due to an atypical hyperplasia and was found to have an invasive endometrial cancer. One participant with normal endocervical and necrotic tissue obtained at hysteroscopy / biopsy later had a biopsy of a liver metastasis which unequivocally indicated a primary endometrial cancer (figure 1). Therefore, the sensitivity of the biopsy to detect endometrial cancer was 81·8% (Figure 4). Sufficient DNA to conduct the WID®-qEC test was isolated from cervical samples from 390 (97·7%) of the 399 women. The ROC AUC for uterine cancer was 94·3% (95% CI 84·7 - 100) overall and 93·9 (95% CI 83·5 - 100) for postmenopausal women (figure 2). Although the comparison of the ROC AUC to endometrial thickness in mm was not statistically significant (p = 0·48), the shape of the WID®-qEC ROC curve indicates that a high sensitivity is already reached at a high specificity. Based on the previously defined cut-off of ≥ 0·0324the sensitivity and specificity to detect a uterine cancer was 90·9% (95% CI 62·3 - 98·4) and 92·1 (95% CI 88·9 - 94·4), respectively, with a PPV and NPV of 25·6% (95% CI 14·6 - 41·1) and 99·7 (95% CI 98·3 - 99·9), respectively (Figure 5). Applying a cut-off of 0·3 (‘high specificity cut-off’) would have substantially increased the specificity (97·3%; 95% CI 95·1 - 98·5) and the PPV (50%; 95% CI 29·9-70·1) without affecting the sensitivity (Figure 5). The single WID®-qEC-false negative case was a 2 mm grade 1 invasive endometrial cancer on a background of atypical hyperplasia. Discussion In this prospective observational cohort study, we compared the performance of molecular testing and sonography to detect endometrial cancers in women presenting with AUB. The conventional assessment of 399 women with AUB required a total of 801 diagnostic procedures (603 imaging procedures, 56 pipelle biopsies, and 142 non-pipelle biopsies and hysteroscopies) in order to identify 10 uterine cancers; two cancers were only diagnosed after further assessments (one at hysterectomy and one at biopsy of a liver metastasis). For both the index imaging and the WID®- qEC, test results were inconclusive for one patient who was eventually diagnosed with a cancer; the endometrial cavity could not be visualised by ultrasound and the sample was inadequate for the DNA test. Both methods missed one cancer; ultrasound did not detect the tubal metastasis in the endometrium and the WID®-qEC test missed a 2 mm grade 1 endometrial cancer. Detection of metastasis by the test is indicative of an ability to various types of cancer in the female reproductive tract. Ultrasound-assessed endometrial thickness as an index test in our cohort had a similar sensitivity but showed a substantially higher specificity compared with published data. The specificity in our cohort was 79·1% for a cut-off of ≥ 4·5 mm compared to 35·4%, 52·7% and 62·5% for a cut-off of >3, ≥ 4 or ≥ 5 mm, respectively9,10. Combining data from women with ≥ 4·5 mm endometrial thickness and / or polyps did not affect sensitivity but would result in a drop of specificity to 61·7%. The comparably high specificity of ultrasound might be explained by the multimodal approach in our study. TVS provided suboptimal images in 37·6% of patients in our cohort (i.e. women with TVS requiring at least one additional index imaging test), which is similar to a previous study30reporting a 38·1% rate of suboptimal endometrial assessment on TVS in their patients. It has been previously shown that suboptimal imaging of the uterine cavity leads to overestimation on endometrial thickness resulting in a higher proportion of false positive findings15. By using transrectal and transabdominal routes to examine the endometrium, and saline infusion sonography in selected cases, we eventually obtained optimal images of endometrium in 95·8% of our patients which translated into the increased index imaging test specificity. Despite the excellent performance of sonography in our study, the WID®-qEC test outperformed all current strategies for assessing women with AUB. For the WID®-qEC only one sample (obtained either by a healthcare professional or by the study participant) was required and only 9 samples were inconclusive, whereas the initial sonographic assessment (i.e., first index imaging test) led to 16·7 times more inconclusive results. Comparing tests providing a numerical value (i.e., endometrial thickness or ΣPMR), the WID®-qEC test delivered a higher ROC AUC than endometrial thickness, albeit this was not statistically significant. Direct comparison of sensitivities might be challenging due to the low number of cancer cases. However, when utilising predefined cut-offs or parameters the sensitivity of endometrial thickness and WID®-qEC were comparably high (90·9%) whereas the sensitivity of the subjective pattern recognition was low (63·6%) and did not offer a level of improvement that would warrant the wider use of it to triage women with AUB. Hysteroscopy and biopsy – currently deemed to be the gold standard – missed two cancer cases, both of which were WID®-qEC test positive. Although the strength of our study is the prospective cohort design embedded in a real-life setting, a limitation is the fact that we did not act on positive WID®-qEC test results. Nevertheless, of the 40 patients with a positive WID®-qEC, 28 (70·0%) had a histological assessment. Amongst patients with a false positive WID®-qEC test result were two women with an atypical hyperplasia, one of whom had a granulosa cell tumour. Among 12 women without histology, 11 had sonographic features which did not justify histological assessment (normal / atrophic endometrium). Additionally, hysteroscopy failed in one patient due to morbid obesity. This patient eventually had a hysterectomy revealing a grade 1 stage 1a endometrioid endometrial cancer, eight months after collection of the cervicovaginal sample which was WID®-qEC positive; she was not included in the performance analyses as the histology was obtained after database lockdown. Women undergoing outpatient hysteroscopy suffer from significant levels of preoperative anxiety31, comparable to levels experienced before major surgery under general anaesthesia and, for a proportion of women, the procedure is painful and traumatising32, meaning that efforts to reduce the number of these interventions required will be welcomed by clinical and patient communities26. Inclusion of the WID®-qEC test in the clinical diagnostic pathway for endometrial cancer offers five key advantages: (i) the test can be carried out in a primary care setting without the need for expensive equipment or highly skilled staff as evidenced by our previous data in cervico- vaginal sample self-collected by study participants24; (ii) the assay is suitable for high-throughput analysis, (iii) delivers an objective result within less than 48 hours and (iv) the decision to conduct hysteroscopy / biopsy will be reached after fewer investigations; and, overall, (v) fewer hysteroscopy / biopsy procedures will be required. Applying our data and a 3 mm endometrial thickness cut-off, as recommended in several countries10,11, to a population of 100 women presenting with abnormal bleeding would generate 52·6 false positive results requiring further investigation with hysteroscopy and biopsy. In contrast, applying the WID®-qEC test with a ΣPMR cutoff of 0·3, the number of false positive results could be reduced by 95% to 2·6 without affecting the number of true positive test results (figure 3). As prevalence is an important factor for the PPV and NPV, these parameters may vary depending on the prevalence of endometrial cancer in the population tested. Recent data show that in some countries about 80% of patients presenting with signs of gynaecological cancers have to wait for more than 62 days to start the treatment33. Most of this delay is triggered by overly long times to obtain an appointment at a gynaecological diagnostic centre. Hence our recommendation is that women with a very high likelihood of having cancer as the underlying cause of AUB (i.e. WID®-qEC ΣPMR > 0.3) are referred for a hysteroscopy and an endometrial biopsy in a tertiary cancer referral centre. Women with a WID®-qEC ΣPMR > 0·03 and < 0·3 could be referred as lower priority to general gynaecological clinics to investigate and treat possible causes of their AUB. The present study limited enrolment to patients ≥ 45 years of age and thereby the proportion of premenopausal women was low. Performance of the WID®-qEC test in menstruating women is therefore unclear, however based on previous data24,25sensitivity of the test is likely to be similar in pre- and postmenopausal women. Overall, these data indicate that the WID®-qEC test outperforms currently established strategies on important diagnostic test parameters (i.e., specificity and number of women required to be triaged for a reference histology test) for detection of uterine cancer in women who present with AUB. Implementation of the WID®-qEC test in the clinical diagnosis of women presenting with AUB could significantly reduce the complexity of the pathway by decreasing the number of required tests and help to target those most in need of rapid histological assessment. Research in context Evidence before this study We conducted a search of PubMed for articles published in English up to and including June 12, 2023 on the assessment of abnormal uterine bleeding in a prospective cohort setting (either interventional or observational) comparing conventional diagnostic pathways with novel tools similar to testing for cancer-specific DNA aberrations in cervicovaginal samples. The following search terms were utilised ("abnormal uterine bleeding" OR "postmenopausal bleeding") AND ("sonography" OR "diagnostic pathway" OR "ultrasound") AND "cohort" AND "prospective" AND "DNA", and the resultant literature proved extensive in describing the performance of ultrasound in reducing the number of women who require further tests (i.e., hysteroscopies and / or biopsies). The majority of studies evaluated retrospective data and only a few described the number of different procedures required to obtain a final diagnosis and the number of procedures that failed. In addition, a plethora of studies (mainly small case / control sets) describe molecular tests (both in plasma and cervicovaginal specimens) aimed to identify women with uterine cancers. No data provide a prospective back-to-back comparison of conventional diagnostic pathways and novel molecular tests for triage of women with abnormal uterine bleeding for invasive diagnostic procedures. Added value of this study To our knowledge EPI-SURE is the first study embedded in a conventional diagnostic pathway that has assessed a novel and easy to apply molecular test in women presenting with abnormal uterine bleeding. A positive DNA methylation test result indicates a higher probability a uterine cancer diagnosis compared to the conventional assessment pathway. Applying the test would lead to a smaller number of women requiring urgent invasive diagnostic procedures to detect cancer, substantially reducing delays in diagnosis. A negative DNA methylation test result indicates a very low probability of cancer; in our study, the only false negative case was a very small 2 mm grade 1 cancer. The DNA methylation test result can help assess the likelihood that abnormal uterine bleeding is due to cancer, providing an objective means to decide which patients require urgent referral to a tertiary cancer referral centre. Implications of all the available evidence With reference to the current guidelines, the data from our observational prospective study demonstrate the enormous labour, resource, skill-intensive, and time-consuming endeavours associated with the current assessment of women presenting with abnormal uterine bleeding, and highlights that even these procedures are not 100% sensitive. Our new DNA methylation test is based on a simple cervicovaginal sample and delivers a quantitative result within 48 hours. Those with negative results would be offered conservative and expectant management. Fewer healthy women would be triaged to have invasive hysteroscopy / biopsy procedures, which would reduce the pressures on rapid access gynaecology clinics and the overall costs of managing abnormal uterine bleeding. References 1. Lu KH, Broaddus RR. Endometrial Cancer. N Engl J Med 2020; 383(21): 2053-64. 2. Crosbie EJ, Kitson SJ, McAlpine JN, Mukhopadhyay A, Powell ME, Singh N. Endometrial cancer. Lancet 2022; 399(10333): 1412-28. 3. Siegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics, 2023. CA Cancer J Clin 2023; 73(1): 17-48. 4. Moss EL, Teece L, Darko N. Uterine cancer mortality and Black women: time to act. Lancet Oncol 2023; 24(6): 586-8. 5. Sud A, Torr B, Jones ME, et al. Effect of delays in the 2-week-wait cancer referral pathway during the COVID-19 pandemic on cancer survival in the UK: a modelling study. Lancet Oncol 2020; 21(8): 1035-44. 6. Matteson KA, Raker CA, Clark MA, Frick KD. Abnormal uterine bleeding, health status, and usual source of medical care: analyses using the Medical Expenditures Panel Survey. J Womens Health (Larchmt) 2013; 22(11): 959-65. 7. NICE. Clinical Guideline 44; Heavy menstrual bleeding 2007. National Institute for Health and Clinical Excellence (NICE). Available at: http: / / wwwniceorguk / nicemedia / pdf / CG44FullGuidelinepdf; 2007. 8. Clarke MA, Long BJ, Sherman ME, et al. Risk assessment of endometrial cancer and endometrial intraepithelial neoplasia in women with abnormal bleeding and implications for clinical management algorithms. Am J Obstet Gynecol 2020; 223(4): 549 e1- e13. 9. Clarke MA, Long BJ, Del Mar Morillo A, Arbyn M, Bakkum-Gamez JN, Wentzensen N. Association of Endometrial Cancer Risk With Postmenopausal Bleeding in Women: A Systematic Review and Meta-analysis. JAMA Intern Med 2018; 178(9): 1210-22. 10. Long B, Clarke MA, Morillo ADM, Wentzensen N, Bakkum-Gamez JN. Ultrasound detection of endometrial cancer in women with postmenopausal bleeding: Systematic review and meta- analysis. Gynecol Oncol 2020; 157(3): 624-33. 11. Doll KM, Romano SS, Marsh EE, Robinson WR. Estimated Performance of Transvaginal Ultrasonography for Evaluation of Postmenopausal Bleeding in a Simulated Cohort of Black and White Women in the US. JAMA Oncol 2021; 7(8): 1158-65. 12. Wong M, Thanatsis N, Amin T, Bean E, Madhvani K, Jurkovic D. Ultrasound diagnosis of endometrial cancer by subjective pattern recognition in women with postmenopausal bleeding: prospective inter-rater agreement and reliability study. Ultrasound Obstet Gynecol 2021; 57(3): 471- 7. 13. Wong M, Amin T, Thanatsis N, Naftalin J, Jurkovic D. A prospective comparison of the diagnostic accuracies of ultrasound and magnetic resonance imaging in preoperative staging of endometrial cancer. J Gynecol Oncol 2022; 33(2): e22. 14. Wong M, Amin T, Thanatsis N, Foo X, Jurkovic D. Efficacy of transrectal ultrasound in assessing endometrium of postmenopausal women with axial uterus. Ultrasound Obstet Gynecol 2022; 60(3): 414-9. 15. Price P, Sullivan R, Ahmed A, Wishart GC. UK cancer care: a watershed moment and the need for urgent intervention. Lancet Oncol 2023; 24(2): 133-8. 16. Nicholson BD, Oke J, Virdee PS, et al. Multi-cancer early detection test in symptomatic patients referred for cancer investigation in England and Wales (SYMPLIFY): a large-scale, observational cohort study. Lancet Oncol 2023. 17. Fiegl H, Gattringer C, Widschwendter A, et al. Methylated DNA collected by tampons--a new tool to detect endometrial cancer. Cancer Epidemiol Biomarkers Prev 2004; 13(5): 882-8. 18. Bakkum-Gamez JN, Sherman ME, Slettedahl SW, et al. Detection of endometrial cancer using tampon-based collection and methylated DNA markers. Gynecol Oncol 2023; 174: 11-20. 19. Jones A, Teschendorff AE, Li Q, et al. Role of DNA methylation and epigenetic silencing of HAND2 in endometrial cancer development. PLoS Med 2013; 10(11): e1001551. 20. Wentzensen N, Bakkum-Gamez JN, Killian JK, et al. Discovery and validation of methylation markers for endometrial cancer. Int J Cancer 2014; 135(8): 1860-8. 21. Huang RL, Su PH, Liao YP, et al. Integrated Epigenomics Analysis Reveals a DNA Methylation Panel for Endometrial Cancer Detection Using Cervical Scrapings. Clin Cancer Res 2017; 23(1): 263-72. 22. Wen KC, Huang RL, Chen LY, et al. Endometrial Cancer Detection Using a Cervical DNA Methylation Assay (MPap) in Women with Abnormal Uterine Bleeding: A Multicenter Hospital- Based Validation Study. Cancers (Basel) 2022; 14(17). 23. Herzog C, Marin F, Jones A, et al. A Simple Cervicovaginal Epigenetic Test for Screening and Rapid Triage of Women With Suspected Endometrial Cancer: Validation in Several Cohort and Case / Control Sets. J Clin Oncol 2022; 40(33): 3828-38. 24. Schreiberhuber L, Herzog C, Vavourakis CD, et al. The WID-qEC test: Performance in a hospital-based cohort and feasibility to detect endometrial and cervical cancers. Int J Cancer 2023; 152(6): 1269-74. 25. Wan YL, Beverley-Stevenson R, Carlisle D, et al. Working together to shape the endometrial cancer research agenda: The top ten unanswered research questions. Gynecol Oncol 2016; 143(2): 287-93. 26. von Elm E, Altman DG, Egger M, et al. The Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) statement: guidelines for reporting observational studies. Lancet 2007; 370(9596): 1453-7. 27. Leone FP, Timmerman D, Bourne T, et al. Terms, definitions and measurements to describe the sonographic features of the endometrium and intrauterine lesions: a consensus opinion from the International Endometrial Tumor Analysis (IETA) group. Ultrasound Obstet Gynecol 2010; 35(1): 103-12. 28. Barrett JE, Herzog C, Kim YN, et al. Susceptibility to hormone-mediated cancer is reflected by different tick rates of the epithelial and general epigenetic clock. Genome Biol 2022; 23(1): 52. 29. Goldstein SR, Khafaga A. Ability to successfully image endometrium on transvaginal ultrasound in asymptomatic postmenopausal women. Ultrasound Obstet Gynecol 2021; 58(4): 625- 9. 30. Barrett JE, Herzog C, Jones A, et al. The WID-BC-index identifies women with primary poor prognostic breast cancer based on DNA methylation in cervical samples. Nat Commun 2022; 13(1): 449. 31. O'Flynn H, Murphy LL, Ahmad G, Watson AJ. Pain relief in outpatient hysteroscopy: a survey of current UK clinical practice. Eur J Obstet Gynecol Reprod Biol 2011; 154(1): 9-15. EXAMPLE 2 – Assay optimisation Summary The present Example demonstrates the utility of the assay of the invention in assessing individuals as having endometrial cancer. Exemplary embodiments of the invention are evaluated herein and demonstrate diagnosis of individuals having endometrial cancer with high sensitivity and high specificity. Assays of the invention that requires PCR and the use of PMR-based thresholds is exemplified herein. The assays comprise the use of a test panel of CpGs contained within either three DMRs (defined according to SEQ ID NOs 1, 2 and 4) or within two DMRs (defined according to SEQ ID NOs 1 and 2). The assay comprising the use of a test panel of CpGs contained within three DMRs is shown to accurately assess individuals as having endometrial cancer with high sensitivity and high specificity. However, the present Example surprisingly demonstrates that an assay comprising the using a test panel of two or more CpGs contained within as little as two DMRs (SEQ ID NOs 1 and 2) can assess individuals as having endometrial cancer with even greater statistical accuracy. Findings concerning this surprising improvement are set out in detail below. - The above assay comprising the use of a test panel of CpGs contained within three DMRs refer two DMRs found in GYPC gene (SEQ ID NOs 1 and 4) and one found in the ZSCAN12 gene (SEQ ID NO 2). - One of the two GYPC DMRs (SEQ ID NO 4) was removed from the assay to arrive at the assay comprising the using a test panel of two or more CpGs contained within as two DMRs (SEQ ID NOs 1 and 2). This resulted in fewer false positive assessments of induvial having endometrial cancer. - Using a quantitative PCR based approach, a CT (cycle threshold) cutoff for the control sequence (COL2A1 defined according to SEQ ID NO 3) was sown to COL2A1 further reduced false negative and false positive rates. - The assay comprising a test panel of two or more CpGs contained within as two DMRs (SEQ ID NOs 1 and 2) was further optimised by the use of a duplex reaction of GYPC and COL2A1 (SEQ ID NOs 1 and 3) and ZSCAN12 as a singleplex reaction. The GYPC reaction is thought to be stabilised when in combination with the COL2A1 reaction). Primer and probe concentrations are also shown to be optimised to further improve the assay. - Demonstration the performance of the assay back-to-back with the conventional index testing (i.e., ultrasound) in a true cohort of women with abnormal uterine bleeding and defining cutoff thresholds of 0.03 and 0.3 as described further herein. Details During assay development, 768 samples from different studies including ThinPrep- and SurePath-based Cervex- and self-collection devices in case / control, symptomatic cohorts and pre- symptomatic cohorts (cases defined as endometrial cancer or cervical cancer) were analysed in duplex PCR reactions in technical replicates (n=2) with the original three-DMR assay test setup, detecting ZSCAN12 (Chr6: 28367535-28367599), GYPC (Chr2: 127413858-127413944), GYPC (Chr2: 127413797-127413902), and COL2A1 (Chr12: 48381229-48381320) regions. In the PCR method for assessing DNAme of bisulfite treated DNA described in this example, as a result of performing the method it is confirmed that each one of the CpGs of SEQ ID NOs 1, 2, 4, 18, 19 and 20 which are denoted by [[CG]], as identified further herein, is identified as methylated (prior to bisulfite treatment) in the nucleic acid strand assessed by the method. It is further confirmed that each one of the corresponding CpGs in the nucleic acid strand which is complementary to the assessed strand is methylated prior to bisulfite treatment. For the purposes of determining the methylation status of CpG in such a region (i.e. a DMR), the skilled person would therefore be aware that determining CpG methylation in one strand of a region is sufficient to define a CpG within the region as a whole (i.e. on either strand) as methylated. With the teaching of an assay directed to one strand in mind, the skilled person would be capable of designing an assay to directed to the complementary CpGs on the complementary strand. 30 of 768 samples were OC cases or not annotated and another 19 samples did not show COL2A1 amplification in both duplicates and were therefore excluded from the analysis. Data from the remaining 718 samples were re-analysed and a subset of these samples were utilised to optimise the PCR reactions and the setup of a further optimised assay. 1. Increasing specificity by removing one GYPC reaction and increasing Input amount (i.e., lowering COL2A1 CT cutoff): We stratified the samples according to the COL2A1 CT values and deemed the test to be positive and negative in the event both duplicates showed detectable or non-detectable CT values, respectively. The results were deemed to be inconclusive (non-reproducible) in the event only one duplicate revealed a detectable CT value. In the initial experiments with the selected targets ZSCAN12 (Chr6: 28367535-28367599), GYPC (Chr2: 127413858-127413944), and GYPC (Chr2: 127413797-127413902), we observed false positive results due to inconclusive amplification in technical replicates or high CT values most prevalent in one of the GYPC (Chr2: 127413858- 127413944) regions, leading to a decrease in specificity, whereas sensitivity remained high. Data analysis of the single targets revealed that GYPC (Chr2: 127413858-127413944) leads to an increased number of false positive results, therefore lowering the specificity of the assay (Figure 6). Furthermore, we observed a higher sensitivity with increasing DNA input amount (lower COL2A1 CT value), suggesting a preferred cutoff of CT <28 for COL2A1 for future testing to optimise sensitivity of detection of DNA methylation of the two remaining target genes (ZSCAN12 (Chr6: 28367535-28367599) and GYPC (Chr2: 127413797-127413902)) in endometrial cancer cases. 2. 2-target (2-DMR) versus 3-target (3-DMR) assay setup (excluding GYPC (Chr2: 127413858-127413944)): The above data analysis suggested the exclusion of the GYPC (Chr2: 127413858- 127413944) region from the assay may further increase specificity. However, we did not want to compromise sensitivity and therefore re-analysed all data in duplicates including either all three targets, ZSCAN12 (Chr6: 28367535-28367599), GYPC (Chr2: 127413858-127413944), and GYPC (Chr2: 127413797-127413902) or only ZSCAN12 (Chr6: 28367535-28367599) and GYPC (Chr2: 127413797-127413902) and calculated SUM PMR values. We applied the COL2A1 CT cutoff of >28 in this analysis and subsequently compared it with the sensitivity and specificity of samples with COL2A1 CT value >28. Although we observed a small reduction in sensitivity, which is mostly due to a slightly lower detection rate of cervical cancers (from 95.3% to 93%) when excluding GYPC (Chr2: 127413858-127413944), the specificity increased significantly (from 90.6% to 96.5%), thereby indicating an overall improvement in statistical accuracy of the assay using the two-DMR approach. Therefore, we decided to exclude GYPC (Chr2: 127413858-127413944) from future testing and continued with optimising the WID-qEC test including the two target regions ZSCAN12 (Chr6: 28367535-28367599) and GYPC (Chr2: 127413797-127413902) as well as the COL2A1 (Chr12: 48381229-48381320) region as a reference. We first assessed a triplex PCR reaction containing both targets and the reference region labelled by 3 different fluorophores, which resulted in reduced sensitivity for both target regions. We next assessed two duplex PCR reactions containing ZSCAN12 (Chr6: 28367535- 28367599) and COL2A1 (Chr12: 48381229-48381320) or GYPC (Chr2: 127413797-127413902) and COL2A1 (Chr12: 48381229-48381320), respectively. Initial tests suggested a reduction of the COL2A1 primer concentration to 0.15 µM for forward as well as reverse primer to obtain higher sensitivity of the other two reactions, ZSCAN12 and GYPC. We performed analytical sensitivity and linearity experiments in artificial gBlock standard as well as methylation standard DNA. For the methylation standard DNA, genomic DNA from SSS1 treated HCT116 cells as well as unmethylated WGA DNA was used to produce a range of 100%, 50%, 10%, 5%, 1%, and 0,1% methylated in unmethylated DNA. Unmethylated DNA was used as a negative control to ensure methylation-specificity of the PCR test (Figure 8). For the linearity test, we used a gBlock, artificial double-stranded DNA containing all three regions, which was used as input material in a range from 1,000,000 to 1 copy (Figure 9). Both experiments showed high sensitivity in the duplex PCR setup. For GYPC (Chr2: 127413797-127413902), the duplex reaction together with COL2A1 resulted in substantially higher stability and sensitivity compared to the single GYPC reaction, whereas the ZSCAN12 reaction showed similarly high sensitivity and stability in single as well as duplex reactions (Figures 8+9, orange marks). We then investigated the duplex test setup in real-life samples. Samples with relatively low PMR were used for Limit of Detection (LOD) and Precision analyses. Interestingly, in contrast to what we observed in the analytical sensitivity experiments, we now observed a reduction in precision and sensitivity in the ZSCAN12 duplex reaction together with COL2A1 compared to the single reaction (Figure 10). We therefore decided to run ZSCAN12 in a single reaction for future testing. However, in line to what was observed in the analytical sensitivity and linearity experiments, the duplex reaction of GYPC and COL2A1 showed higher precision and sensitivity compared to the single GYPC reaction (Figure 11). Based on these analytical performance tests the following preferred performance parameters were defined: Reactions in general: 20 µl reactions in 384-well PCR plate: • 20 ng DNA per reaction (4 ng / µl → 5 µl). • 10 µl 2x Luna Universal Probe qPCR MM (NEB). • 5 µl MM1: COL2A1-FAM(BHQ1) + GYPC-CY5(BHQ3). • OR 5 µl MM2: ZSCAN12-FAM(BHQ1). Reaction 1 WHAT? Stock Working Concentration Concentration LUNA MM 2x 1x ZSCAN12_fo 100 µM 400 nM ZSCAN12_re 100 µM 400 nM ZSCAN12-FAM 100 µM 200 nM Water DNA 4 ng / µl 20 ng TOTAL Reaction 2 WHAT? Stock Working Concentration Concentration LUNA MM 2x 1x GYPC_fo 100 µM 400 nM GYPC_re 100 µM 400 nM GYPC-CY5 100 µM 200 nM COL2A1_fo 100 µM 150 nM COL2A1_re 100 µM 150 nM COL2A1-FAM 100 µM 250 nM Water DNA 4 ng / µl 20 ng TOTAL • gBlock (artificial dsDNA, ordered from IDT) containing all 3 targets (fully methylated, bisulfite converted sequence) for Std. curve: 10^5-10^2 copies. • gBlock positive Ctrl (gBlock at 2260 copies) for PMR calculation. • Water as negative Ctrl. • Analysed in technical duplicates. • 90 samples per plate + 4 Std + 1 pos. Ctrl + 1 neg. Ctrl (96 samples in total). • Primer / Probes. Gene Sequence ZSCAN12 (Chr6: ZSCAN12 28367535-28367599) Forward Primer 5' to 3' AGAGCGGTCGCGGAAGT Reverse Primer 5' to 3' AACCGAAAACGACCACGAAA Probe CGTTTCGCGCGGGTTGGTTTT Probe labelling 5' 6-FAM - 3' BHQ-1 GYPC (Chr2: 127413797- GYPC 127413902) Forward Primer 5' to 3' TTTGGTTAGTTTTCGCGGTTTT Reverse Primer 5' to 3' CGACGAATACTCACCGAAACTAAA Probe TCGGGTTGACGTTTAGGAATGTGGTCG Probe labelling 5' Cy5 - 3' BHQ-3 COL2A1 (Chr12: COL2A1 48381229-48381320) Forward Primer 5' to 3' TCTAACAATTATAAACTCCAACCACCAA Reverse Primer 5' to 3' GGGAAGATGGGATAGAAGGGAATAT CCTTCATTCTAACCCAATACCTATCCCACCTCT Probe AAA Probe labelling 5' 6-FAM - 3' BHQ-1 • gBlock sequence: 5'- CTC ACT TGT AGA ACG GTG ATC AGC CTG TGC TCT AGA GCC TGA TAG TTG AGC GAT ACA CAC AGA GCG GTC GCG GAA GTG CGT TTC GCG CGG GTT GGT TTT TAG ATT TTT CGT GGT CGT TTT CGG TTA GTC GTA GCT CCC ACA ATC ATC GTA GGT GTT TTG GTT AGT TTT CGC GGT TTT TGT TCG GGT TGA CGT TTA GGA ATG TGG TCG ACG AGA AGT TTT AAT AGT ACG GCG TGG TTT TTT AGT TTC GGT GAG TAT TCG TCG CGT CCA AGA CAT ACT GCG TTT ACG TGT CGA GGG AAG ATG GGA TAG AAG GGA ATA TAT TTA GAG GTG GGA TAG GTA TTG GGT TAG AAT GAA GGT TTG GTG GTT GGA GTT TAT AAT TGT TAG ATG ATC GTT GAA GTC GAC CTA CAT CGA GTG CGC ACT ATC AAG AGT GTT CCA GTC ACG CGA T -3’ gBlock is used for Standard curve: - Std1: 100,000 copies. - Std2: 10,000 copies. - Std3: 1,000 copies. - Std4: 100 copies. PMR calculation: Calculation 1a: input amount( ^^ ^^ ^^2 ^^1) =CT( ^^ ^^ ^^2 ^^1) − Intercept ( ^^ ^^ ^^2 ^^1 Std curve)Slope( ^^ ^^ ^^2 ^^1 Std curve)Calculation 1b: input amount( ^^ ^^ ^^ ^^) =CT( ^^ ^^ ^^ ^^) − Intercept ( ^^ ^^ ^^ ^^ Std curve)Slope( ^^ ^^ ^^ ^^ Std curve)Calculation 1c: input amount^^ ^^ ^^ ^^ − Intercept ( ^^ ^^ ^^ ^^ ^^12 Std curve) ( ^^ ^^ ^^ ^^ ^^12 Std curve)Input amounts are calculated for all samples and the gBlock positive Ctrl, respectively. Calculation 2a: 100 Where t refers to the mean input c to the mean input amount of COL2A1, s refers to the sample, and g refers to the gBlock positive Ctrl. Calculation 2b: Where t refers to the mean input amount of ZSCAN12, c refers to the mean input amount of COL2A1, s refers to the sample, and g refers to the gBlock pos Ctrl. Calculation 3: ^^^ ^^ ^^ = ^^ ^^ ^^^^^ ^^ ^^ ^^^+ ^^ ^^ ^^^^^ ^^ ^^ ^^ ^^12^ EXAMPLE 3 – Sample collection comparison The aim of the study was to assess whether the nature of sample collection (ie. using FLOQSwab or a Cervex brush) or the fluid in which the sample has been collected (for the FLOQSwab the sample is being released into the eNAT lysis buffer and for the Cervex brush the sample is being released into ThinPrep PreservCyt fluid) has an impact on the WID-qEC test result (i.e. level of WID-qEC ∑PMR). WID-qEC ∑PMR is as described in earlier examples herein. 16 women were recruited who have had a high suspicion of endometrial cancer. 15 / 16 women were confirmed to have an active endometrial cancer when the sample was collected and 1 / 16 women were confirmed to not have a cancer at the time of sample collection. Both collection methods were used in all 16 patients. In order to account for the fact that the first collection could reduce the amount of tumour DNA in the cervico-vaginal region the 16 patients were randomly split into 8 women where Copan collection device was used first and then the ThinPrep collection system was used afterwards and 8 patients where the sequence was changed (see Figure 13). A strong correlation of the WID-qEC ∑PMR assessed in Copan and ThinPrep device was observed (correlation coefficient = 0.89, P<0.01; Figure 14). Importantly, utilising the Copan device 100% (15 / 15) of women with endometrial cancer had a WID-qEC ∑PMR > 0.3. Utilising the ThinPrep device 100% (15 / 15) of women with endometrial cancer had a WID-qEC ∑PMR > 0.03; the 3 / 15 women with WID-qEC ∑PMR > 0,03 but < 0,3 had either a very small cancer or had the first sample collected with Copan and hence the amount of tumour DNA might have been reduced. The 1 / 16 woman with no endometrial cancer had a negative WID-qEC test result (WID-qEC ∑PMR = 0). The storage of the sample in eNAT for 7 days at room-temperature had no impact on the WID-qEC ∑PMR level (correlation coefficient of WID-qEC ∑PMR of sample processed instantly and after 7-day storage at room temperature = 0.93, p<0.01; Figure 15). In summary, the Copan FLOQSwab / eNAT system is at least as suitable as the ThinPrep Cervex / PreservCyt system to collect the sample for the WID-qEC testing. The Copan FLOQSwab / eNAT system might have 2 advantages: 1. Suitability to collect a sample with a low amount of tumour DNA and hence a higher concentration is the collection media due to the fact that (i) collection of normal cervical cells is being avoid and (ii) the sample is only released into 1 mL and not diluted in 20 mL as is in the ThinPrep Cervex / PreservCyt. 2. Suitability of high throughput as the eNAT sample can be directly utilized for DNA isolation and no sedimentation and / or centrifugation step is required as it is needed for the ThinPrep Cervex / PreservCyt system.

Claims

CLAIMS 1. An assay for assessing the presence, absence or development of cancer of the female reproductive tract in an individual, the assay comprising: a. providing a sample which has been taken from the individual, the sample comprising a population of DNA molecules; b. determining in the population of DNA molecules in the sample the methylation status of a test panel of two or more CpGs, wherein: i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 18, and wherein the at least one CpG is denoted by [[CG]]; and ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 2 and SEQ ID NO 19, and wherein the at least one CpG is denoted by [[CG]]; and c. assessing the presence, absence or development of cancer of the female reproductive tract in the individual based on the methylation status of the CpGs in the test panel.

2. An assay according to claim 1, wherein: a. at least two CpGs denoted by [[CG]] contained within the first DMR, at least three CpGs denoted by [[CG]] contained within the first DMR, at least four CpGs denoted by [[CG]] contained within the first DMR, at least five CpGs denoted by [[CG]] contained within the first DMR, or all of the CpGs denoted by [[CG]] contained within the first DMR, are in the test panel of CpGs; and / or b. at least two CpGs denoted by [[CG]] contained within the second DMR, at least three CpGs denoted by [[CG]] contained within the second DMR, at least four CGs denoted by [[CG]] contained within the second DMR, at least five CpGs denoted by [[CG]] contained within the second DMR, or all of the CpGs denoted by [[CG]] contained within the second DMR, are in the test panel of CpGs.

3. An assay according to claim 1 or claim 2, wherein the assay does not comprise determining in the population of DNA molecules in the sample the methylation status of one or more CpGs denoted by [[CG]] contained with a third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 20, optionally wherein the assay does not comprise determining the methylation status of any of the CpGs denoted by [[CG]] contained within the third DMR.

4. An assay according to any one of claims 1 to 3, wherein when the CpGs of the test panel of two or more CpGs are determined to be methylated, the individual is assessed as having cancer in the female reproductive tract, or as being at risk of development of cancer of the female reproductive tract.

5. An assay according to any one of claims 1 to 4, wherein cancer of the female reproductive tract comprises endometrial cancer, cervical cancer and ovarian cancer, uterine cancer, vaginal cancer and vulvar cancer, preferably wherein the cancer of the female reproductive tract is endometrial cancer or uterine cancer.

6. An assay according to any one of claims 1 to 5, wherein the step of determining the methylation status of the CpGs in the test panel comprises an amplification-based technique, preferably wherein: i. the amplification-based technique is PCR, optionally wherein the PCR comprises quantification; and / or ii. the amplification-based technique comprises a detection system, optionally wherein the system comprises a probe comprising a detection moiety.

7. An assay according to claim 6, wherein the step of determining the methylation status of the CpGs contained within the first DMR and the second DMR by PCR comprises: a. a duplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by [[CG]] in the first DMR, preferably in the strand defined by SEQ ID NO: 1 and a control sequence within the same reaction vessel, preferablywherein the control sequence does not comprise any CpG dinucleotides, denoted by CG; and b. a singleplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by [[CG]] in the second DMR, preferably in the strand defined by SEQ ID NO:

2.

8. An assay according to claim 8, wherein the control sequence is defined according to SEQ ID NO:

3.

9. An assay according to any one of claims 6-8, wherein prior to PCR, the two or more CpGs in the test panel have been subject to bisulfite treatment.

10. An assay according to claim 9, wherein: a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 7; and / or b. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primercomprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 10; and / or c. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising an a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment; and the reverse primer anneal to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 12, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 13; and / or optionally d. the assay comprises a negative control PCR reaction, preferably wherein the negative control reaction does not comprise a template nucleic acid sequence.

11. An assay according to any one of claims 8 to 10, wherein the assessing of the presence, absence or development of cancer of the female reproductive tract in the individual based on methylation of the CpGs in the test panel comprises determining mean percent of fully methylated reference (PMR) values for each DMR based on the methylation status of the CpGs from each DMR comprised in the test panel.

12. An assay according to any one of claims 1 to claim 11, wherein the test panel of two or more CpGs consists of the CpGs denoted by [[CG]] contained with the first strand of the first DMR defined according to SEQ ID NO 1 and the CpGs denoted by [[CG]] contained within the second strand of the second DMR defined according to SEQ ID NO 2.

13. A system for a PCR assay, the system comprising: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfitetreatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated.

14. A system according to claim 13, further comprising: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment of SEQ ID NO:

3.

15. A system according to claim 14, wherein: i. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 7; and ii. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 10; and iii. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 12, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO:

13.

16. A kit comprising:- a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated and following bisulfite treatment; and - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the nucleotide strand defined according to SEQ ID NO: 2 in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated and following bisulfite treatment of SEQ ID NO: 2; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated and following bisulfite treatment.

17. A kit according to claim 16, further comprising: - a forward primer, a reverse primer, and a probe optionally comprising a detection moiety, wherein the forward primer and probe anneal to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment of SEQ ID NO:

3.

18. A kit according to claim 17, wherein: i. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 7; and ii. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 10; and iii. the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, the reverse primer comprises or consists of a sequence defined according toSEQ ID NO: 12, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO:

13.

19. An in vitro method of assaying DNA and detecting methylation of the DNA therein, the method comprising measuring a methylation status of a test panel of two or more CpGs, wherein: i. at least one CpG in the test panel is contained within a first Differentially Methylated Region (DMR) comprised in the population of DNA molecules, the first DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 1 and SEQ ID NO 18, and wherein the at least one CpG is denoted by [[CG]]; and ii. at least one CpG in the test panel is contained within a second DMR comprised in the population of DNA molecules, the second DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO 2 and SEQ ID NO 19, and wherein the at least one CpG is denoted by [[CG]] and.

20. An in vitro method according to claim 19, wherein the test panel of two or more CpGs comprises: a. at least two CpGs denoted by [[CG]] contained within the first DMR, at least three CpGs denoted by [[CG]] contained within the first DMR, at least four CpGs denoted by [[CG]] contained within the first DMR, at least five CpGs denoted by [[CG]] contained within the first DMR, or all of the CpGs denoted by [[CG]] contained within the first DMR, are in the test panel of CpGs; and / or b. at least two CpGs denoted by [[CG]] contained within the second DMR, at least three CpGs denoted by [[CG]] contained within the second DMR, at least four denoted by [[CG]] CpGs contained within the second DMR, at least five CpGs denoted by [[CG]] contained within the second DMR, or all of the CpGs denoted by [[CG]] contained within the second DMR, are in the test panel of CpGs.

21. An in vitro method according to claim 19 or claim 20, wherein the method does not comprise measuring the methylation status of one or more CpGs denoted by [[CG]] contained with a third DMR defined by complementary nucleotide strands having the nucleotide sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 20, optionally wherein the method does not comprisemeasuring the methylation status of any of the CpGs denoted by [[CG]] contained within the third DMR.

22. An in vitro method according to any one of claims 19 to 21, wherein the method comprises PCR, optionally wherein the PCR comprises quantification.

23. An in vitro method according to claim 22, wherein the PCR comprises: a. a duplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by [[CG]] in the first DMR, preferably in the strand defined by SEQ ID NO: 1 and a control sequence within the same reaction vessel, preferably wherein the control sequence does not comprise any CpG dinucleotides, denoted by CG; and b. a singleplex PCR reaction comprising PCR amplification of a region comprising one or more CpGs denoted by [[CG]] in the second DMR, preferably in the strand defined by SEQ ID NO:

2.

24. An in vitro method according to claim 23, wherein the control sequence is defined according to SEQ ID NO:

3.

25. An in vitro method according to claim 24, wherein: a. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein reverse primer anneals to the strand defined according to SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 1 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 1 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 5, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 6, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 7; and / orb. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein the reverse primer anneals to the strand defined according to SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and the forward primer and the probe anneal to the complementary sequence of SEQ ID NO: 2 following bisulfite treatment in which all CpGs denoted by [[CG]] in SEQ ID NO: 2 are methylated; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 8, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 9, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 10; and / or c. the PCR comprises amplification using a forward primer, a reverse primer, and annealing of a probe optionally comprising a detection moiety, wherein forward primer and probe anneal to the sequence defined according to SEQ ID NO: 3 following bisulfite treatment, and the reverse primer anneals to the complementary sequence of SEQ ID NO: 3 following bisulfite treatment of SEQ ID NO: 3; and preferably wherein the forward primer comprises or consists of a sequence defined according to SEQ ID NO: 11, the reverse primer comprises or consists of a sequence defined according to SEQ ID NO: 12, and the probe sequence comprises or consists of a sequence defined according to SEQ ID NO: 13; and / or optionally d. the assay comprises a negative control PCR reaction, preferably wherein the negative control reaction does not comprise a template nucleic acid sequence.

26. A method of treating and / or preventing cancer of the female reproductive tract in an individual, the method comprising: i. assessing the presence, absence or development of cancer in the female reproductive tract of an individual according to any one of claims 1 to 12; and ii. administering one or more therapeutic or preventative treatments or measures to the individual based on the assessment.

27. A method of monitoring the cancer status and / or the risk of cancer development of an individual, the method comprising: (a) assessing the presence, absence or development of cancer inan individual by performing the assay according to any one of claims 1 to 12 at a first time point; (b) assessing the presence, absence or development of cancer in the individual by performing the assay according to any one of claims 1 to 12 at one or more further time points; and (c) monitoring any change in the cancer status and / or the risk of cancer development of the individual, wherein the cancer is of the female reproductive tract.

Images