Set of primers, diagnostic set, method of detecting the v600e mutation in the BRAF gene and use thereof

Abstract

The present invention relates to a set of primers for DNA amplification, which have the following sequences: 5'-CTGATAGGAAAATGAGATCTACTG-3' (SEQ ID NO: 1) 5'-GGCCAAAAATTTAATCAGTGG-3' (SEQ ID NO: 2) 5'-TCTGTAGCTAGACCAAAATCACCTATTTTCCTTTACTTACTACACCTC-3' (SEQ ID NO: 3) 5 '-AGAAATCTCGATGGAGTGGGTCCAAAATAGCCTC AATTCTTACC AT-3 ' (SEQ ID NO: 4) 5'-TCTTCATGAAGAAATATATCT-3' (SEQ ID NO: 5) 5'-CATCAGTTTGAACAGTTGT-3' (SEQ ID NO: 6). The present invention further relates to a diagnostic kit, a method for detecting a V600E mutation in the BRAF gene in a DNA sample, and to the use of said set of primers and / or of the diagnostic kit for detection of the BRAF V600E mutation in a DNA sample.

Description

[0001] Set of primers, diagnostic set, method of detecting the V600E mutation in the BRAF gene and use thereof

[0002] Field of Art

[0003] The present invention relates to a novel detection method for diagnosing the V600E mutation in the BRAF gene using the LAMP method and specific sequences recognising only the mutated variant of the gene. The V600E mutation is a diagnostic biomarker determined in selected cancer diagnoses to determine effective treatment.

[0004] Background Art

[0005] Point mutations in the original proto-oncogenes are often responsible for the development of cancer. An example of such an oncogenic mutation is the substitution of thymine for adenine bases at position 1799 in the BRAF proto-oncogene, resulting in a change in the sense of codon 600 from valine (V) to glutamic acid (E), abbreviated as BRAF V600E. The functional consequence of this mutation is the permanent activation of oncoprotein B-raf, which is independent of external signals, and the subsequent activation of the MEKZERK signalling pathway that stimulates cell proliferation and migration. The V600E mutation is present in up to 50 % of malignant melanoma and 45 % of papillary thyroid tumours, and to a lesser extent in colorectal cancer (10 %) or nonsmall cell lung cancer (3 %) (Corcoran RB. New therapeutic strategies for BRAF mutant colorectal cancers. J Gastrointest Oncol. 2015;6(6):650-659; Xing M. BRAF mutation in thyroid cancer. Endocr Relat Cancer. 2005;12(2):245-262). Negative prognostic significance has been demonstrated for all of these tumours, with patients carrying the mutation showing a significantly worse response to treatment compared to patients without the mutation. These findings have contributed to the increased success of targeted therapy in recent years with new inhibitors of the mutated B-raf protein, particularly in melanoma.

[0006] Standard methods for detecting the V600E mutation in the BRAF gene include next-generation sequencing or digital PCR, which are both expensive in terms of instrumentation and chemistry and time-consuming. Isothermal amplification techniques represent a cheaper and faster option for DNA analysis, even for point mutations. These are constant temperature techniques during amplification of the target DNA and therefore do not require PCR cyclers. In addition, they achieve comparable sensitivity to PCR but are usually more resistant to potential inhibitors of the PCR reaction. The best known of these is probably LAMP, or loop-mediated isothermal amplification, (Notomi T, Okayama H, Masubuchi H, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28(12):E63), using 4 to 6 primers. Annealing of primers results in the formation of loops, specific dumbbell-shaped structures (dumbbells), and amplicons of different lengths during a single reaction, so that when visualized on agarose gel, a ladder composed of LAMP products of different lengths appears instead of the classical single band. Most commonly, the LAMP method is used to detect pathogens in a variety of samples (food, soil, clinical samples, etc.). However, the possibility of detecting a point mutation (single nucleotide polymorphism, SNP) when primers are annealed, where amplification occurs or does not occur depending on the presence of the mutation, is a much more challenging process and has not been very successful so far. In addition, in studies where LAMP method has been used to detect point mutations, additional probes or restriction analyses have often been used to increase the selectivity of the assay.

[0007] The state of the art lacks an easy and rapid method to detect the V600E point mutation of the BRAF gene that is also robust to potential inhibitors of the PCR reaction.

[0008] Disclosure of the Invention

[0009] The present invention is based on the amplification of the V600E mutated form of the BRAF gene by the LAMP method (Fig. 1), using primers specific for the V600E mutation (a set of primers labelled BRAF V600E). Using the present method, it is possible to detect the presence of the V600E mutation of the BRAF gene quickly, easily and with high sensitivity and specificity. The analysis does not amplify the non-mutated, so-called wild-type (wt) form of the BRAF gene, for which the result is negative (Fig. IB). We also present a second set of primers, labelled ACTB, which amplifies the ACTB gene and this concurrent reaction serves as an amplification control to confirm the presence and integrity of genomic DNA in the sample. Thus, the reaction with ACTB primers is a control, as a negative reaction with the BRAF V600E primer set could also be due to insufficient amount of DNA or degradation of DNA, especially in samples obtained from, for example, serum. The developed method for detection of the mutated form of the BRAF gene by LAMP method using the set of primers described below allows qualitative detection of the presence of the mutation in the sample and thus of the activation of the B-raf oncoprotein, all without the need for additional probes or restriction analysis, which previous detection methods did not allow. Moreover, the present invention does not require expensive laboratory equipment such as a PCR cycler or Real-Time PCR cycler, but only a thermoblock or incubator with a temperature range of up to about 70 °C. The minimal amount of literature describing the LAMP method for SNP analysis indicates the difficulty of designing appropriate primers for the determination of the BRAF V600E mutation by the LAMP method using only a unique set of primers. Current methods for mutation detection using variants of the PCR method (ddPCR, ARMS-PCR, qPCR, etc.) require multi-step protocols, longer reaction times, and possibly additional fluorescent probes, which increases the overall time and material requirements of the assay. The present invention offers a simple and rapid option for monitoring cancer progression - prediction of resistance to BRAF inhibitors (e.g. encorafenib, vemurafenib).

[0010] In one aspect, the present invention provides a set of primers for detecting the BRAF V600E mutation in human DNA, comprising six DNA amplification primers having the following sequences:

[0011] The above set of six primers is designed for amplification of DNA derived from biological samples (Homo sapiens), for example, from formalin-fixed, paraffin-embedded (FFPE) blocks taken from patients with colorectal cancer, malignant melanoma or papillary thyroid cancer. Compared to prior art methods, the above six primers increase the efficiency of the LAMP method and reduce the detection time.

[0012] The set of primers described above is designed to amplify a section of the BRAF (B-Raf protooncogene, serine / threonine kinase) gene. The primers according to the present invention bind specifically to the target DNA, the sequence serving as template is 210 bp in size. The resulting product of LAMP amplification is composed of fragments of different lengths and is detectable, for example, by horizontal agarose gel electrophoresis, where it is ladder-shaped. The corresponding gene section with the position of the regions (in bold) to which the primers BRAF V600E F3, BRAF V600E B3, BRAF V600E FIP, BRAF V600E BIP, BRAF V600E LF and

[0013] BRAF V600E LB anneal has the following sequence:

[0014] CATTGTTTTAGACATACTTATTGACTCTAAGAGGAAAGATGAAGTACTATGTTTTAA

[0015] AGAATATTATATTACAGAATTATAGAAATTAGATCTCTTACCTAAACTCTTCATAAT

[0016] GCTTGCTCTGATAGGAAAATGAGATCTACTGTTTTCCTTTACTTACTACACCTCA

[0017] GATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTA

[0018] CAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCA

[0019] TTTTGTGGATGGTAAGAATTGAGGCTATTTTTCCACTGATTAAATTTTTGGCCCT

[0020] GAGATGCTGCTGAGTTACTAGAAAGTCATTGAAGGTCTCAACTATAGTATTTTCATA

[0021] GTTCCCAGTATTCACAAAAATCAGTGTTCTTATTTTTTATGTAAATAGATTTTTTAAC (SEQ ID NO: 7)

[0022] GAG - mutated variant (V600E), both the 5 -end of BRAF V600E FIP and the 5 -end of BRAF V600E BIP hybridises to adenine ‘A’.

[0023] In one embodiment of the invention, the set of primers for detecting the BRAF V600E mutation described above can be used in combination with a set of primers for detecting the ACTB gene in human DNA, comprising DNA amplification primers having the following sequences:

[0024] The above DNA amplification primer set for the detection of the ACTB gene is designed to amplify DNA from the same biological samples (Homo sapiens) as the set of six primers for the detection of the BRAF V600E mutation described above. The purpose of using the ACTB detection primer set is to check that sufficient amount of genomic DNA has been used for LAMP amplification and that the reaction has taken place.

[0025] The set of primers described above is designed to amplify a section of the ACTB (beta actin) gene. The sequence used as template is 218 bp in size. The resulting product of LAMP amplification is composed of fragments of different lengths and can be determined, for example, by horizontal agarose gel electrophoresis, where it has the shape of a ladder. The corresponding gene section with the position of the regions (in bold) to which the primers ACTB F3, ACTB B3, ACTB FIP, ACTB BIP, ACTB LF and ACTB LB anneal has the sequence:

[0026] GGCACCAGGTAGGGGAGCTGGCTGGGTGGGGCAGCCCCGGGAGCGGGCGGGAGGC AAGGGCGCTTTCTCTGCACAGGAGCCTCCCGGTTTCCGGGGTGGGGGCTGCGCCCGT

[0027] GCTCAGGGCTTCTTGTCCTTTCCTTCCCAGGGCGTGATGGTGGGCATGGGTCAG AAGGATTCCTATGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTG AAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATC TGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGC TGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGGT GAGTGGCC

[0028] (SEQ ID NO: 14)

[0029] All primers described above can be prepared by standard oligonucleotide synthesis methods.

[0030] Thus, another object of the present invention is a diagnostic kit for detecting the BRAF V600E mutation biomarker, which can be used to detect activation of the B-raf oncoprotein and the associated risk of developing certain cancers, such as colorectal cancer, malignant melanoma, or papillary thyroid cancer, using LAMP amplification. Said diagnostic set comprises both sets of primers described above for the detection of the BRAF V600E mutation and for the detection of the A CTB gene.

[0031] In a preferred embodiment, the diagnostic set may further comprise:

[0032] - a reaction mixture for LAMP amplification comprising the nucleoside triphosphates dATP, dCTP, dGTP, dTTP and DNA polymerase, optionally further comprising a magnesium salt (e.g., MgCL or MgSCU) to form a thermostable complex with the nucleoside triphosphates that is recognised by the DNA polymerase. The DNA polymerase is Bst polymerase (Bacillus stearothermophilus), or variants thereof (2.0, 3.0, Turbo, etc.); and / or buffer (e.g., tris-borate-EDTA (TBE) buffer); and / or deionized water. Reaction mixtures for LAMP amplification are commercially available and a person skilled in the art would know where to obtain the necessary reaction mixture and how to use it for LAMP amplification.

[0033] A further object of the present invention is a method for detecting a V600E mutation in the BRAF gene in a DNA sample by isothermal LAMP amplification method, comprising the following steps:

[0034] 1) isolating DNA from a sample; and

[0035] 2) performing DNA amplification by the LAMP method using the set of primers for detecting the BRAF V600E mutation as defined above.

[0036] The isolation of DNA from the sample in step 1) may be performed by commonly available methods known to a person skilled in the art, such as fractional separation, column-based kit extraction, etc.

[0037] In one preferred embodiment, a step 3) is further performed, wherein DNA amplification is performed by LAMP method using the set of primers for ACTB detection as defined above, wherein the concentration of DNA in the sample in step 2) is the same as the concentration of DNA in the sample in step 3). Preferably, the same sample is used for both DNA amplifications by LAMP method (using both ACTB detection primers and BRAF V600E detection primers).

[0038] In a preferred embodiment, said method for detecting the V600E mutation in the BRAF gene in a DNA sample by isothermal LAMP amplification comprises the following steps:

[0039] (i) isolation of DNA from the sample;

[0040] (ii) providing a mixture for detection of BRAF\yy LAMP amplification method, comprising: a DNA sample, the set of primers for detection of the BRAF V600E mutation as defined above, LAMP amplification reaction mixture, deionised water;

[0041] (iii) providing a control mixture for detection of ACTB by LAMP amplification method, comprising: a DNA sample, the set of primers for detection of the ACTB gene as defined above, a reaction mixture for LAMP amplification, deionised water, wherein the concentration of the DNA sample and primers in the mixture is the same as the concentration of the DNA sample and primers in the mixture from step (ii);

[0042] (iv) LAMP amplification of the mixtures of steps (ii) and (iii); (v) gel electrophoresis of the amplified mixtures from step (iv);

[0043] (vi) evaluation of the presence of the V600E mutation in the BRAF gene in the DNA sample.

[0044] Ad (i): The DNA for analysis is found, for example, in a tissue, serum or blood sample of the subject. In some cases, it may be appropriate to prepare the DNA sample using various extraction methods that isolate and purify the DNA from other components of the sample. These purification methods are known to a person skilled in the art.

[0045] Ad (ii) and (iii): Providing a mixture for detection of BRAF\yy LAMP amplification method means providing the set of primers BRAF V600E F3, BRAF V600E B3, BRAF V600E FIP, BRAF V600E BIP, BRAF V600E LF and BRAF V600E LB, as defined above. Primers can be prepared by standard methods of oligonucleotide synthesis. The mixture in step (ii) further comprises the DNA sample to be analysed.

[0046] The reaction mixture for LAMP amplification is commercially available and typically contains the nucleoside triphosphates dATP, dCTP, dGTP, dTTP and DNA polymerase.

[0047] It is important to have sufficient amount of target DNA in the reaction mixture to successfully amplify the target sequence. If the DNA sample is of insufficient amount or quality, false negative results may occur. This is prevented by using the control mixture of step (iii), where the same concentrations of all components are used, only the set of primers is different - the set of primers for the ACTB gene detection as defined above is used.

[0048] Using the set of primers for ACTB gene detection, if sufficient amount of DNA is used, amplification should be visible regardless of the presence / absence of the BRAF V600E mutation. Thus, this mixture serves as a control that the concentration of DNA in the analysed sample is sufficient for the LAMP reaction to proceed.

[0049] In a preferred embodiment, the amount of genomic DNA in the sample to be analysed using LAMP analysis is in the range of from units of nanograms to units of micrograms, more preferably the concentration of DNA in the sample for LAMP analysis is in the range of from 5 ng / pl to 100 ng / pl. In one embodiment, the concentration of DNA in the sample for LAMP analysis is 10 ng / pl.

[0050] Each primer (FIP, BIP, F3, B3, possibly LF and LB) should be present in the reaction mixture at a concentration typically in the range of from 0.1 to 2 pM. The exact concentration of primers may vary depending on optimisation. In one embodiment, the concentration of primers in the sample for LAMP analysis is as follows: 1.6 pM FIP; 1.6 pM BIP, 0.4 pM LF; 0.4 pM LB; 0.2 pM F3; 0.2 pM B3. Optimal concentrations of deoxyribonucleoside triphosphates (dNTPs) are usually in the range of from 0.4 to 2.4 mM for each dNTP. The total concentration of dNTPs should be high enough to promote DNA amplification but not excessively high to avoid adverse side reactions. In one embodiment, the concentration of dNTP in the sample for LAMP analysis is in the range of from 1.2 to 1.6 mM.

[0051] The DNA polymerase is preferably Bst polymerase, more preferably its concentration in the sample for LAMP analysis is in the range of from 0.30 to 0.34 U / pL.

[0052] Ad (iv): the LAMP amplification of the mixtures of steps (ii) and (iii) is preferably carried out at a temperature in the range of from 60 to 65 °C for at least 30 min. A DNA-free sample, for example deionised water only, may be used as a control.

[0053] Ad (v): Detection of the results of the amplified mixtures and, where appropriate, of the control sample is carried out by gel electrophoresis. In one embodiment, in this step, the amplified reaction mixture is mixed with a loading buffer (the loading buffer is a solution containing a dye and glycerol and optionally other additives such as sucrose, etc.), the samples are spotted onto an agarose gel with added nucleic acid dye and subjected to electrophoresis. Electrophoresis separates the amplified mixture based on the size / mass of the amplicons. Comparison with a standard is then used to evaluate whether or not a reaction has occurred based on the presence / absence of a specific LAMP product. The standard may be a positive control (i.e., a sample that contains DNA with a V600E mutation present in the BRAF gene) or an assayed DNA sample amplified by LAMP method using the set of primers for ACTB detection, as defined above.

[0054] Ad (vi): Evaluation of the presence of the V600E mutation in the BRAF gene in the DNA sample is performed as follows: First, it is assessed whether the DNA concentration in the sample was sufficient. This is determined by electrophoresis of the amplified mixture from step (iii) containing the set of primers for detection of the ACTB gene. If the mixture contains a specific LAMP product when compared to the standard, the DNA concentration in the sample was sufficient, and is followed by evaluation by electrophoresis of the amplified mixture from step (ii) containing the set of primers for the detection of the BRAF V600E mutation. If this mixture contains a specific LAMP product when compared to the standard, this indicates that the analysed DNA sample did contain the BRAF V600E gene mutation. If the amplified mixture from step (iii), containing primers for the detection of the ACTB gene, does not contain a specific LAMP product when compared to the standard, the concentration of DNA in the sample was insufficient and the detection of the V600E mutation in the BRAF gene in the DNA sample by isothermal LAMP amplification method needs to be repeated with a more concentrated DNA sample (it is possible to increase the amount of sample used in the reaction or to increase the reaction time).

[0055] Another object of the present invention is the use of the set of primers for the detection of the BRAF V600E mutation comprising the sequences BRAF V600E F3 (SEQ ID NO: 1), BRAF V600E B3 (SEQ ID NO: 2), BRAF V600E FIP (SEQ ID NO: 3), BRAF V600E BIP (SEQ ID NO: 4), BRAF V600E LF (SEQ ID NO: 5) and BRAF V600E LB (SEQ ID NO: 6), described above, and / or the diagnostic set as defined above, for detecting the BRAF V600E mutation in a DNA sample, preferably by the LAMP method.

[0056] Description of the Drawings

[0057] Figure 1 : Schematic of the SNP-specific LAMP reaction. The four primers F3, B3, FIP, BIP are essential for the course of the reaction. Additional primers LF and LB increase the efficiency of the LAMP reaction and shorten the detection time. Their annealing occurs only in the second step of amplification (not shown). The oligonucleotide at the 5 end of primers FIP and BIP ensures recognition of the mutation and specificity of its amplification. In the presence of the unmutated (wt) template, the primers do not anneal correctly and amplification does not proceed.

[0058] Figure 2: Results of qualitative determination visualized on gel. A: The set of primers specific for the V600E mutation in the BRAF gene was used in the LAMP reaction. B: The set of primers specific for the ACTB gene was used in the LAMP reaction.

[0059] Figure 3: Results of qualitative determination at two time intervals of 30 and 60 minutes visualized on gel. A: The set of primers specific for the V600E mutation in the BRAF gene (SEQ ID NO: 1- 4) was used in the LAMP reaction. B: The more convenient set of primers specific for the V600E mutation in the BRAF gene (SEQ ID NO: 1-6) was used in the LAMP reaction.

[0060] Figure 4: Results of qualitative determination visualized on gel. A: The set of primers specific for the V600E mutation in the BRAF gene was used in the LAMP reaction. B: The set of primers specific for the ACTB gene was used in the LAMP reaction.

[0061] Figure 5 : The target sequence (SEQ ID NO: 7) of the Homo sapiens B-Raf proto-oncogene (BRAF) on chromosome 7, with regions for primer annealing indicated. Figure 6: The target sequence (SEQ ID NO: 14) of the Homo sapiens actin beta (ACTS) on chromosome 7, with regions for primer annealing indicated.

[0062] Figure 7: Results of qualitative determination at a time interval of 30 minutes visualized on the gel. Left: The set of six primers specific for the V600E mutation in the BRAF gene according to the present invention was used in the LAMP reaction SEQ ID NO: 1-6). Right: A set of primers specific for the V600E mutation in the BRAF gene was used in the LAMP reaction (SEQ ID NO: 1, 2, 3, 15, 5, 6).

[0063] Examples

[0064] Material and instrumentation required to determine the V600E mutation in the BRAF gene and the presence of the ACTB gene using the kit according to the present invention:

[0065] Material

[0066] • deionised water

[0067] • pipetting tips with filter

[0068] • microtubes (0.2 ml) or 96- / 384-well plate

[0069] • reaction mix for LAMP amplification in the 2x Master Mix variant (contains the nucleoside triphosphates dATP, dCTP, dGTP, dTTP [2.8 mM each], MgSO4 [16 mM] and Bst polymerase [0.64 U / pl]);

[0070] • agarose

[0071] • 0.5 x TBE buffer, pH 8

[0072] • GelRed nucleic acid dye for visualization under UV light

[0073] • 6x loading buffer for gel (PCR loading buffer)

[0074] Instrumentation & Accessories

[0075] • thermoblock or thermomixer

[0076] • horizontal electrophoretic apparatus

[0077] • camera system for visualisation of the gel with UV transilluminator

[0078] Example 1 : Method for qualitative determination of the presence of the V600E mutation of the B RAF gene DNA amplification using the LAMP isothermal amplification technique was performed as follows: A mixture of the components listed below was amplified at 62 °C for 30 min (without the need of denaturation or deactivation).

[0079] Total volume 10 pl

[0080] After the incubation was completed, the reaction mixture was mixed with 6x loading buffer and the samples were pipetted onto a 1.5% agarose gel with added nucleic acid dye and loaded into a horizontal electrophoretic apparatus filled with TBE buffer where the mixture was separated based on the size / weight of the amplicons. Upon completion of the separation, the gel was photographed, and it was demonstrated whether or not a reaction had occurred based on the presence of a specific LAMP product. A DNA sample from the cell line with the V600E mutation (A375) was used as a positive control, and a sample without DNA (blank) was used as a negative control. Actin (ACTB) was used as an internal sample quality control. Results

[0081] Six cancer cell lines (A375, HT29, Caco2, SW620, LAPC4 and PANCI) with known mutational status of the BRAF gene were used for the reaction. The control sample did not contain DNA but only water (blank). These seven samples were tested by LAMP method in the presence of the BRAF V600E primer set, containing the primers BRAF V600E F3, BRAF V600E B3, BRAF V600E FIP, BRAF V600E BIP, BRAF V600E LF and BRAF V600E LB as defined above (Fig. 2 A) and the ACTB primer set containing the primers ACTB F3, ACTB B3, ACTB FIP, ACTB BIP, ACTB LF and ACTB LB defined above (Fig. 2B). Using the BRAF V600E primer set, only the A375 and HT29 cell lines carrying the BRAF V600E mutation were amplified. The other lines did not amplify as they only carry the unmutated variant of the gene (wt). When using the ACTB set, amplification was observed in all samples except the blank, demonstrating that sufficient genomic DNA was present and the reaction took place. The results of the experiment are shown in Table 1.

[0082] Table 1 : Cell lines with known BRAF gene status. HT29 line is heterozygous, i.e. carries both mutated V600E variant and unmutated variant (wt, wild-type).

[0083] As can be seen from the results, the evaluation by gel electrophoresis is not quantitative, because, for example, the signals of samples A375 and HT29 show the same intensity on the gel, but line A375 carries a mutation in both copies of the gene, whereas line HT29 carries one wt and one mutated variant of the gene. However, from a clinical point of view, even the presence of one mutated allele (the more common case) is a key factor in selecting the appropriate treatment.

[0084] In the following experiment, 10 DNA samples isolated from FFPE blocks of colorectal cancer patients were sequenced with the aim to detect the presence of the BRAF V600E mutation. In samples MUT1 to MUT5, the presence of the V600E mutation was detected in 22% to 29% of the sequenced DNA, whereas in samples WT1 to WT5, the BRAF V600E mutation was not detected (ND). The results are shown in Table 2.

[0085] Table 2: DNA isolated from FFPE blocks of colorectal cancer patients. The presence of the V600E mutation in the MUT1 to MUT5 samples detected by sequencing is expressed as a percentage of DNA. In samples WT1 to WT5, the mutation was not detected by sequencing (ND).

[0086] These ten samples were tested with primers for BRAF V600E, containing the primers BRAF V600E F3, BRAF V600E B3, BRAF V600E FIP, BRAF V600E BIP, BRAF V600E LF and BRAF V600E LB as defined above (Fig. 4A) and the set of ACTB primers containing the primers ACTB F3, ACTB B3, ACTB FIP, ACTB BIP, ACTB LF and ACTB LB as defined above (Fig. 4B). As with testing cell lines of known BRAF status, for samples tested with primers for BRAF V600E, only samples in which the mutation was detected by sequencing have a visible pattern of LAMP products on the gel. Samples without template addition (blank), unmutated control (SW620, wt / wt) and mutated control (A375, V600E / V600E) were also included in this assay. The weaker signals in samples WT1 to WT5 with no specific product pattern visible are mainly consistent with the presence of RNA and other contaminants that entered the sample during tissue isolation from FFPE blocks (not visible in cell lines). For samples tested with primers for ACTB, amplification was observed in all samples except the blank, demonstrating that sufficient genomic DNA was present and the reaction took place.

[0087] Comparison of qualitative determination of the presence of the V600E mutation of the BRAF gene using a set of four and six primers

[0088] Sequences used:

[0089] Part of experiment A

[0090] Part of experiment B

[0091] DNA from the cell lines used The HT29 line is heterozygous, i.e. it carries both the mutated variant V600E and the unmutated variant (wt, wild type). The mixture of the following components was amplified at 62 °C for 30 and 60 min (without the need of denaturation or deactivation).

[0092] Part of experiment A Total volume 10 pl

[0093] Part of experiment B

[0094] Total volume 10 pl

[0095] After the incubation was completed, the reaction mixture was mixed with 6x loading buffer and the samples were pipetted onto a 1.5% agarose gel with added nucleic acid dye and loaded into a horizontal electrophoretic apparatus filled with TBE buffer where the mixture was separated based on the size / weight of the amplicons. Upon completion of the separation, the gel was photographed, and it was demonstrated whether or not a reaction had occurred based on the presence of a specific LAMP product.

[0096] Results

[0097] Four cancer cell lines (A375, HT29, SW620 and Caco2) with known mutational status of the BRAF gene were used for the reaction. The control sample did not contain DNA but only water (blank). The experiment was performed at two time intervals: 30 min and 60 min (see Figure 3). Using the set of six primers (B) according to the present invention, a positive result for the A375 and HT29 lines (Table 3) carrying the mutated sequence was observed after 30 min of reaction, compared to the variant (A) where only the first four claimed primers were used and where an identical result was only observed after 60 min of reaction, i.e. in double the time. The use of six primers is therefore more efficient and it can be assumed that it would achieve significantly higher sensitivity in real samples.

[0098] Table 3

[0099] Furthermore, it was observed that if a BIP sequence truncated by even one nucleotide is used, there is no overlap of the two internal primers (FIP, BIP) at the mutated site and the mutation is recognized by only one primer (FIP), thus the sensitivity, efficiency and specificity of the method is significantly reduced (see Figure 7, which shows the same experiment using a set of six primers according to the present invention (left) and the same set of primers in which only the BIP primer is truncated at the 5' end by one nucleotide). The same reaction conditions were used for the experiment as for the variant of experiment B (30 min). Table 4 shows the truncated BRAF UNI BIP sequence (SEQ ID NO: 15) used and its comparison with the claimed sequence (BRAF V600E BIP, SEQ ID NO:4) in which the missing nucleotide is highlighted.

[0100] Table 4

Claims

CLAIMS1. A set of primers for detecting the BRAF V600E mutation by LAMP method, characterized in that it comprises six primers for DNA amplification, which have the following sequences: BRAF V600E F3:5'-CTGATAGGAAAATGAGATCTACTG-3' (SEQ ID NO: 1)BRAF V600E B3:5'-GGCCAAAAATTTAATCAGTGG-3' (SEQ ID NO: 2)BRAF V600E FIP:5'-TCTGTAGCTAGACCAAAATCACCTATTTTCCTTTACTTACTACACCTC-3' (SEQ ID NO: 3)BRAF V600E BIP: 5'-AGAAATCTCGATGGAGTGGGTCCAAAATAGCCTCAATTCTTACCAT-3' (SEQ ID NO: 4)BRAF V600E LF:5'-TCTTCATGAAGAAATATATCT-3' (SEQ ID NO: 5)BRAF V600E LB:5'-CATCAGTTTGAACAGTTGT-3' (SEQ ID NO: 6).

2. A diagnostic kit for detecting B-raf oncoprotein activation using LAMP amplification, characterized in that it comprises:- the set of primers for DNA amplification for detecting the BRAF V600E mutation according to claim 1;- a set of primers for DNA amplification for detecting ACTB gene, which have the following sequences:ACTB F3:5'-GGGCTTCTTGTCCTTTCCTT-3' (SEQ ID NO: 8)ACTB B3:5'-TCAGCAGCACGGGGT-3' (SEQ ID NO: 9)ACTB _LF:5'-GCCCACATAGGAATCCTTCT-3' (SEQ ID NO: 10)ACTB LB:5'-ACTGGGACGACATGGAGAAAATCT-3' (SEQ ID NO: 11)ACTB FIP:5'-CCTCTCTTGCTCTGGGCCTCGTGTGATGGTGGGCATGGGT-3' (SEQ ID NO: 12)ACTB BIP:5'-CATCGAGCACGGCATCGTCACCACACGCAGCTCATTGT-3' (SEQ ID NO: 13).

3. The diagnostic kit according to claim 2, characterized in that it further comprises:- a reaction mixture for LAMP amplification comprising nucleoside triphosphates dATP, dCTP, dGTP, dTTP; DNA polymerase; and a magnesium salt; and optionally further comprises deionized water and / or a buffer.

4. A method for detecting a V600E mutation in the BRAF gene in a DNA sample by isothermal LAMP amplification method, characterized in that it comprises the following steps:1) isolating DNA from a sample; and2) performing DNA amplification by the LAMP method using the set of primers according to claim 1.

5. The method according to claim 4, characterized in that it further comprises step 3) wherein DNA amplification is performed by LAMP method using a set of primers for DNA amplification for ACTB gene detection, which have the following sequences:ACTB F3:5'-GGGCTTCTTGTCCTTTCCTT-3' (SEQ ID NO: 8)ACTB B3:5'-TCAGCAGCACGGGGT-3' (SEQ ID NO: 9)ACTB _LF:5'-GCCCACATAGGAATCCTTCT-3' (SEQ ID NO: 10)ACTB LB:5'-ACTGGGACGACATGGAGAAAATCT-3' (SEQ ID NO: 11)ACTB _FIP:5'-CCTCTCTTGCTCTGGGCCTCGTGTGATGGTGGGCATGGGT-3' (SEQ ID NO: 12)ACTB BIP:5'-CATCGAGCACGGCATCGTCACCACACGCAGCTCATTGT-3' (SEQ ID NO: 13); wherein the concentration of DNA in the sample in step 2) is the same as the concentration of DNA in the sample in step 3).

6. The detection method according to claim 5, characterized in that the LAMP amplification is carried out at a temperature in the range of from 60 to 65 °C for at least 30 min; subsequently, gel electrophoresis of the amplified mixtures from step 2) and step 3) is performed; and finally the evaluation of the presence of the V600E mutation in the BRAF gene in the DNA sample is carried out.

7. Use of the set of primers according to claim 1 and / or the diagnostic set according to claim 2, for detection of the BRAF V600E mutation in a DNA sample.

Images