Mitochondrial DNA intrinsic controls for use in MSRE-dependent DNA methylation analysis

WO2025097008A3PCT designated stage expired Publication Date: 2025-08-07NUCLEIX LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/054200
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-02
Filing Date
2024-11-01
Publication Date
2025-08-07

AI Technical Summary

Technical Problem

Assessing the digestion efficiency of methylation-specific restriction enzymes (MSREs) against natural DNA is challenging due to variable methylation levels between individuals, and synthetic DNA spiking methods fail to capture modulators like DNA crosslinking or associated proteins.

Method used

A multiplex qPCR assay using mitochondrial DNA (mtDNA) markers to assess the performance of MSREs, specifically HinPlI and Acil, by measuring digestion efficiency through four separate mtDNA markers: mtIR, mtINF, mtA, and mtB, which contain specific recognition sites for the enzymes.

Benefits of technology

The method provides a robust and accurate assessment of MSRE activity, capable of detecting anomalies caused by inhibitors and optimizing digestion conditions, while preserving the sample for other analyses.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present application provides tools for rapidly, accurately, and accessibly quantifying endonuclease activity. The system is broadly capable of qualifying enzymatic reagents, detecting chemical inhibitors, and optimizing reaction conditions. Minimal adaptations could further enable use in high-throughput screens for enhancers or inhibitors of specific endonucleases. In this context, the present invention demonstrates the utility of mitochondrial DNA (mtDNA) - which is abundant in plasma as cell-free DNA ("cfDNA") and naturally has minimal methylation - as an endogenous digestion control system in MSRE-dependent methylation assays. While demonstrated in the context of qPCR, the control endogenous digestion control systems of the present invention are broadly applicable to MSRE-dependent methylation assays generally, and particularly to those assays that use a multiplex of MSREs having different recognition sequences.
Need to check novelty before this filing date? Find Prior Art

Description

MITOCHONDRIAL DNA INTRINSIC CONTROLS FOR USE IN MSRE- DEPENDENT DNA METHYLATION ANALYSIS

[0001] The present application claims the benefit of United States Provisional Patent Application 63 / 595,280 filed November 1, 2023; and of United States Provisional Patent Application 63 / 595,724 filed November 2, 2023, from each of which priority is claimed and each of which is hereby incorporated by reference in its entirety.FIELD OF THE INVENTION

[0002] The present invention relates to methods and kits for assessing the digestion efficiency of methylation-specific restriction enzymes.BACKGROUND OF THE DISCLOSURE

[0003] The following discussion of the background of the disclosure is merely provided to aid the reader in understanding the disclosure and is not admitted to describe or constitute prior art to the present disclosure.

[0004] Methylation-sensitive restriction enzymes (MSREs) are used to assess DNA methylation levels in various cancer diagnostic liquid biopsy (LBx) tests. As their name suggests, MSREs cannot digest DNA that contains methylated residues, such as cytosines in CpG sequences. However, because DNA methylation is not the sole factor that limits MSRE activity (e.g., chemical inhibitors), establishing an internal control for digestion is valuable for enhancing performance of MSRE-based diagnostic assays. For certain applications, the failure to digest <1% of unmethylated DNA can produce a false positive result, making robust endonuclease performance highly desirable.

[0005] Assessing the digestion efficiency of an MSRE (Methylation Specific Restriction Enzyme) against natural DNA (i.e., not synthetic / synthesized) is problematic due to the variable nature of methylation present between individuals. Although synthetic DNA (e.g. gBlocks, plasmids) can be spiked into the sample to gauge endonuclease function, this approach fails to capture some modulators of digestion, such as DNA crosslinking (i.e. from tube preservatives), or associated proteins.

[0006] The use of mitochondrial DNA largely bypasses these limitations, allowing quantitative assessment of endonuclease performance that considers the sampleenvironment. mtDNA is derived directly from the sample, is not bound by nucleosomes (which influences cfDNA digestion) and is not as highly methylated. That said, the effect of nucleoid association (mtDNA’ s packaging system) and conflicting reports of methylation makes the utility of this material unclear.BRIEF SUMMARY OF THE DISCLOSURE

[0007] It is an object of the present invention to provide methods and kits for performing a multiplex qPCR assay that assesses the performance of two methylationsensitive restriction enzymes (e.g., Acil and HinPIl) in human samples by measuring mitochondrial DNA (mtDNA) digestion. As described herein, the assay contains four separate mtDNA markers: mtIR: An uncuttable (lacking the necessary restriction sites) sequence that serves as a means of quantifying the amount of mtDNA present. mtINF : Contains one cut site each for each of two methylation-sensitive restriction enzymes. Determines general digestibility for both enzymes, but if both enzymes are present, cannot determine relative activity. mtA: Contains a single cut site for one of the two methylation-sensitive restriction enzymes, allowing specific assessment of digestion with that enzyme. mtB: Contains a single cut site for the other of the two methylation-sensitive restriction enzymes, allowing specific assessment of digestion with that enzyme.

[0008] In a first aspect, the invention provides a method of measuring methylationspecific restriction enzyme (MSRE) activity in a sample comprising mitochondrial DNA, comprising: digesting the cell-free mitochondrial DNA with at least two MSREs that have different recognition sequences to provide a digested sample; performing a multiplexed quantitative PCR (qPCR) amplification of the digested sample using a first primer pair configured to amplify a first mitochondrial DNA sequence containing a recognition sequence for a first of the at least two MSREs but norecognition sequence for a second of the at least two MSREs, and a first qPCR probe configured for sequence-specific detection of a first amplification product resulting from amplification of the first mitochondrial DNA sequence, a second primer pair configured to amplify a second mitochondrial DNA sequence containing a recognition sequence for a second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs, and a second qPCR probe configured for sequence-specific detection of a second amplification product resulting from amplification of the second mitochondrial DNA sequence, and a third primer pair configured to amplify a third mitochondrial DNA sequence containing no recognition sequences for the first and second MSREs, and a third qPCR probe configured for sequence-specific detection of a third amplification product resulting from amplification of the third mitochondrial DNA sequence, a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs, and a fourth qPCR probe configured for sequence-specific detection of a fourth amplification product resulting from amplification of the fourth mitochondrial DNA sequence; and detecting a signal from each of the first, second, third, and fourth qPCR probes as a function of cycle number.

[0009] In certain embodiments, the sample is a body fluid sample from an individual, and the mitochondrial DNA is cell-free mitochondrial DNA of the individual naturally present in the body fluid sample. In preferred embodiments, the sample is a plasma sample.

[0010] In preferred embodiments, the at least two MSREs that have different recognition sequences comprise HinPlI and / or Acil. Most preferably, the at least two MSREs comprise both HinPlI and Acil.

[0010] In certain embodiments, the signal from each of the first, second, third, and fourth qPCR probes is a Cq value. In some embodiments, the method may comprise calculating a dCq for each of the second, third, or fourth amplicons, whereindCqfirstamplicon - Cqfirst amplicon ' - Cqthird amplicon, dCqsecond amplicon Cqsecond amplicon Cqthird amplicon, and dCqfourth amplicon Cqtburth amplicon Cqthird amplicon-

[0011] Exemplary mtDNA amplicon sequences include one or more of, and preferably each of, the following:First ampliconAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACC,Second ampliconAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCACCCAA, andThird ampliconCGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACT,Fourth ampliconAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCG ATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTC ACCCT.

[0012] For these exemplary amplicons, the primer pair and probe sequences may be:First primer pair Forward Primer AGACGTAAATTATGGCTGAATCATReverse Primer GGTTTCTGAGTAGAGAAATGATCFirst probe TCTTTATCTGCCTCTTCCTACACATCSecond primer pair Forward Primer AATTCCTCCCTGTACGAAAGGReverse Primer TTGGGTGGGTGTGGGTATAASecond probe TCACAAAGCGCCTTCCCCCGThird primer pair Forward Primer CGGAAGCAATATGAAATGATCTGReverse Primer AGTACGTGTCGTGTAGTACGATThird probe TTCTTTTCACCGTAGGTGGCCTGFourth primer pair Forward Primer AGACCCTACTTCTAACCTCCCReverse Primer AGGGTGAGTGGTAGGAAGTTTFourth probe CCCCCGATTCCGCTACGACC.

[0013] In a related aspect, the invention relates to methods of measuring methylationspecific restriction enzyme (MSRE) activity in a sample comprising mitochondrial DNA, comprising: digesting the cell-free mitochondrial DNA with at least two MSREs that have different recognition sequences to provide a digested sample; and performing one or both of steps (i) or (ii):(i) performing a PCR amplification of the digested sample using a first primer pair configured to amplify a first mitochondrial DNA sequence containing a recognition sequence for a first of the at least two MSREs but no recognition sequence for a second of the at least two MSREs to provide a first amplification product resulting from amplification of the first mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the first amplification product, and(ii) performing a PCR amplification of the digested sample using a second primer pair configured to amplify a second mitochondrial DNA sequence containing a recognition sequence for the second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs to provide a second amplification product resulting from amplification of the second mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the second amplification product.

[0014] In certain embodiments, both step (i) and step (ii) are performed. Optionally, one or both of steps (iii) and (iv) are also performed:(iii) performing a PCR amplification of the digested sample using a third primer pair configured to amplify a third mitochondrial DNA sequence containing no recognition sequences for the at least two MSREs to provide a third amplification product resulting from amplification of the third mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the third amplification product;(iv) performing a PCR amplification of the digested sample using a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs to provide a fourth amplification product resulting from amplification of the fourth mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the fourth amplification product.

[0015] In certain preferred embodiments, each of steps (i), (ii) and (iv) are performed; in other preferred embodiments, each of steps (i) - (iv) are performed.

[0016] Preferably, the PCR amplification is a qPCR amplification, wherein if step (i) is performed, the signal is a first Cq value determined using a first qPCR probe configured for sequence-specific detection of the first amplification product, and if (ii) is performed, the signal is a second Cq value determined using a first qPCR probe configured for sequence-specific detection of the second amplification product, if (iii) is performed, the signal is a third Cq value determined using a first qPCR probe configured for sequence-specific detection of the third amplification product, and if (iv) is performed, the signal is a fourth Cq value determined using a first qPCR probe configured for sequence-specific detection of the fourth amplification product.

[0017] In various embodiments, the sample is a body fluid sample from an individual, and the mitochondrial DNA is cell-free mitochondrial DNA of the individual naturally present in the body fluid sample. In preferred embodiments, the sample is a plasma sample.

[0018] In preferred embodiments, the at least two MSREs that have different recognition sequences comprise HinPlI and / or Acil. Most preferably, the at least two MSREs comprise both HinPlI and Acil.

[0019] In certain embodiments, the method may comprise calculating a dCq for for one or more of the first, second, and third amplicons, wherein dCqfirst amplicon Cqfirst amplicon Cqthird amplicon, dCqsecond amplicon Cqsecond amplicon—Cqthird amplicon, and dCqfourth amplicon Cqiburth amplicon—Cqthird amplicon.

[0020] Exemplary mtDNA amplicon sequences include one or more of, and preferably each of, the following: first ampliconAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATAT TACGGATCATTTCTCTACTCAGAAACC, second ampliconAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCACCCAA, and third ampliconCGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACT,Fourth ampliconAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCT ACCACTCACCCT.

[0021] For these exemplary amplicons, the primer pair and probe sequences may be:First primer pair Forward Primer AGACGTAAATTATGGCTGAATCATReverse Primer GGTTTCTGAGTAGAGAAATGATCFirst probe TCTTTATCTGCCTCTTCCTACACATCSecond primer pair Forward Primer AATTCCTCCCTGTACGAAAGGReverse Primer TTGGGTGGGTGTGGGTATAASecond probe TCACAAAGCGCCTTCCCCCGThird primer pair Forward Primer CGGAAGCAATATGAAATGATCTGReverse Primer AGTACGTGTCGTGTAGTACGATThird probe TTCTTTTCACCGTAGGTGGCCTGFourth primer pair Forward Primer AGACCCTACTTCTAACCTCCCReverse Primer AGGGTGAGTGGTAGGAAGTTTFourth probe CCCCCGATTCCGCTACGACC.

[0022] In related aspects, the invention provides kits for the digestion of cell-free mitochondrial DNA with at least two MSREs that have different DNA cut site specificities, comprising: a first primer pair configured to amplify a first mitochondrial DNA sequence containing a recognition sequence for a first of the at least two MSREs but no recognition sequence for a second of the at least two MSREs, a second primer pair configured to amplify a second mitochondrial DNA sequence containing a recognition sequence for the second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs, and a third primer pair configured to amplify a third mitochondrial DNA sequence containing no recognition sequences for the at least two MSREs, a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs.

[0023] In certain embodiments, the kits comprise one or more of the following:the at least two MSREs, a first qPCR probe configured for sequence-specific detection of a first amplification product resulting from amplification of the first mitochondrial DNA sequence, a second qPCR probe configured for sequence-specific detection of a second amplification product resulting from amplification of the second mitochondrial DNA sequence, a third qPCR probe configured for sequence-specific detection of a third amplification product resulting from amplification of the third mitochondrial DNA sequence, and a fourth qPCR probe configured for sequence-specific detection of a fourth amplification product resulting from amplification of the fourth mitochondrial DNA sequence.

[0024] In certain embodiments, the primer pair sequences in the kit are:First primer pair Forward Primer AGACGTAAATTATGGCTGAATCATReverse Primer GGTTTCTGAGTAGAGAAATGATCSecond primer pair Forward Primer AATTCCTCCCTGTACGAAAGGReverse Primer TTGGGTGGGTGTGGGTATAAThird primer pair Forward Primer CGGAAGCAATATGAAATGATCTGReverse Primer AGTACGTGTCGTGTAGTACGATFourth primer pair Forward Primer AGACCCTACTTCTAACCTCCCReverse Primer AGGGTGAGTGGTAGGAAGTTT.

[0025] In related embodiments, the probe sequences in the kit are:First probe TCTTTATCTGCCTCTTCCTACACATCSecond probe TCACAAAGCGCCTTCCCCCGThird probe TTCTTTTCACCGTAGGTGGCCTGFourth probe CCCCCGATTCCGCTACGACC.

[0026] In preferred embodiments, the at least two MSREs that have different recognition sequences provided in the kit comprise HinPlI and / or Acil. Most preferably, the at least two MSREs comprise both HinPlI and Acil.

[0027] In still other related aspects, the invention provides kits for the digestion of cell-free mitochondrial DNA with at least two MSREs that have different DNA cut site specificities, comprising one or both of (i) and (ii):(i) a first primer pair configured to amplify a first mitochondrial DNA sequence containing a recognition sequence for a first of the at least two MSREs but no recognition sequence for a second of the at least two MSREs,(ii) a second primer pair configured to amplify a seconf mitochondrial DNA sequence containing a recognition sequence for the second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs, and optionally comprising one or both of (iii) and (iv):(iii) a third primer pair configured to amplify a third mitochondrial DNA sequence containing no recognition sequences for the at least two MSREs, and(iv) a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs.

[0028] In various embodiments, kits may comprise both (i) and (ii), both (i) and (iii), each of (i), (ii), and (iii), and each of (i)-(iv). Kits may also further comprise the at least two MSREs. Exemplary MSREs provided in the kits may comprise HinPlI, Acil, or both HinPlI and Acil.

[0029] In certain embodiments,if (i) is present, kits further comprise a first qPCR probe configured for sequencespecific detection of a first amplification product resulting from amplification of the first mitochondrial DNA sequence, if (ii) is present, kits further comprise a second qPCR probe configured for sequencespecific detection of a second amplification product resulting from amplification of the second mitochondrial DNA sequence, if (iii) is present, kits further comprise a third qPCR probe configured for sequencespecific detection of a third amplification product resulting from amplification of the third mitochondrial DNA sequence, and if (iv) is present, kits further comprise a qPCR probe configured for sequence-specific detection of a fourth amplification product resulting from amplification of the fourth mitochondrial DNA sequence.

[0030] In preferred embodiments, the primer pair sequences, if present, are:First primer pair Forward Primer AGACGTAAATTATGGCTGAATCATReverse Primer GGTTTCTGAGTAGAGAAATGATCSecond primer pair Forward Primer AATTCCTCCCTGTACGAAAGGReverse Primer TTGGGTGGGTGTGGGTATAAThird primer pair Forward Primer CGGAAGCAATATGAAATGATCTGReverse Primer AGTACGTGTCGTGTAGTACGATFourth primer pair Forward Primer AGACCCTACTTCTAACCTCCCReverse Primer AGGGTGAGTGGTAGGAAGTTT

[0031] In preferred embodiments, the probe sequences, if present, are:First probe TCTTTATCTGCCTCTTCCTACACATCSecond probe TCACAAAGCGCCTTCCCCCGThird probe TTCTTTTCACCGTAGGTGGCCTGFourth probe CCCCCGATTCCGCTACGACC.BRIEF DESCRIPTION OF THE FIGURES

[0032] Fig. 1 shows a mtDNA control system of the invention in schematic form.

[0033] Fig. 2 shows digestion optimization using a mitochondrial multiplex and modulation of dCq values using artificially high and low methylated DNA.

[0034] Fig. 3 shows the sensitivity of two MSREs to dilution in the methods of the present invention.

[0035] Fig. 4 shows the sensitivity of two MSREs to digestion inhibitors in the methods of the present invention.

[0036] Fig. 5 shows the use of the methods of the present invention in human samples.DETAILED DESCRIPTION OF THE DISCLOSURE

[0037] The present application provides tools for rapidly, accurately, and accessibly quantifying endonuclease activity. The system is broadly capable of qualifying enzymatic reagents, detecting chemical inhibitors, and optimizing reaction conditions. Minimal adaptations could further enable use in high-throughput screens for enhancers or inhibitors of specific endonucleases. In this context, the present invention demonstrates the utility of mitochondrial DNA (mtDNA) - which is abundant in plasma as cell-free DNA (“cfDNA”) and naturally has minimal methylation - as an endogenous digestion control system in MSRE-dependent methylation assays. While demonstrated in the context of qPCR, the control endogenous digestion control systems of the present invention are broadly applicable to MSRE-dependent methylation assays generally, and particularly to those assays that use a multiplex of MSREs having different recognition sequences.

[0038] The present invention demonstrates that multiplexed control loci are valuable for rapid optimization of digestion temperature and time. Furthermore, they can detectshifts in dCq’s when DNA with high and low methylation levels are combined in different ratios. dCq values derived from the multiplex are valuable for pinpointing digestion anomalies, such as those caused by inhibitors. As described herein, clinical samples analyzed did not display any significant disparities or trends across different disease stages.

[0039] Examples of methylation-sensitive restriction endonucleases that may be used according to the present invention include Acil, Bstul, Hhal, HinPlI, Hpall, HpyCH4VI. In some embodiments, the method comprises subjecting the DNA sample to digestion with the methylation-sensitive restriction endonucleases HinPlI and Acil. In some embodiments, HinPlI and Acil at a ratio between 1 : 1 to 5: 1 (enzyme units) (Hinp:AciI) are used with the methods and systems of the present invention, for example 2: 1, 2.5: 1, 3: 1, 3.5: 1, 4: 1 and 4.5: l(enzyme units) (Hinp:AciI). Each possibility represents a separate embodiment of the present invention. In some embodiments, HinPlI and Acil at a ratio between 2: 1 to 4.5: 1 (enzyme units) (Hinp:AciI) are used with the methods and systems of the present invention.

[0040] In order to evaluate endonuclease activity, the methods described herein may be performed on fluid samples, including wholly artificial samples into which sheared mitochondrial DNA or synthetic copies of mitochondrial DNA have been added. DNA fragments, including fragments of mitochondrial DNA, are released into body fluids (so- called “cell free DNA” or “cfDNA”). Thus, in certain embodiments, a sample of the invention is a body fluid sample. Non-limiting body fluid samples suitable for use in the present invention include blood, serum, plasma, saliva, sputum, cerebrospinal fluid, tears, and peritoneal fluid.

[0041] In certain embodiments, following digestion of the cell-free mitochondrial DNA in a sample with at least two MSREs that have different recognition sequences to provide a digested sample; a multiplexed quantitative PCR (qPCR) amplification of the digested sample is performed using a first primer pair configured to amplify a first mitochondrial DNA sequence containing no recognition sequences for the at least two MSREs, and a first qPCR probe configured for sequence-specific detection of a first amplification product resulting from amplification of the first mitochondrial DNA sequence,a second primer pair configured to amplify a second mitochondrial DNA sequence containing a recognition sequence for a first of the at least two MSREs but no recognition sequence for a second of the at least two MSREs, and a second qPCR probe configured for sequence-specific detection of a second amplification product resulting from amplification of the second mitochondrial DNA sequence, a third primer pair configured to amplify a third mitochondrial DNA sequence containing a recognition sequence for the second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs, and a third qPCR probe configured for sequence-specific detection of a third amplification product resulting from amplification of the third mitochondrial DNA sequence, and a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs, and a fourth qPCR probe configured for sequence-specific detection of a fourth amplification product resulting from amplification of the fourth mitochondrial DNA sequence.

[0042] According to some embodiments, the method comprising determining a signal for each generated amplification product. In certain embodiments, the signal is a Cq value. According to certain embodiments, the first amplification product is used as an internal reference (IR) in a multiplexed qPCR assay. According to some embodiments, a dCq is calculated as a Cq of an informative amplicon (one of the second, third, or fourth amplicons) minus the Cq of the IR amplicon.

[0043] A number of advantages are provided by the invention described herein:Due to the very high relative abundance of mtDNA, very little sample is needed (2-6 uL) for qPCR. This preserves the rest of the DNA for other uses (important when only a few copies per blood tube are typically present, such as a methylated loci or mutated gene). Cq values imply that a representative target within mtDNA is roughly 1000 times more common than a similar length of DNA within the genome.The methods use typical qPCR instrumentation. Can be run concurrently with the present sample methylation assessment workflow (for genomic markers).Information about a sample’s digestion performance could be used as a correction factor for methylation markers. This could improve sensitivity / specificity for the main assay.Shorter target sequences tend to produce earlier Cq values (for uncut mtDNA). This is due to longer sequences being more likely to contain breaks between the primer spanning region, preventing amplification.The methods described herein should work for any endonuclease site, so long as it can be isolated in the mitochondrial genome. It appears particularly valuable for MSREs, owing to the cleaning methylation profile of mtDNA.

[0044] The following are preferred embodiments of the invention:

[0045] Embodiment 1. A method of measuring methylation-specific restriction enzyme (MSRE) activity in a sample comprising mitochondrial DNA, comprising: digesting the cell-free mitochondrial DNA with at least two MSREs that have different recognition sequences to provide a digested sample; and performing one or both of steps (i) or (ii):(i) performing a PCR amplification of the digested sample using a first primer pair configured to amplify a first mitochondrial DNA sequence containing a recognition sequence for a first of at least two MSREs but no recognition sequence for a second of the at least two MSREs to provide a first amplification product resulting from amplification of the first mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the first amplification product, and(ii) performing a PCR amplification of the digested sample using a second primer pair configured to amplify a second mitochondrial DNA sequence containing a recognition sequence for the second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs to provide a second amplification product resulting from amplification of the second mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the second amplification product.

[0046] Embodiment 2. A method according to embodiment 1, wherein both step (i) and step (ii) are performed.

[0047] Embodiment 3. A method according to embodiment 1 or 2, further comprising performing step (iii):(iii) performing a PCR amplification of the digested sample using a third primer pair configured to amplify a third mitochondrial DNA sequence containing no recognition sequences for the at least two MSREs to provide a third amplification product resulting from amplification of the third mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the third amplification product.

[0048] Embodiment 4. A method according to embodiment 3, wherein each of steps (i) - (iii) are performed.

[0049] Embodiment 5. A method according to one of embodiments 1-4, further comprising performing step (iv):(iv) performing a PCR amplification of the digested sample using a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs to provide a fourth amplification product resulting from amplification of the fourth mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the fourth amplification product.

[0050] Embodiment 6. A method according to embodiment 5, wherein each of steps (i), (ii) and (iv) are performed.

[0051] Embodiment 7. A method according to embodiment 5, wherein each of steps (i) - (iv) are performed.

[0052] Embodiment 8. A method according to one of embodiments 1-7, wherein the PCR amplification is a qPCR amplification, wherein if step (i) is performed, the signal is a first Cq value determined using a first qPCR probe configured for sequence-specific detection of the first amplification product, andif (ii) is performed, the signal is a second Cq value determined using a first qPCR probe configured for sequence-specific detection of the second amplification product, if (iii) is performed, the signal is a third Cq value determined using a first qPCR probe configured for sequence-specific detection of the third amplification product, and if (iv) is performed, the signal is a fourth Cq value determined using a first qPCR probe configured for sequence-specific detection of the fourth amplification product.

[0053] Embodiment 9. A method according to one of embodiments 1-7, wherein the sample is a body fluid sample from an individual, and wherein the mitochondrial DNA is cell-free mitochondrial DNA of the individual naturally present in the body fluid sample.

[0054] Embodiment 10. A method according to embodiment 9, wherein the sample is a plasma sample.

[0055] Embodiment 11. A method according to one of embodiments 1-10, wherein the at least two MSREs that have different recognition sequences comprise HinPlI, Acil, or both HinPlI and Acil.

[0056] Embodiment 12. A method according to one of embodiments 8-11, further comprising calculating a dCq for one or more of the first, second, and third amplicons, wherein dCqfirst amplicon = Cqfirst amplicon - Cqthird amplicon, dCqsecond amplicon = Cqsecond amplicon - Cqthird amplicon, and dCqfourth amplicon = Cqfourth amplicon - Cqthird amplicon.

[0057] Embodiment 13. A method according to one of embodiments 1-12, wherein the amplicon sequences, when present, are: first amplicon AGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAAT ATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTT CTCTACTCAGAAACC,second ampliconAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCACCCAA, and third ampliconCGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACT,Fourth ampliconAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCC T.

[0058] Embodiment 14. A method according to one of embodiments 1-13, wherein the primer pair and probe sequences, when present, are:First primer pairForward Primer AGACGTAAATTATGGCTGAATCATReverse Primer GGTTTCTGAGTAGAGAAATGATCFirst probe TCTTTATCTGCCTCTTCCTACACATCSecond primer pairForward Primer AATTCCTCCCTGTACGAAAGGReverse Primer TTGGGTGGGTGTGGGTATAASecond probe TCACAAAGCGCCTTCCCCCGThird primer pairForward Primer CGGAAGCAATATGAAATGATCTGReverse Primer AGTACGTGTCGTGTAGTACGATThird probe TTCTTTTCACCGTAGGTGGCCTGFourth primer pairForward Primer AGACCCTACTTCTAACCTCCCReverse Primer AGGGTGAGTGGTAGGAAGTTTFourth probe CCCCCGATTCCGCTACGACC.

[0059] Embodiment 15. A method of measuring methylation-specific restriction enzyme (MSRE) activity in a sample comprising mitochondrial DNA, comprising: digesting the cell-free mitochondrial DNA with at least two MSREs that have different recognition sequences to provide a digested sample; performing a multiplexed quantitative PCR (qPCR) amplification of the digested sample using a first primer pair configured to amplify a first mitochondrial DNA sequence containing a recognition sequence for a first of the at least two MSREs but no recognition sequence for a second of the at least two MSREs, and a first qPCR probe configured for sequencespecific detection of a first amplification product resulting from amplification of the first mitochondrial DNA sequence, a second primer pair configured to amplify a second mitochondrial DNA sequence containing a recognition sequence for a second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs, and a second qPCR probe configured for sequence-specific detection of a second amplification product resulting from amplification of the second mitochondrial DNA sequence, and a third primer pair configured to amplify a third mitochondrial DNA sequence containing no recognition sequences for the first and second MSREs, and a third qPCR probe configured for sequence-specific detection of a third amplification product resulting from amplification of the third mitochondrial DNA sequence, a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs, and a fourth qPCR probe configured for sequence-specific detection of a fourthamplification product resulting from amplification of the fourth mitochondrial DNA sequence; and detecting a signal from each of the first, second, third, and fourth qPCR probes as a function of cycle number.

[0060] Embodiment 16. A method according to embodiment 15, wherein the sample is a body fluid sample from an individual, and wherein the mitochondrial DNA is cell- free mitochondrial DNA of the individual naturally present in the body fluid sample.

[0061] Embodiment 17. A method according to embodiment 16, wherein the sample is a plasma sample.

[0062] Embodiment 18. A method according to one of embodiments 15-3, wherein the at least two MSREs that have different recognition sequences comprise HinPlI, Acil, or both HinPlI and Acil.

[0063] Embodiment 19. A method according to one of embodiments 15-18, wherein the signal from each of the first, second, third, and fourth qPCR probes is a Cq value.

[0064] Embodiment 20. A method according to embodiment 19, further comprising calculating a dCq for each of the second, third, or fourth amplicons, wherein dCqfirst amplicon = Cqfirst amplicon - Cqthird amplicon, dCqsecond amplicon = Cqsecond amplicon - Cqthird amplicon, and dCqfourth amplicon = Cqfourth amplicon - Cqthird amplicon.

[0065] Embodiment 21. A method according to one of embodiments 15-20, wherein the amplicon sequences are:First amplicon AGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAAT ATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACC,Second ampliconAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCACCCAA, andThird ampliconCGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACT,Fourth ampliconAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGAT TCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCC T.

[0066] Embodiment 22. A method according to one of embodiments 15-21, wherein the primer pair and probe sequences are:First primer pairForward Primer AGACGTAAATTATGGCTGAATCATReverse Primer GGTTTCTGAGTAGAGAAATGATCFirst probe TCTTTATCTGCCTCTTCCTACACATCSecond primer pairForward Primer AATTCCTCCCTGTACGAAAGGReverse Primer TTGGGTGGGTGTGGGTATAASecond probe TCACAAAGCGCCTTCCCCCGThird primer pairForward Primer CGGAAGCAATATGAAATGATCTGReverse Primer AGTACGTGTCGTGTAGTACGATThird probe TTCTTTTCACCGTAGGTGGCCTGFourth primer pairForward Primer AGACCCTACTTCTAACCTCCCReverse Primer AGGGTGAGTGGTAGGAAGTTTFourth probe CCCCCGATTCCGCTACGACC.

[0067] Embodiment 23. A kit for the digestion of cell-free mitochondrial DNA with at least two MSREs that have different DNA cut site specificities, comprising one or both of (i) and (ii):(i) a first primer pair configured to amplify a first mitochondrial DNA sequence containing a recognition sequence for a first of the at least two MSREs but no recognition sequence for a second of the at least two MSREs,(ii) a second primer pair configured to amplify a second mitochondrial DNA sequence containing a recognition sequence for the second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs, and optionally comprising one or both of (iii) and (iv):(iii) a third primer pair configured to amplify a third mitochondrial DNA sequence containing no recognition sequences for the at least two MSREs, and(iv) a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs.

[0068] Embodiment 24. A kit according to embodiment 23, comprising both (i) and

[0069] Embodiment 25. A kit according to embodiment 23 or 24, comprising (iii).

[0070] Embodiment 26. A kit according to one of embodiments 25, comprising (iv).

[0071] Embodiment 27. A kit according to one of embodiments 23-26, further comprising the at least two MSREs.

[0072] Embodiment 28. A kit according to one of embodiments 23-27, further comprisingif (i) is present, a first qPCR probe configured for sequence-specific detection of a first amplification product resulting from amplification of the first mitochondrial DNA sequence, if (ii) is present, a second qPCR probe configured for sequence-specific detection of a second amplification product resulting from amplification of the second mitochondrial DNA sequence, if (iii) is present, a third qPCR probe configured for sequence-specific detection of a third amplification product resulting from amplification of the third mitochondrial DNA sequence, and if (iv) is present, a qPCR probe configured for sequence-specific detection of a fourth amplification product resulting from amplification of the fourth mitochondrial DNA sequence.

[0073] Embodiment 29. A kit according to one of embodiments 23-28, wherein the primer pair sequences, if present, are:First primer pairForward Primer AGACGTAAATTATGGCTGAATCATReverse Primer GGTTTCTGAGTAGAGAAATGATCSecond primer pairForward Primer AATTCCTCCCTGTACGAAAGGReverse Primer TTGGGTGGGTGTGGGTATAAThird primer pairForward Primer CGGAAGCAATATGAAATGATCTGReverse Primer AGTACGTGTCGTGTAGTACGATFourth primer pairForward Primer AGACCCTACTTCTAACCTCCCReverse Primer AGGGTGAGTGGTAGGAAGTTT.

[0074] Embodiment 30. A kit according to one of embodiments 23-29, wherein the probe sequences, if present, are:First probe TCTTTATCTGCCTCTTCCTACACATCSecond probe TCACAAAGCGCCTTCCCCCGThird probe TTCTTTTCACCGTAGGTGGCCTGFourth probe CCCCCGATTCCGCTACGACC.

[0075] Embodiment 31. A kit according to one of embodiments 23-30, wherein the at least two MSREs that have different recognition sequences comprise HinPlI, Acil, or both HinPlI and Acil.

[0076] The invention will now be further illustrated and supported with reference to the following non-limiting examples.

[0077] Example 1.

[0087] Fig. 1 depicts an example mitochondrial DNA control schematic. Amplicons generated for use as internal digestion controls using mitochondrial cfDNA include: mtIR - Mitochondrial Internal Reference, an amplicon with no cut sites to act as an internal standard. mtINFab - Mitochondrial Informative Amplicon AB, a target with cut sites for two restriction enzymes. mtINFa - Mitochondrial Informative Amplicon A, a target with a single cut site for restriction enzyme A. mtINFb - Mitochondrial Informative Amplicon B, a target with a single cut site for restriction enzyme B.

[0088] Primers and probes targeting mitochondrial loci spanning zero, one, or two cut sites of two representative MSREs (“A" and “B") were developed using proprietary software and incorporated into functional multiplex qPCR reactions (Figure 1). To ensure the ability to detect shifts in methylation, the multiplex was tested on mixtures of artificially methylated and un-methylated sheared genomic DNA after a 2-hour digestion with enzymes A and B at 37°C. To optimize time and temperature for this assay, cfDNA samples were digested using both enzymes A and B for varying times and temperatures prior to subsequent qPCR.

[0089] Response to enzyme input levels and cross cutting potential was assessed by digesting cfDNA using a single enzyme system with digestion mixes containing mock (no enzyme) or dilutions of either enzyme A or enzyme B separately.

[0090] Dual digestion, using both enzymes A and B was utilized to demonstrate the ability of target amplicons to detect inhibition of digestion (cfDNA samples) when common DNA extraction contaminants were present. Clinical samples digested for an internal study were also assayed using the multiplex to explore mitochondrial methylation between cases and controls of lung cancer patients.

[0091] Example 2.

[0092] In this example, Acil is used as Enzyme A, and HinPlI is used as Enzyme B.The recognition sites for these enzymes are:Acil:5' C C G C 3'3' G G C t G 5'HinPlI:5' G C G C 3'3' C G C $ G 5'

[0093] The mitochondrial genome was analyzed for <150 bp regions containing:No Acil or HinPlI cut sites (mtIR candidates)One, each, Acil / HinPlI sites (mtINF candidates)One HinPlI site (mtHinP candidates)One Acil site (mtAci candidates)

[0094] Primers and probes were ordered for candidate targets and tested for singleplex functionality (robust dCq values & clean amplicons). Response to enzyme titration (Acil, HinPlI, or both) was then measured. Designs that responded linearly to an intended enzyme (but not an unmatched enzyme) were retained. Proprietary software wasthen used to determine primer compatibility in a multiplexed reaction, allowing downselection of prospective primers / probes. The final design was verified for functionality as before (off-targeting, enzyme response).

[0095] Digestion conditions:

[0096] Standard digestion reactions contain lx cutsmart buffer (NEB: New England Biolabs), 0.1 U / pL of the Acil restriction enzyme (NEB), 0.42 U / pL of the HinPlI restriction enzyme (NEB), and 72% DNA (v / v from 4 mL of blood plasma, extracted with a Qiagen cfDNA kit, standard protocol, i.e. of a 100 pL elution from a Qiagen column, 72 pL is used in the subsequent digestion, with the rest of the volume made up of lx cutsmart buffer, enzymes, and AVE buffer). Although the standard volume for digestion is 125 pL total, when lower amounts of digested DNA are required, the entire reaction is scaled down proportionally so that DNA can be conserved.

[0097] Standard digestion reactions are incubated at 37°C for 16 hours followed by an enzyme inactivation step at 65°C for 20 minutes and an infinite hold at 4°C. Following digestion, the reaction goes into a qPCR reaction as follows:

[0098] qPCR conditions:0.6 pL Amplitaq gold enzyme (ThermoFisher)0.48 pL diluent A (NEB)8.16 pL AVE buffer (Qiagen kit)0.96 pL lOx Cutsmart (NEB, this brings the final reaction cone, to 0.4x)2.4 pL digested DNA (very little is needed from the earlier digestion)Primers and Probes (17.4 pL master mix):

[0099] Amplicon sequences & lengths: (Primers underlined, probes in bold, cut sites italics) milR: (131 bases)CGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACT mtlnf: (124 bases)AGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCMtoHl: (107 bases)AATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCC ACACCCACCCAAMtoA5: (109 bases)AGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCT ACCACTCACCCT 1

[0100] Digestion optimization using a mitochondrial multiplex and modulation of dCq values using artificially high and low methylated DNA is depicted in Fig. 2. As shown in Fig. 2a, mtINFa exhibited a maximum dCq (Cq of an informative amplicon minus the Cq of the IR amplicon) at 37°C, while mtINFab exhibited a maximum at 42°C. Enzyme B appeared to have greater sensitivity to temperature than Enzyme A, but mtINFb has a minimum at 37°C.

[0101] As shown in Fig. 2b, dCq values increased with time for mtINFa and mtINFab, however mtINFb showed a minimal shift with time. Artificially high and low methylated DNA was sheared to a size profile similar to that of cfDNA, prior to mixing in varying ratios. As shown in Fig. 2c, all loci have clear responses, with dCq values decreasing with increasing ratios of high methylated DNA in a background of low methylated DNA.

[0102] As shown in Fig. 3, dCq values increasd with increased Enzyme A input for amplicons containing Enzyme A cut sites (mtINFa, mtINFab), but did not for amplicons lacking Enzyme A cut sites (mtINFb). dCq values were higher with Enzyme B in digestion reactions for amplicons containing Enzyme B cut sites (mtINFab, mtINFb), but remained stable for amplicons without Enzyme B cut sites (mtINFa). Enzyme B exhibited much less concentration dependence than Enzyme A; note that the inputs for Enzyme B were significantly lower than those used for Enzyme A, yet digestion still occurred at a high rate for all dilutions of Enzyme B. Asterisks indicate p-values <0.05 with Dunnett’s method using 100% enzyme as the control condition.

[0103] Example 3.

[0104] An important role of an internal control, such as the mitochondrial multiplex, is to identify performance issues regarding MSRE activity in the assay. Samples were digested with or without a known digestion inhibitor present (common to DNA isolation kits). As shown in Fig. 4, the control system was able to determine that Enzyme A is much more sensitive to the inhibitor than Enzyme B. Thus, a significant difference was observed in dCq values for mtINFa with and without the presence of the inhibitor, while mtINFab and mtINFb was statistically similar with and without the inhibitor due to the ability of Enzyme B to cut the template in the original digestion reaction.

[0105] As shown in Fig. 5, ACq values remained steady between control patients and case patients with stages I, II, III, and IV lung cancer for mtINFa and mtINFb. However, for mtINFab, there were statistically significant differences between the control samples and stages I, II, and IV. This could be a result of a small sample set (103 patients total: 60 controls, 4 stage I, 6 stage II, 9 stage III, 24 stage IV) or it could indicate changes in methylation at those mitochondrial loci.

[0106] One skilled in the art readily appreciates that the present disclosure is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The examples provided herein are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the disclosure.

[0107] It will be readily apparent to a person skilled in the art that varying substitutions and modifications may be made to the disclosure disclosed herein without departing from the scope and spirit of the disclosure.

[0108] All patents and publications mentioned in the specification are indicative of the levels of those of ordinary skill in the art to which the disclosure pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0109] The disclosure illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations that is not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising”, “consisting essentially of’ and “consisting of’ may be replaced with either of the other two terms. The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the disclosure claimed. Thus, although the present disclosure has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art,and that such modifications and variations are within the scope of this disclosure as defined by the appended claims.

[0110] Other embodiments are set forth within the following claims.

Claims

We claim:

1. A method of measuring methylation-specific restriction enzyme (MSRE) activity in a sample comprising mitochondrial DNA, comprising: digesting the cell-free mitochondrial DNA with at least two MSREs that have different recognition sequences to provide a digested sample; and performing one or both of steps (i) or (ii):(i) performing a PCR amplification of the digested sample using a first primer pair configured to amplify a first mitochondrial DNA sequence containing a recognition sequence for a first of at least two MSREs but no recognition sequence for a second of the at least two MSREs to provide a first amplification product resulting from amplification of the first mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the first amplification product, and(ii) performing a PCR amplification of the digested sample using a second primer pair configured to amplify a second mitochondrial DNA sequence containing a recognition sequence for the second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs to provide a second amplification product resulting from amplification of the second mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the second amplification product.

2. A method according to claim 1, wherein both step (i) and step (ii) are performed.

3. A method according to claim 1 or 2, further comprising performing step (iii):(iii) performing a PCR amplification of the digested sample using a third primer pair configured to amplify a third mitochondrial DNA sequence containing no recognition sequences for the at least two MSREs to provide a third amplification product resulting from amplification of the third mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the third amplification product.

4. A method according to claim 3, wherein each of steps (i) - (iii) are performed.

5. A method according to one of claims 1-4, further comprising performing step (iv):(iv) performing a PCR amplification of the digested sample using a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs to provide a fourth amplification product resulting from amplification of the fourth mitochondrial DNA sequence, and determining a signal indicative of the presence or amount of the fourth amplification product.

6. A method according to claim 5, wherein each of steps (i), (ii) and (iv) are performed.

7. A method according to claim 5, wherein each of steps (i) - (iv) are performed.

8. A method according to one of claims 1-7, wherein the PCR amplification is a qPCR amplification, wherein if step (i) is performed, the signal is a first Cq value determined using a first qPCR probe configured for sequence-specific detection of the first amplification product, and if (ii) is performed, the signal is a second Cq value determined using a first qPCR probe configured for sequence-specific detection of the second amplification product, if (iii) is performed, the signal is a third Cq value determined using a first qPCR probe configured for sequence-specific detection of the third amplification product, and if (iv) is performed, the signal is a fourth Cq value determined using a first qPCR probe configured for sequence-specific detection of the fourth amplification product.

9. A method according to one of claims 1-7, wherein the sample is a body fluid sample from an individual, and wherein the mitochondrial DNA is cell-free mitochondrial DNA of the individual naturally present in the body fluid sample.

10. A method according to claim 9, wherein the sample is a plasma sample.

11. A method according to one of claims 1-10, wherein the at least two MSREs that have different recognition sequences comprise HinPlI, Acil, or both HinPlI and Acil.

12. A method according to one of claims 8-11, further comprising calculating a dCq for one or more of the first, second, and third amplicons, wherein dCqfirst amplicon Cqfirst amplicon—Cqthird amplicon, dCqsecond amplicon Cqsecond amplicon—Cqthird amplicon, and dCqfourth amplicon Cqfourth amplicon—Cqthird amplicon.

13. A method according to one of claims 1-12, wherein the amplicon sequences, when present, are: first ampliconAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACC, second ampliconAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCACCCAA, and third ampliconCGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACT,Fourth ampliconAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCT.

14. A method according to one of claims 1-13, wherein the primer pair and probe sequences, when present, are:First primer pair Forward Primer AGACGTAAATTATGGCTGAATCATReverse Primer GGTTTCTGAGTAGAGAAATGATCFirst probe TCTTTATCTGCCTCTTCCTACACATCSecond primer pair Forward Primer AATTCCTCCCTGTACGAAAGGReverse Primer TTGGGTGGGTGTGGGTATAASecond probe TCACAAAGCGCCTTCCCCCGThird primer pair Forward Primer CGGAAGCAATATGAAATGATCTGReverse Primer AGTACGTGTCGTGTAGTACGATThird probe TTCTTTTCACCGTAGGTGGCCTGFourth primer pair Forward Primer AGACCCTACTTCTAACCTCCCReverse Primer AGGGTGAGTGGTAGGAAGTTTFourth probe CCCCCGATTCCGCTACGACC.

15. A method of measuring methylation-specific restriction enzyme (MSRE) activity in a sample comprising mitochondrial DNA, comprising: digesting the cell-free mitochondrial DNA with at least two MSREs that have different recognition sequences to provide a digested sample; performing a multiplexed quantitative PCR (qPCR) amplification of the digested sample using a first primer pair configured to amplify a first mitochondrial DNA sequence containing a recognition sequence for a first of the at least two MSREs but no recognition sequence for a second of the at least two MSREs, and a first qPCR probe configured for sequence-specific detection of a first amplification product resulting from amplification of the first mitochondrial DNA sequence, a second primer pair configured to amplify a second mitochondrial DNA sequence containing a recognition sequence for a second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs, and a second qPCRprobe configured for sequence-specific detection of a second amplification product resulting from amplification of the second mitochondrial DNA sequence, and a third primer pair configured to amplify a third mitochondrial DNA sequence containing no recognition sequences for the first and second MSREs, and a third qPCR probe configured for sequence-specific detection of a third amplification product resulting from amplification of the third mitochondrial DNA sequence, a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs, and a fourth qPCR probe configured for sequence-specific detection of a fourth amplification product resulting from amplification of the fourth mitochondrial DNA sequence; and detecting a signal from each of the first, second, third, and fourth qPCR probes as a function of cycle number.

16. A method according to claim 15, wherein the sample is a body fluid sample from an individual, and wherein the mitochondrial DNA is cell-free mitochondrial DNA of the individual naturally present in the body fluid sample.

17. A method according to claim 16, wherein the sample is a plasma sample.

18. A method according to one of claims 15-3, wherein the at least two MSREs that have different recognition sequences comprise HinPlI, Acil, or both HinPlI and Acil.

19. A method according to one of claims 15-18, wherein the signal from each of the first, second, third, and fourth qPCR probes is a Cq value.

20. A method according to claim 19, further comprising calculating a dCq for each of the second, third, or fourth amplicons, wherein dCqfirst amplicon Cqfirst amplicon—Cqthird amplicon, dCqsecond amplicon Cqsecond amplicon—Cqthird amplicon, and dCqfourth amplicon Cqiburth amplicon—Cqthird amplicon.

21. A method according to one of claims 15-20, wherein the amplicon sequences are:First ampliconAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACC,Second ampliconAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCACCCAA, andThird ampliconCGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACT,Fourth ampliconAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCT ACCACTCACCCT.

22. A method according to one of claims 15-21, wherein the primer pair and probe sequences are:First primer pair Forward Primer AGACGTAAATTATGGCTGAATCATReverse Primer GGTTTCTGAGTAGAGAAATGATCFirst probe TCTTTATCTGCCTCTTCCTACACATCSecond primer pair Forward Primer AATTCCTCCCTGTACGAAAGGReverse Primer TTGGGTGGGTGTGGGTATAASecond probe TCACAAAGCGCCTTCCCCCGThird primer pair Forward Primer CGGAAGCAATATGAAATGATCTGReverse Primer AGTACGTGTCGTGTAGTACGATThird probe TTCTTTTCACCGTAGGTGGCCTGFourth primer pair Forward Primer AGACCCTACTTCTAACCTCCCReverse Primer AGGGTGAGTGGTAGGAAGTTTFourth probe CCCCCGATTCCGCTACGACC.

23. A kit for the digestion of cell-free mitochondrial DNA with at least two MSREs that have different DNA cut site specificities, comprising one or both of (i) and (ii):(i) a first primer pair configured to amplify a first mitochondrial DNA sequence containing a recognition sequence for a first of the at least two MSREs but no recognition sequence for a second of the at least two MSREs,(ii) a second primer pair configured to amplify a second mitochondrial DNA sequence containing a recognition sequence for the second of the at least two MSREs but no recognition sequence for the first of the at least two MSREs, and optionally comprising one or both of (iii) and (iv):(iii) a third primer pair configured to amplify a third mitochondrial DNA sequence containing no recognition sequences for the at least two MSREs, and(iv) a fourth primer pair configured to amplify a fourth mitochondrial DNA sequence containing recognition sequences for each of the first and second of the at least two MSREs.

24. A kit according to claim 23, comprising both (i) and (ii).

25. A kit according to claim 23 or 24, comprising (iii).

26. A kit according to one of claims 25, comprising (iv).

27. A kit according to one of claims 23-26, further comprising the at least twoMSREs.

28. A kit according to one of claims 23-27, further comprising if (i) is present, a first qPCR probe configured for sequence-specific detection of a first amplification product resulting from amplification of the first mitochondrial DNA sequence, if (ii) is present, a second qPCR probe configured for sequence-specific detection of a second amplification product resulting from amplification of the second mitochondrial DNA sequence, if (iii) is present, a third qPCR probe configured for sequence-specific detection of a third amplification product resulting from amplification of the third mitochondrial DNA sequence, and if (iv) is present, a qPCR probe configured for sequence-specific detection of a fourth amplification product resulting from amplification of the fourth mitochondrial DNA sequence.

29. A kit according to one of claims 23-28, wherein the primer pair sequences, if present, are:First primer pair Forward Primer AGACGTAAATTATGGCTGAATCATReverse Primer GGTTTCTGAGTAGAGAAATGATCSecond primer pair Forward Primer AATTCCTCCCTGTACGAAAGGReverse Primer TTGGGTGGGTGTGGGTATAAThird primer pair Forward Primer CGGAAGCAATATGAAATGATCTGReverse Primer AGTACGTGTCGTGTAGTACGATFourth primer pair Forward Primer AGACCCTACTTCTAACCTCCCReverse Primer AGGGTGAGTGGTAGGAAGTTT30. A kit according to one of claims 23-29, wherein the probe sequences, if present, are:First probe TCTTTATCTGCCTCTTCCTACACATCSecond probe TCACAAAGCGCCTTCCCCCGThird probe TTCTTTTCACCGTAGGTGGCCTGFourth probe CCCCCGATTCCGCTACGACC.

31. A kit according to one of claims 23-30, wherein the at least two MSREs that have different recognition sequences comprise HinPlI, Acil, or both HinPlI and Acil.

Citation Information

Patent Citations

  • Combinatorial oligonucleotide PCR: a method for rapid, global expression analysis

    US20030027141A1

  • Method of detecting methylation

    US20160017418A1

  • Compositions and methods for detection of genomic variance and DNA methylation status

    US20200048697A1

  • Characterizing methylated DNA, RNA, and proteins in subjects suspected of having lung neoplasia

    US20220403471A1

  • Determining linear and circular forms of circulating nucleic acids

    WO2020192680A1