DNA construct for expressing signaling substance for cancer treatment, and cancer treatment method using same

Abstract

Cyclic dinucleotides, which are a type of signaling substance for cancer treatment, are secondary messengers of intracellular events initiated by GPCR activation and act as a stimulator of interferon genes (STING), and thus can have a significant effect on tumor suppression. Meanwhile, when cancer occurs in a subject, angiogenesis and cell growth proceed at a very high rate in the body, and thus an oxygen-deficient environment is created due to incomplete angiogenesis in cancer tissues, which may be very suitable for the proliferation of anaerobic bacteria such as Salmonella sp. strains or E. coli. Therefore, the present invention relates to a DNA construct into which is introduced a gene for an enzyme that synthesizes a signaling substance for cancer treatment, e.g., a cyclic dinucleotide, or to a strain transformed with a vector comprising the DNA construct. The DNA construct or the strain transformed with a vector comprising the DNA construct, according to the present invention, targets cancer in a subject and then secretes C-di-AMP or C-di-GMP synthase in the surrounding environment of the cancer, and thus can very effectively prevent or treat cancer and, at the same time, can diagnose cancer in real time.

Description

DNA construct for expressing signaling substances for cancer treatment, and cancer treatment method using the same

[0001] The present invention relates to a DNA construct for expressing a signal substance for cancer treatment, such as a cyclic dinucleotide, a strain into which a recombinant vector including the DNA construct has been introduced, and a cancer treatment method using the same.

[0002] Cyclic dinucleotides, a type of cancer therapeutic signaling molecule, are known to be second messengers of intracellular events initiated by G-protein-coupled receptor (GPCR) activation, and are stimulators of interferon genes (STING), which can induce type I interferons. STING is a signaling molecule encoded by the TMEM173 gene in humans. STING is a 379 amino acid protein composed of several transmembrane domains. STING protein is expressed in several endothelial and epithelial cell types, as well as in the hematopoietic lineage, which may or may not include dendritic cells (DCs), including T cells, plasmacytoid dendritic cells (pDCs), and macrophages. STING is associated with the endoplasmic reticulum (ER) and plays a crucial role in regulating the transcription of numerous host defense genes, including type I interferons (IFNs) and proinflammatory cytokines. STING is activated upon recognition of abnormal DNA species or cyclic dinucleotides (CDNs) in the cytoplasm of cells. Cytoplasmic DNA species can activate STING signaling after binding to cyclic GMP-AMP synthase (cGAS). Binding of cytoplasmic DNA to cGAS catalyzes the production of a type of CDN known as cyclic GMP-AMP (cGAMP), which contains a single 2',5'-phosphodiester bond and a canonical 3',5' linkage (c[G(2,5')pA(3,5')p]). Binding of cGAMP and other bacterial CDNs induces a conformational change in the STING protein, promoting the binding of TANK-binding kinase 1 (TBK1). The STING-TBK1 complex then translocates further to the perinuclear region of the cell, transporting TBK1 to the endolysosomal compartment where it phosphorylates transcription factors such as interferon regulatory factor 3 (IRF3). Similarly, STAT6 and nuclear factor-κB (NF-κB) are also activated downstream of STING activation.These transcription factors then translocate to the nucleus, initiating transcription of innate immune genes and production of type I IFNs and other cytokines. STING is then rapidly degraded, avoiding the problems associated with sustained cytokine production (Nature Reviews Immunol, 2015, 15:760-770; Cell Reports, 2015, 11:1018-1030). Studies in mice have shown that type I IFN signaling plays a critical role in tumor-initiating T cell priming and tumor control (J. Exp. Med. 2011, 208, 1989-2003). Mice lacking IFN-α / β receptors in their DCs fail to reject immunogenic tumors, and their CD8α+ DCs are defective in cross-presenting antigen to CD8+ T cells. Furthermore, transcriptional profiling analysis of melanoma patients revealed that tumors containing infiltrating activated T cells are characterized by a type I IFN transcriptional signature (Cancer Res. 2009, 69:3077-3085). Therefore, STING activation is expected to have a significant effect on tumor suppression.

[0003] Meanwhile, when cancer develops in an individual, blood vessel formation and cell growth occur very rapidly within the body. Therefore, the interior of the cancerous tissue may have incomplete blood vessel formation, creating an oxygen-deficient environment, which can be ideal for the proliferation of anaerobic bacteria such as Salmonella strains or Escherichia coli. Accordingly, efforts are ongoing to develop cancer treatment methods using bacteria that can target cancer, such as Salmonella strains and Clostridium strains. However, most anaerobic bacteria can cause disease in animals, including humans. For example, Salmonella enterica, which is closely related to our diet, is known as a family of enterobacteria that inhabit the intestines of primates, including humans, and secretes cytolysin, a known exotoxin. Cytolysin secreted in this way is a cytotoxic protein with a molecular weight of approximately 34 kDa. It destroys red blood cells in the intestines of primates, including humans, through hemolysis and forms pores in the membranes of normal cells, causing cell lysis and resulting in severe vascular inflammation and local tissue necrosis, even death. However, recent research results have shown that cytolysin isolated and purified from Salmonella enterica reacts specifically with cancer tissues present in the intestines of the body and induces the death of cancer tissues, attracting attention as a next-generation anticancer treatment. Therefore, bacteria transformed with a gene that secretes cytolysin, a cytotoxic substance, may have very high potential for use as an anticancer treatment targeting cancer tissues.

[0004] Accordingly, the present researchers additionally introduced genes expressing cancer therapeutic signaling molecules, such as the C-di-AMP synthase gene, into transformed anaerobic bacteria that can be utilized as cancer-targeting anticancer therapeutics, thereby developing a strain with superior anticancer efficacy. The DNA construct for expressing cancer therapeutic signaling molecules according to the present invention, and the strain transformed with the recombinant vector containing the DNA construct, exhibit remarkable anticancer effects, and are therefore expected to be widely utilized for cancer treatment in the medical and health care fields.

[0005] One object of the present invention is to provide a DNA construct.

[0006] Another object of the present invention is to provide a recombinant vector comprising the above DNA construct.

[0007] Another object of the present invention is to provide a strain into which the recombinant vector is introduced.

[0008] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer, which contains the strain as an active ingredient.

[0009] Another object of the present invention is to provide a method for diagnosing or treating cancer, comprising a step of treating the strain.

[0010] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.

[0011] In one embodiment of the present invention, a DNA construct is provided.

[0012] The DNA construct of the present invention comprises a cyclic dinucleotide synthetase gene and additionally comprises a secretion signal sequence. The cyclic dinucleotide may be C-di-AMP (Cyclic-di-adenosine monophosphate), C-di-GMP (Cyclic-di-diguanylate), or cGAMP (Cyclic guanosine monophosphate-adenosine monophosphate), and the cyclic dinucleotide synthetase gene may be DisA, CdaA, CdaS, DosC, AdrA, ydeH, YfiN, CGAS, cdnC, relA, capV, cdnD, cdnE, cdnB, AKT1, gdpP, disA, dncV, cdnG, ZDHHC9, dacA, radA, STING3, argF, folP, cdaR, glmS, ybbP, dacA_2, disA_2, ossG, sle_31840, dacB, disA_1, disA_3, 1d0912, dacZ, cGlr1, cGlr2, guaA, cdnA, LYPLAL1, Rnf185, VC_A0931, VC_A0681, GG20550, GD11141, TcasGA2_TC003965, thsB1, eccD1, VC_A0210, CG7194, nadE, STING7, STING2, STING1, STING5, mucR, dgcP, pleD, dgcZ, dgcA, cdgI, dgcM, tpbB, csrA, dgcT, dgcN, dgcQ, dgcS, dgcF, dgcJ, dgcC, It may be at least one selected from the group consisting of dgcE, dgcI, ydiV, vdcA, csrD, dosP, wspR, pdeF, csgD, tpbA, pdeR, and nbdA, but is not limited thereto.

[0013] The secretion signal sequence of the present invention is intended to facilitate secretion of a protein expressed by a foreign nucleic acid molecule outside of a bacterial cell, and the foreign nucleic acid molecule may additionally include a leader sequence (or signal sequence). Specifically, it may include one or more leader sequences selected from pelB, ompA, ompB, ompC, ompD, ompE, ompF, ompT, phoA TolB, TorT, LamB, LivK, TorA, SuflCT-B, LTⅡb-B, BAP, MFα, SUC2, HasA, PspA, TlyA, OutD, YwbN, NprE, SpsA, LipA, LysK, XcpT, AmyE, EstA, BrkA, IcsA, CelA, ClyA, HlyA, VgrG, EspA, EsxA, AprE, FhuD, MglB, OppA, RbsB, Agp, FkpA, YtfQ, HdeA, HdeB, GlnH, LLO and phoE, but is not limited thereto.

[0014] The DNA construct of the present invention may further comprise any one selected from the group consisting of a gene encoding an anticancer protein; a gene encoding a cytokine; a gene encoding a chemokine; a gene encoding an immune modulator; an oligonucleotide specific for a cancer antigen; and a gene encoding a reporter protein.

[0015] The strain transformed with the DNA construct of the present invention secretes a cyclic dinucleotide synthetase, which stimulates the immune system of the subject to whom the strain is administered, and thus can be used as a type of immuno-oncology agent. Furthermore, when the strain is an anaerobic bacterium, it exhibits a preference for oxygen-deficient environments, such as the tumor microenvironment, and thus can be used as a composition for cancer diagnosis. Thus, when the DNA construct of the present invention is used, cancer diagnosis and treatment can be performed simultaneously.

[0016] The "DNA construct" of the present invention is a structure that enables the expression of a desired protein, etc. when introduced into a host strain or cell through transformation, and includes not only a gene encoding the desired protein, but also a base sequence corresponding to a promoter, which is an essential regulatory element operably linked to enable the expression of the gene.

[0017] The "promoter" of the present invention refers to a base sequence present in the upstream region of a gene operably linked in a host strain or cell, and refers to a base sequence of a specific portion of the DNA construct to which RNA polymerase can bind to initiate transcription.

[0018] The DNA construct of the present invention may be one in which the expression of the cyclic dinucleotide synthetase gene is regulated by a cis-acting element or a trans-acting element.

[0019] In the present invention, the term “regulation” or “expression regulation” may mean that transcription and translation of a specific gene are activated or suppressed.

[0020] The cis-acting element of the present invention is a region of non-coding DNA that regulates transcription of neighboring genes, is an essential component of a gene regulatory network, and controls gene expression. The cis-acting element may be at least one selected from the group consisting of a ribosome binding site (RBS), a 5'-untranslated region (5'-UTR), a transcription factor binding site, and terminators, but is not limited thereto.

[0021] In the present invention, the ribosome binding site (RBS) is also called a Shine-Dalgarno sequence (SD sequence), and refers to a short sequence present on mRNA that enables ribosomes to bind effectively when ribosomes must bind to mRNA in order for translation to occur after genetic information contained in DNA is transcribed into messenger RNA (mRNA).

[0022] In the present invention, the 5'-untranslated region (5'-UTR) is an untranslated region located on both sides of the coding region, which is a portion translated into amino acids of mRNA in the 5' region, and was considered to be a portion (junk) that was unnecessarily discarded during the evolutionary process, but is known to play a major role in regulating gene expression.

[0023] In the present invention, the transcription factor binding site is a DNA region that functions to turn on or off a specific gene nearby. The transcription factor binding site may be at least one selected from the group consisting of a promoter of the cyclic dinucleotide synthetase gene; an enhancer; and a silencer, but is not limited thereto.

[0024] The promoter for expression of the signal substance for cancer treatment of the present invention, for example, the promoter of the cyclic dinucleotide synthetase gene, may include any promoter whose activity can be induced in most host strains or cell environmental conditions and developmental states. For example, the promoter may be at least one selected from the group consisting of the E. coli σ70 promoter; the E. coli σS promoter; the E. coli σ32 promoter; the B. subtilis σA promoter; the B. subtilis σB promoter; the K112706 or K112707 promoter derived from Salmonella; the bacteriophage T7 promoter; the bacteriophage SP6 promoter; the yeast promoter; the I712004 or K076017 promoter derived from eukaryotic cells; the OXB1 promoter; and the plant-derived promoter, but is not limited thereto. The E.coliσ70 promoters include I14018, I14033, I14034, I732021, I742126, J01006, J23103, J23109, J23112, J23113, J23117, J23119, J23150, J23151, J44002, J48104, J56015, J64951, K088007, K119000, K119001, K1330002, K137029, K137030, K137031, K137032, K137085, K137086, K137087, K137088, K137089, K137090, K137091, K1585100, K1585101, K1585102, K1585103, K1585104, K1585105, K1585106, K1585110, K1585113, K1585115, K1585116, K1585117, K1585118, K1585119, K2486171, K256002, K256018, K256020, K256033, K292000, K823007, K823010, K823013, M13101, M13102, M13103, M13104, It may be at least one selected from the group consisting of M13105, M13106, M13108, M13110, M31519, R1074, R1075, and S03331, but is not limited thereto. The E. coli σS promoter may be J45992 or J45993, but is not limited thereto. The E. coli σ32 promoter may be J45504, K1895002, or K1895003, but is not limited thereto. The B. subtilis σA promoter may be at least one selected from the group consisting of K143012, K143013, K823000, K823002, and K823003, but is not limited thereto. The B. The subtilisσB promoter may be, but is not limited to, K143010, K143011 or K143013.The above bacteriophage T7 promoter may be at least one selected from the group consisting of, but is not limited to, I719005, J34814, J64997, K113010, K113011, K113012, K1614000, R0085, R0180, R0181, R0182, R0183, Z0251, Z0252, and Z0253. The above bacteriophage SP6 promoter may be, but is not limited to, J64998. The yeast-derived promoter may be at least one selected from the group consisting of, but is not limited to, I766557, J63005, K105027, K105028, K105029, K105030, K105031, K122000, K124000, K124002, K319005, M31201, K2365040, K2365036, K2365041, K2365042, K2365032, K2365051, K2365514, K2365515 and K2365516. The plant-derived promoter may be at least one selected from the group consisting of PLPR0203, PLPR0210, PLPR0177, PLPR0193, PLPR0507, PLPR0422, PLPR0228, PLPR0226, PLPR0223, PLPR0040, PLPR0465, PLPR0232, PLPR0205, PLPR0247, PLPR0328, PLPR0525, AtREG383, AtREG415, AtREG416, OsREG438, OsREG443, OsREG501, PpREG186, PpREG194 and PpREG197, but is not limited thereto.

[0025] The enhancer of the present invention is a sequence found in both prokaryotes and eukaryotes, and generally has a region of 50 to 1500 bp and is located upstream or downstream from the starting point of a target gene, a signaling substance for cancer treatment in the present invention, for example, a cyclic dinucleotide synthetase gene, to induce binding of the transcription factor.

[0026] The silencer of the present invention maintains the same mechanism as an enhancer and acts as an antagonist of the enhancer. The transcription factor that binds to the silencer is a repressor. The enhancer and the silencer may be located in close proximity to each other, or the transcription factors may be located in different regions within the same region.

[0027] The terminators of the present invention are also called transcription terminators and mediate the termination of transcription of genes or operons in the genome, and in prokaryotes, there are Rho-dependent terminators and Rho-independent terminators.

[0028] The trans-acting factor of the present invention is also called a trans-activating factor or a trans-acting transcription factor, and is a factor that transactivates the transcription of a gene. The trans-acting factor may be at least one selected from the group consisting of, but is not limited to, a transcription factor, an aptamer, sRNA, and antisense RNA (asRNA).

[0029] In the present invention, the transcription factor is a protein that binds to the transcription factor binding site and helps turn on or off a specific gene.

[0030] In the present invention, the aptamer is a part of a riboswitch, and is a general term for an oligonucleotide or peptide substance that can bind to a specific target molecule, and the aptamer may be a peptide aptamer or a nucleic acid aptamer. The riboswitch is a type of mRNA that regulates gene expression, and may include, but is not limited to, a glmS riboswitch, an FMN riboswitch, a cobalamin riboswitch, etc.

[0031] In the present invention, the sRNA, antisense RNA (asRNA), refers to a single-stranded RNA capable of complementarily binding to a specific RNA. It complementarily binds to sense RNA, which is a messenger RNA (mRNA) that expresses a specific protein, ultimately regulating the expression of the protein.

[0032] The term "operably linked" in the present invention means that one desired nucleic acid fragment is functionally linked to another nucleic acid fragment, so that the function or expression of one desired nucleic acid fragment is affected by the other nucleic acid fragment.

[0033] The "reporter protein" of the present invention is a protein that performs a function that enables cancer to be diagnosed visually, and may be, for example, at least one selected from the group consisting of fluorescent proteins, luciferase, and proteins used in nuclear medicine or MRI imaging, but is not limited thereto.

[0034] The "fluorescent protein" of the present invention is a protein that fluoresces on its own so that cancer can be visually diagnosed, and may be at least one selected from the group consisting of, for example, Green Fluorescent Protein (GFP), Modified Green Fluorescent Protein (MGFP), Enhanced Green Fluorescent Protein (EGFP), Red Fluorescent Protein (RFP), Enhanced Red Fluorescent Protein (ERFP), Blue Fluorescent Protein (BFP), Enhanced Blue Fluorescent Protein (EBFP), Yellow Fluorescent Protein (YFP), and Enhanced Yellow Fluorescent Protein (EYFP), but is not limited thereto.

[0035] The protein used in the nuclear medicine or MRI imaging of the present invention may be, for example, at least one selected from the group consisting of Herpes simplex virus thymidine kinase, dopamine receptor, somatostatin receptor, sodium-iodide transporter, iron receptor, transferrin receptor, ferritin, and iron transporter (magA), but is not limited thereto.

[0036] The "cytokine" of the present invention refers to a protein secreted by an immune cell, and the cytokine of the present invention may include any cytokine that can be used in cancer immunotherapy to induce the death of disease-related cells, such as cancer cells, by regulating a host immune response, and is preferably IFN-α2, IL-2, IL-15, IL-21, and IL-12, but is not limited thereto.

[0037] The "chemokine" of the present invention is one that plays a role in regulating cell movement between tissues and the location and interaction of cells within a tissue, and can include any one that can mediate a host response to a disease, such as cancer, by guiding leukocytes into a tumor microenvironment, and is preferably CXCR3, CCR5, etc., but is not limited thereto.

[0038] The "immune modulator" of the present invention is something that enables various treatments by utilizing the unique immune system of an individual, and can include anything that can activate immune cells and induce the death of cells related to a disease, such as cancer cells.

[0039] The "anticancer protein" of the present invention is a peptide having a function that can directly or indirectly induce the death of cancer cells, and may be at least one selected from the group consisting of, for example, a toxin protein, an antibody specific for a cancer antigen or a fragment of the antibody, a tumor suppressor protein, an angiogenesis inhibitor, a cancer antigen, a prodrug-converting enzyme, a tumor microenvironment matrix-degrading enzyme, and a pro-apoptotic protein, but is not limited thereto.

[0040] The "toxic protein" of the present invention is a protein having a function that can directly or indirectly induce the death of cancer cells, and may be at least one selected from the group consisting of, for example, ricin, saporin, gelonin, momordin, devuganin, diphtheria toxin, Pseudomonas toxin, hemolysin (HlyA), FAS ligand (FASL), tumor necrosis factor-α (TNF-α), TNF-related apoptosis-inducing ligand (TRAIL), and cytolysin A (ClyA), more preferably cytolysin A, but is not limited thereto.

[0041] The above "tumor suppressor protein" of the present invention refers to a gene that exists in normal cells and maintains its function, but when the function is lost, it functions to induce indiscriminate cell division and growth of normal cells and transform them into cancer cells, and examples thereof include, but are not limited to, RB (Retinoblastoma protein) protein, p53 protein, APC (Adenomatous polyposis coli) protein, PTEN (Phosphatase and tensin homologue) protein, CDKN2A (cyclin dependent kinase inhibitor 2A) protein, etc.

[0042] The antibody or fragment of the antibody specific for the cancer antigen of the present invention is an antibody that can specifically bind to an antigen that is a protein with a high level of expression specifically on the surface or cytoplasm of cancer cells, and may be, for example, an antibody specific for HER2, which has a high level of expression specifically in breast cancer or stomach cancer cells, but is not limited thereto.

[0043] The antibody of the present invention refers to a protein molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. The form of the antibody is not particularly limited, and may include a polyclonal antibody, a monoclonal antibody, or any antibody that has antigen binding properties, even if it is a part of an antibody, and all types of immunoglobulin antibodies may be included. In addition, special antibodies such as humanized antibodies may be included, and the antibody includes not only a complete form having two full-length light chains and two full-length heavy chains, but also a functional fragment of an antibody molecule. A functional fragment of an antibody molecule means a fragment that has at least an antigen binding function, and may be, but is not limited to, Fab, F(ab'), F(ab') 2, Fv, etc.

[0044] The "antibody" of the present invention can be produced by a conventional method after cloning a gene encoding the cancer antigen of the present invention into an expression vector according to a conventional method to obtain a protein encoded by the gene.

[0045] The "angiogenesis inhibitor" of the present invention refers to a protein or compound that has the function of directly or indirectly inducing the death of cancer cells by inhibiting the formation of new blood vessels around cancer cells. Preferably, the angiogenesis inhibitor may be angiostatin, endostatin, thrombospondin, or a protease inhibitor protein, but is not limited thereto.

[0046] The "cancer antigen" of the present invention refers to a protein that is expressed in cancer cells but hardly expressed in normal cells, and can induce an anti-tumor immune response through this antigen, thereby directly or indirectly inducing the death of cancer cells. The cancer antigen of the present invention may preferably be, but is not limited to, alpha-fetoprotein (AFP), vascular endothelial growth factor receptor 2 (VEGFR2), survivin, legumain, prostate cancer specific antigen (PCSA), etc.

[0047] The "prodrug conversion enzyme" of the present invention refers to a protein having a function of converting an inactive drug into an active drug through metabolism by an enzymatic reaction. When such a prodrug conversion enzyme is used, the inactive drug is metabolized and converted into an active drug that can directly or indirectly induce the death of cancer cells, so that it can be very usefully used for the prevention or treatment of cancer. The prodrug conversion enzyme of the present invention may preferably be, but is not limited to, thymidine kinase, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, carboxypeptidase G2, chromate reductase YieF, herpes simplex virus type I thymidine kinase / ganciclovir (HSV1-TK / GCV), β-glucuronidase, etc.

[0048] The “tumor microenvironment matrix decomposing enzyme” of the present invention refers to an enzyme capable of decomposing the matrix existing in the tumor microenvironment, i.e., the cellular environment in which a tumor exists, such as surrounding blood vessels, immune cells, fibroblasts, and other cells that send signals to molecules and the extracellular matrix. The tumor microenvironment matrix decomposing enzyme of the present invention may preferably be collagenase, heparinase, hyaluronidase, protease, chymotrypsin, chymopapain, trypsin, caseinase, elastase, papain, deoxyribonuclease, matrix metalloproteinases (MMPs), cathepsins, β-glucuronidase, serine proteases, etc., but is not limited thereto.

[0049] The "pro-apoptotic protein" of the present invention refers to a protein that directly or indirectly induces the death of cancer cells by causing a deficiency of factors (proteins, nutrients, oligonucleotides, etc.) essential for the growth or maintenance of cancer cells. The pro-apoptotic protein of the present invention may preferably be L-ASNase, RNA-binding motif protein 5 (RBM5), etc., but is not limited thereto.

[0050] The oligonucleotide specific for the cancer antigen of the present invention is a nucleotide capable of inhibiting the expression or function of the cancer antigen by complementarily binding to the gene or mRNA of the cancer antigen, and may be any one selected from the group consisting of antisense oligonucleotides, aptamers, siRNAs, and shRNAs, but is not limited thereto.

[0051] The "antisense oligonucleotide" of the present invention refers to DNA, RNA, or a derivative thereof that contains a nucleic acid sequence complementary to the sequence of a specific mRNA, and can bind to the complementary sequence within the mRNA to inhibit the translation of the mRNA into a protein. The antisense oligonucleotide can be synthesized in vitro using a conventional method, for example, using RNA polymerase I, and then administered into a living body, or can be synthesized in a living body using a method such as using a vector in which the origin of the recognition site (MCS) is in the opposite direction.

[0052] The "aptamer" of the present invention refers to a small single-stranded oligonucleotide capable of specifically recognizing a target substance with high affinity. For the purposes of the present invention, the target substance may be a gene or mRNA of a cancer antigen.

[0053] The "siRNA" of the present invention refers to a short double-stranded RNA capable of inducing RNA interference (RNAi) by cleaving a specific mRNA. It is composed of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto. For the purposes of the present invention, the siRNA can specifically bind to mRNA transcribed from a gene encoding a cancer antigen and effectively suppress the expression of such a gene.

[0054] The "shRNA" of the present invention is a short hairpin RNA, which has the advantage of a higher cell transfection rate than siRNA and of allowing RNA interference to be maintained for a long period of time, and can induce RNA interference through a process of transfecting cells with an adenovirus, lentivirus, or plasmid expression vector system from the promoter of RNA polymerase III and then expressing the same, but is not limited thereto. For the purpose of the present invention, the shRNA can specifically bind to mRNA transcribed from a gene encoding a cancer antigen and effectively suppress the expression of such a gene.

[0055] In another embodiment of the present invention, a recombinant vector comprising the DNA construct of the present invention is provided.

[0056] The recombinant vector of the present invention comprises the DNA construct of the present invention, and allows a cancer treatment signaling substance inherent in the DNA construct, for example, a cyclic dinucleotide synthetase gene, to be expressed by a separate promoter, and can be introduced into a host cell or strain to transform the host cell or strain.

[0057] In the recombinant vector of the present invention, the contents of the DNA construct, anticancer protein, cytokine, chemokine, immune modulator, oligonucleotide specific for cancer antigen, reporter protein, and promoter are the same as those described in the DNA construct, and thus are omitted to avoid excessive complexity of the present specification.

[0058] The recombinant vector of the present invention is a means for introducing a protein into a cell and expressing the protein, and a known recombinant vector such as a plasmid vector, a cosmid vector, or a bacteriophage vector can be used, and the recombinant vector can be easily produced by a person skilled in the art according to any known method using DNA recombination technology.

[0059] In the present invention, specific examples of the recombinant vector may be selected from the group consisting of commercially widely used pCDNA vectors, F, R1, RP1, Col, pBR322, ToL, Ti vectors, cosmids, lambda, lambdoid, M13, Mu, p1 P22, Qμ, T-even, T2, T3, T7, phages, plant viruses, etc., but are not limited thereto. For the purpose of the present invention, a suitable recombinant vector may be selected depending on the properties of the host cell or strain.

[0060] In another embodiment of the present invention, a host cell or strain into which a recombinant vector comprising the DNA construct of the present invention is introduced is provided.

[0061] The host cell of the present invention may include a mammalian, plant, insect, fungal or cellular origin cell, and may be at least one selected from the group consisting of, but is not limited to, bacterial cells such as Escherichia coli, Streptomyces or Salmonella strains, yeast cells, fungal cells such as Pichia pastoris, insect cells such as Drozophylla or Spodoptera Sf9 cells, animal cells such as CHO (Chinese hamster ovary cells), SP2 / 0 (mouse myeloma), human lymphoblastoid, COS, NSO (mouse myeloma), 293T cells, Bow melanoma cells, HT-1080 cells, BHK cells (Baby Hamster Kidney cells), HEK cells (Human Embryonic Kidney cells) or PERC.6 cells (human retinal cells), and plant cells. For the purpose of the present invention, the strain may be at least one selected from the group consisting of anaerobic strains, for example, strains of the genus Salmonella, strains of the genus Clostridium, strains of the genus Bifidobacterium, and strains of the genus Escherichia coli, and preferably at least one selected from the group consisting of Salmonella typhimurium, Salmonella choleraesuis, and Salmonella enteritidis, and more preferably Salmonella typhimurium, but is not limited thereto.

[0062] The strain of the present invention may be attenuated.

[0063] The "attenuation" of the present invention means that a gene or the like has been modified to reduce toxicity and other side effects when a microorganism is administered to a patient. For the purpose of the present invention, when the strain is a Salmonella strain, at least one gene selected from the group consisting of aroA, aroC, aroD, aroE, Rpur, htrA, ompR, ompF, ompC, galE, cya, crp, cyp, phoP, phoQ, rfaY, dksA, hupA, sipC, clpB, clpP, clpX, pab, nadA, pncB, pmi, rpsL, hemA, rfc, poxA, galU, cdt, pur, ssa, guaA, guaB, fliD, flgK, flgL, relA and spoA may be modified for attenuation, but is not limited thereto.

[0064] The method of modifying the gene of the present invention can be performed by various methods of deleting or destroying genes known in the art, and for example, the deletion and destruction methods can be performed by methods such as homologous recombination, chemical mutagenesis, radiation mutagenesis, or transposon mutagenesis.

[0065] In the present invention, since the strain targets the interior of cancer tissue, which is an oxygen-deficient environment with incomplete blood vessel formation that is highly suitable for the proliferation of anaerobic strains, if a recombinant vector capable of simultaneously and balancedly expressing a reporter protein capable of real-time imaging and an anticancer protein is introduced into the strain, cancer can be diagnosed and treated very effectively at the same time.

[0066] The contents of the DNA construct, anticancer protein, cytokine, chemokine, immune modulator, cancer antigen-specific oligonucleotide, reporter protein, promoter, and recombinant vector in the strain of the present invention are the same as those described in the DNA construct and recombinant vector, and thus are omitted to avoid excessive complexity of the present specification.

[0067] The recombinant vector of the present invention can be introduced into a host cell or strain through transformation (or transfection). Any transformation method can be used for the transformation method used in the present invention, and can be easily performed according to a conventional method in the art. Specifically, the recombinant vector can be introduced into the strain using, but is not limited to, a transformation method of bacteria such as the Salmonella spp. strain that can be commonly used, a CaCl2 precipitation method, a Hanahan method that increases efficiency by using a reducing substance, DMSO (Dimethyl sulfoxide), in the CaCl2 method, electroporation, calcium phosphate precipitation, protoplast fusion, a stirring method using silicon carbide fibers, an Agrobacterium-mediated transformation method, a transformation method using PEG, a dextran sulfate, lipofectamine, and a drying / inhibition-mediated transformation method.

[0068] In another embodiment of the present invention, a pharmaceutical composition for preventing or treating cancer is provided.

[0069] The pharmaceutical composition of the present invention comprises, as an active ingredient, a strain transformed with the DNA construct of the present invention or a vector containing the DNA construct.

[0070] The strain of the present invention is transformed with the DNA construct according to the present invention, targets cancer in an organism, and then secretes a cancer treatment signal substance, for example, a cyclic dinucleotide synthetase, in the environment surrounding the cancer, so that cancer can be prevented or treated very effectively, and at the same time, cancer can be diagnosed in real time.

[0071] The "cancer" of the present invention is a disease characterized by rapid and uncontrolled growth of mutant cells, and may be at least one selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymphoma, gallbladder cancer, blood cancer, thyroid cancer, endocrine cancer, oral cancer, liver cancer, biliary tract cancer, colon cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain tumor, lung cancer, undifferentiated thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureteral cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia and solitary myeloma, and preferably liver cancer, biliary tract cancer, colon cancer, rectal cancer, cervical cancer, It may be at least one selected from the group consisting of ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain tumor, lung cancer, undifferentiated thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureteral cancer, pancreatic cancer, bone / soft tissue sarcoma and skin cancer, and more preferably, it may be colon cancer, but is not limited thereto.

[0072] The above “prevention” of the present invention may include, without limitation, any act of blocking, suppressing or delaying symptoms caused by cancer by using the effective ingredient of the present invention.

[0073] The term "treatment" in the present invention refers to any action that improves symptoms caused by cancer or benefits a subject by using the active ingredient of the present invention, and refers to an attempt to obtain a useful or desirable result, including a clinical outcome. Useful or desirable clinical results may include, but are not necessarily limited to, alleviation or improvement of one or more symptoms or conditions, reduction in the extent of the disease, stabilization of the disease state, inhibition of disease occurrence, inhibition of disease spread, delay or slowing of disease progression, delay or slowing of disease onset, improvement or palliation of the disease state, and reduction (partial or complete). Furthermore, "treatment" may mean prolonging the survival of a patient beyond what would be expected in the absence of treatment. Furthermore, "treatment" may mean inhibition of disease progression, temporarily slowing disease progression, and more preferably, permanently arresting disease progression. As will be understood by those skilled in the art, while improving a particular disease state, a treatment may be unbeneficial or undesirable if it produces adverse results in the treated patient, i.e., results that outweigh any benefits achieved by the treatment.

[0074] In the pharmaceutical composition of the present invention, the contents of the DNA construct, anticancer protein, cytokine, chemokine, immune modulator, cancer antigen-specific oligonucleotide, reporter protein, promoter recombinant vector, strain, and transformation, etc. are the same as those described for the DNA construct, recombinant vector, and strain, and are therefore omitted to avoid excessive complexity of the present specification.

[0075] The pharmaceutical composition of the present invention may be characterized as being in the form of a capsule, tablet, granule, injection, ointment, powder or beverage, and the pharmaceutical composition may be characterized as being intended for humans.

[0076] The pharmaceutical composition of the present invention is not limited thereto, but may be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, as well as external preparations, suppositories, and sterile injection solutions, each according to a conventional method. The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, coloring agents, fragrances, etc. for oral administration, and buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc. may be mixed and used for injections, and bases, excipients, lubricants, preservatives, etc. may be used for topical administration. The formulation of the pharmaceutical composition of the present invention may be prepared in various ways by mixing it with the pharmaceutically acceptable carriers described above. For example, for oral administration, it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injections, it can be manufactured in the form of unit dose ampoules or multiple doses. In addition, it can be formulated in the form of solutions, suspensions, tablets, capsules, sustained-release preparations, etc.

[0077] Meanwhile, examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, or mineral oil. In addition, fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, and the like may be additionally included.

[0078] Routes of administration of the pharmaceutical composition of the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Oral or parenteral administration is preferred.

[0079] The "parenteral" of the present invention includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.

[0080] The pharmaceutical composition of the present invention may vary depending on various factors including the activity of the specific compound used, age, body weight, general health, sex, dosage form, administration time, administration route, excretion rate, drug combination, and severity of the specific disease to be prevented or treated, and the dosage of the pharmaceutical composition may vary depending on the patient's condition, body weight, degree of disease, form of medicine, administration route, and period, but may be appropriately selected by those skilled in the art, and may be administered at 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg per day. Administration may be administered once a day or divided into several times. The dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as a pill, a dragee, a capsule, a liquid, a gel, a syrup, a slurry, or a suspension.

[0081] In another embodiment of the present invention, a composition for diagnosing cancer is provided.

[0082] The diagnostic composition of the present invention comprises, as an active ingredient, a strain transformed with the DNA construct according to the present invention or a vector including the DNA construct, wherein the strain may additionally comprise a reporter protein capable of tracking the strain.

[0083] The strain of the present invention is transformed with the DNA construct according to the present invention, targets cancer in an organism, and then secretes a cancer treatment signal substance, for example, a cyclic dinucleotide synthetase, in the environment surrounding the cancer, so that cancer can be prevented or treated very effectively, and at the same time, cancer can be diagnosed in real time.

[0084] The above "diagnosis" of the present invention means all acts of confirming cancer tissue in a living body, including being able to monitor the presence or absence of cancer in real time by a reporter protein expressed from a DNA construct introduced into the strain when the strain of the present invention is positioned to target cancer.

[0085] In the diagnostic composition of the present invention, the contents of the DNA construct, anticancer protein, reporter protein, constitutive promoter, inducible promoter, recombinant vector, Salmonella spp. strain, transformation, cancer, etc. are the same as those described in the DNA construct, recombinant vector, strain, and pharmaceutical composition, and are therefore omitted to avoid excessive complexity of the present specification.

[0086] Another embodiment of the present invention provides a method for diagnosing or treating cancer.

[0087] The method of the present invention comprises a step of treating a strain into which the recombinant vector according to the present invention has been introduced into a biological sample isolated from a target individual.

[0088] The method for diagnosing cancer of the present invention may further include a step of diagnosing cancer when a reporter protein is expressed from the strain.

[0089] The "biological sample" of the present invention refers to any material, tissue or cell obtained from or derived from an individual, and may include, but is not limited to, tissue, cell or cell extract.

[0090] In the above diagnostic method of the present invention, the contents of the DNA construct, anticancer protein, cytokine, chemokine, immune modulator, oligonucleotide specific for cancer antigen, reporter protein, promoter, recombinant vector, strain, transformation, cancer, diagnosis, etc. are the same as those described in the above DNA construct, recombinant vector, strain, pharmaceutical composition, and diagnostic composition, and are therefore omitted to avoid excessive complexity of the present specification.

[0091] The DNA construct according to the present invention, or a strain transformed with a vector containing the DNA construct, targets cancer in an individual and then secretes a cyclic dinucleotide synthetase in the environment surrounding the cancer, thereby enabling very effective prevention or treatment of cancer and, at the same time, real-time diagnosis of cancer.

[0092] In addition, since the DNA construct of the present invention cannot cause the cyclic dinucleotide synthetase to be expressed at all in the absence of doxycycline, it is possible to control whether doxycycline is treated so that the cyclic dinucleotide can be synthesized at a dosage appropriate for cancer treatment, and at the same time, the size of the cancer can be monitored in real time according to the expression level of the reporter protein.

[0093] FIG. 1 is a schematic diagram of a mechanism by which DisA, CdaA, and CdaS genes produce cyclic dinucleotide (C-di-AMP) in bacteria according to one embodiment of the present invention.

[0094] FIG. 2 shows the results of confirming that a cyclic dinucleotide is produced in a strain transformed with a DNA construct including a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0095] Figure 3 shows the results confirming that INFb and CXCL10 transcription increases by cyclic dinucleotides according to one embodiment of the present invention.

[0096] FIG. 4 is a schematic diagram of an animal experiment to confirm the anticancer effect of a strain transformed with a DNA construct containing a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0097] FIG. 5 shows the results of confirming the tumor suppression effect of a strain transformed with a DNA construct containing a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0098] FIG. 6 shows the results of confirming the effect of improving the survival rate of tumor cells of a strain transformed with a DNA construct including a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0099] FIG. 7 shows the results of confirming a rapid decrease in strain and a rapid increase in expression of IFN-b within tumors in some mice administered a strain transformed with a DNA construct containing a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0100] FIG. 8 shows the results of confirming the change in strain amount when a strain transformed with a DNA construct including a cyclic dinucleotide synthetase gene is cultured in an animal cell culture medium according to one embodiment of the present invention.

[0101] FIG. 9 shows the results of confirming the change in strain amount when a strain transformed with a DNA construct including a cyclic dinucleotide (C-di-GMP) synthetase gene is cultured in an animal cell culture medium according to one embodiment of the present invention.

[0102] FIG. 10 shows the results of confirming the change in strain amount when a strain transformed with a DNA construct including a cyclic dinucleotide (cGAMP) synthetase gene is cultured in an animal cell culture medium according to one embodiment of the present invention.

[0103] FIG. 11 shows the results of confirming changes in strain amount when a strain transformed with a DNA construct including a cyclic dinucleotide gene is cultured in a culture medium with various salt concentrations according to one embodiment of the present invention.

[0104] FIG. 12 shows the results of confirming antibiotic susceptibility by measuring the size of the ring that became transparent due to various antibiotic concentrations when a strain transformed with a DNA construct including a cyclic dinucleotide synthetase gene was cultured in a culture medium according to one embodiment of the present invention.

[0105] FIG. 13 shows the results of confirming the possibility of the strain of the present invention as a system for releasing and delivering foreign proteins or nucleic acid molecules that cannot be secreted by bacteria according to one embodiment of the present invention, and confirming that a strain that does not secrete GFP alone releases GFP into the medium by expression of DisA.

[0106] FIG. 14 shows the results of confirming C-di-AMP expression in a strain transformed with a DNA construct including a secretory gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0107] FIG. 15 shows the results of confirming whether an endogenous protein is secreted in a strain transformed with a DNA construct including a secretory gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0108] Figure 16 shows the results of confirming the change in strain amount when a strain transformed with a DNA construct including a secretion gene and a cyclic dinucleotide synthetase gene is cultured in an animal cell culture medium according to one embodiment of the present invention.

[0109] Figure 17 shows the results of confirming antibiotic sensitivity by culturing a strain transformed with a DNA construct including a secretory gene and a cyclic dinucleotide synthetase gene in a medium treated with antibiotics at various concentrations according to one embodiment of the present invention.

[0110] FIG. 18 shows the results of evaluating the antibiotic susceptibility of a strain transformed with a DNA construct including a secretion gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0111] FIG. 19 illustrates a tumor energy depletion mechanism of a strain transformed with a DNA construct comprising a secretory gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0112] Figure 20 shows the results of confirming the immune stimulating effect of a strain transformed with a DNA construct including a secretory gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention, using IFN-B.

[0113] Figure 21 shows the results of confirming the immune stimulating effect of a strain transformed with a DNA construct including a secretory gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention, using TNFα.

[0114] FIG. 22 shows the results of measuring the amount of ATP produced in a medium in which a strain transformed with a DNA construct including a secretion gene and a cyclic dinucleotide synthetase gene was cultured, according to one embodiment of the present invention.

[0115] FIG. 23 shows the results of measuring the degree of ATP depletion after treatment of a strain transformed with a DNA construct comprising a secretion gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0116] Figure 24 shows the results of confirming the amount of adenosine produced after treatment of a strain transformed with a DNA construct including a secretion gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0117] FIG. 25 is a schematic diagram of an animal experiment to confirm the anticancer effect of a strain transformed with a DNA construct comprising a secretory gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0118] Figure 26 shows the results of confirming the tumor suppression effect of a strain transformed with a DNA construct including a secretory gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0119] FIG. 27 shows the results of confirming P-gp expression and Doxorubicin accumulation in a strain transformed with a DNA construct including a secretion gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0120] Figure 28 shows the results of confirming the tumor cell survival rate when a strain transformed with a DNA construct including a secretory gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention is treated.

[0121] FIG. 29 shows the results of confirming the survival rate of Doxorubicin-resistant tumor cells when treated with a strain transformed with a DNA construct including a secretory gene and a cyclic dinucleotide synthetase gene according to one embodiment of the present invention.

[0122] Figure 30 shows the results of confirming the survival rate of cisplatin-resistant tumor cells when treated with a strain transformed with a DNA construct containing a secretory gene and a cyclic dinucleotide synthetase gene.

[0123] To determine whether a Salmonella strain transformed with an improved DNA construct expressing the STING agonist synthase induces anticancer effects in living animals, a tumor animal model test was performed using doxycycline. The overall settings for the in vivo test were identical to those described in Examples 2-3 above. The test results showed that the pJH18_pDisA strain exhibited excellent tumor suppression effects.

[0124] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0125] Example

[0126] Example 1. Production of a DNA construct expressing the STING agonist synthase.

[0127] STING (stimulator of interferon genes), a protein present in immune cells, acts as a sensor that detects cancer cells and prepares the immune cells to attack them. Furthermore, cyclic dinucleotides such as c-di-AMP, c-di-GMP, and cGAMP are known to act as STING agonists, activating the STING pathway and inducing interferon production, thereby enhancing the anti-cancer immune response. Therefore, the present inventors developed a recombinant strain transformed to express c-di-AMP, c-di-GMP, and cGAMP synthetases, and sought to utilize it for cancer treatment.

[0128] To this end, DisA, CdaA, CdaS, DosC, AdrA, ydeH, YfiN, Adra, DosC(S), CGAS, or Cgas were selected as cyclic dinucleotide (C-di-AMP, C-di-GMP, or cGAMP) synthetase genes, and their gene sequences are shown in Table 1. These were amplified using the forward primer (F) and reverse primer (R) described in Table 2, and the amplified product was digested with a restriction enzyme, purified, and the gene amplification product was obtained, which was then introduced into the pJH18 plasmid, thereby constructing a plasmid.

[0129] 타겟 유전자(서열번호 (No.))서열DisA(서열번호 1)AAAAAATCAAAAAAGGATTAAAACGCCTGCAAGAGAAGCATTATTTAGACAGACAACTGTGACdaA(서열번호 2)ATGGCTTTTGAGGATATCCCTTTTTTGCAGTACCTCGGCAATGCCGTTGATATTCTCCTTGTTTGGTATGTGATATATAAATTGATTATGGTGATACGCGGCACGAAAGCGGTTCAGCTGTTAAAAGGAATTGTAGTCATCGTGCTTGTTCGTATGGCCAGCCAATATTTGGGCCTCAGCACACTTCAATGGCTGATGGACCAAGCGATAACATGGGGATTTTTAGCAATTATTATTATTTTTCAGCCTGAGCTGAGAAGAGCGCTTGAACAGCTAGGCCGCGGCCGCTTTTTTTCGAGGAGCGGCACGCCTGTTGAAGAAGCGCAGCAGAAAACGATTGAGGCCATTACAAAAGCAATCAATTATATGGCGAAACGCCGTATAGGCGCCCTGCTGACCATTGAGCGGGATACTGGAATGGGCGATTATATTGAGACCGGCATACCACTAAATGCCAAAGTCAGCTCTGAGCTGCTGATCAATATTTTTATTCCAAACACCCCGCTTCATGACGGTGCGGTAATTATGAAAAATAATGAAATTGCCGCGGCCGCCTGTTATCTGCCGCTTTCTGAGAGCCCGTTTATTTCAAAAGAACTGGGCACGCGGCACAGAGCAGCTGTCGGTATCAGTGAAGTAACAGACAGTTTGACGATTATTGTGTCTGAAGAGACCGGCGGCGTCAGTGTGGCAAAGAACGGCGACCTTCACAGAGAGCTTACAGAAGAAGCGCTGAAAGAAATGCTTGAAGCCGAGTTTAAGAAAAACACCAGAGACACTTCTTCTAACCGCTGGTATTGGAGGGGCAGGAAAAATGGATAACdaS(서열번호3)ATGAAGGCTATGCGCTATGAGCAGATATCAGAAAATGCGTTCAAGGGGAAAATACAGGTGTACTTAGAGCAAATATTAGGTGATGCATCTCTAATCTTGAAAACGCTTCACGAAAAAGACCAGTGTCTCCTTTGTGAATTAGATGATTTGGGGCACGTTTTTCAGGACATGCAGGGGATTGCATCCTCCTTTTATTTGCAATCATACATTGAGGAATTTACGCCGGCATTTATTGAGCTGGCCAAGGCGATTAAAGCCTTATCGGAACATAAGCATGGAGCTTTAATTGTGATTGAAAGAGCAGACCCGGTTGAACGTTTTATTCAAAAAGGCACCTCCCTACACGCCGAGATCAGCTCTTCATTAATTGAAAGCATCTTTTTTCCCGGAAACCCTCTTCATGACGGCGCTTTATTAGTGAGGGAAAACAAACTCGTGTCAGCAGCCAATGTGCTCCCGCTGACGACGAAGGAAGTGGATATCCATTTGGGAACCCGGCACCGGGCGGCTCTTGGTATGTCGGGCTATACGGATGCACTGGTGCTCGTGGTTTCAGAGGAAACAGGGAAGATGTCGTTTGCCAAAGACGGTGTATTATATCCGTTAATTTCACCAAGAACGTAADosC(서열번호4)ACGATACGTGGGGCCATAACACTGGTGATGAAATTCTGCGTAAAGTCTCTCAGGCCTTTTATGACAACGTCCGCAGTAGTGATTATGTTTTCCGCTACGGGGGCGATGAATTTATCATTGTTTTGACTGAAGCTTCTGAAAACGAAACGTTACGTACCGCAGAACGTATTCGCAGTCGGGTGGAGAAAACCAAACTGAAAGCCGCAAACGGCGAAGATATTGCCCTCTCACTTTCCATCGGTGCCGCCATGTTTAATGGTCATCCTGACTATGAGCGCCTCATTCAAATAGCCGATGAAGCTCTGTATATCGCCAAAAGACGAGGTAGAAACCGTGTTGAACTCTGGAAAGCCAGTCTTTAGAdrA(서열번호 5)AAATGAGTCACTATCGTGAGTGGTTGAAATCGGCAGATTTGGCGCTTTACAAAGCAAAGAAAGCCGGACGTAACCGCACCGAAGTGGCGGCCTGAydeH(서열번호6)ATGATCAAGAAGACAACGGAAATTGATGCCATCTTGTTAAATCTCAATAAGGCTATCGATGCCCACTACCAGTGGCTGGTGAGTATGTTTCACAGCGTGGTCGCGAGAGATGCCAGTAAGCCAGAAATAACGGATAACCATTCTTATGGACTGTGCCAGTTTGGTCGGTGGATTGATCATCTGGGGCCACTCGATAACGATGAATTACCTTACGTTCGGCTAATGGATTCTGCCCATCAACATATGCATAACTGTGGTCGGGAATTAATGCTGGCTATTGTTGAAAATCACTGGCAGGACGCGCATTTCGACGCCTTTCAGGAGGGGTTGCTTTCTTTTACTGCGGCATTAACCGATTACAAAATTTATTTGCTGACGATCCGTAGCAATATGGATGTTTTGACGGGATTGCCGGGTCGTCGGGTTCTTGATGAATCCTTTGATCATCAGTTACGCAACGCTGAGCCTCTGAATCTTTATTTAATGTTGTTGGATATTGACCGATTTAAATTGGTTAATGATACCTACGGGCATTTAATCGGCGATGTAGTATTACGCACCCTGGCAACTTACTTAGCCAGTTGGACGCGTGATTACGAAACGGTTTATCGCTACGGGGGCGAAGAATTTATCATTATTGTCAAAGCGGCTAATGATGAAGAAGCATGTCGTGCAGGTGTCAGAATTTGCCAGTTAGTCGATAACCATGCCATCACACATTCTGAAGGGCATATCAACATTACCGTGACAGCAGGTGTGAGTCGCGCATTTCCTGAAGAGCCTCTGGATGTGGTCATTGGAAGAGCGGACCGGGCAATGTATGAGGGTAAGCAAACCGGAAGAAATCGCTGCATGTTTATTGACGAACAAAATGTGATTAACCGAGTTTAAYfiN(서열번호7)AAGTACAACGTATTTGCGCAGCGCTATCCCAGGCGTTTAATCGACCTTTTGAACTGCATAACGGCCAGCGAATAACGATGACCCTGAGTATTGGCTTTGCGCTGACATGGGAACATGCCACTGCCGAAAAACTACAAGAACTGGCCGATCGAAATATGTATCAGGCTAAACACCGGCGTGCGGAGCGCTCGCTAAACTAAAdra(서열번호 8)TCGGTCATTATCGGGAATGGCTAAAGTCTGCGGATATGGCGCTTTACAAAGCAAAGAATGCCGGACGTAACCGCACCGAAGTGGCGGCATGADosC(S)(서열번호 9)CACGCGAAAATATTAGCGATGCCATGACCGGGCTTTACAACCGTAAAATATTAACACCGGTGCTGGAACAGCGACTGCAACGCCTGGTCAATACCGGGACGCCGGTGACATTTGTCGCTATTGATTGCGATAGGTTAAAACTGATCAACGATACCCAGGGGCACCAGGAAGGCGACCGAATTATAACCCTGTTGGCGAAAGCGATTAAAACATCGATTCGTAAAAGCGATTACGCCATTCGCCTCGGCGGCGATGAGTTCTGTATTATTCTTGTTGATTACGCGGCGGATTTGGCTATCCATCTGCCGGAGCGTATTATTCGTAACCTGCAAATTATCGCACCGGATAAGACAGTCCATTTTTCTGCCGGGATTTATAATATGCAGCCCAATGATACGATTAATGATGCCTACCAGGCTTCCGATGCGCAGCTCTATCTGAACAAACAACAAAAACAACATCGTTCATCATAGCGAS(서열번호10) (SEQ ID NO: 11) The (S) in GAGCGAGAGGCCGTTTTATCTCGTACCCAAGAATGCAAAGGATGGAAATAGDosC(S) indicates a sequence derived from the genus Salmonella. Sequences without separate parentheses are sequences derived from Escherichia coli.

[0130] Primer identification code sequence number (No.) sequence pJH18-DisA-F sequence number 12 AAAGGCCTAAAGAGGAGAAAGCTAGCATGGAAAAAGpJH18-DisA-R sequence number 13 GGACTAGTTTAGTGATGGTGATGGTGATGCAGTTGTCTGTCTAAATAATGCTTCTCTTpJH18-CdaA-F sequence number 14 AAAGGCCTAAAGAGGAGAAAGCTAGCATGGCTTTpJH18-CdaA-R sequence number 15 GGACTAGTTTAGTGATGGTGATGGTGATGTCCATTTTpJH18-CdaS-F sequence number 16 AAAGGCCTAAAGAGGAGAAAGCTAGCATGAAGGCTATGCGCTATGAGCAGATATCpJH18-CdaS-R sequence number 17GGCCGACGTCGACTTACGTTCTTGGTGAAATTAACGGATATAATACpJH18-DosC-FSEQ ID NO: 18AAACTAGTAAAGAGGAGAAAGCTAGCATGGAGATGTATTTTAAAAGAATGAAAGATGAGTGpJH18-DosC-RSEQ ID NO: 19GGGAGCTCTTAGTGATGGTGATGGTGATGAAGACTGGCTTTCCAGAGTTCAACApJH18-AdrA-FSEQ ID NO: 20AAAGGCCTAAAGAGGAGAAAGCTAGCATGTTCCCAAAAATAATGAATGATGAAAACTTTTTCAAAApJH18-AdrA-RSEQ ID NO: 21GGACTAGTTTAGTGATGGTGATGGTGATGGGCCGCCACTTCGGTGCpJH18-ydeH-FSEQ ID NO: 22AAAGGCCTAAAGAGGAGAAAGCTAGCATGATCAAGAAGACAACGGAAATTGATGCpJH18-ydeH-R SEQ ID NO: 23GGACTAGTTTAGTGATGGTGATGGTGATGAACTCGGTTAATCACATTTTGTTCGTCAATAApJH18-yfiN-F SEQ ID NO: 24AAAGGCCTAAAGAGGAGAAAGCTAGCATGAATAAGGAATTTTCTCTGTCCAGGCpJH18-yfiN-R SEQ ID NO:25GGACTAGTTTAGTGATGGTGATGGTGATGGTTTAGCGAGCGCTCCGCApJH18-Adra-FSEQ ID NO: 26AAAGGCCTAAAGAGGAGAAAGCTAGCATGTTCCCAAAAATAATGAATGATGAAAATTTTTACCpJH18-Adra-RSEQ ID NO: 27GGACTAGTTTAGTGATGGTGATGGTGATGTGCCGCCACTTCGGTGCGpJH18-DosC(S)-FSEQ ID NO: 28AAAGGCCTAAAGAGGAGAAAGCTAGCATGAATTTGCATCATAAAGCGCTCAGGpJH18-DosC(S)-RSEQ ID NO: 29GGACTAGTTTAGTGATGGTGATGGTGATGTGATGAACGATGTTGTTTTTGTTGTTTGTTCApJH18-CGAS-FSEQ ID NO: 30AAACTAGTAAAGAGGAGAAAGCTAGCATGCAGCCTTGGCACGGAAAGpJH18-CGAS-RSEQ ID NO: 31GGGAGCTCTTAGTGATGGTGATGGTGATGAAATTCATCAAAAACTGGAAACTCATTGTTTpJH18-Cgas-FSEQ ID NO: 32AAAGGCCTAAAGAGGAGAAAGCTAGCATGGAAGATCCGCGTAGAAGGACGApJH18-Cgas-RSEQ ID NO: 33GGGAGCTCTTAGTGATGGTGATGGTGATGTTTCCATCCTTTGCATTCTTGGGTACG

[0131] Example 2. Confirmation of the anticancer effect of a DNA construct expressing the STING agonist synthase.

[0132] [2-1] Production of recombinant strain and confirmation of STING agonist production

[0133] The DNA construct (plasmid) prepared in Example 1 was introduced into SHJ2037 (relA::cat, spoT::kan, SLppGpp), CNC18 (△relA, △spoT, △SPI1, △SPI2), VNP20009, E. coli DH5a, and E. coli Nissle, which are Salmonella typhimurium (S. typhimurium) strains lacking ppGpp, using electroporation, and then cultured overnight using LB medium containing 100 ㎍ / ml of ampicillin. The next day, the culture was diluted 1:100 using fresh LB medium containing ampicillin, and further culture was performed to determine the OD 600 When the value reached 0.5 to 0.7, doxycycline diluted in ethanol was added to the culture medium to give final concentrations of 0, 10, 50, 100, 300, and 500 ng / ml, and cultured in a shaking incubator at 200 rpm and 37°C.

[0134] Among the above strain cultures, C-di-AMP was first measured by liquid chromatography, and it was confirmed that C-di-AMP was successfully produced from the recombinant strain (Fig. 2).

[0135] [2-2] Confirmation of the immune stimulating effect of the transformed recombinant strain

[0136] RAW 264.7 cells, a macrophage cell line, were administered 5 nM / well of C-di-AMP, a Salmonella strain transformed with a blank cell (SLppGpp), or a Salmonella strain transformed with the vector prepared in Example 1 (SLppGpp_pJH18-DisA), and incubated for an additional 9 hours. Thereafter, the expression of IFNβ (Interferonβ) and CXCL10 (CXC motif chemokine 10) was measured from the culture medium. As a result, it was confirmed that the immune stimulation effect was significantly increased when the Salmonella strain transformed with a DNA construct expressing C-di-AMP synthase (SLppGpp_pJH18-DisA) was administered (Fig. 3).

[0137] [2-3] Confirmation of anticancer effect of transformed recombinant strain

[0138] To determine whether the recombinant strain harboring the DNA construct expressing the STING agonist synthase induces anticancer effects in living animals, 5-6 week-old C57BL / 6 (Orient Company, Korea) mice weighing 20-30 g were administered cancer cells and tumors of approximately 100 mm in size were grown. 3 When 2x10 Salmonella strain (SLppGpp_pJH18-DisA) transformed with the DNA construct expressing the C-di-AMP synthase 7 cfu / mice were injected into the tail vein. For imaging of the tumor animal model and evaluation of tumor size, 2% isoflurane was used for anesthesia, and 200 mg / kg of ketamine and 10 mg / kg of xylasine were used during surgery. To induce the expression of C-di-AMP, doxycycline was administered orally daily at a dose of 1.7 mg / kg, and tumor size was measured every 3 days. Tumor size (mm 3) was calculated using (length × height × width) / 2, and the tumor size of the animal model was 1500 mm 3 In such cases, the animal model was euthanized (Fig. 4). As a result of the above test, it was found that the pJH18-DisA strain had an excellent tumor suppression effect (Fig. 5).

[0139] [2-4] Confirmation of the problem with the pJH18-DisA strain

[0140] The above examples 2-3 demonstrated the excellent anticancer effect of a Salmonella strain transformed with a DNA construct expressing C-di-AMP synthase, but also provided a clue to an unexpected risk factor. Some of the mice administered the pJH18-DisA strain died suddenly within one day of doxycycline administration, and autopsies of these mice revealed thrombosis along with renal hypertrophy (Fig. 6). In addition, the number of bacteria (Salmonella) in the mouse tumors decreased approximately 100-fold compared to before C-di-AMP synthase expression (= before 0.5 μg / ml of doxycycline administration), and the expression level of IFN-b in the tumors increased explosively (Fig. 7), which may suggest a cytokine storm.

[0141] To clarify the hypothesis, a ppGpp-deficient Salmonella strain (SLppGpp) transformed with the DisA or CdaA gene capable of expressing the same C-di-AMP, or a wild type (WT) Salmonella strain, was prepared, and 3x10 of each strain 5Cells / well were cultured in vitro in DMEM animal cell culture medium (with 10% FBS). As a result, it was confirmed that the number of strains rapidly decreased when culturing a Salmonella strain expressing the C-di-AMP synthase gene in the animal cell culture medium (Fig. 8). Further studies showed that this phenomenon occurred equally in strains expressing C-di-AMP, C-di-GMP, and cGAMP synthase as well as C-di-AMP (Figs. 9 and 10). To confirm whether this phenomenon was due to the osmotic pressure of the culture medium, the strains were cultured by adjusting the salt concentration, and it was found that the strains did not grow regardless of the osmotic pressure (Fig. 11). Even in a test using LB medium, a medium exclusively for bacteria, the number of strains rapidly decreased, so it was determined that the problem was not with the medium components.

[0142] Artificially introducing a STING agonist synthase gene into a recombinant strain allows the STING agonist to regulate various physiological processes, including cell wall homeostasis, DNA repair, gene expression regulation, and virulence factor production. However, if the intracellular concentration of STING agonist is not properly regulated and accumulates excessively, it can negatively impact the growth of Gram-negative bacteria.

[0143] Excessive accumulation of STING agonists within bacteria can inhibit cell wall synthesis, leading to cell wall defects and cell lysis and death. To confirm this, strains were cultured in media treated with various concentrations of the antibiotic Cefotaxime, which inhibits bacterial cell wall synthesis. As a result, bacterial growth was inhibited simultaneously with expression of the STING agonist synthase (=doxycycline administration) (Figure 12 and Table 3).

[0144] EmtpyCdaAyfiNCgasVNP200090.370.700.830.90SHJ20370.371.301.601.13CNC180.471.531.770.97DH5a0.370.730.730.83Nissle0.370.630.800.63

[0145] To utilize a recombinant strain as an anticancer therapeutic, intratumoral strain growth is required, and the expression of STING agonist synthase was determined to be a growth-inhibiting factor, such as weakening the cell wall within the strain. In summary, a recombinant strain with the STING agonist synthase gene introduced must synthesize endogenous STING agonist synthase within the strain and load it into the cell. However, expression of the STING agonist synthase gene causes a collision with a signaling substance within the strain, which lyses the cell wall (bacterial lysis). In the short term, this exposes cancer cells (e.g., tumor animal models) to excessive amounts of STING agonist synthase and strain lysates, and induces a cytokine storm in the strain's immune system.

[0146] [2-5] Utilization as a strain dissolution system

[0147] To confirm the possibility that the expression of the STING agonist synthase gene in bacteria can serve as a system for releasing and delivering foreign proteins or nucleic acid molecules that cannot be secreted by bacteria because they would inhibit cell growth or lyse, the GFP fluorescent gene was introduced into the pJH18-DisA plasmid into the SLppGpp strain. Doxycycline diluted in ethanol was added to the final concentrations of 0, 20, 100, and 200 ng / ml of the culture medium, and the strain was cultured in a shaking incubator at 200 rpm and 37°C. After inducing the expression of DisA and GFP with doxycycline, the supernatant was collected and the activity was confirmed by Western blotting and a fluorescent reader. As a result, it was confirmed that GFP was eluted into the medium by the expression of DisA in a strain that did not secrete GFP alone (Fig. 13). These results suggest that the STING agonist synthase can be used as a novel bacterial lytic protein when expressed only within the strain.

[0148] Example 3. Preparation of an improved DNA construct expressing a STING agonist synthase.

[0149] To improve the problem while maintaining the effect of Example 2, an additional signal sequence was introduced into the DNA construct manufactured in Example 1 (Table 4).

[0150] Signal sequence identification code Sequence number (No.) Sequence Arg T Sequence number 34 ATGAAGAAGACCGTTCTCGCTTTGTCTTTGCTGATAGGTCTGGGCGCGACGGCGGCCAGTTACGCCAroQ Sequence number 35 ATGATTCGTCATATCGCCATTTTTCTTTGTTCTTTATTGATGTGCAGCACCACTTTTGCCFlgH Sequence number 36 ATGCAAAAATACGCGCTTCACGCTTACCCAGTTATGGCCCTGATGGTCGCGACGCTGACAGGAFlgI Sequence number 37 ATGGTGTTTAAAGCTCTTGCAGGAATCGTTCTGGCACTGGTTGCCACTCTGGCGCACGCCHiuH Sequence number 38 ATGAAACGACATATACTGGCTACCGTGATAGCATCTCTTGTTGCAGCCCCGGCAATGGCGCTGGCCLpp2 Sequence number 39ATGAACCGTACTAACCAGCTGATCTTAGGTGCAGTAGTTCTGGGTTCCACGTTACTGGCAGGTMltFSEQ ID NO. 40ATGTTGAAAAAATTAAAGATTAATTATCTGTTCATCGGCATATTGACGCTGCTGCTGGCAGCAGCCCTTTGGCCCTCAATCCCCTGGTTCOmpASEQ ID NO. 41ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCCOmpDSEQ ID NO. 42ATGAAACTTAAGTTAGTGGCAGTGGCAGTGACTTCCCTGTTGGCAGCAGGCGTTGTAAATGCAOmpFSEQ ID NO. 43ATGATGAAGCCGCAAAATCCTGGCAGCGGTGATCCCTGCCCTGCTGGCTGCTGCAACCGCAAACGCAPelBSEQ ID NO. 44ATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCScrYSEQ ID NO. 45ATGTACAGAAAAAGCACACTTGCGATGCTTATCGCTTTGCTAACCAGCGCTGCCTCAGCCCATGCGSodC1SEQ ID NO.46ATGAAATACACAATATTGTCGCTGGTAGCTGGGTGCGCTCATCAGTTGTTCAGCAATGGCATsxSEQ ID NO. 47ATGAAAAAAACTTTACTCGCAGTCAGCGCAGCGCTGGCGCTCACCTCATCTTTTACTGCTAACGCAUshASEQ ID NO. 48ATGAAATTTTTGAAACGGGGTGTGGCGCTGGCGTTACTGGCGGCGTTCGCGCTGACGACTCAGCCTGCACAGGCT

[0151] Example 4. Confirmation of the anticancer effect of an improved DNA construct expressing the STING agonist synthase.

[0152] [4-1] Production of recombinant strains transformed with improved DNA constructs

[0153] The DNA construct (plasmid) prepared in Example 3 was introduced into SHJ2037 (relA::cat, spoT::kan, SLppGpp), CNC18 (△relA, △spoT, △SPI1, △SPI2), VNP20009, E. coli DH5a, and E. coli Nissle, which are Salmonella typhimurium (S. typhimurium) strains lacking ppGpp, using electroporation, and then cultured overnight using LB medium containing 100 ㎍ / ml of ampicillin. Then, the culture solution was diluted at a ratio of 1:100 using fresh LB medium containing ampicillin, and further culture was performed to determine OD 600 When the value reached 0.5 to 0.7, doxycycline diluted in ethanol was added to the culture medium to give final concentrations of 0, 10, 50, 100, 300, and 500 ng / ml, and cultured in a shaking incubator at 200 rpm and 37°C.

[0154] C-di-AMP synthase was confirmed by Western blotting in the culture medium of the strain into which DisA, CdaA, or CdaS was introduced together with the above pelB (SDS-PAGE 10%, Myc tag ab). As a result, C-di-AMP synthase was secreted well in the strain into which the DisA or CdaS gene was introduced, but C-di-AMP synthase secretion was not smooth in the strain into which the CdaA gene was introduced (Fig. 14). To clarify that the C-di-AMP synthase was secreted outside the cell without the cell being lysed, it was confirmed together with the endogenous protein DnaK. As a result, the strain into which the DisA gene was introduced selectively secreted only C-di-AMP synthase outside the cell and well maintained the endogenous protein inside the cell, but the strain into which the CdaS gene was introduced showed that the endogenous protein DnaK was excessively detected, and this selectivity was significantly reduced (Fig. 15). In addition, when the strains were cultured and doxycycline was administered, it was shown that the strains into which the DisA or CdaS genes were introduced specifically maintained a state in which the cells were not lysed (Fig. 16). In addition, when the strains were cultured on media treated with various concentrations of the antibiotic Cefotaxime, it was confirmed that the antibiotic sensitivity was lowered to the extent that the cells were not lysed (Fig. 17). In summary, when the STING agonist synthase was transduced together with the signal sequence, it had the effect of preventing the lysis of the bacterial cells while allowing the STING agonist synthase to be secreted outside the cells.

[0155] [4-2] Antibiotic susceptibility evaluation of recombinant strains transformed with improved DNA constructs

[0156] Since it was confirmed that antibiotic susceptibility increased when the STING agonist synthase was expressed within the strain, the antibiotic susceptibility of the recombinant strains into which the signal sequence was introduced was evaluated. First, the SLppGpp strain containing the STING agonist synthase into which the signal sequence was introduced was cultured on a medium treated with various concentrations of the antibiotic Cefotaxime. As a result, it was confirmed that the strain secreting the STING agonist synthase had reduced antibiotic susceptibility, as in Example 4-2 (Fig. 18). As a result of confirming antibiotic susceptibility by transforming the DNA construct with reduced antibiotic susceptibility of the SLppGpp strain into various strains, it was confirmed that when the STING agonist synthase was transfected together with the signal sequence, the lysis of bacterial cells was prevented (Table 5).

[0157] CdaAPelB-DisATsx-AdrAUshA-AdraMltF-ydeHFlgH-CGASVNP200090.830.430.570.530.500.60SHJ20371.400.500.53 0.470.430.53CNC181.530.430.500.530.530.47DH5a0.730.570.530.470.430.53Nissle0.730.530.530.500.530.53

[0158] In order to reduce repetitive work, subsequent experiments used the CNC18 strain introduced with pJH18_PelB-DisA, which was confirmed to have no problems with protein secretion and strain growth in the previous example.

[0159] [4-3] Confirmation of the immune stimulating effect of the transformed recombinant strain

[0160] The strain transformed with the improved DNA construct secretes the STING agonist synthase outside the cell body in a sustained manner, allowing it to utilize not only the ATP within the strain but also the ATP in the tumor microenvironment, further expected to have a synergistic effect of depleting tumor energy (Fig. 19). To demonstrate this, 3x10 RAW 264.7 cells were cultured. 5 The Salmonella strain introduced with the PelB-DisA gene manufactured in Example 4-1 was administered to cells / well, and 100 μM of ATP was additionally administered, along with 200 ng / well of doxycycline. As a result, as hypothesized, the pJH18-PelB_DisA test group administered with ATP and doxycycline showed the highest significantly higher immunostimulatory effect (Figs. 20 and 21). In addition, to confirm whether the transformed recombinant strain consumed ATP in the tumor microenvironment, the amount of secreted ATP produced in the medium was measured after co-culture with 4T1 and MC38 tumor cells. As a result, it was found that the recombinant strain administered with doxycycline removed external ATP (Figs. 22 and 23). A decrease in external ATP may reduce the efficiency of tumor cells to convert ATP to adenosine using CD39 and CD73 for immune defense, which may expose them to an immune response. To demonstrate this, we obtained a medium co-cultured with 4T1 and the recombinant strain using the above method, and confirmed the amount of adenosine produced using LC-MS equipment. As a result, it was confirmed that the amount of adenosine was lower in the pJH18_PelB-DisA test group co-administered with doxycycline compared to the control group (Fig. 24). This confirmed that the STING agonist synthase secreted outside the strain consumes external ATP in the tumor microenvironment to enhance the immune response, and lowers the adenosine concentration, thereby enhancing the immune cell response.

[0161] [4-4] Confirmation of anticancer effect of transformed recombinant strain

[0162] To determine whether a Salmonella strain transformed with an improved DNA construct expressing the STING agonist synthase induces anticancer effects in surviving animals, a tumor animal model test was performed using doxycycline. The overall setup of the in vivo test was identical to that described in Examples 2-3 (Fig. 25). The test results showed that the pJH18_pDisA strain exhibited a remarkably excellent tumor suppression effect (Fig. 26).

[0163] Example 5. Confirmation of the combination therapy effect of an improved DNA construct expressing the STING agonist synthase.

[0164] [5-1] Confirmation of improved efficacy of combination anticancer drugs using transformed recombinant strains

[0165] Tumor cells develop resistance to anticancer drugs by using channels such as ABC transporters to transport drugs outside the cell, preventing their accumulation within the cell. At this time, ATP is used as an energy source. However, a decrease in ATP (extracellular ATP) in the tumor microenvironment reduces the energy source to drive ABC transporters within the cell. This can lead to problems with the channel function, such as decreased expression of P-gp, one of the ABC transporters, which prevents proper drug release and causes intracellular accumulation, leading to cell death. To determine whether a decrease in extracellular ATP increases the accumulation of anticancer drugs within tumor cells, 4T1 cells were co-cultured with a recombinant strain to express and secrete STING agonist synthase, and then treated with 1 μM doxorubicin. The treated cells were examined using a confocal microscope. As a result, it was confirmed that tumor cells treated with a recombinant strain secreting STING agonist synthase had decreased P-gp expression and increased doxorubicin accumulation, similar to those treated with ATPase (Figure 27). This suggests that recombinant strains secreting STING agonist synthase reduce extracellular ATP, allowing more anticancer drugs to accumulate within tumor cells.

[0166] [5-2] Confirmation of anticancer effect by combining transformed recombinant strains with anticancer drugs

[0167] We aimed to determine whether the anticancer effect could be enhanced by co-administration of a recombinant strain secreting STING agonist synthase and an anticancer drug. 4T1 cells were seeded in a 96-well plate at a density of 3x10 4After adding 10 cells / well, the recombinant strain secreting STING agonist synthase and treating with 1 μM Doxorubicin were measured for cell viability using the CCK8 assay. As a result, the group that secreted STING agonist synthase and treated with Doxorubicin showed the lowest tumor cell viability compared to the group treated alone (Fig. 28). As a result of additionally examining other tumor cells (A549 cells, MCF7 cells) that were resistant to Doxorubicin through the mechanism related to intracellular anticancer drug accumulation, the group that secreted STING agonist synthase and treated with Doxorubicin showed the lowest tumor cell viability (Fig. 29). In addition, as a result of additionally examining tumor cells (SW620 cells, MCF7 cells) that were resistant to Cisplatin through the mechanism related to intracellular anticancer drug accumulation, the group that secreted STING agonist synthase and treated with Cisplatin showed the lowest tumor cell viability (Fig. 30). Through this, it was confirmed that the combined administration of a recombinant strain secreting a STING agonist synthase and an anticancer agent can enhance the anticancer effect.

[0168] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred implementation examples and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0169] The present invention relates to a strain transformed with a DNA construct into which a signaling substance for cancer treatment, for example, a cyclic dinucleotide synthetase gene, has been introduced, or a vector including the DNA construct. The strain transformed with the DNA construct according to the present invention, or a vector including the DNA construct, targets cancer in a subject and then secretes cyclic dinucleotide synthetase in the environment surrounding the cancer, thereby being able to very effectively prevent or treat cancer and, at the same time, diagnose cancer in real time.

Claims

1. Contains a cyclic dinucleotide synthetase gene, A DNA construct additionally comprising a secretion signal sequence.

2. In paragraph 1, The above cyclic dinucleotide synthetase genes are DisA, CdaA, CdaS, DosC, AdrA, ydeH, YfiN, CGAS, cdnC, relA, capV, cdnD, cdnE, cdnB, AKT1, gdpP, disA, dncV, cdnG, ZDHHC9, dacA, radA, STING3, argF, folP, cdaR, glmS, ybbP, dacA_2, disA_2, ossG, sle_31840, dacB, disA_1, disA_3, 1d0912, dacZ, cGlr1, cGlr2, guaA, cdnA, LYPLAL1, Rnf185, VC_A0931, VC_A0681, A DNA construct comprising at least one selected from the group consisting of GG20550, GD11141, TcasGA2_TC003965, thsB1, eccD1, VC_A0210, CG7194, nadE, STING7, STING2, STING1, STING5, mucR, dgcP, pleD, dgcZ, dgcA, cdgI, dgcM, tpbB, csrA, dgcT, dgcN, dgcQ, dgcS, dgcF, dgcJ, dgcC, dgcE, dgcI, ydiV, vdcA, csrD, dosP, wspR, pdeF, csgD, tpbA, pdeR, and nbdA.

3. In paragraph 1, A DNA construct comprising at least one leader sequence selected from the group consisting of pelB, ompA, ompB, ompC, ompD, ompE, ompF, ompT, phoA TolB, TorT, LamB, LivK, TorA, SuflCT-B, LTⅡb-B, BAP, MF α, SUC2, HasA, PspA, TlyA, OutD, YwbN, NprE, SpsA, LipA, LysK, XcpT, AmyE, EstA, BrkA, IcsA, CelA, ClyA, HlyA, VgrG, EspA, EsxA, AprE, FhuD, MglB, OppA, RbsB, Agp, FkpA, YtfQ, HdeA, HdeB, GlnH, LLO and phoE, wherein the secretion signal sequence is selected from the group consisting of phoE, phoA, TolB, TorT, LamB, LivK, TorA, SuflCT-B, LTⅡb-B, BAP, MF α, SUC2, HasA, PspA, TlyA, OutD, YwbN, NprE, SpsA, LipA, LysK, XcpT, AmyE, EstA, BrkA, IcsA, CelA, ClyA, HlyA, VgrG, EspA, EsxA, AprE, FhuD, MglB, OppA, RbsB, Agp, FkpA, YtfQ, HdeA, HdeB, GlnH, LLO and phoE.

4. In paragraph 1, The above DNA construct is a DNA construct in which the expression of the cyclic dinucleotide synthetase gene is regulated by a cis-acting element or a trans-acting element.

5. In paragraph 4, A DNA construct, wherein the cis-acting element is at least one selected from the group consisting of a ribosome binding site (RBS), a 5'-untranslated region (5'-UTR), a transcription factor binding site, and terminators.

6. In paragraph 5, A DNA construct, wherein the above transcription factor binding site is at least one selected from the group consisting of a promoter of the cyclic dinucleotide synthetase gene; an enhancer; and a silencer.

7. In paragraph 4, A DNA construct, wherein the trans-acting factor is at least one selected from the group consisting of a transcription factor, an aptamer, sRNA, and antisense RNA (asRNA).

8. In paragraph 1, A DNA construct further comprising at least one selected from the group consisting of a gene encoding an anticancer protein; a gene encoding a cytokine; a gene encoding a chemokine; a gene encoding an immune modulator; an oligonucleotide specific for a cancer antigen; and a gene encoding a reporter protein.

9. In paragraph 8, A DNA construct, wherein the anticancer protein is at least one selected from the group consisting of a toxic protein, an antibody specific for a cancer antigen or a fragment of the antibody, a tumor suppressor protein, an angiogenesis inhibitor, a cancer antigen, a prodrug-converting enzyme, a tumor microenvironment matrix-degrading enzyme, and a pro-apoptotic protein.

10. In paragraph 9, A DNA construct wherein the toxin protein is at least one selected from the group consisting of Ricin, Saporin, Gelonin, Momordin, Debuganin, Diphtheria toxin, Pseudomonas toxin, Hemolysin (HlyA), FAS ligand (FASL), Tumor necrosis factor-α (TNF-α), TNF-related apoptosis-inducing ligand (TRAIL), and Cytolysin A (ClyA).

11. In paragraph 9, A DNA construct wherein the tumor suppressor protein is at least one selected from the group consisting of RB (Retinoblastoma protein) protein, p53 protein, APC (Adenomatous polyposis coli) protein, PTEN (Phosphatase and tensin homologue) protein, and CDKN2A (cyclin dependent kinase inhibitor 2A) protein.

12. In paragraph 9, A DNA construct wherein the angiogenesis inhibitor is at least one selected from the group consisting of angiostatin, endostatin, thrombospondin, and protease inhibitor proteins.

13. In paragraph 9, A DNA construct, wherein the cancer antigen is at least one selected from the group consisting of alpha-fetoprotein (AFP), vascular endothelial growth factor receptor 2 (VEGFR2), Survivin, Legumain, and Prostate cancer specific antigen (PCSA).

14. In paragraph 9, A DNA construct, wherein the prodrug conversion enzyme is at least one selected from the group consisting of thymidine kinase, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, carboxypeptidase G2, chromate reductase YieF, herpes simplex virus type I thymidine kinase / ganciclovir (HSV1-TK / GCV), and β-glucuronidase.

15. In paragraph 9, A DNA construct wherein the tumor microenvironment matrix decomposing enzyme is at least one selected from the group consisting of collagenase, heparinase, hyaluronidase, protease, chymotrypsin, chymopapain, trypsin, caseinase, elastase, papain, deoxyribonuclease, matrix metalloproteinases (MMPs), cathepsins, β-glucuronidase, and serine proteases.

16. In paragraph 9, A DNA construct wherein the pro-apoptotic protein is L-ASNase or RNA-binding motif protein 5 (RBM5).

17. In paragraph 8, A DNA construct wherein the oligonucleotide specific for the cancer antigen is a base sequence encoding at least one selected from the group consisting of an antisense oligonucleotide, an aptamer, siRNA, and shRNA.

18. In paragraph 8, A DNA construct wherein the reporter protein is at least one selected from the group consisting of fluorescent proteins, luciferase, and proteins used in nuclear medicine or MRI imaging.

19. In paragraph 18, A DNA construct, wherein the fluorescent protein is at least one selected from the group consisting of a green reporter protein (Green Fluorescent Protein; GFP), a modified green reporter protein (Modified Green Fluorescent Protein; MGFP), an enhanced green reporter protein (Enhanced Green Fluorescent Protein; EGFP), a red reporter protein (RFP), an enhanced red reporter protein (ERFP), a blue reporter protein (BFP), an enhanced blue reporter protein (Enhanced Blue Fluorescent Protein; EBFP), a yellow reporter protein (YFP), and an enhanced yellow reporter protein (Enhanced Yellow Fluorescent Protein; EYFP).

20. In paragraph 18, A DNA construct wherein the protein used in the above nuclear medicine or MRI imaging is at least one selected from the group consisting of herpes simplex virus thymidine kinase, dopamine receptor, somatostatin receptor, sodium-iodide transporter, iron receptor, transferrin receptor, ferritin, and iron transporter (magA).

21. A recombinant vector comprising a DNA construct of any one of claims 1 to 20.

22. A strain into which the recombinant vector of Article 21 has been introduced.

23. In paragraph 22, The strain is at least one selected from the group consisting of a Salmonella strain, a Clostridium strain, a Bifidobacterium strain, and an Escherichia coli strain.

24. A pharmaceutical composition for the prevention or treatment of cancer, comprising the strain of Article 22 as an active ingredient.

25. In paragraph 24, A pharmaceutical composition, wherein the cancer is at least one selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymphoma, gallbladder cancer, blood cancer, thyroid cancer, endocrine cancer, oral cancer, liver cancer, biliary tract cancer, colon cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain tumor, lung cancer, undifferentiated thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureteral cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and solitary myeloma.

26. A composition for diagnosing cancer comprising the strain of Article 22.

27. A method for diagnosing or treating cancer, comprising the step of treating a biological sample isolated from a target organism with the strain of claim 22.

28. In paragraph 27, A method for diagnosing or treating cancer, further comprising a step of diagnosing cancer when a reporter protein is expressed from the strain.

Images