Detection method for rare-mutation BRAF gene
By blocking the amplification of wild-type templates using blocking primers during PCR amplification of the BRAF gene, the proportion of mutant products is increased, and the accurate detection of low-frequency mutations in the BRAF gene is achieved, solving the problem that the prior art is difficult to detect low-frequency mutations.
Patent Information
- Application Number
- PCT/CN2024/114463
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-15
- Filing Date
- 2024-08-26
- Publication Date
- 2025-06-19
AI Technical Summary
Existing sequencing methods are difficult to accurately detect low-frequency mutations in BRAF genes with less than 25%, especially those with less than 5% of mutations, which cannot obtain accurate detection results.
By adding blocking primers matching the wild-type template during the PCR amplification of the BRAF gene, the blocking primers are combined with the wild-type template and block their amplification, thereby increasing the proportion of mutant products and achieving accurate detection of samples with lower mutation rate.
This method can increase the proportion of mutants in PCR products, realize accurate detection of low-frequency mutations in the BRAF gene as low as 1%, and solve the problem that the prior art cannot accurately detect low-frequency mutations.
Smart Images

Figure CN2024114463_19062025_PF_FP_ABST
Abstract
Description
A method for detecting low-frequency mutations in the BRAF gene Technical Field
[0001] The present invention belongs to the technical field of BRAF gene sequencing, and in particular relates to a method for detecting low-frequency mutations of the BRAF gene. Background Art
[0002] Harmful sequence variation plays a significant role in the development and progression of many different types of cancer. Sanger sequencing, the gold standard for detecting germline mutations, is well established. However, detecting somatic mutations, especially low-frequency variants in consistent tumor samples, is extremely challenging.
[0003] When using the classic Sanger sequencing method, it is difficult to detect low-frequency mutations below 25%. TM Minor Variant Finder software can be used on a capillary sequencer to maximally subtract background noise signals, distinguish background noise from control samples, visually detect mutation peaks, and detect low-frequency mutations as low as 5%.
[0004] The BRAF gene encodes the B-RAF protein, which is involved in cell signaling regulation, growth, and survival. Its mutation is an important therapeutic target for multiple solid tumors, with varying mutation rates in melanoma, thyroid cancer, colorectal cancer, and NSCLC. The BRAF V600D / E / K / R mutation (class I mutation) strongly activates BRAF kinase activity, constitutively activates the MAPK pathway, thereby promoting cell proliferation and inhibiting apoptosis. It is also sensitive to BRAF and MEK inhibitors. Different targeted therapies have been approved for patients with BRAF mutations in different tumor types.
[0005] To detect BRAF gene mutations, Sanger sequencing can be used in combination with Applied biosystems TM Although Minor Variant Finder software analysis can detect low-frequency mutations as low as 5% in BRAF gene mutations, it cannot produce accurate detection results for low-frequency mutations below 5%.
[0006] In summary, among the current sequencing methods, for BRAF gene mutations, it is difficult to detect low-frequency mutations below 25% using the classic Sanger sequencing method. TM Although Minor Variant Finder can detect mutations as low as 5%, it still cannot accurately detect lower mutations.
[0007] Summary of the Invention
[0008] To solve the above problems, the present invention provides a method for detecting low-frequency mutations in the BRAF gene, comprising:
[0009] During the BRAF gene amplification process of the target sample fragment, a blocking primer matching the wild template in the target sample fragment is added, the blocking primer is combined with the denatured wild template, and sequencing is performed to obtain a sequencing result corresponding to the target sample fragment.
[0010] Preferably, the nucleic acid sequence of the blocking primer is shown as SEQ ID NO.1.
[0011] Preferably, during the BRAF gene amplification process of the target sample fragment, a blocking primer matching the wild template in the target sample fragment is added, the blocking primer is combined with the denatured wild template, and sequencing is performed to obtain a sequencing result corresponding to the target sample fragment, including:
[0012] Designing specific BRAF amplification primers according to the human genome sequence; and, based on the BRAF amplification primers, designing the blocking primers according to the site to be detected;
[0013] adding the blocking primer during the enrichment of the target sample fragment using the BRAF amplification primer, so that the blocking primer combines with the denatured wild template to obtain a specific fragment;
[0014] The specific fragments are sequenced to obtain the sequencing results.
[0015] Preferably, the BRAF amplification primers include: an upstream primer as shown in SEQ ID NO.2, and a downstream primer as shown in SEQ ID NO.3.
[0016] Preferably, the blocking primer is added during the enrichment of the target sample fragment using the BRAF amplification primer, so that the blocking primer combines with the denatured wild template to obtain a specific fragment, comprising:
[0017] Based on PCR amplification technology, the target sample fragment is PCR amplified using BRAF amplification primers, and the blocking primer is added during the enrichment process of the target sample fragment to obtain a target amplification product;
[0018] The target amplified product is confirmed by gel electrophoresis, and the amplification result is confirmed by gel electrophoresis, and the amplified product is purified by gel electrophoresis to extract the specific fragment.
[0019] Preferably, in the step of obtaining the target amplification product, the amplification reaction system includes:
[0020] The upstream primer and downstream primer in the BRAF amplification primer, template DNA, the blocking primer, 2×Hieff™ PCR Master Mix buffer and deionized water.
[0021] Preferably, the amounts used in the amplification reaction system are as follows:
[0022] 1 μL of each of the upstream primer and the downstream primer of the BRAF amplification primers, both with a concentration of 10 pmol / μL, 3 μL of template DNA, 1 μL of the blocking primer, 10 μL of 2×Hieff™ PCR Master Mix buffer, and 4 μL of deionized water.
[0023] Preferably, sequencing the specific fragment to obtain the sequencing result comprises:
[0024] Purifying the specific fragments and sequencing them to obtain sequencing data;
[0025] The sequencing data is analyzed to obtain the sequencing results.
[0026] Preferably, analyzing the sequencing data to obtain the sequencing results comprises:
[0027] The sequencing data corresponding to the sample to be tested are analyzed using Minor Variant Finder software to obtain the sequencing results.
[0028] Preferably, in the step of purifying the specific fragments and then sequencing them to obtain sequencing data, the sequencing reaction system includes:
[0029] The purified specific fragment, BigDyeMix mixture, sequencing primers and deionized water.
[0030] The present invention provides a method for detecting low-frequency BRAF gene mutations, comprising: adding a blocking primer that matches a wild-type template in a target sample fragment during BRAF gene amplification, combining the blocking primer with the denatured wild-type template, and sequencing to obtain a sequencing result corresponding to the target sample fragment. The present invention uses a blocking primer during sequencing template preparation to suppress the wild-type BRAF gene template during amplification, thereby relatively increasing the proportion of mutant products, thereby accurately detecting samples with lower mutation rates. This method is of great significance for detecting low-frequency mutations using Sanger sequencing. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG1 is a schematic diagram of sequencing results of PCR products in an embodiment and a comparative example of a method for detecting a low-frequency mutation of the BRAF gene of the present invention;
[0032] FIG2 is a schematic diagram showing the results of MVF analysis of the product amplified by the conventional method of the comparative example in the present invention;
[0033] FIG3 is a schematic diagram showing the results of MVF analysis of the products amplified using the blocking primer amplification method of the embodiment of the present invention.
[0034] The purpose, features and advantages of the present invention will be further described with reference to the accompanying drawings and in conjunction with the embodiments. DETAILED DESCRIPTION
[0035] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0036] The present invention provides a method for detecting a low-frequency BRAF gene mutation, comprising:
[0037] During the BRAF gene amplification process of the target sample fragment, a blocking primer matching the wild template in the target sample fragment is added, the blocking primer is combined with the denatured wild template, and sequencing is performed to obtain a sequencing result corresponding to the target sample fragment.
[0038] The BRAF gene is a gene found in humans that encodes the B-RAF protein. This protein is an important component of the mitogen-activated protein kinase (MAPK) pathway, which is primarily responsible for regulating cell signaling, as well as cell growth and survival.
[0039] The B-RAF protein is a member of the RAF kinase family, which plays a key role in multiple cellular signaling pathways, particularly in regulating cell division and growth. BRAF gene mutations, particularly the V600E mutation, have been linked to the development of various cancers. These mutations often lead to abnormally enhanced B-RAF kinase activity, which in turn overactivates the MAPK pathway, promoting cell proliferation and inhibiting apoptosis.
[0040] Blocking primers are used to block the amplification of certain DNA sequences during PCR amplification reactions. They are characterized by being a perfect match for the DNA sequence to be blocked, allowing them to bind to the sequence and hinder its amplification.
[0041] Wild-type template refers to the wild-type gene sequence present in the DNA sample to be amplified. Here, wild-type refers to the normal, non-mutated genotype.
[0042] By adding a blocking primer that perfectly matches the wild-type template, it binds to the denatured wild-type template and hinders its amplification. This hinders amplification of the wild-type template, reducing amplification efficiency and allowing the mutant gene to be amplified more readily than the wild-type template. Consequently, the proportion of the mutant gene in the PCR product increases.
[0043] The principle of this method is to increase the proportion of the mutant gene in the PCR product by hindering the amplification of the wild-type gene, thereby achieving the goal of detecting samples with low levels of BRAF V600 gene mutations. During the PCR amplification process, primers serve to locate and amplify the target DNA sequence. By adding a blocking primer that perfectly matches the wild-type template, it binds to the denatured wild-type template and hinders its amplification. As a result, due to the obstruction of the wild-type template, amplification efficiency is reduced, while the mutant gene is more easily amplified than the wild-type template.
[0044] This method can effectively increase the proportion of mutant forms in PCR products and can detect samples with lower levels of BRAF V600 gene mutations. Furthermore, the method is simple to operate and highly reliable, making it suitable for testing large samples.
[0045] The present invention inhibits the wild-type BRAF gene template during amplification by blocking primers during the sequencing template preparation process, thereby relatively increasing the proportion of mutant products, so as to achieve the purpose of accurately detecting samples with lower mutation rates. This method is of great significance for detecting low-frequency mutations using the Sanger sequencing method.
[0046] Furthermore, the nucleic acid sequence of the blocking primer is shown as SEQ ID NO.1.
[0047] The blocking primer may be as follows:
[0048] GATTTTGGTCTAGCTACAGTGAAATCTCGATGG.
[0049] In addition, other primers that are related to, similar to, or capable of performing the same function as the above-mentioned blocking primer may also be used.
[0050] Furthermore, during the BRAF gene amplification process of the target sample fragment, a blocking primer matching the wild template in the target sample fragment is added, the blocking primer is combined with the denatured wild template, and sequencing is performed to obtain a sequencing result corresponding to the target sample fragment, including:
[0051] Step S1, designing specific BRAF amplification primers according to the human genome sequence; and, based on the BRAF amplification primers, designing the blocking primers according to the site to be detected;
[0052] Step S2, adding the blocking primer during the enrichment of the target sample fragment using the BRAF amplification primer, so that the blocking primer combines with the denatured wild template to obtain a specific fragment;
[0053] Step S3: sequencing the specific fragment to obtain the sequencing result.
[0054] Furthermore, the BRAF amplification primers include: an upstream primer as shown in SEQ ID NO.2, and a downstream primer as shown in SEQ ID NO.3.
[0055] As mentioned above, the BRAF amplification primer may be a V600E amplification primer, which may be the following primer:
[0056] (1) BRAF (V600E) upstream primer: 5'GAATATCTGGGCCTACATTGCT 3';
[0057] (2) BRAF (V600E) downstream primer: 5'AGCCTCAATTCTTACCATCCAC3'.
[0058] Furthermore, the step S2, adding the blocking primer during the enrichment of the target sample fragment using the BRAF amplification primer, so that the blocking primer combines with the denatured wild template to obtain a specific fragment, includes:
[0059] Step S21, based on PCR amplification technology, PCR amplification is performed on the target sample fragment using BRAF amplification primers, and the blocking primer is added during the enrichment process of the target sample fragment to obtain a target amplification product;
[0060] In step S22, the target amplified product is subjected to gel electrophoresis to confirm the amplification result, and the gel is cut and purified to obtain the specific fragment.
[0061] Furthermore, in the step S21, in the step of obtaining the target amplification product, the amplification reaction system includes:
[0062] Step S211: the upstream primer and the downstream primer in the BRAF amplification primers, the template DNA, the blocking primer, 2×Hieff™ PCR Master Mix buffer and deionized water.
[0063] Furthermore, in step S21, the amounts used in the amplification reaction system are as follows:
[0064] 1 μL of each of the upstream primer and the downstream primer of the BRAF amplification primers, both with a concentration of 10 pmol / μL, 3 μL of template DNA, 1 μL of the blocking primer, 10 μL of 2×Hieff™ PCR Master Mix buffer, and 4 μL of deionized water.
[0065] Furthermore, the step S3 of sequencing the specific fragment to obtain the sequencing result includes:
[0066] Step S31, purifying the specific fragments and sequencing them to obtain sequencing data;
[0067] Step S32: Analyze the sequencing data to obtain the sequencing results.
[0068] Furthermore, the step S31 of analyzing the sequencing data to obtain the sequencing results includes:
[0069] Step S311 , analyzing the sequencing data corresponding to the sample to be tested using Minor Variant Finder software to obtain the sequencing results.
[0070] Conventional methods, such as the classic Sanger sequencing method, are difficult to detect low-frequency mutations below 25%. TM While Minor Variant Finder can detect mutations as low as 5%, it still cannot accurately detect lower mutations. In the present invention, unbalanced amplification caused by blocking primers increases the proportion of mutation peaks in Sanger sequencing results. Combined with Minor Variant Finder software analysis, it can detect mutations with mutation rates as low as 1%.
[0071] Furthermore, in the step of purifying the specific fragments and then sequencing them to obtain sequencing data, the sequencing reaction system includes:
[0072] The purified specific fragment, BigDyeMix mixture, sequencing primers and deionized water.
[0073] The present invention is further described below by way of specific examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.
[0074] Example:
[0075] Experimental methods:
[0076] In this example, a blocking primer that perfectly matches the wild-type template is added during PCR amplification of the BRAF V600 gene. During the annealing process, the blocking primer binds to the denatured wild-type template, hindering amplification of the wild-type template and reducing amplification efficiency. This increases the proportion of the mutant form in the product, enabling the detection of a lower number of samples with BRAF V600 gene mutations.
[0077] 1. Primer set:
[0078] Specifically, the BRAF amplification primers used are as follows:
[0079] (1) BRAF (V600E) upstream primer: 5'GAATATCTGGGCCTACATTGCT 3'
[0080] (2) BRAF (V600E) downstream primer: 5'AGCCTCAATTCTTACCATCCAC3'
[0081] The blocking primer used is:
[0082] 2. Materials and reagents:
[0083] 2×HieffTM PCR Master Mix (Shanghai Yisheng Biotechnology), Terminator v3.1Cycle Sequencing Kit (Thermo Fisher), POP-7 TM (Thermo Fisher), HiDi formamide (Thermo Fisher), and magnetic bead-based DNA gel recovery kit (Sangon Biotechnology).
[0084] 3. PCR amplification:
[0085] (1) The amplification reaction system with the addition of blocking primers is as follows:
[0086] Table 1. PCR amplification reaction system
[0087] (2) PCR reaction conditions:
[0088] Table 2. PCR amplification reaction conditions
[0089] 4. PCR product sequencing
[0090] (1) PCR product sequencing reaction system:
[0091] Table 3. PCR product sequencing reaction system
[0092] (2) PCR product reaction conditions:
[0093] Table 4. PCR product sequencing reaction conditions
[0094] The prepared system was mixed thoroughly, centrifuged, and placed on a PCR instrument, selecting the appropriate program for amplification. The sequencing reaction product was purified according to the purification steps and then sequenced.
[0095] Comparative Example:
[0096] In this comparative example, PCR amplification and sequencing experiments were performed on the samples in the above examples.
[0097] Among them, in the PCR amplification experiment, the reaction system used is as follows:
[0098] Table 5. PCR amplification reaction system
[0099] Horizontal comparison experiment:
[0100] (1) Sequencing experiments were performed under the above two conditions, and the sequencing results of the amplified PCR products were compared as shown in Figure 1.
[0101] Figure 1 shows the sequencing results of the products of the traditional amplification method (comparative example) and the blocking primer amplification method (example) for the same sample. It can be seen that, compared with the comparative example, the ratio of the A peak to the T peak in the circular magnification frame of the example using the detection method of the present application is significantly improved.
[0102] (2) The sequencing results were analyzed using Minor Variant Finder.
[0103] Table 6. Main data of the analysis results of the examples and comparative examples
[0104] The analysis results are shown in Figures 2 and 3. Figure 2 shows the results of MVF analysis of the products amplified using the conventional method employed in the comparative example; Figure 3 shows the results of MVF analysis of the products amplified using the blocking primer amplification method of the present invention. Referring to Table 6, which shows the key data from the analysis results of the examples and comparative examples, as shown in Figures 2 and 3, as well as Table 6, the detection methods provided in the present invention can more accurately detect mutation information in samples.
[0105] In summary, the present invention inhibits the amplification of the wild-type BRAF gene template by blocking primers during the preparation of sequencing templates, thereby relatively increasing the proportion of mutant products, so as to achieve the purpose of accurately detecting samples with lower mutation rates. This method is of great significance for detecting low-frequency mutations using Sanger sequencing.
[0106] The above are preferred embodiments and corresponding examples of the present invention. It should be pointed out that for ordinary technicians in this field, without departing from the creative concept of the present invention, several modifications and improvements can be made, including but not limited to adjustments of proportions, processes, dosages and reaction vessels, all of which fall within the scope of protection of the present invention.
Claims
1. A method for detecting low-frequency mutation of BRAF gene, characterized in that: include: During the BRAF gene amplification process of the target sample fragment, a blocking primer matching the wild template in the target sample fragment is added, the blocking primer is combined with the denatured wild template, and sequencing is performed to obtain a sequencing result corresponding to the target sample fragment.
2. The method for detecting low-frequency mutation BRAF gene according to claim 1, characterized in that: The nucleic acid sequence of the blocking primer is shown in SEQ ID NO.
1.
3. The method for detecting low-frequency mutation BRAF gene according to claim 1, characterized in that: The method comprises: adding a blocking primer matching the wild template in the target sample fragment during the BRAF gene amplification process of the target sample fragment, combining the blocking primer with the denatured wild template, and sequencing to obtain a sequencing result corresponding to the target sample fragment, including: Designing specific BRAF amplification primers according to the human genome sequence; and, based on the BRAF amplification primers, designing the blocking primers according to the site to be detected; Adding the blocking primer during the enrichment of the target sample fragment using the BRAF amplification primer, so that the blocking primer is combined with the denatured wild template to obtain a specific fragment; The specific fragment is sequenced to obtain the sequencing result.
4. The method for detecting low-frequency mutation BRAF gene according to claim 3, characterized in that: The BRAF amplification primers include: an upstream primer as shown in SEQ ID NO.2, and a downstream primer as shown in SEQ ID NO.
3.
5. The method for detecting low-frequency mutation BRAF gene according to claim 3, characterized in that: The method further comprises adding the blocking primer during the enrichment of the target sample fragment using the BRAF amplification primer, so that the blocking primer is combined with the denatured wild template to obtain a specific fragment, including: Based on PCR amplification technology, the target sample fragment is PCR amplified using BRAF amplification primers, and the blocking primer is added during the enrichment of the target sample fragment to obtain the target sample fragment. Mark amplification products; The target amplified product is subjected to gel electrophoresis to confirm the amplification result, and the amplified product is subjected to gel electrophoresis, and the specific fragment is cut and purified to obtain the specific fragment.
6. The method for detecting low-frequency mutation BRAF gene according to claim 5, characterized in that: In the step of obtaining the target amplification product, the amplification reaction system includes: The upstream primer and the downstream primer in the BRAF amplification primer, the template DNA, the blocking primer, 2×HieffTM PCR Master Mix buffer and deionized water.
7. The method for detecting low-frequency mutation BRAF gene according to claim 6, characterized in that: The amounts used in the amplification reaction system are as follows: The concentration of each of the upstream primer and the downstream primer of the BRAF amplification primer is 10 pmol / μL, 1 μL each, 3 μL of template DNA, 1 μL of the blocking primer, 10 μL of 2×HieffTM PCR Master Mix buffer and 4 μL of deionized water.
8. The method for detecting low-frequency mutation BRAF gene according to claim 3, characterized in that: The step of sequencing the specific fragment to obtain the sequencing result comprises: After purifying the specific fragments, sequencing is performed on a sequencing machine to obtain sequencing data; The sequencing data is analyzed to obtain the sequencing results.
9. The method for detecting low-frequency mutation BRAF gene according to claim 8, characterized in that: The step of analyzing the sequencing data to obtain the sequencing result comprises: The sequencing data corresponding to the sample to be tested is analyzed by Minor Variant Finder software to obtain the sequencing result.
10. The method for detecting low-frequency mutation BRAF gene according to claim 8, characterized in that: In the step of purifying the specific fragments and sequencing them to obtain sequencing data, the sequencing reaction system includes: The purified specific fragment, BigDyeMix mixture, sequencing primers and deionized water.
Citation Information
Patent Citations
Kit for detecting BRAF gene V600E trace mutation through pyrosequencing technique and application of kit
CN105400900A
Primer for detecting BRAF gene V600E mutation of human colorectal cancer, detection method and kit thereof
CN109295176A
Detection kit, primer and method for targeted drug administration gene of lung cancer
CN109486951A
Detection method of low-frequency mutation BRAF gene
CN117701713A