Memory chassis cells

Abstract

A programmable drug-delivery system comprising a chassis cell, (e.g., a Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)) engineered to produce an orthogonal inducible recombinase to alter extrachromosomal nucleic acid. Also disclosed herein is a synthetic probiotic composition comprising the programmable drug-delivery system, described herein, and a pharmaceutically acceptable carrier, and the methods of use thereof in preventing or treating gut microbiota dysbiosis in a subject in need thereof.

Description

MEMORY CHASSIS CELLSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to, and the benefit of, U.S. Provisional Patent Application No. 63 / 554,660, filed February 16, 2024, which is incorporated by reference herein in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under Grant No. GCR / CBET 1934836 awarded by the National Science Foundation. The government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING

[0003] The sequence listing submitted on February 14, 2025, as an .XML file entitled “10034-351W01_ST26.xml” created on February 12, 2025, and having a file size of 210,683 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).FIELD

[0004] The present disclosure relates to programmable drug-delivery compositions, systems, and the methods of use thereof in preventing or treating disease and disorders.BACKGROUND

[0001] Traditional therapeutics, such as small-molecule drugs and biologies, have been instrumental in treating a wide range of diseases by targeting specific pathways in cells or symptoms of the patient. However, their limitations include off-target effects, lack of personalization, and challenges in addressing complex, multifactorial conditions like chronic inflammation and metabolic disorders.

[0002] An example of such therapeutics includes traditional probiotics used, for example, to treat gut dysbiosis and other gastrointestinal disorders or conditions. Gut dysbiosis refers to an imbalance in the composition or function of the gut microbiota. It is often linked to a range of health issues, including inflammatory bowel disease (IBD), irritable bowel syndrome (IBS), obesity, metabolic disorders, and infections. Probiotics have long been explored as a therapeutic approach to restore a balance of the gut microbiota to address dysbiosis. Traditional probiotic therapies typically employ live microorganisms, often derived from naturally occurring gut commensals or fermented foods, that demonstratedefficacy in reducing symptoms of gut-related diseases when administered in adequate amounts, albeit with limitations in colonization efficiency and specific targeting. These probiotics primarily manage symptoms of gut dysbiosis by restoring microbial diversity immune modulation, including inducing regulatory T cells, enhancing mucosal immunity, reducing inflammation, enhancing gut barrier function, and producing metabolites to maintain a healthy gut environment. However, traditional probiotics face several challenges, such as off-target effects, and can only address simple factor conditions that result in limited survivability of the probiotics in the gastrointestinal tract, e.g., due to stomach acid and bile salts and difficulty in colonizing the gut or sustainability of their effects after treatment.Further, the microorganism strain- specific effects lack personalization and do not address all aspects of dysbiosis. The efficacy of the traditional probiotics is inconsistent across individuals due to differences in baseline microbiota composition.

[0003] What is needed are improved therapeutics, including probiotic compositions, methods and systems, and other therapeutics designed to address the limitations of traditional strains.SUMMARY

[0005] An exemplary programmable drug-delivery platform, method of use, fabrications, and delivery are disclosed that combine decision-making, intercellular communication, and the equivalent of memory in an engineered chassis cell (referred to as Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)) that can facilitate discrete, precise and multi-input regulation of recombinase functions. These recombinases can facilitate targeted and inheritable DNA modifications, including inversions, deletions, and insertions containing functional genomic elements - e.g., reading frames, promoters, terminators, or replication origins. The exemplary MEMORY cells can achieve programmable and permanent changes (i.e., gain or loss) of functions either extrachromosomally or at a specific genomic locus without the loss or modification of the MEMORY platform.

[0006] The retention of the exemplary chassis cell platform facilitates the sequential programming and reprogramming of DNA circuits harbored within a given chassis cell, enabling dynamic modifications as needed. The exemplary chassis cells are designed to embody all three core principles of biological intelligence: cellular decision-making, which allows cells to process inputs and make logical choices; inheritable memory, which ensuresthat genetic changes are inheritable and passed to progeny; and cell-to-cell communication, which enables coordinated interactions among cells including cell signaling. These features position MEMORY cells as a powerful tool for advancing synthetic biology and bioengineering applications.

[0007] Synthetic biologists have made significant advancements in developing technologies that mimic essential features of biological systems, such as decision-making, intercellular communication, and the equivalent of memory, within various types of cells. However, translating these innovations into practical applications for therapeutics presents numerous challenges. These challenges arise from the inherent complexity of cellular networks and the difficulty of designing engineered systems that can process multiple signals without causing unintended interactions or crosstalk. Additionally, therapeutic systems need to meet stringent requirements such as stability, persistence, reversibility, safety, and adaptability, while the lack of reliable predictive models further complicates their development and implementation in therapeutics.

[0008] A study was conducted to engineer an exemplary embodiment of the chassis cells as engineered Escherichia coli strains to harbor a genome-integrated array of six orthogonal inducible recombinases - forming the Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY). This study also developed a probiotic MEMORY strain capable of programmable information exchange between Nissle 1917 and the gastrointestinal commensal Bacteroides thetaiotaomicron. Accordingly, disclosed herein are programmable drug-delivery compositions and the methods of use thereof in preventing or treating gut microbiota dysbiosis.

[0009] In one aspect, disclosed herein, is a programmable drug-delivery system comprising a chassis cell, wherein the chassis cell (e.g., a Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)) comprises an inducible promoter, a modified ribosome-binding site (RBS), one or more genes expressing one or more orthogonal inducible recombinase(s), one or more transcription factor(s), wherein the one or more transcription factor(s) regulate the one or more orthogonal inducible recombinase(s) expression, one or more degradation tag(s), a variable start codon; and a terminator, wherein the terminator provides transcriptional insulation. In some embodiments, the chassis cell is engineered to produce an orthogonal inducible recombinase. In some embodiments, the chassis cell facilitates discrete multi-input regulation of recombinase function to alter extrachromosomal nucleic acid, wherein chromosomal nucleic acid of the chassis cell is not altered.

[0010] In some embodiments, the programmable drug-delivery system further comprises a drug. In some embodiments, the chassis cell is a non-colonizing bacterium (such as, for example, Escherichia coli).

[0011] In some embodiments, the inducible promoter is selected from a group consisting of PLacIR, PPhlF, PCymRC, Pvan, PLuxB, cH OsymC*, dH OsymC*, fH OsymC*, bH OttaC*, cG OttaC*, pPhl, pBAD, pTet, and PvanBT.

[0012] In some embodiments, the modified RBS is selected from a group consisting of phl3, cym2, lux2, van3, lac2, tet2, ara2, el, Al, BX, 13, 15, 18, and 112. In some embodiments, the one or more orthogonal inducible recombinase(s) is selected from a group consisting of Al 18, Bxbl, Int3, Int5, Int8, and Intl2. In some embodiments, Al 18 comprises at least 70% of SEQ ID NO: 73. In some embodiments, Al 18 comprises SEQ ID NO: 73. In some embodiments, Bxbl comprises at least 70% of SEQ ID NO: 74. In some embodiments, Bxbl comprises SEQ ID NO: 74. In some embodiments, Int3 comprises at least 70% of SEQ ID NO: 75. In some embodiments, Int3 comprises SEQ ID NO: 75. In some embodiments, Int5 comprises at least 70% of SEQ ID NO: 76. In some embodiments, Int5 comprises SEQ ID NO: 76. In some embodiments, Int8 comprises at least 70% of SEQ ID NO: 77. In some embodiments, Int8 comprises SEQ ID NO: 77. In some embodiments, Intl2 comprises at least 70% of SEQ ID NO: 78. In some embodiments, Intl2 comprises SEQ ID NO: 78.

[0013] In some embodiments, the one or more orthogonal inducible recombinase(s) is induced by an inducer. In some embodiments, the inducer is selected from a group consisting of 2,4-Diacetylphloroglucinol (DAPG), aTc, L-Ara, cuminic acid, vanillic acid, Isopropyl [3- D-l -thiogalactopyranoside (IPTG), and 3OC6 Ahl. In some embodiments, the chassis cell comprises 1, 2, 3, 4, 5, 6 orthogonal inducible recombinases or a combination thereof. In some embodiments, the one or more transcription factor(s) is selected from a group consisting of PhlF, TetR, AraC, CymR, VanR, Lad, AraE, CelR (TAN), RbsR, and LuxR. In some embodiments, the one or more degradation tag(s) is selected from a group consisting of DAS tag, AAV tag, and LAA tag. In some embodiments, the terminator is selected from a group consisting of L3S1P11, L3S1P13, L3S2P21, L3S2P55, L3S3P00, L3S3P21, L3S3P22, L3S3P23, L3S3P41, ECK120010799, ECK120010818, ECK120010858-R, ECK120015170, ECK120015440, ECK120017009, ECK120033736, ECK120035133, rrnB Tl, BBa_B0014, BBa_B0053, BBa_B0062-R, BBa_B1006, and IOT. In some embodiments, the system is configured as a gain-of-function (GOF) memory circuit for both inversion and excision attachment site configuration. In some embodiments, the system is configured as a loss-of- function (LOF) memory circuit for both inversion and excision attachment site configuration.In some embodiments, a catalytically inactive Cas9 (dCas9) is employed to a recombinase attachment site to prevent recombination with high (-99%) efficiency.

[0014] In some embodiments, extrachromosomal nucleic acid alteration comprises deletion, insertion, or inversion. In some embodiments, the insertion is a genomic insertion. In some embodiments, the genomic insertion is a functional element. In some embodiments, the functional element comprises a reading frame shift, a promoter, a terminator, or a replication origin.

[0015] In one aspect, disclosed herein is a synthetic probiotic composition comprising a programmable drug-delivery system and a pharmaceutically acceptable carrier, wherein the programmable drug-delivery system comprising a chassis cell, wherein the chassis cell (e.g., a Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)) comprises, an inducible promoter, a modified ribosome-binding site (RBS), one or more genes expressing one or more orthogonal inducible recombinase(s), one or more transcription factor(s), wherein the one or more transcription factor(s) regulate the one or more orthogonal inducible recombinase(s) expression, one or more degradation tag(s), a variable start codon; and a terminator, wherein the terminator provides transcriptional insulation. In some embodiments, the chassis cell is engineered to produce an orthogonal inducible recombinase. In some embodiments, the chassis cell facilitates discrete multi-input regulation of recombinase function to alter extrachromosomal nucleic acid, wherein chromosomal nucleic acid of the chassis cell is not altered.

[0016] In some embodiments, the synthetic probiotic composition further comprises a drug. In some embodiments, the chassis cell is a non-colonizing bacterium (such as, for example, Escherichia coli).

[0017] In some embodiments, the inducible promoter is selected from a group consisting of PLacIR, PPhlF, PCymRC, Pvan, PLuxB, cH OsymC*, dH OsymC*, fH OsymC*, bH OttaC*, cG OttaC*, pPhl, pBAD, pTet, and PvanBT.

[0018] In some embodiments, the modified RBS is selected from a group consisting of phl3, cym2, lux2, van3, lac2, tet2, ara2, el, Al, BX, 13, 15, 18, and 112. In some embodiments, the one or more orthogonal inducible recombinase(s) is selected from a group consisting of Al 18, Bxbl, Int3, Int5, Int8, and Intl2. In some embodiments, Al 18 comprises at least 70% of SEQ ID NO: 73. In some embodiments, Al 18 comprises SEQ ID NO: 73. In some embodiments, Bxbl comprises at least 70% of SEQ ID NO: 74. In some embodiments, Bxbl comprises SEQ ID NO: 74. In some embodiments, Int3 comprises at least 70% of SEQ ID NO: 75. In some embodiments, Int3 comprises SEQ ID NO: 75. In some embodiments,Int5 comprises at least 70% of SEQ ID NO: 76. In some embodiments, Int5 comprises SEQ ID NO: 76. In some embodiments, Int8 comprises at least 70% of SEQ ID NO: 77. In some embodiments, Int8 comprises SEQ ID NO: 77. In some embodiments, Intl2 comprises at least 70% of SEQ ID NO: 78. In some embodiments, Intl2 comprises SEQ ID NO: 78.

[0019] In some embodiments, the one or more orthogonal inducible recombinase(s) is induced by an inducer. In some embodiments, the inducer is selected from a group consisting of 2,4-Diacetylphloroglucinol (DAPG), aTc, L-Ara, cuminic acid, vanillic acid, Isopropyl [3- D-l -thiogalactopyranoside (IPTG), and 3OC6 Ahl. In some embodiments, the chassis cell comprises 1, 2, 3, 4, 5, 6 orthogonal inducible recombinases or a combination thereof. In some embodiments, the one or more transcription factor(s) is selected from a group consisting of PhlF, TetR, AraC, CymR, VanR, Lad, AraE, CelR (TAN), RbsR, and LuxR. In some embodiments, the one or more degradation tag(s) is selected from a group consisting of DAS tag, AAV tag, and LAA tag. In some embodiments, the terminator is selected from a group consisting of L3S1P11, L3S1P13, L3S2P21, L3S2P55, L3S3P00, L3S3P21, L3S3P22, L3S3P23, L3S3P41, ECK120010799, ECK120010818, ECK120010858-R, ECK120015170, ECK120015440, ECK120017009, ECK120033736, ECK120035133, rrnB Tl, BBa_B0014, BBa_B0053, BBa_B0062-R, BBa_B1006, and IOT. In some embodiments, the system is configured as a gain-of-function (GOF) memory circuit for both inversion and excision attachment site configuration. In some embodiments, the system is configured as a loss-of- function (LOF) memory circuit for both inversion and excision attachment site configuration. In some embodiments, a catalytically inactive Cas9 (dCas9) is employed to a recombinase attachment site to prevent recombination with high (-99%) efficiency.

[0020] In some embodiments, extrachromosomal nucleic acid alteration comprises deletion, insertion, or inversion. In some embodiments, the insertion is a genomic insertion. In some embodiments, the genomic insertion is a functional element. In some embodiments, the functional element comprises a reading frame shift, a promoter, a terminator, or a replication origin.

[0021] In some embodiments, the chassis cell exchanges information with a stably colonizing species, wherein the stably colonizing species is found in the gut of a subject. In some embodiments, the stably colonizing species is Bacteroides thetaiotaomicron.

[0022] In one aspect disclosed herein is a method of preventing or treating gut microbiota dysbiosis in a subject in need thereof, the method comprising administering a therapeutically effective amount of a synthetic probiotic composition comprising a programmable drug-delivery system and a pharmaceutically acceptable carrier, wherein theprogrammable drug-delivery system comprising a chassis cell, wherein the chassis cell (e.g., a Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)) comprises, an inducible promoter, a modified ribosome-binding site (RBS), one or more genes expressing one or more orthogonal inducible recombinase(s), one or more transcription factor(s), wherein the one or more transcription factor(s) regulate the one or more orthogonal inducible recombinase(s) expression, one or more degradation tag(s), a variable start codon; and a terminator, wherein the terminator provides transcriptional insulation. In some embodiments, the chassis cell is engineered to produce an orthogonal inducible recombinase. In some embodiments, the chassis cell facilitates discrete multi-input regulation of recombinase function to alter extrachromosomal nucleic acid, wherein chromosomal nucleic acid of the chassis cell is not altered.

[0023] In some embodiments, the method further comprises a drug. In some embodiments, the chassis cell is a non-colonizing bacterium (such as, for example, Escherichia coli).

[0024] In some embodiments, the inducible promoter is selected from a group consisting of PLacIR, PPhlF, PCymRC, Pvan, PLuxB, cH OsymC*, dH OsymC*, fH OsymC*, bH OttaC*, cG OttaC*, pPhl, pBAD, pTet, and PvanBT.

[0025] In some embodiments, the modified RBS is selected from a group consisting of phl3, cym2, lux2, van3, lac2, tet2, ara2, el, Al, BX, 13, 15, 18, and 112. In some embodiments, the one or more orthogonal inducible recombinase(s) is selected from a group consisting of Al 18, Bxbl, Int3, Int5, Int8, and Intl2. In some embodiments, Al 18 comprises at least 70% of SEQ ID NO: 73. In some embodiments, Al 18 comprises SEQ ID NO: 73. In some embodiments, Bxbl comprises at least 70% of SEQ ID NO: 74. In some embodiments, Bxbl comprises SEQ ID NO: 74. In some embodiments, Int3 comprises at least 70% of SEQ ID NO: 75. In some embodiments, Int3 comprises SEQ ID NO: 75. In some embodiments, Int5 comprises at least 70% of SEQ ID NO: 76. In some embodiments, Int5 comprises SEQ ID NO: 76. In some embodiments, Int8 comprises at least 70% of SEQ ID NO: 77. In some embodiments, Int8 comprises SEQ ID NO: 77. In some embodiments, Intl2 comprises at least 70% of SEQ ID NO: 78. In some embodiments, Intl2 comprises SEQ ID NO: 78.

[0026] In some embodiments, the one or more orthogonal inducible recombinase(s) is induced by an inducer. In some embodiments, the inducer is selected from a group consisting of 2,4-Diacetylphloroglucinol (DAPG), aTc, L-Ara, cuminic acid, vanillic acid, Isopropyl [3- D-l -thiogalactopyranoside (IPTG), and 3OC6 Ahl. In some embodiments, the chassis cell comprises 1, 2, 3, 4, 5, 6 orthogonal inducible recombinases or a combination thereof. Insome embodiments, the one or more transcription factor(s) is selected from a group consisting of PhlF, TetR, AraC, CymR, VanR, Lad, AraE, CelR (TAN), RbsR, and LuxR. In some embodiments, the one or more degradation tag(s) is selected from a group consisting of DAS tag, AAV tag, and LAA tag. In some embodiments, the terminator is selected from a group consisting of L3S1P11, L3S1P13, L3S2P21, L3S2P55, L3S3P00, L3S3P21, L3S3P22, L3S3P23, L3S3P41, ECK120010799, ECK120010818, ECK120010858-R, ECK120015170, ECK120015440, ECK120017009, ECK120033736, ECK120035133, rrnB Tl, BBa_B0014, BBa_B0053, BBa_B0062-R, BBa_B1006, and IOT. In some embodiments, the system is configured as a gain-of-function (GOF) memory circuit for both inversion and excision attachment site configuration. In some embodiments, the system is configured as a loss-of- function (LOF) memory circuit for both inversion and excision attachment site configuration. In some embodiments, a catalytically inactive Cas9 (dCas9) is employed as a recombinase attachment site to prevent recombination with high (-99%) efficiency.

[0027] In some embodiments, extrachromosomal nucleic acid alteration comprises deletion, insertion, or inversion. In some embodiments, the insertion is a genomic insertion. In some embodiments, the genomic insertion is a functional element. In some embodiments, the functional element comprises a reading frame shift, a promoter, a terminator, or a replication origin.

[0028] In some embodiments, the chassis cell exchanges information with a stably colonizing species, wherein the stably colonizing species is found in the gut of a subject. In some embodiments, the stably colonizing species is Bacteroides thetaiotaomicron. In some embodiments, the synthetic probiotic composition is administered to the subject orally. In some embodiments, the synthetic probiotic composition is administered to the subject daily or multiple times a day. In some embodiments, the synthetic probiotic composition is administered to the subject weekly, monthly, or only once. In some embodiments, the synthetic probiotic composition is administered to the subject daily for at least 1, 2, 3, 4, 5, 6,7, or 8 weeks. In some embodiments, the subject is a human.BRIEF DESCRIPTION OF FIGURES

[0029] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below.

[0030] Figures 1A, IB, and 1C show components of an intelligent biological system. Figure 1A shows the concept of decision-making illustrated on the left. Transient state changes are achieved by controlling gene expression with transcription factor-based genecircuits to achieve Boolean logic (middle, right). Figure IB shows the concept of synthetic memory illustrated on the left. Permanent state changes are achieved through the manipulation of genetic components at the DNA level. Transiently expressed recombinases facilitate gain-of-function (middle) or loss-of-function (right) via genetic circuits. Figure 1C shows the concept of communication illustrated on the left. Information transfer is achieved through inducible small-molecule production and subsequent sensing by sender and receiver cells, respectively (right).

[0031] Figures 2A, 2B, 2C, 2D, and 2E demonstrate the engineering of the MEMORY platform. Figure 2A shows the variables involved in library generation for recombinase expression levels. Libraries contain randomized combinations of an inducible promoter, a modified RBS sequence, a variable start codon, and a C-terminal degradation tag. Each recombinase library is co-transformed with a reporter plasmid containing an inverted promoter upstream of green fluorescent protein (GFP). Individual transformants were screened for low levels of recombination (uninduced) and high levels of recombination (induced). Figure 2B shows the performances of isolated optimized clones from a. % GFP ON denotes the percentage of cells expressing GFP as measured by flow cytometry (See Methods). Figure 2C shows the complete genetic schematic of the recombinase expression system. The transcription factors are those reported in [9] unaltered. The recombinases are inserted directly downstream of the ECK 120017009 terminator. Full sequences of parts are given in Table 2. The full sequence of the recombinase expression cluster is given in Table 2. Figure 2D shows a map of ligand input to unique recombinase output via transcription factor- regulated expression for EcMem. Figure 2E shows the orthogonality between the six recombinases. The EcMem strain transformed with each of the six inversion GOF circuits is assayed with all single inducers. The heatmap shows the percentage of cells with the reporter circuit recombined. Source data are provided as a Source Data file. Data in Figures 2B and 2E represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars in Figure 2B correspond to the SEM of these measurements.

[0032] Figures 3A, 3B, 3C, 3D, 3E, and 3F show the characterization of the MEMORY platform. Figure 3 A shows the kinetics of recombinase activity. The time required for recombination is shown for the EcMem strain transformed with each of the six inversion GOF circuits (circles) and each of the six excision GOF circuits (squares). Figure 3B shows the inversion GOF circuit architecture (left) along with the performance of 6 unique circuits corresponding to the 6 recombinases (right). Figure 3C shows the inversion LOF circuit architecture (left) along with the performance of 6 unique circuits correspondingto the 6 recombinases (right). Figure 3D shows the excision GOF circuit architecture (left) along with the performance of 6 unique circuits corresponding to the 6 recombinases (right). Figure 3E shows the excision LOF circuit architecture (left) along with the performance of 6 unique circuits corresponding to the 6 recombinases (right). Figure 3F shows the genetic stability of the MEMORY platform. The EcMem strain transformed with each of the six inversion GOF circuits is cultured continuously for 11 days. Every other day, the cultures are used to seed media with inducers to assess for maintenance of recombinase functionality. Open circles represent no inducer, and filled circles represent induced cultures. A single biological time-course is shown. See Methods for additional information and Figure 13 for an additional biological replicate. Source data are provided as a Source Data file. Data in Figure 3(A-E) represents the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements. All data represent experiments performed using the EcMem strain.

[0033] Figures 4A, 4B, 4C, and 4D show a multi-input multi-output program with a cellular reset. Figure 4A shows a four-state program (left). The Int8 excision GOF circuit controls the activation of GFP, the Bxbl inversion GOF circuit controls the activation of a red fluorescent protein (mKate), and Int3 controls the excision of the pSClOl origin of replication. The distribution of cells in the four possible states of fluorescent protein expression after growth in a medium without inducers is shown in the middle bar graph. The recombinases involved in the program are highlighted in EcMem (right). Figure 4B shows the program behavior when Int8 is induced (top), Bxbl is induced (middle), or when both recombinases are induced (bottom). The percentages of fluorescent cells are shown to the right of each circled DNA arrangement. After initial program activation, cells were grown with L-arabinose to induce excision of the plasmid origin and resetting of cellular genotype (right bar graphs). Figure 4C shows testing of the origin erasure fidelity. A schematic of erasing the program from Figure 4A and implementing a new program (the Int5 GOF circuit) is shown. Figure 4D shows the fidelity of the cellular reset. Reset cells from the “GFP + mKate” state in Figure 4B were made chemically competent and transformed with the Int5 inversion GOF circuit. The distributions of cells in each expression state are shown when induced with cuminic acid, vanillic acid, and aTc to demonstrate consistent strain performance with a new program, as well as loss of the previous program. Source data are provided as a Source Data file. For Figure 4(A-B), data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. For Figure 4D, data represent the average of n = 3 biological replicates from a single experiment. Error barscorrespond to the SEM of these measurements. All data represent experiments performed using the EcMem strain.

[0034] Figures 5A, 5B, 5C, 5D, 5E, 5F, 5G, 5H, 51, and 5J show MEMORY recording through genomic integration. Figure 5A shows the first genomic safe harbor (aGSHl) recording circuit (left) and payload 1 (right). Figure 5B shows the percentage of cells expressing GFP prior to recombinase induction. Figure 5C shows the recombined genomic DNA (left) and plasmid DNA (middle) states after induction of Bxbl and Int8, followed by Int3 induction to erase the plasmids (right). Figure 5D shows the percentage of cells expressing GFP after recombinase induction, representing the percentage of integration. Figure 5E shows the new genomic sequence and aGSH2 (left) with payload 2 (right). Figure 5F shows the percentage of cells expressing GFP and mKate prior to recombinase induction. Figure 5G shows the recombined genomic DNA (left) and plasmid DNA (middle) states after induction of Int5 and Intl2, followed by Int3 induction (right). Figure 5H shows the percentage of cells expressing GFP and mKate after recombinase induction. Figure 51 shows representative colony PCR products from cells in Figure 5C. Primers are denoted by halffilled arrows. Figure 5J shows representative colony PCR products from cells in Figure 5G. Source data are provided as a Source Data file. Data in Figures 5B, 5D, 5F, and 5H represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0035] Figures 6A, 6B, 6C, 6D, 6E, and 6F show the development of CRISPRp. Figure 6A shows a representative CRISPRp program. Fad regulates sgRNA production, while dCas9 is constitutively expressed from the BAC. In the case of no IPTG present in the medium, the recombinase can recombine its target normally when induced. With IPTG in the medium, the sgRNA is produced and directs dCas9 to bind to an att site, preventing the recombinase from performing its catalysis. Figure 6B shows a representative schematic of an att site with key features (left), along with a detailed schematic of the putative CRISPRp binding mechanisms (right). Figure 6C shows an illustration of synthetic PAM addition to the inversion GOF circuit. The positions P1-P4 were assigned based on 5’-3’ directionality, not based on specific attB / attP sites. An illustration of the specific strand targeted by each synthetic PAM site is shown to the right. Figure 6D shows examples of CRISPRp applied to different recombinases. Marionette-Wild cells transformed with the program described in Figure 6A were assayed for recombination with cognate inducer as well as in the presence of IPTG. The specific sgRNA target is shown below each bar graph. Figure 6E shows a schematic of EcMem with expanded memory capacity. Figure 6F shows CRISPRp applied toInt8 with sgRNA regulation by RbsR (left) or CelR (right). Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0036] Figures 7A, 7B, 7C, and 7D show next-generation recombinase-based state machines. Figure 7A shows a 3-input RSM with 9 possible states based on CRISPRp (left). The same RSM is shown without CRISPRp capability (right). Figure 7B shows the RSM from Figure 7A as a genetic program. The correct induction pattern (Int8, then Bxbl, then Int3) is required to deprotect and unlock the gfp output gene. The EcMem strain transformed with the program was sequentially induced with each relevant inducer in all possible permutations. State transitions are shown by connecting arrows, and the state number is shown on the top left of each circled DNA arrangement. The percentage of cells expressing GFP is shown as a pie chart for each program state. Figure 7C shows detailed state transitions for Figure 7B. A ’ indicates a synonymous state achieved by a different induction sequence. Figure 7D shows data from Figure 7B as bar charts representing recombination percentages. Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars in d correspond to the SEM of these measurements.

[0037] Figures 8A, 8B, 8C, 8D, 8E, 8F, 8G, 8H, 81, 8J, and 8K show intercellular communication for programmed information exchange. Figure 8A shows a representative autoinduction program. Figure 8B shows a map of cognate interactions for a synthase pathway to activate a given recombinase. Figure 8C shows the performance of the Al 18 autoinduction program for EcMem. Figure 8D shows the performance of the Intl2 autoinduction program for EcMem. Figure 8E shows the performance of the Int8 autoinduction program for EcMem. Figure 8F shows a representative intercellular communication program (top) with a conceptual illustration (bottom). Figure 8G shows the performance of the Al 18 intercellular communication program for EcMem. Figure 8H shows the performance of the Intl2 intercellular communication program for EcMem. Figure 81 shows the performance of the Int8 intercellular communication program for EcMem. Figure 8J shows a cross-species communication program (top, bottom right) with a conceptual illustration (bottom left). EcMemproharbors an autoinduction program that controls the biosynthesis of vanillic acid, while B. thetaiotaomicron harbors a vanillic acid-responsive circuit that controls the production of Nanoluc. Figure 8K shows the luminescence of the EcMemproand B. thetaiotaomicron co-culture from Figure 8 J for different ligand conditions. P values are based on unpaired two-tailed t-tests with Welch’s correction; **P < 0.01; ***P< 0.001. Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0038] Figures 9A, 9B, 9C, and 9D show the performance of BAC -based recombinase circuits in Marionette-Wild. Figure 9A shows the performances of the inversion GOF circuits when the individual recombinases are harbored on the BAC. Figure 9B shows the performances of the inversion LOF circuits when the individual recombinases are harbored on the BAC. Figure 9C shows the performances of the excision GOF circuits when the individual recombinases are harbored on the BAC. Figure 9D shows the performances of the excision LOF circuits when the individual recombinases are harbored on the BAC. All data represent experiments performed using Marionette-Wild. Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0039] Figure 10 shows a cryptic promoter identified in the Intl2 sequence. Key sequence features of the Intl2 cryptic promoter are shown. The boxed sequence is an antisense promoter containing only a 3 bp mismatch with the consensus sigma 70 promoter sequence.

[0040] Figures 11A and 1 IB show orthogonality between Al 18 and Intl2. Figure 11 A shows that PhlF is not induced by 3OC6 AHL. Marionette-Wild was transformed with the Al 18-harboring BAC and Al 18 inversion GOF plasmid and grown in the presence and the absence of 3OC6 AHL. Figure 1 IB shows that Intl2 does not recombine Al 18 att sites. Marionette-Wild was transformed with the Intl2-harboring BAC and Al 18 inversion GOF plasmid and grown in the presence and absence of 3OC6 AHL. Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0041] Figures 12A, 12B, 12C, and 12D show GFP fluorescence in 24 recombinase circuits. Figure 12A shows the FITC-H values for the inversion GOF circuits. Figure 12B shows the FITC-H values for the inversion LOF circuits. Figure 12C shows the FITC-H values for the excision GOF circuits. Figure 12D shows the FITC-H values for the excision LOF circuits. The dashed line represents the autofluorescence of wild-type E. coli harboring no plasmids. The FITC-H values in Figure 12(A-D) correspond to the population data presented in Figure 3(B-E). Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0042] Figure 13 shows additional data related to the genetic stability of EcMem. Data from a second evolutionary trajectory are shown from the experiment presented in Figure 3F. The EcMem strain transformed with each of the six inversion GOF circuits is cultured continuously for 11 days. Every other day, the cultures are used to seed media with inducers to assess for maintenance of recombinase functionality. Open circles represent no inducer, and filled circles represent induced cultures.

[0043] Figure 14 shows the cellular burden of recombinase expression. Growth curves of EcMem in minimal media during specific recombinase expression are shown. Each graph shows the growth curve for the EcMem without inducers (circles), with all inducers (small squares), and with the specific inducer of the indicated recombinase (large squares). Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0044] Figures 15A, 15B, and 15C show Al 18 excision gain-of-function with cellular reset. Figure 15A shows the Al 18 excision GOF circuit with the Int3 origin excision (left). The percentage of recombined cells after growth in MM without inducer is shown (middle) along with an input-output table for this program (right). Figure 15B shows the recombined circuit after Al 18 induction (left). The percentage of recombined cells after growth in MM with 2,4-Diacetylphloroglucinol (DAPG) is shown (middle). Cells were then grown with L- ara to induce Int3 expression and origin excision (right). Figure 15C shows the efficiency of the cellular reset. Reset cells from Figure 15B were serially diluted and plated on LB agar with and without kanamycin to assess for pSClOl plasmid loss. Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0045] Figures 16A, 16B, 16C, and 16D show extended data related to Figure 4. Figure 16A shows a recreated Figure 4A with flow cytometry dot plots. Figure 16B shows a recreated Figure 4B with flow cytometry dot plots. Figure 16C shows a recreated Figure 4D with flow cytometry dot plots. FITC-H is shown on the X-axis, representing GFP expression, and ECD-H is shown on the Y-axis, representing mKate expression. A single representative dot plot is shown for each case. Figure 16D shows the efficiency of the cellular reset. Reset cells from the “GFP + mKate” state in Figure 16B were serially diluted and plated on LB agar with and without kanamycin before and after Int3 induction to assess for pSClOl plasmid loss. Resultant colonies were counted, and colony-forming units (CFU) were determined. Source data are provided as a Source Data file. Data in Figure 16D represent the average of n = 6biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0046] Figures 17A, 17B, 17C, 17D, 17E, 17F, 17G, 17H, 171, 17J, 17K, and 17L show data related to inducible integration. Figure 17A shows the first genomic safe harbor (aGSHl) recording site (left) and the memory sequence (right). Figure 17B shows the percentage of cells expressing GFP prior to recombinase induction. Figure 17C shows the recombined genomic DNA (left) and plasmid DNA (middle) states after induction of Bxbl and Int8, followed by Int3 induction to erase the plasmids (right). Figure 17D shows the percentage of cells expressing GFP after recombinase induction, representing the percentage of integration. Figure 17E shows the new genomic sequence and aGSH2 (left) with the second memory sequence (right). Figure 17F shows the percentage of cells expressing GFP and mKate prior to recombinase induction. Figure 17G shows the recombined genomic DNA (left) and plasmid DNA (middle) states after induction of Int5 and Intl2, followed by Int3 induction (right). Figure 17H shows the percentage of cells expressing GFP and mKate after recombinase induction. Figure 171 shows representative colony PCR products of 8 colonies from Figure 17C. Primers are denoted by half-filled arrows. Figure 17J shows representative colony PCR products of 8 colonies from Figure 17G. Figure 17K shows representative colony PCR products of 8 colonies from Figure 5C. Figure 17E shows representative colony PCR products of 8 colonies from Figure 5G. Source data are provided as a Source Data file. Data in Figures 5B, 5D, 5F, and 5H represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0047] Figure 18 shows additional demonstrations of CRISPR protection. Figure 18A shows additional examples of successful CRISPR protection are shown. Cells transformed with the circuit described in Figure 6A were assayed for recombination performance with cognate inducer as well as in the presence of IPTG. The specific sgRNA target is shown below each bar graph. Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0048] Figures 19A and 19B show that dCas9 affects PhlF- and Al 18-based circuits. Figure 19A shows the circuit described in Figure 6A tested with Al 18. The top bar graphs show circuit performance when dCas9 is constitutively expressed from the BAC, while the bottom bar graphs show circuit performance when dCas9 is controlled by an IPTG-inducible promoter (Psym). Figure 19B shows the genetic context for recombinase and dCas9expression next to the appropriate bar graphs. Circuits were assayed in the EcMem strain. Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0049] Figures 20A, 20B, and 20C show controlling CRISPRp with additional transcription factors. Figure 20A shows CRISPRp programs using transcription factors harbored on a pl5a plasmid. RbsR or CelR regulates sgRNA production from the Ptta promoter of varying strengths (bH for RbsR and cG for CelR; see Tables 1 and 2 for details). Figure 20B shows the performance of RbsR-controlled CRISPRp. Figure 20C shows the performance of CelR-controlled CRISPRp. Circuits were assayed in the EcMem strain. Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0050] Figures 21A, 21B, and 21C show the expansion of memory capacity using CRISPRp. Figure 21 A demonstrates that given one set of att sites to recombine, a single recombinase allows for n = 2 distinct DNA states. Figure 21B demonstrates that given two sets of att sites to recombine (with orthogonal dinucleotide cores), a single recombinase still only allows for n = 2 distinct DNA states (assuming complete recombination). Figure 21C demonstrates that given the same two sets of att sites as in b, along with the ability to apply CRISPRp to att sites independently, a single recombinase now allows for n = 4 distinct DNA states. If three sets of att sites are used, a single recombinase can produce n = 9 distinct DNA states. In theory, for n sets of orthogonal att sites, there are n2possible distinct DNA states.

[0051] Figures 22A and 22B show the next-generation RSM design. Figure 22A shows a typical 2-input RSM designed by Roquet el al. (left). The expanded RSM state diagram is shown if CRISPRp is applied (right). “A” and “B” represent inputs for different recombinases. A ‘ indicates a unique recombination event due to the ability to selectively use CRISPRp. Figure 22B shows the genetic schematic for Figure 22A. Red arrows indicate recombination by recombinase 1, and blue arrows indicate recombination by recombinase 2. A grey lobe covering an at site denotes the programmed CRISPRp of that site. This RSM assumes that CRISPRp can be applied to any at site independently.

[0052] Figures 23A, 23B, 23C, 23D, 23E, 23F, 23G, and 23H show performance of recombinase circuits in EcMemPro. Figure 23A shows the performances of the inversion GOF circuits assayed aerobically in EcMemPro. Figure 23B shows the performances of the inversion EOF circuits assayed aerobically in EcMemPro. Figure 23C shows the performancesof the excision GOF circuits assayed aerobically in EcMcmPro. Figure 23D shows the performances of the excision LOF circuits assayed aerobically in EcMemPro. Figure 23E shows the performances of the inversion GOF circuits assayed anaerobically in EcMemPro. Figure 23F shows the performances of the inversion LOF circuits assayed anaerobically in EcMcmPro. Figure 23G shows the performances of the excision GOF circuits assayed anaerobically in EcMemPro. Figure 23H shows the performances of the excision LOF circuits assayed anaerobically in EcMemPro. Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Aerobic circuits were assayed in M9 minimal medium. Anaerobic circuits were assayed in TYG broth (see Methods).

[0053] Figure 24 shows VanR regulation of Nanoluc in B. thetaiotaomicron. The performance of the VanR biosensor is shown. B. thetaiotaomicron was grown in TYG broth with and without van. acid and assayed for luminescence (Methods). Source data are provided as a Source Data file. Data represent the average of n = 6 biological replicates, with groups of three taken on two separate days. Error bars correspond to the SEM of these measurements.

[0054] Figure 25 shows an example gating strategy for flow cytometry. Representative gates used in flow cytometry analysis are shown. Cells were first gated by side scatter area vs. forward scatter area (left). This population was then gated by side scatter height vs. side scatter area to discriminate single cells (middle). In this example, cells with a FITC-H value greater than 3E3 were deemed GFP -positive while cells with a lower FITC-H value were deemed GFP-negative.

[0055] Figures 26A, 26B, 26C, and 26D show representative flow cytometry data for 24 recombinase circuits. A representative flow cytometry plot is provided for each of the 24 recombinase circuits. The uninduced and induced states are shown on the same plot with an arrow denoting the transition of the populations upon induction. The y-axis is the cell count and the x-axis is the GFP intensity (FITC- H).

[0056] Figure 27 shows relevant plasmid maps used in this study. Maps correspond to descriptions in Table 1.DETAILED DESCRIPTION

[0057] To facilitate an understanding of the principles and features of various embodiments of the present invention, they are explained hereinafter with reference to their implementation in illustrative embodiments.

[0058] Terminology

[0059] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of’ and “consisting of’ can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this disclosure and in the appended claims, the singular forms “a”, “an”, “the”, include plural referents unless the context clearly dictates otherwise.

[0060] The following definitions are provided for the full understanding of terms used in this specification.

[0061] The terms "about" and "approximately" are defined as being “close to” as understood by one of ordinary skill in the art. In one non-limiting embodiment the terms are defined to be within 10%. In another non-limiting embodiment, the terms are defined to be within 5%. In still another non-limiting embodiment, the terms are defined to be within 1%.

[0062] As used herein, the terms "may," "optionally," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient.

[0063] “Composition” refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, a vector, polynucleotide, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “composition” is used, then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0064] "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of' when used todefine compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of' shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and / or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure.

[0065] An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition, or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100%, or more, increase so long as the increase is statistically significant.

[0066] A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant.

[0067] "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels.

[0068] By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic. It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to.

[0069] By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.

[0070] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.

[0071] A "promoter," as used herein, refers to a sequence in DNA that mediates the initiation of transcription by an RNApolymerase. Transcription promoters may comprise one ormore of a number of different sequence elements as follows: 1) sequence elements present at the site of transcription initiation; 2) sequence elements present upstream of the transcription initiation site and; 3) sequence elements downstream of the transcription initiation site. The individual sequence elements function as sites on the DNA, where RNA polymerases and transcription factors that facilitate positioning of RNA polymerases on the DNA bind.

[0072] A “transcription factor” refers to a sequence- specific DNA-binding protein that controls the rate of transcription of genetic information from DNA to messenger RNA, by binding to a specific DNA sequence.

[0073] As used herein, a “transcription terminator” or a “terminator” refers to a segment of a nucleic acid sequence that marks the end of gene in genomic DNA during the transcription process, or gene expression. This sequence mediates or signals the end of transcription by providing signaling nucleotides in newly synthesized RNA transcripts that trigger an RNA polymerase to release the DNA and newly synthesized RNA.

[0074] The word “vector” refers to any vehicle that carries a polynucleotide into a cell for the expression of the polynucleotide in the cell. The vector may be, for example, a plasmid, a virus, a phage particle, or a nanoparticle. A “bacterial plasmid” is a smallextrachromosomal DNA molecule that can be incorporated into another cell that is physically separated from the chromosomal DNA and is easily replicated. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may in some instances, integrate into the genome itself. In some embodiments, the vector is a DNA construct containing a DNA sequence which is operably linked to a suitable control sequence capable of effecting the expression of the DNA in a suitable host cell. Such control sequences can include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome binding sites, and sequences that control the termination of transcription and translation.

[0075] The term “administer,” “administering”, or derivatives thereof refer to delivering a composition, substance, inhibitor, or medication to a subject or object by one or more the following routes: oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation or via an implanted reservoir. The term “parenteral” includes subcutaneous, intravenous, intramuscular, intra- articular, intra- synovial, intrastemal, intrathecal, intrahepatic, intralesional, and intracranial injections or infusion techniques.

[0076] Generally, “host” refers to an organism or cell into which a heterologous component (polynucleotide, polypeptide, other molecule, cell) has been introduced. As used herein, a “host cell” refers to an in vivo or in vitro eukaryotic cell, prokaryotic cell (e.g., bacterial or archaeal cell), or cell from a multicellular organism (e.g., a cell line) cultured as a unicellular entity, into which a heterologous polynucleotide or polypeptide has been introduced. In some embodiments, the cell is selected from the group consisting of: an archaeal cell, a bacterial cell, a eukaryotic cell, a eukaryotic single-cell organism, a somatic cell, a germ cell, a stem cell, a plant cell, an algal cell, an animal cell, in invertebrate cell, a vertebrate cell, a fish cell, a frog cell, a bird cell, an insect cell, a mammalian cell, a pig cell, a cow cell, a goat cell, a sheep cell, a rodent cell, a rat cell, a mouse cell, a non-human primate cell, and a human cell. In some cases, the cell is in vitro. In some cases, the cell is in vivo.

[0077] An "effective amount" is an amount sufficient to affect beneficial or desired results. An effective amount can be administered in one or more administrations, applications or dosages.

[0078] “Effective amount” encompasses, without limitation, an amount that can ameliorate, reverse, mitigate, prevent, or diagnose a symptom or sign of a medical conditionor disorder (e.g., HIV-1 infection). Unless dictated otherwise, explicitly or by context, an “effective amount” is not limited to a minimal amount sufficient to ameliorate a condition. The severity of a disease or disorder, as well as the ability of a treatment to prevent, treat, or mitigate, the disease or disorder can be measured, without implying any limitation, by a biomarker or by a clinical parameter.

[0079] The term “microbiota” refers to the range of microorganisms that may be commensal, symbiotic, or pathogenic found in and on all multicellular organisms, including plants and animals. These include bacteria, archaea, protists, fungi, and viruses and have been found to be crucial for immunologic, hormonal, and metabolic homeostasis of the host.

[0080] As used herein, “monitoring” refers to the actions of observing and checking the progress or quality of a treatment or procedure over a period of time. Herein, “monitoring” refers to the actions of observing and checking for changes to the GI tract microbiome following administration of a cell comprising a construct to (re)program to transcriptional regulation of the microbiome.

[0081] A “nucleotide” is a compound consisting of a nucleoside, which consists of a nitrogenous base and a 5-carbon sugar, linked to a phosphate group forming the basic structural unit of nucleic acids, such as DNA or RNA. The four types of nucleotides are adenine (A), cytosine (C), guanine (G), and thymine (T), each of which are bound together by a phosphodiester bond to form a nucleic acid molecule.

[0082] A “nucleic acid” is a chemical compound that serves as the primary information-carrying molecules in cells and make up the cellular genetic material. Nucleic acids comprise nucleotides, which are the monomers made of a 5-carbon sugar (usually ribose or deoxyribose), a phosphate group, and a nitrogenous base. A nucleic acid can also be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA).

[0083] The terms “percent identity” and “% identity,” as applied to polynucleotide sequences, refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences and, therefore, achieve a more meaningful comparison of the two sequences. Percent identity for a nucleic acid sequence may be determined as understood in the art. (See, e.g., U.S. Pat. No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol.Biol. 215:403 410), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including “blastn,” that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences,” which is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively at the NCBI website. The “BLAST 2 Sequences” tool can be used for both Blastn and Blastp (discussed above).

[0084] Percent identity may be measured over the length of an entire defined polynucleotide sequence or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length may be used to describe a length over which percentage identity may be measured.

[0085] A “full length” polynucleotide sequence is one containing at least a translation initiation codon (e.g., methionine) followed by an open reading frame and a translation termination codon. A “full length” polynucleotide sequence encodes a “full length” polypeptide sequence.

[0086] A “variant,” “mutant,” or “derivative” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastn with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences — a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments a variant polynucleotide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polynucleotide.

[0087] As used herein, “upstream” refers to the relative position of a genetic sequence, either DNA or RNA. Upstream relates to the 5’ to 3’ direction relative to the start site of transcription, wherein upstream is usually closer to the 5’ end of a genetic sequence.

[0088] As used herein, “downstream” refers to the relative position of a genetic sequence, either DNA or RNA. Downstream relates to the 5’ to 3’ direction relative the startsite of transcription, wherein downstream is usually closer to the 3’ end of a genetic sequence.

[0089] “Gene” includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein, including regulatory sequences preceding (5’ noncoding sequences) and following (3’ non-coding sequences) the coding sequence. “Native gene” refers to a gene as found in its natural endogenous location with its own regulatory sequences.

[0090] The terms “knock-out,” “gene knock-out,” and “genetic knock-out” are used interchangeably herein. A knock-out represents a DNA sequence of a cell that has been rendered partially or completely inoperative by targeting with a Cas protein; for example, a DNA sequence prior to knock-out could have encoded an amino acid sequence or could have had a regulatory function (e.g., promoter).

[0091] The terms “knock-in,” “gene knock-in,” “gene insertion,” and “genetic knock- in” are used interchangeably herein. A knock-in represents the replacement or insertion of a DNA sequence at a specific DNA sequence in cell by targeting with a Cas protein (for example, by homologous recombination (HR), wherein a suitable donor DNA polynucleotide is also used) examples of knock-ins are a specific insertion of a heterologous amino acid coding sequence in a coding region of a gene, or a specific insertion of a transcriptional regulatory element in a genetic locus.

[0092] By “domain” it is meant a contiguous stretch of nucleotides (that can be RNA, DNA, and / or RNA-DNA-combination sequence) or amino acids.

[0093] An “enhancer” is a DNA sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue- specificity of a promoter. Promoters may be derived in their entirety from a native gene or be composed of different elements derived from different promoters found in nature and / or comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity.

[0094] Although example embodiments of the present disclosure are explained in some instances in detail herein, it is to be understood that other embodiments are contemplated. Accordingly, it is not intended that the present disclosure be limited in itsscope to the details of construction and arrangement of components set forth in the following description or illustrated in the drawings. The present disclosure is capable of other embodiments and of being practiced or carried out in various ways.

[0095] It must also be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from “about” or “ 5 approximately” one particular value and / or to “about” or “approximately” another particular value. When such a range is expressed, other exemplary embodiments include from the one particular value and / or to the other particular value.

[0096] By “comprising” or “containing” or “including” is meant that at least the name compound, element, particle, or method step is present in the composition or article or method, but does not exclude the presence of other compounds, materials, particles, method steps, even if the other such compounds, material, particles, method steps have the same function as what is named.

[0097] In describing example embodiments, terminology will be resorted to for the sake of clarity. It is intended that each term contemplates its broadest meaning as understood by those skilled in the art and includes all technical equivalents that operate in a similar manner to accomplish a similar purpose. It is also to be understood that the mention of one or more steps of a method does not preclude the presence of additional method steps or intervening method steps between those steps expressly identified. Steps of a method may be performed in a different order than those described herein without departing from the scope of the present disclosure. Similarly, it is also to be understood that the mention of one or more components in a device or system does not preclude the presence of additional components or intervening components between those components expressly identified.

[0098] The term “about,” as used herein, means approximately, in the region of, roughly, or around. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” is used herein to modify a numerical value above and below the stated value by a variance of 10%. In one aspect, the term “about” means plus or minus 10% of the numerical value of the number with which it is being used. Therefore, about 50% means in the range of 45%-55%. Numerical ranges recited herein by endpoints include all numbers and fractions subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, 4.24, and 5).

[0099] Similarly, numerical ranges recited herein by endpoints include subranges subsumed within that range (e.g., 1 to 5 includes 1-1.5, 1.5-2, 2-2.75, 2.75-3, 3-3.90, 3.90-4, 4-4.24, 4.24-5, 2-5, 3-5, 1-4, and 2-4). It is also to be understood that all numbers and fractions thereof are presumed to be modified by the term “about.”

[0100] Disclosed herein is an intelligent biotic system as one or more chassis cells capable of (i) decision-making, (ii) coupled memory development, (iii) and communication between chassis cells and / or the host. Accordingly, disclosed herein are programmable drugdelivery compositions, and the methods of use thereof, in preventing or treating gut microbiota dysbiosis.

[0101] Compositions

[0102] In one aspect disclosed herein, is a programmable drug-delivery system comprising a chassis cell. A chassis cell is a self -replicating organism that serves as a foundation for engineered biological systems in synthetic biology. Chassis cells are used to produce specific chemicals and other bioproducts. Chassis cells provide a framework for genetic components, and they provide resources like transcription and translation machinery to support those components.

[0103] An exemplary chassis cell comprises a Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)). MEMORY) chassis cells are designed to facilitate discrete multi-input regulation of recombinase functions enabling inheritable DNA inversions, deletions, and genomic insertions containing functional elements - e.g., reading frames, promoters, terminators, or replication origins. In some embodiments, extrachromosomal nucleic acid alteration comprises deletion, insertion, or inversion. In some embodiments, the insertion is a genomic insertion. In some embodiments, the genomic insertion is a functional element. In some embodiments, the functional element comprises a reading frame shift, a promoter, a terminator, or a replication origin. MEMORY cells can achieve programmable and permanent gain (or loss) of functions extrachromosomally or from a specific genomic locus without the loss or modification of the MEMORY platform. Retention of the MEMORY platform facilitates the sequential programming and reprogramming of DNA circuits harbored within a given chassis cell. When fully deployed, MEMORY cells can achieve all three tenets of intelligence - i.e., cellular decision-making, inheritable memory, and communication between cells.

[0104] As disclosed herein, the chassis cell comprises an inducible promoter. An inducible promoter is a molecular tool that can be used to control when and how strongly a gene is expressed. Inducible promoters are activated by a stimulus, such as a chemical, heatshock, osmotic stress, drought, or cold. Some exemplary inducers are IPTG, lactose, arabinose, tetracycline, anhydrotetracycline, doxycycline, rhamnose, galactose, estrogen, tamoxifen, heavy metals (Zn2+, Cu2+, Cd2+), glucocorticoids. The stimulus causes a change in the promoter, which then turns the gene on or off. Some exemplary inducible promoters are PLacIR, PPhlF, PCymRC, Pvan, PLuxB, cH OsymC*, dH OsymC*, fH OsymC*, bH OttaC*, cG OttaC*, pPhl, pBAD, pTet, and PvanBT. In some embodiments, a promoter can be made “inducible” or “regulated” by rationally modifying it to contain transcription factor operators.

[0105] In some embodiments, PLacIR comprises at least 70% of SEQ ID NO: 2. In some embodiments, PLacIR comprises SEQ ID NO: 2. In some embodiments, PLacIR may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:2.

[0106] In some embodiments, PPhlF comprises at least 70% of SEQ ID NO: 3. In some embodiments, PPhlF comprises SEQ ID NO: 3. In some embodiments, PPhlF may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:3.

[0107] In some embodiments, PTet comprises at least 70% of SEQ ID NO: 4. In some embodiments, PTet comprises SEQ ID NO: 4. In some embodiments PTet may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 4.

[0108] In some embodiments, pBAD comprises at least 70% of SEQ ID NO: 5. In some embodiments, pBAD comprises SEQ ID NO: 5. In some embodiments, pBAD may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 5.

[0109] In some embodiments, PCymRC comprises at least 70% of SEQ ID NO: 6. In some embodiments, PCymRC comprises SEQ ID NO: 6. In some embodiments PCymRC may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, atleast 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:6.

[0110] In some embodiments, Pvan comprises at least 70% of SEQ ID NO: 7. In some embodiments, Pvan comprises SEQ ID NO: 7. In some embodiments Pvan may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 7.

[0111] In some embodiments, PLuxB comprises at least 70% of SEQ ID NO: 8. In some embodiments, PLuxB comprises SEQ ID NO: 8. In some embodiments PLuxB may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 8.

[0112] In some embodiments, cH OsymC* comprises at least 70% of SEQ ID NO: 9. In some embodiments, cH OsymC* comprises SEQ ID NO: 9. In some embodiments cH OsymC* may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 9.

[0113] In some embodiments, dH OsymC* comprises at least 70% of SEQ ID NO:10. In some embodiments, dH OsymC* comprises SEQ ID NO: 10. In some embodiments, dH OsymC* may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 10.

[0114] In some embodiments, fH OsymC* comprises at least 70% of SEQ ID NO:11. In some embodiments, fH OsymC* comprises SEQ ID NO: 11. In some embodiments, fH OsymC* may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 11.

[0115] In some embodiments, bH OttaC* comprises at least 70% of SEQ ID NO: 12.In some embodiments, bH OttaC* comprises SEQ ID NO: 12. In some embodiments bHOttaC* may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 12.

[0116] In some embodiments, cG OttaC* comprises at least 70% of SEQ ID NO: 13. In some embodiments, cG OttaC* comprises SEQ ID NO: 13. In some embodiments cG OttaC* may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 13.

[0117] In some embodiments, PvanBT comprises at least 70% of SEQ ID NO: 14. In some embodiments, PvanBT comprises SEQ ID NO: 14. In some embodiments PvanBT may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 14.

[0118] Inducible promoters can be of bacterial or eukaryotic origin. Some other examples of inducible promoters are T7, rhaBAD, trc, tac, GALI, HSP, CMV, UAS-GAL4, ERE, MMTV, NT1, CUP1, GRE, and RD29A. In some embodiments, a promoter can be made “inducible” or “regulated” by rationally modifying it to contain transcription factor operators.

[0119] The chassis cell comprises a modified ribosome-binding site (RBS). A ribosome binding site (RBS) is a sequence of nucleotides in messenger RNA (mRNA) that helps ribosomes bind to the mRNA and start translation. The RBS is located upstream of the start codon. Herein used is a modified RBS, such as, for example, phl3, cym2, lux2, van3, lac2, tet2, ara2, el, Al, BX, 13, 15, 18, and 112.

[0120] In some embodiments, phl3 comprises at least 70% of SEQ ID NO: 15. In some embodiments, phl3 comprises SEQ ID NO: 15. In some embodiments, phl3 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 15.

[0121] In some embodiments, cym2 comprises at least 70% of SEQ ID NO: 16. In some embodiments, cym2 comprises SEQ ID NO: 16. In some embodiments, cym2 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, atleast 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 16.

[0122] In some embodiments, lux2 comprises at least 70% of SEQ ID NO: 17. In some embodiments, lux2 comprises SEQ ID NO: 17. In some embodiments, lux2 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 17.

[0123] In some embodiments, van3 comprises at least 70% of SEQ ID NO: 18. In some embodiments, van3 comprises SEQ ID NO: 18. In some embodiments, van3 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 18.

[0124] In some embodiments, lac2 comprises at least 70% of SEQ ID NO: 19. In some embodiments, lac2 comprises SEQ ID NO: 19. In some embodiments, lac2 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 19.

[0125] In some embodiments, tet2 comprises at least 70% of SEQ ID NO: 20. In some embodiments, tet2 comprises SEQ ID NO: 20. In some embodiments, tet2 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 20.

[0126] In some embodiments, ara2 comprises at least 70% of SEQ ID NO: 21. In some embodiments, ara2 comprises SEQ ID NO: 21. In some embodiments, ara2 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 21.

[0127] In some embodiments, el comprises at least 70% of SEQ ID NO: 22. In some embodiments, el comprises SEQ ID NO: 22. In some embodiments, el may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 22.

[0128] In some embodiments, Al comprises at least 70% of SEQ ID NO: 23. In some embodiments, Al comprises SEQ ID NO:23. In some embodiments, Al may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 23.

[0129] In some embodiments, BX comprises at least 70% of SEQ ID NO: 24. In some embodiments, BX comprises SEQ ID NO: 24. In some embodiments, BX may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 24.

[0130] In some embodiments, 13 comprises at least 70% of SEQ ID NO: 25. In some embodiments, 13 comprises SEQ ID NO: 25. In some embodiments, 13 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 25.

[0131] In some embodiments, 15 comprises at least 70% of SEQ ID NO: 26. In some embodiments, 15 comprises SEQ ID NO: 26. In some embodiments, 15 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 26.

[0132] In some embodiments, 18 comprises at least 70% of SEQ ID NO: 27. In some embodiments, 18 comprises SEQ ID NO: 27. In some embodiments, 18 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 27.

[0133] In some embodiments, 112 comprises at least 70% of SEQ ID NO: 28. In some embodiments, 112 comprises SEQ ID NO: 28. In some embodiments, 112 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 28.

[0134] The chassis cell, as disclosed herein comprises one or more genes expressing one or more orthogonal inducible recombinase(s). Orthogonal inducible recombinases are systems that use multiple recombinases to control gene expression in a cell or organism, are site- specific enzymes that mediate DNA recombination in response to a specific inducer.In some embodiments, the inducer is selected from a group consisting of 2,4- Diacetylphloroglucinol (DAPG), aTc, L-Ara, cuminic acid, vanillic acid, Isopropyl -D-1- thiogalactopyranoside (IPTG), and 3OC6 Ahl. Some other exemplary inducers are light, small molecules, or temperature. In some embodiments, the chassis cell is engineered to produce an orthogonal inducible recombinase. In some embodiments, the chassis cell facilitates discrete multi-input regulation of recombinase function to alter extrachromosomal nucleic acid, wherein the chromosomal nucleic acid of the chassis cell is not altered.

[0135] In some embodiments, the one or more orthogonal inducible recombinase(s) is selected from a group consisting of Al 18, Bxbl, Int3, Int5, Int8, and Intl2.

[0136] In some embodiments, Al 18 comprises at least 70% of SEQ ID NO: 73. In some embodiments, Al 18 comprises SEQ ID NO: 73. In some embodiments, Al 18 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:73.

[0137] In some embodiments, Bxbl comprises at least 70% of SEQ ID NO: 74. In some embodiments, Bxbl comprises SEQ ID NO: 74. In some embodiments, Bxbl may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:74.

[0138] In some embodiments, Int3 comprises at least 70% of SEQ ID NO: 75. In some embodiments, Int3 comprises SEQ ID NO: 75. In some embodiments, Int3 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 75.

[0139] In some embodiments, Int5 comprises at least 70% of SEQ ID NO: 76. In some embodiments, Int5 comprises SEQ ID NO: 76. In some embodiments, Int5 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 76.

[0140] In some embodiments, Int8 comprises at least 70% of SEQ ID NO: 77. In some embodiments, Int8 comprises SEQ ID NO: 77. In some embodiments, Int8 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%,at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 77.

[0141] In some embodiments, Intl2 comprises at least 70% of SEQ ID NO: 78. In some embodiments, Intl2 comprises SEQ ID NO: 78. In some embodiments, Intl2 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 78.

[0142] In some embodiments, the chassis cell comprises 1, 2, 3, 4, 5, 6 orthogonal inducible recombinases or a combination thereof. In some embodiments, the chassis cell comprises 1 orthogonal inducible recombinase. In some embodiments, the chassis cell comprises two orthogonal inducible recombinases. In some embodiments, the chassis cell comprises 3 orthogonal inducible recombinases. In some embodiments, the chassis cell comprises 4 orthogonal inducible recombinases. In some embodiments, the chassis cell comprises 5 orthogonal inducible recombinases. In some embodiments, the chassis cell comprises 6 orthogonal inducible recombinases. In some embodiments, the chassis cell comprises more than 6 orthogonal inducible recombinase.

[0143] The chassis cell, as disclosed herein comprises one or more transcription factor(s), wherein the one or more transcription factor(s) regulate the one or more orthogonal inducible recombinase(s) expression. In some embodiments, the one or more transcription factor(s) is selected from a group consisting of PhlF, TetR, AraC, CymR, VanR, LacI, AraE, CelR (TAN), RbsR, and LuxR.

[0144] In some embodiments, PhlF comprises at least 70% of SEQ ID NO: 60. In some embodiments, PhlF comprises SEQ ID NO: 60. In some embodiments, PhlF may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 60.

[0145] In some embodiments, CymR comprises at least 70% of SEQ ID NO: 61. In some embodiments, CymR comprises SEQ ID NO: 61. In some embodiments, CymR may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 61.

[0146] In some embodiments, LuxR comprises at least 70% of SEQ ID NO: 62. In some embodiments, LuxR comprises SEQ ID NO: 62. In some embodiments, LuxR may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:62.

[0147] In some embodiments, VanR comprises at least 70% of SEQ ID NO: 63. In some embodiments, VanR comprises SEQ ID NO: 63. In some embodiments, VanR may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:63.

[0148] In some embodiments, LacI comprises at least 70% of SEQ ID NO: 64. In some embodiments, LacI comprises SEQ ID NO: 64. In some embodiments, LacI may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 64.

[0149] In some embodiments, TetR comprises at least 70% of SEQ ID NO: 65. In some embodiments, TetR comprises SEQ ID NO: 65. In some embodiments, TetR may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:65.

[0150] In some embodiments, AraC comprises at least 70% of SEQ ID NO: 66. In some embodiments, AraC comprises SEQ ID NO: 66. In some embodiments, AraC may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:66.

[0151] In some embodiments, AraE comprises at least 70% of SEQ ID NO: 67. In some embodiments, AraE comprises SEQ ID NO: 67. In some embodiments, AraE may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, orat least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 67.

[0152] In some embodiments, CelR (TAN) comprises at least 70% of SEQ ID NO:68. In some embodiments, CelR (TAN) comprises SEQ ID NO: 68. In some embodiments, CelR (TAN) may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 68.

[0153] In some embodiments, RbsR comprises at least 70% of SEQ ID NO: 69. In some embodiments, RbsR comprises SEQ ID NO: 69. In some embodiments, RbsR may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:69.

[0154] The chassis, as disclosed herein comprises one or more degradation tag(s). A degradation tag is a short peptide sequence that mark a protein for destruction by the cell's protein recycling machinery. They are used to control the expression of specific proteins. In some embodiments, the one or more degradation tag(s) is selected from a group consisting of DAS tag, AAV tag, and LAA tag.

[0155] In some embodiments, DAS tag comprises at least 70% of SEQ ID NO: 57. In some embodiments, DAS tag comprises SEQ ID NO: 57. In some embodiments, DAS tag may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:57.

[0156] In some embodiments, AAV tag comprises at least 70% of SEQ ID NO: 58. In some embodiments, AAV tag comprises SEQ ID NO: 58. In some embodiments, AAV tag may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:58.

[0157] In some embodiments, LAA tag comprises at least 70% of SEQ ID NO: 59. In some embodiments, LAA tag comprises SEQ ID NO: 59. In some embodiments, LAA tag may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, atleast 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 59.

[0158] Some other exemplary degradation tags are SsrA-tag, tmRNA-tag, CupS-tag, N-end rule degradation tags, PEST sequence, Ubiquitin-tags, CLl-tag, Degl-tag, dTAG system, Auxin-Inducible Degron, dTomato-ODC (Ornithine Decarboxylase degron), SMASh-tag (Small Molecule- Assisted Shutoff), FKBP-rapamycin (Shield- 1 system), Aux / IAA Degron, JAZ degron. The tagged protein can be degraded by a protease system or a Ubiquitin-Proteasome System

[0159] In some embodiments, the chassis cell comprises a variable start codon. A variable start codon is a codon that can be used to start protein translation, other than the standard AUG codon. Other codons that can be used as start codons include GUG, UUG, AUU, AUC, AUA, CUG, ACG, TTG, GTG, and CTG. The start codon signals the ribosome to begin translating the messenger RNA (mRNA) into amino acids, which then form a protein chain.

[0160] In some embodiments, the chassis cell comprises a terminator, wherein the terminator provides transcriptional insulation. In some embodiments, the terminator is selected from a group consisting of L3S1P11, L3S1P13, L3S2P21, L3S2P55, L3S3P00, L3S3P21, L3S3P22, L3S3P23, L3S3P41, ECK120010799, ECK120010818, ECK120010858-R, ECK120015170, ECK120015440, ECK120017009, ECK120033736, ECK120035133, rrnB Tl, BBa_B0014, BBa_B0053, BBa_B0062-R, BBa_B1006, and IOT.

[0161] In some embodiments, L3S1P11, comprises at least 70% of SEQ ID NO: 30.In some embodiments, L3S1P11 comprises SEQ ID NO: 30. In some embodiments, L3S1P11 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:30.

[0162] In some embodiments, L3S1P13, comprises at least 70% of SEQ ID NO: 31. In some embodiments, L3SlP13comprises SEQ ID NO: 31. In some embodiments, L3S1P13 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:31.

[0163] In some embodiments, L3S2P21, comprises at least 70% of SEQ ID NO: 32.In some embodiments, L3S2P21comprises SEQ ID NO: 32. In some embodiments, L3S2P21 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:32.

[0164] In some embodiments, L3S2P55, comprises at least 70% of SEQ ID NO: 33.In some embodiments, L3S2P55 comprises SEQ ID NO: 33. In some embodiments, L3S2P55 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:33.

[0165] In some embodiments, L3S3P00, comprises at least 70% of SEQ ID NO: 34.In some embodiments, L3S3P00 comprises SEQ ID NO: 34. In some embodiments, L3S3P00 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:34.

[0166] In some embodiments, L3S3P21, comprises at least 70% of SEQ ID NO: 35.In some embodiments, L3S3P21 comprises SEQ ID NO: 35. In some embodiments, L3S3P21 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:35.

[0167] In some embodiments, L3S3P22, comprises at least 70% of SEQ ID NO: 36.In some embodiments, L3S3P22 comprises SEQ ID NO: 36. In some embodiments, L3S3P22 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:36.

[0168] In some embodiments, L3S3P23, comprises at least 70% of SEQ ID NO: 37.In some embodiments, L3S3P23 comprises SEQ ID NO: 37. In some embodiments, L3S3P23 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, orat least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 37.

[0169] In some embodiments, L3S3P41, comprises at least 70% of SEQ ID NO: 38. In some embodiments, L3S3P41 comprises SEQ ID NO: 38. In some embodiments, L3S3P41 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 38.

[0170] In some embodiments, ECK120010799, comprises at least 70% of SEQ ID NO: 39. In some embodiments, ECK120010799 comprises SEQ ID NO: 39. In some embodiments, ECK120010799 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 39.

[0171] In some embodiments, ECK120010818, comprises at least 70% of SEQ ID NO: 40. In some embodiments, ECK120010818 comprises SEQ ID NO: 40. In some embodiments, ECK120010818 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 40.

[0172] In some embodiments, ECK120010858-R, comprises at least 70% of SEQ ID NO: 41. In some embodiments, ECK120010858-R comprises SEQ ID NO: 41. In some embodiments, ECK120010858-R may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 41.

[0173] In some embodiments, ECK120015170, comprises at least 70% of SEQ ID NO: 42. In some embodiments, ECK120015170 comprises SEQ ID NO: 42. In some embodiments, ECK120015170 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 42.

[0174] In some embodiments, ECK120015440, comprises at least 70% of SEQ ID NO: 43. In some embodiments, ECK120015440 comprises SEQ ID NO: 43. In someembodiments, ECK120015440 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 43.

[0175] In some embodiments, ECK120017009, comprises at least 70% of SEQ ID NO: 44. In some embodiments, ECK120017009 comprises SEQ ID NO: 44. In some embodiments, ECK120017009 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 44.

[0176] In some embodiments, ECK120033736, comprises at least 70% of SEQ ID NO: 45. In some embodiments, ECK120033736 comprises SEQ ID NO: 45. In some embodiments, ECK120033736 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 45.

[0177] In some embodiments, ECK120035133, comprises at least 70% of SEQ ID NO: 46. In some embodiments, ECK120035133 comprises SEQ ID NO: 46. In some embodiments, ECK120035133 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 46.

[0178] In some embodiments, rrnB Tl, comprises at least 70% of SEQ ID NO: 47. In some embodiments, rrnB Tl comprises SEQ ID NO: 47. In some embodiments, rrnB Tl may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO:47.

[0179] In some embodiments, BBa_B0014, comprises at least 70% of SEQ ID NO:48. In some embodiments, BBa_B0014 comprises SEQ ID NO: 48. In some embodiments, BBa_B0014 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 48.

[0180] In some embodiments, BBa_B0053, comprises at least 70% of SEQ ID NO:49. In some embodiments, BBa_B0053 comprises SEQ ID NO: 49. In some embodiments, BBa_B0053 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 49.

[0181] In some embodiments, BBa_B0062-R, comprises at least 70% of SEQ ID NO:50. In some embodiments, BBa_B0062-R comprises SEQ ID NO: 50. In some embodiments, BBa_B0062-R may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 50.

[0182] In some embodiments, BBa_B1006, comprises at least 70% of SEQ ID NO:51. In some embodiments, BBa_B1006 comprises SEQ ID NO: 51. In some embodiments, BBa_B1006 may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 51.

[0183] In some embodiments, IOT comprises at least 70% of SEQ ID NO: 52. In some embodiments, IOT comprises SEQ ID NO: 52. In some embodiments, IOT may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to SEQ ID NO: 52.

[0184] In some embodiments, the programmable drug-delivery system further comprises a drug. As used herein, the term "drug" refers to any biologically active compound, molecule, or composition that is capable of exerting a therapeutic, diagnostic, prophylactic, or pharmacological effect in a subject. The term includes, but is not limited to: Small molecules - Organic or inorganic compounds, including synthetic and naturally occurring substances, that modulate biological pathways. Biologies - Proteins, peptides, antibodies (monoclonal, polyclonal, and recombinant), nucleic acids (DNA, RNA, aptamers, CRIS PR-based), gene therapy vectors, and cellular therapies. Prodrugs - Compounds that undergo biotransformation into an active pharmacological agent within the body.Pharmaceutical compositions - Any formulation containing an active drug substance along with excipients, carriers, stabilizers, or other formulation agents suitable for administration.Vaccines and Immunomodulators - Any antigenic compositions, adjuvants, or immune- modulating agents used for disease prevention or treatment. Controlled Substances and Regulatory Compounds - Any compound classified as a therapeutic agent by regulatory authorities, including prescription drugs, over-the-counter medications, and investigational new drugs. The term "drug" encompasses agents intended for use in humans, animals, or other biological systems via any route of administration, including but not limited to oral, intravenous, intramuscular, subcutaneous, transdermal, inhalation, intranasal, or topical delivery. The term also includes derivatives, salts, isomers, analogs, metabolites, and polymorphic forms of active compounds, where applicable. In some embodiments, the drug can be a genetically encoded drug.

[0185] In some embodiments, the chassis cell is a non-colonizing bacterium (such as, for example, Escherichia coli, strain Nissle 1917 or K12). A study engineered Escherichia coli strains to harbor a genome-integrated array of six orthogonal inducible recombinases - forming the Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY). To demonstrate intelligence, a study engineered a probiotic MEMORY strain capable of programmable information exchange between Nissle 1917 and the gastrointestinal commensal Bacteroid.es thetaiotaomicron.

[0186] In some embodiments, the system is configured as a gain-of-function (GOF) memory circuit for both inversion and excision attachment site configuration. In some embodiments, the system is configured as a loss-of-function (LOF) memory circuit for both inversion and excision attachment site configuration. In some embodiments, a catalytically inactive Cas9 (dCas9) is employed to a recombinase attachment site to prevent recombination with high (-99%) efficiency. As used herein, the term "Cas9" refers to CRIS PR-associated protein 9, an RNA-guided endonuclease derived from Streptococcus pyogenes or other bacterial species, which functions as a component of the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) adaptive immune system. Cas9 is capable of recognizing and cleaving specific DNA sequences in a programmable manner when guided by a complementary single-guide RNA (sgRNA) or a dual crRNA:tracrRNA complex.

[0187] In one aspect, disclosed herein is as a synthetic probiotic composition comprising a programmable drug-delivery system and a pharmaceutically acceptable carrier, wherein the programmable drug-delivery system comprising a chassis cell, wherein the chassis cell (e.g., a Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)) comprises, an inducible promoter, a modified ribosome-binding site (RBS), one or more genes expressing one or more orthogonal inducible recombinase(s), one or moretranscription factor(s), wherein the one or more transcription factor(s) regulate the one or more orthogonal inducible recombinase(s) expression, one or more degradation tag(s), a variable start codon; and a terminator, wherein the terminator provides transcriptional insulation, as in any of the preceding aspects.

[0188] In some embodiments, the chassis cell exchanges information with a stably colonizing species, wherein the stably colonizing species is found in the gut of a subject. In some embodiments, the stably colonizing species is Bacteroides thetaiotaomicron.

[0189] Methods

[0190] In one aspect, disclosed herein is a method of preventing or treating gut microbiota dysbiosis in a subject in need thereof, the method comprising administering a therapeutically effective amount of a synthetic probiotic composition comprising a programmable drug-delivery system and a pharmaceutically acceptable carrier, wherein the programmable drug-delivery system comprising a chassis cell, wherein the chassis cell (e.g., a Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)) comprises, an inducible promoter, a modified ribosome-binding site (RBS), one or more genes expressing one or more orthogonal inducible recombinase(s), one or more transcription factor(s), wherein the one or more transcription factor(s) regulate the one or more orthogonal inducible recombinase(s) expression, one or more degradation tag(s), a variable start codon; and a terminator, wherein the terminator provides transcriptional insulation, as in any of the preceding aspects.

[0191] In some embodiments, the chassis cell is engineered to produce an orthogonal inducible recombinase as in any of the preceding aspects.

[0192] In some embodiments, the chassis cell facilitates discrete multi-input regulation of recombinase function to alter extrachromosomal nucleic acid, wherein chromosomal nucleic acid of the chassis cell is not altered, as described herein.

[0193] In some embodiments, the method further comprises a drug as in any of the preceding aspects.

[0194] In some embodiments, the chassis cell is a non-colonizing bacterium (such as, for example, Escherichia coli), as in any of the preceding aspects.

[0195] In some embodiments, the system is configured as a gain-of-function (GOF) memory circuit for both inversion and excision attachment site configuration as in any of the preceding aspects.

[0196] In some embodiments, the system is configured as a loss-of-function (LOF) memory circuit for both inversion and excision attachment site configuration as in any of the preceding aspects.

[0197] In some embodiments, a catalytically inactive Cas9 (dCas9) is employed as a recombinase attachment site to prevent recombination with high (-99%) efficiency as in any of the preceding aspects.

[0198] In some embodiments, extrachromosomal nucleic acid alteration comprises deletion, insertion, or inversion as in any of the preceding aspects. In some embodiments, the insertion is a genomic insertion. In some embodiments, the genomic insertion is a functional element. In some embodiments, the functional element comprises a reading frame shift, a promoter, a terminator, or a replication origin.

[0199] In some embodiments, the chassis cell exchanges information with a stably colonizing species, wherein the stably colonizing species is found in the gut of a subject. In some embodiments, the stably colonizing species is Bacteroides thetaiotaomicron.

[0200] In some embodiments, the subject is a human.

[0201] In some embodiments, the synthetic probiotic composition is administered to the subject orally. In some embodiments, the synthetic probiotic composition is administered to the subject daily or multiple times a day. In some embodiments, the synthetic probiotic composition is administered to the subject weekly, monthly, or only once. In some embodiments, the synthetic probiotic composition is administered to the subject daily for at least 1, 2, 3, 4, 5, 6,7, or 8 weeks. The synthetic probiotic composition may be administered in such amounts, time, and route deemed necessary in order to achieve the desired result. The exact amount of the synthetic probiotic composition will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the gut microbiota dysbiosis, the particular synthetic probiotic composition, its mode of administration, its mode of activity, and the like. The synthetic probiotic composition is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the synthetic probiotic composition will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors, including the severity of the gut microbiota dysbiosis; the activity of the synthetic probiotic composition employed; the specific synthetic probiotic composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific syntheticprobiotic composition employed; the duration of the treatment; drugs used in combination or coincidental with the specific synthetic probiotic composition employed; and like factors well known in the medical arts.

[0202] The synthetic probiotic composition may be administered by any route. In some embodiments, the synthetic probiotic composition is administered orally, nasally, buccal, enterally, sublingually, or by tablet, liquid, or oral spray forms. In general, the most appropriate route of administration will depend upon a variety of factors, including the nature of the synthetic probiotic composition (e.g., its stability in the environment of the gastrointestinal tract), the condition of the subject (e.g., whether the subject is able to tolerate oral administration), etc.

[0203] The exact amount of synthetic probiotic composition required to achieve a therapeutically or prophylactically effective amount will vary from subject to subject, depending on species, age, and general condition of a subject, severity of the side effects, identity of the particular compound(s), mode of administration, and the like. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult.

[0204] The concentration of active agent(s) can vary widely and will be selected primarily based on the activity of the active ingredient(s), body weight, and the like in accordance with the particular mode of administration selected and the patient's needs. Concentrations, however, will typically be selected to provide dosages ranging from about 0.1 or 1 mg / kg / day to about 50 mg / kg / day and sometimes higher. Typical dosages range from about 3 mg / kg / day to about 3.5 mg / kg / day, preferably from about 3.5 mg / kg / day to about 7.2 mg / kg / day, more preferably from about 7.2 mg / kg / day to about 11.0 mg / kg / day, and most preferably from about 11.0 mg / kg / day to about 15.0 mg / kg / day. In certain preferred embodiments, dosages range from about 10 mg / kg / day to about 50 mg / kg / day. In certain embodiments, dosages range from about 20 mg to about 50 mg, and they are given orally twice daily. It will be appreciated that such dosages may be varied to optimize a therapeutic and / or prophylactic regimen in a particular subject or group of subjects.

[0205] In one aspect, disclosed herein is a synthetic probiotic composition of any preceding aspect and a pharmaceutically acceptable carrier selected from an excipient, a diluent, a salt, a buffer, a stabilizer, a lipid, an emulsion, a nanoparticle, and a cream. The synthetic probiotic composition can be administered if desired in the form of salts, esters, amides, prodrugs, or a derivative that is pharmacologically suitable. Salts, esters, amides,prodrugs, and other derivatives of the active agents can be prepared using standards procedures known to those skilled in the art of synthetic organic chemistry and described, for example, by March (1992) Advanced. Organic Chemistry; Reactions, Mechanisms, and Structure, 4thEd. N.Y. Wiley-Interscience.

[0206] In some embodiments, a synthetic probiotic composition can be prepared as a “concentrate,” e.g., in a storage container of a premeasured volume and / or a predetermined amount ready for dilution or in a soluble capsule ready for addition to a specified volume of water, saline, alcohol, hydrogen peroxide, or other diluent.

[0207] In some embodiments, the synthetic probiotic composition is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53,54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more times. In some embodiments, the synthetic probiotic composition is administered daily. In some embodiments, the synthetic probiotic composition is administered every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, or more. In some embodiments, the synthetic probiotic composition is administered every week, every 2 weeks, every 3 weeks, every 4 weeks, or more. In some embodiments, the synthetic probiotic composition is administered every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every 12 months, or more. In some embodiments, the synthetic probiotic composition is administered every year, every 2 years, every 3 years, every 4 years, every 5 years, or more.EXAMPLES

[0208] Synthetic biologists have developed separate technologies to emulate decisionmaking [l]-[9], intercellular communication

[0010] -

[0016] , and the equivalent of memory

[0017] -

[0025] in myriad chassis cells. The instant disclosure posited that all three properties can be unified in a single chassis cell to form an intelligent synthetic biological system (see Figure 1). A study hypothesized that an intelligent chassis cell could be engineered via the coordination and optimization of orthogonal recombinase functions mapped to discrete biosensing operations. Recombinases (large serine integrases) are enzymes that mediate sitespecific DNA inversion, excision, and insertion events depending on the orientation of cognate attachment (atf) sites

[0026] ,

[0076] . Several recombinases have been identified andexperimentally characterized, enabling said catalysts to be repurposed for use in synthetic genetic circuits

[0020] ,

[0028] ,

[0029] ,

[0030] ,

[0031] . One of the advantages of serine integrase function is that this type of recombination can be deployed in prokaryotic

[0019] ,

[0030] and eukaryotic

[0023] ,

[0032] systems. In addition, other studies have demonstrated that recombinase function can be artificially regulated by way of inducible promoters

[0018] ,

[0019] ,

[0022] . These works utilized well-characterized transcription factors (TFs) to regulate recombinase expression, allowing at most three orthogonal inducible (plasmid-based) recombinases to be deployed in a single E. coli chassis cell

[0022] ,

[0030] . Additional studies have used similar strategies to create recombinase circuits incorporating more relevant biosensors for targeted applications

[0033] -

[0035] , including the detection of key biomarkers for non-invasive diagnostics

[0036] -

[0038] - Similarly, these iterations of recombinase circuits utilized fewer than three regulated recombination operations.

[0209] A recent study demonstrated that the regulation of recombination can be achieved via synthetic transcription factors (z.e., synthetic repressors and synthetic antirepressors) and can be deployed concurrently with Transcriptional Programming (T-Pro)

[0039] - see

[0084] . T-Pro [4], [5],

[0040] ,

[0041] has emerged alongside Cello circuit design software [2], [6],

[0042] as promising technologies for engineering cellular decision-making (z.e., tenet 1, see Figure 1). Here the instant study sought to engineer an iteration of synthetic memory (tenet 2) that is concurrently compatible with both Marionette [9] and T-Pro transcription factors. The instant study posited that the envisioned engineered cells would enable the development of bespoke living programs capable of executing unified decision-making, communication, and memory.

[0210] To achieve this goal, the instant study developed a novel Escherichia coli chassis cell with a genomically integrated memory array composed of six orthogonal, inducible recombinases - regulated by a set of transcription factors commonly used in the Marionette biosensing array (z.e., PhlF, TetR, AraC, CymR, VanR, and LuxR). The expression level of each recombinase was carefully optimized to achieve near digital switching of cell genotype when induced to perform a specific recombination function. The instant study developed 24 fundamental gain-of-function (GOF) and loss-of-function (LOF) memory circuits for both inversion and excision attachment site configurations. To expand the capacity of memory functions, the instant study developed a means of CRISPR-Cas9- mediated protection of recombinase action (CRISPRp). Namely, the instant study showed that catalytically inactive Streptococcus pyogenes Cas9 (dCas9) can be directed to a givenrecombinase attachment site and successfully prevent recombination with high (-99%) efficiency.

[0211] Moreover, the instant study demonstrated that CRISPRp of a given att site could be programmed with fundamental decision-making via T-Pro transcription factors - with concurrent MEMORY operation. In addition, CRISPRp was used to develop a nextgeneration recombinase-based state machine (ngRSM) to demonstrate an application of this posttranslational control mechanism. Finally, the study demonstrated the engineered chassis cells can be used to program information exchange between a probiotic E. coli Nissle with a transplanted MEMORY platform and the commensal bacterium Bacteroides thetaiotaomicron - i.e., a chassis cell that the instant study demonstrated is capable of supporting the full range of two-input Transcriptional Programs via ligands that can be used as dietary supplements

[0041] . The pairing of a non-colonizing probiotic strain with B. thetaiotaomicron establishes an important platform technology, defining the next generation of consortium-based living therapeutics capable of concurrently supporting all three tenets of intelligence (Figure 1).

[0212] Experimental Results

[0213] Inheritable synthetic memory. Decision-making is composed of one or more INPUT(s) mapped to an OUTPUT, such that the system can be reset upon the removal of the INPUT(s). In contrast, a synthetic memory operation is not reset upon the removal of cognate INPUT(s) - i.e., memory operations retain changes in the OUTPUT state upon the removal of the cognate INPUT(s). Canonical synthetic memory (type-I) is achieved by way of the regulation of a given recombinase, which is typically induced by a small molecule. Once matured (folded and assembled), the recombinase attaches to DNA elements attb and attp, resulting in the reconfiguration of DNA. Recently, it was reported that a novel posttranslational strategy for controlling recombinase function, termed interception (type-II), expands the utility of recombinases for synthetic memory operations

[0039] . Herein, interception is defined as the controlled blocking of any protein-DNA interaction (other than RNA polymerase) via a transcription factor (TF) that interacts with a cognate DNA operator pair in situ. Interception was achieved by strategically replacing a small segment of a recombinase attachment site with a DNA operator. The study posits that mechanistically, this results in the TF - when bound to operator DNA - sterically hindering a given recombinase from binding to a cognate attachment site. Correspondingly, under conditions in which the TF becomes unbound (i.e., induced), the said recombinase can attach to the DNA element andcatalyze the reconfiguration of cognate DNA elements (e.g.. resulting in deletion or inversion). Accordingly, this iteration of synthetic memory requires two parts: (i) an operation that regulates recombinase attachment post-translation and (ii) a genetic circuit to define the memory function - i.e., the orientation and positioning of recombinase attachment sites allb and allp.

[0214] Engineering an array of inducible recombinases. There have been, at most, three independently inducible recombinases deployed in a single E. coli cell

[0022] ,

[0030] . The instant study sought to increase this number by identifying six putatively orthogonal recombinases (Al 18, Bxbl, Int3, Int5, Int8, and Intl2) from the large serine integrase family that have been previously characterized and used in synthetic biology applications

[0018] -

[0020] ,

[0022] . Next, the study identified six TFs (PhlF, TetR, AraC, CymR, VanR, and LuxR) that have been rigorously optimized and shown to be orthogonal to one another from the Marionette biosensing arrays For each recombinase, the study arbitrarily assigned a regulating TF to control enzyme expression (Figure 2). Genetic libraries were created for each recombinase to determine the optimal expression levels that would result in (i) minimal leakiness in the uninduced state and (ii) high recombination efficiency in the context of inversion upon induction of the regulating promoters (Figure 2a-b). Each recombinase library consisted of an inducible promoter, a degenerate ribosome binding site (RBS) sequence

[0043] , a degenerate start codon, and two degradation tags of variable strength. These libraries were cloned into a single-copy bacterial artificial chromosome (BAC) with the intent of mimicking genomic expression levels

[0044] . To test the function of each inducible recombinase, output circuits were designed where a strong, inverted promoter (Pj23i 19) was flanked by anti-aligned att sites followed by a green fluorescent protein (GFP') gene, harbored on a low-copy (3-5 copy) pSClOl plasmid (Figure 2a). The study designated this genetic circuit architecture as an inversion GOF circuit. In this study, the iteration of GOF and LOF defined by Huang et al.

[0041] was used, which utilized an inert reporter output e.g., green fluorescent protein) as a proxy for function.

[0215] The study initially used the Marionette-Wild [9] strain of E. coli to screen the resulting libraries, as this strain has six TF regulators integrated into its genome. Each recombinase library was co-transformed with the corresponding inversion GOF plasmid, and transformants were randomly screened using a memory assay that the study developed (Methods). Briefly, transformants harboring a recombinase circuit were grown in M9 minimal medium (MM) with and without the cognate inducer and, after a defined growth period, transferred into fresh MM without inducer. These final cultures were then analyzedusing flow cytometry to assess levels of recombination. This assay ensured that the expression state of the cells being analyzed was dependent on the inducer input history rather than the current growth environment. After screening the instant libraries and recharacterizing promising clones, the study was able to isolate variants that exhibited low recombination activity without inducer, complemented by high levels of recombination when transiently induced - determined by flow cytometry (Figure 2a-b, and Figure 9a).

[0216] Coordinating insulated recombinase expression from a genomic locus.Once the expression level for each recombinase was optimized, the study sought to integrate the six inducible cassettes into the genome of E. coli MG1655. The majority of prokaryotic recombinase circuits reported to date have utilized medium- and high-copy plasmids to harbor the recombinases

[0017] -

[0020] ,

[0022] ,

[0030] ,

[0038] ,

[0045] , with the exception of a genome- integrated system reported in Bacteroides thetaiotaomicron

[0046] . Several independent investigations have demonstrated that multi-copy genetic circuits can impose a significant resource burden on the host

[0047] -

[0057] , leading researchers to move toward the construction of single-copy genetic circuits

[0044] ,

[0058] ,

[0059] . There are several advantages to creating singlecopy expression systems, including enhanced genetic stability and reduced risk of horizontal gene transfer

[0058] ,

[0060] ,

[0061] ,

[0062] . To this end, the study designed the recombinase expression system to be implemented at the single-copy level at the outset of this study.

[0217] Prior to genomic integration, the study used the BAC as a testbed for the design of an insulated locus for the six recombinases. The study anticipated that the induction of one recombinase could lead to the unintended expression of a different recombinase if its coding sequence was in frame with an active promoter. To diminish this possibility, the study incorporated strong terminators

[0063] upstream and downstream of each recombinase, as well as alternated the direction of transcription of each successive gene to provide further transcriptional insulation. The study cloned an initial version of this insulated locus into the BAC and used Marionette- Wild to perform the memory assay with each of the six inversion GOF reporter plasmids. However, this time, all sets of inducers for each of the six circuits were used to assess for cross-induction of recombinases. Despite this initial insulation attempt, the study saw evidence of transcriptional readthrough and cryptic promoter activity causing unintended activation of certain recombinases (

[0091] , also see Figure 10). These effects were largely mitigated with the strategic insertion of additional terminators in the recombinase expression array. After these modifications, the only instance of significant cross-induction was observed with Al 18 att sites unexpectedly recombining (z.e., -9%) in thepresence of the 3OC6 AHL inducer corresponding to the Inti 2 recombinase (Source Data, also see Figure 11).

[0218] After the recombinase expression system showed suitable orthogonality when harbored on the BAC, the study proceeded to integrate the insulated set of genes into the MG1655 genome (Figure 2c, also see Methods). The study integrated the sequence immediately downstream of the regulating TFs, simultaneously removing the unused TFs harbored in the Marionette-Wild genome with the exception of LacI (to be used later for orthogonal proof-of-concept T-Pro regulation, unifying tenet 1 and tenet 2). Herein, this genetic construct is referred to as Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY) platform - establishing tenet 2 - and the study designated the new strain of E. coli as EcMem (Figure 2d). The study then repeated the orthogonality experiment to confirm that each genome-integrated recombinase performed equivalently to its BAC counterpart (Figure 2e). Each recombinase successfully recombined its inversion GOF target with >97% efficiency while exhibiting <3% recombination in the uninduced state. In addition, the study characterized the relative rate of recombination for each recombinase by measuring the amount of time required for recombination under ideal growth conditions in a minimal medium with inducer (Figure 3a). Each genome-integrated recombinase was tested for its recombination rate using the inversion GOF circuit as well as an excision-based version of GOF synthetic memory. All recombinases showed complete recombination after approximately 12 hours when maintained in exponential growth.

[0219] After insulation, the only instance of significant cross-induction was observed with Al 18 unexpectedly recombining -9% of its targets in the presence of the Intl2 inducer (3OC6 AHL). It was confirmed that the Intl2 inducer did not directly cause expression of Al 18 by interacting with PhlF and that Inti 2 was not responsible for recombining the Al 18 inversion GOF circuit (Figure 11). It was posited that LuxR may exhibit bidirectional recruitment of RNAP given the high symmetry of its DNA operator, potentially leading to unwanted antisense transcription from its promoter. Interestingly, Al 18’ s regulator- PhlF- has previously been reported to provide a strong transcriptional roadblocking effect when used in genetic circuits [2]. These situations of unintended Al 18 expression suggest, however, evidence of PhlF being easily displaced from its promoter, potentially due to lower levels of PhlF expression used in this study.

[0220] Mitigating crosstalk between inducible recombinase cassettes. Intriguingly, two situations were observed where transcription in one reading frame led to the activation of a gene located downstream of the active promoter but in the opposite reading frame. Thestudy theorized that this antisense transcription from the first promoter could lead to the displacement of the TF bound to the second promoter, resulting in short windows for RNA polymerase (RNAP) to bind the second promoter and transcribe its downstream gene. Specifically, it was seen that induction of the Intl2 promoter resulted in slight activation of Bxbl, which was eliminated with the addition of a second terminator (L3S3P21) after the Intl2 gene. A second, more prominent instance of this effect was seen with Al 18 expression (evidenced by the activation of the inversion GOF circuit) when promoters were located upstream of this inverted expression cassette. Unwanted Al 18 expression was mitigated with the addition of the L3S3P22 terminator upstream of the inverted expression cassette, corroborating the theory of antisense readthrough.

[0221] An additional challenge encountered was the introduction of cryptic promoters when the six expression cassettes were combined into a single locus. Notably, it was seen that placing the Intl2 cassette after the Al 18 cassette, despite their promoters being in transcriptionally diverging directions and each gene having an upstream insulating terminator, led to activation of Al 18 in the absence of either inducer. A manual scan of the Inti 2 DNA sequence revealed a region with a 3 bp mismatch to the consensus G70promoter sequence (5’-TTGACA[N17]TATAAT-3’) oriented in frame with the Al 18 CDS (Figure 10). It was posited that this led to unwanted transcription of Al 18, so a second terminator (L3S3P41) was added to block this cryptic promoter. This change successfully eliminated the expression of Al 18 in the absence of an inducer.

[0222] Expanding synthetic memory with additional recombinase circuits. After the development and characterization of the EcMem strain using inversion GOF circuits, the study then expanded the memory system by designing, building, and testing 18 additional synthetic memory circuits (Figure 3b-e). Namely, the study sought to design a second GOF circuit based on DNA excision, as well as two LOF circuits based on either DNA inversion or excision. The study posited that engineering a diverse set of optimized (z.e., near digital) circuits capable of both inversion and excision would allow for the accelerated design and development of complex genetic programs that utilize the strategic arrangement of att sites (z.e., nesting) that rearrange transcriptionally regulating elements such as promoters, terminators, or noncoding RNAs. To this end, the study developed the complementary inversion LOF circuit by flanking an in-frame promoter with anti-aligned att sites upstream of the gfp gene (Figure 3c). The excision GOF circuit was designed to have a strong constitutive promoter upstream of aligned att sites flanking two terminators in series, followed by the gfp gene (Figure 3d). Finally, the excision LOF circuit was designed byflanking an in-frame constitutive promoter with aligned at sites, followed by the gfp gene (Figure 3e).

[0223] When designing recombinase circuits, several orientations of at sites were tested for each recombinase, given that cryptic promoters and terminators can arise from the at sequences

[0030] ,

[0045] (Figure 12). The study tested all 18 additional synthetic memory circuits using the EcMem strain and demonstrated that each memory operation performed on par with the initial inversion GOF circuits (Figure 3c-e, also see

[0094] ). Interestingly, when these circuits were characterized using single recombinases harbored on the BAC, the performance was less efficient when compared to the genome-integrated recombinases (Figure 9, also see Source Data File). The study posited that this was due to increased variability in initial recombinase expression levels when cells were co-transformed with a pSClOl circuit plasmid and a BAC, as there may be a delay in the genome-integrated TFs initiating the regulation of a recombinase’s promoter. This served to highlight another advantage of the genome-integrated recombinase array, where the recombinase expression levels are already minimized due to the TFs having achieved stable concentrations prior to the introduction of a pSClOl circuit.

[0224] Consideration of optimal recombinase expression levels. The study believes that it is worth emphasizing that the expression levels of recombinases were specifically tuned based on the inversion gain-of-function circuits. The study’s goal was to isolate expression variants that exhibited <5% recombination when uninduced and >95% recombination when induced. This is of note because each inversion GOF circuit features a strong constitutive promoter actively transcribing the 5’ at site of the inversion circuit, which theoretically could impact the binding of a recombinase to this at site and, thus, the efficiency of recombination. This may explain the slight variations in recombination performances when comparing inversion GOF vs. LOF or excision GOF vs. LOF circuits for a given recombinase. Simply put, varying the genetic context near at sites may result in subtle changes in recombinase efficiency and should be considered if the inversion and excision circuits are modified.

[0225] Robustness and resource burden of the recombinase array. To assess the long-term utility and genetic stability of the integrated memory system, the study performed an extended growth experiment with the EcMem chassis cell harboring the inversion GOF circuits. Specifically, the study transformed the EcMem strain with each of the six inversion GOF plasmids and grew these cells for 11 days (-200 doublings) - (Figure 3f). The cultureswere passaged every 12 hours into fresh minimal medium without inducers for the entire experiment and analyzed by flow cytometry.

[0226] Additionally, every other day, a separate set of cultures was inoculated, containing the cognate inducer to activate the corresponding GOF circuit. A standard memory assay was performed on these induced cultures to assess for genomic maintenance of the recombinase array and potential loss of recombinase function through genetic drift. All recombinases performed consistently throughout the entire 11 -day period, with negligible recombination occurring in the absence of inducers. Each attempt to induce the recombinases was successful with >95% recombination efficiency (Figure 3f, also see Figure 13). This experiment demonstrated that the integrated recombinase array is stable against evolution and that memory circuits can be maintained successfully for greater than 10 days.

[0227] Furthermore, the study analyzed the growth rate of EcMem during recombinase expression to assess potential toxicity and metabolic burden. Even when all six recombinases were induced simultaneously, the study saw minimal impact on cell growth rate (Figure 14).

[0228] Extrachromosomal MEMORY programming, erasing, and reprogramming. In principle, the EcMem chassis cell can be used to execute bespoke memory programs supplied on extrachromosomal DNA or via genome-integrated circuits. Here, the study aimed to demonstrate MEMORY programming by way of extrachromosomal (plasmid DNA) circuits. The study posited that functional memory circuits with an additional feature could be designed that would enable the complete removal of the extrachromosomal DNA at any point on cue - effectively erasing the plasmid-based circuit - while retaining the genomically integrated MEMORY platform. A putative synthetic memory eraser was designed via an aligned pair of all sites flanking the origin of replication of the pSClOl plasmid. As designed, the addition of the L-arabinose inducer should result in the origin of replication being excised, preventing extrachromosomal DNA propagation - i.e., erasing the corresponding memory circuit and resetting the EcMem chassis cell (Figure 15). Here, the erasable DNA plasmid contained a two-output memory circuit, designed for independent inducible GOF by way of the expression of GFP or mKate - via transient exposure to small molecules vanillic acid or aTc, respectively (Figure 4a). The study demonstrated that each GOF proxy could be induced individually or simultaneously to achieve the desired fluorescent protein output(s) and subsequently reset the MEMORY cells by way of origin excision (Figure 4b, also see Figure 16). The study estimated that greater than 99.9% of cells were successfully reset (i.e., lost the pSClOl plasmid) by flow cytometry analysis. Afterdemonstrating that the study could erase the two-output extrachromosomal circuit, the study showed that the reset MEMORY cell could be transformed with a new circuit, maintain the genome-integrated array, and execute a new extrachromosomal program (Figure 4c-d). Specifically, the study selected a single reset colony and made the cells chemically competent to transform the Int5 inversion GOF circuit. The study proceeded to grow these cells with and without the Int5 inducer (cuminic acid), as well as the two relevant inducers from the original circuit (vanillic acid and aTc). Consistent with the expectation, the circuit was faithfully executed in response to the Int5 inducer and showed no response to the other inducers (Figure 4d).

[0229] Programmed DNA insertion by way of MEMORY chassis cells for genome engineering. In addition to DNA inversion and excision circuits, the study also developed proof-of-concept integration circuits that allow for the inducible (programmed) insertion of genetic elements into the genome of EcMem chassis cells (Figure 5). Park et al. introduced a robust iteration of recombinase-based genomic insertion technology that leverages single att site landing pads

[0058] .

[0230] However, given that this landing pad technology is based on a single att site payload insertion, the initial recombination event incorporates the entire plasmid. To remove any unwanted DNA, the authors used the FLP recombinase and cognate attachment sites to minimize the footprint of the insert. In this landing pad system, the recombinases are supplied via plasmid DNA and are unregulated. Likewise, Santos et al. demonstrated in an earlier study that the Cre recombinase can be used to insert a specific DNA fragment into the E. coli genome using two sets of orthogonal att sites - again unregulated

[0064] . Here, the study introduces the next iteration of recombinase-based genomic insertion technology that leverages the MEMORY platform for the programmed insertion of DNA into the genome of EcMem chassis cells. In principle, MEMORY chassis cells can accomplish the programmed genomic insertion of an exact pay load in a single step - z.e., without the need to remove unwanted integrated DNA - and can support programmed serial genomic integrations.

[0231] To accomplish programmed integration, the study created an artificial genomic safe harbor (aGSH) using a nonsynonymous pair of attP sites corresponding to two recombinases (Methods). In principle, the aGSH can be integrated with genetic information stored on a plasmid between a set of complementary attB sites (Figure 5a). To demonstrate MEMORY -facilitated programmed insertion, the study positioned a promoter upstream of the aGSH in the genome of the EcMem chassis cell and paired the engineered safe harbor with a set of complementary attB sites directing a pay load (Payload 7) containing the gfp gene and akanamycin resistance gene (kanR) flanked by a second pair of nonsynonymous attP sites - creating a new aGSH upon genomic integration (Figure 5a-c). Additionally, the pSClOl donor vector was equipped with the memory eraser to remove the “empty” plasmid after integration, as well as the sacB gene to provide a counterselection and eliminate integrants receiving the entire plasmid. In turn, the study used flow cytometry to quantify the efficiency of integration after insertion and plasmid erasing, but before SacB counterselection, at -99% by measuring the fluorescence of GFP (Figure 5d). The study then confirmed the integration via colony PCR of the inserted region (Figure 5c, i) after plating cells on LB agar with sucrose (Methods). The study then demonstrated sequential integration by inserting the mKate gene (Payload 2) in the second aGSH, simultaneously reintroducing the first aGSH flanking an ampicillin resistance gene (Figure 5e-g). The percentage of cells that received the second integration was shown to be -90% based on cytometry and was confirmed via colony PCR (Figure 5hj, also see Figure 17). The study also tested a version of this integration circuit where the pSClOl plasmid did not contain the sacB gene, and observed nearly identical performance (Figure 17). These results demonstrated that the recombinase system could be used for efficient genomic integration, which should allow for the rapid development of derivative strains for user-specific applications.

[0232] MEMORY expansion via programmable CRISPR protection. Serine integrases bind to and recombine all pairs of cognate att sites concurrently, with the capability of recombining orthogonal sites defined by unique dinucleotide (core) sequences. Consequently, achieving two or more discrete (decoupled) memory operations requires the use of multiple recombinases - z.e., one recombinase per set(s) of cognate attachment sites.

[0233] Accordingly, the study sought to develop a technology that would allow for the systematic expansion of single recombinase circuit capacity. The goal was to program one recombinase to independently recombine two or more cognate attachment sites, including the ability to differentiate between identical att sites that would result in unique recombination events. The study posited that dCas9 could be repurposed to bind (within or in proximity to) specific recombinase att sites and protect the DNA from programmed recombination. Shur and Murray presented a proof-of-concept of unregulated dCas9-mediated protection of a single att site cognate to Bxbl in a cell-free (TX-TL) environment

[0065] , which is distinct from canonical CRISPR interference (CRISPRi) of transcription

[0066] . The study posited that it could achieve an advance over this design via (i) generalization of dCas9-mediated att site protection to a panoply of recombinases in a living system, (ii) demonstration that dCas9-mediated protection can be controlled in parallel with MEMORY, and (iii) demonstration that dCas9-mediated protection is amenable to Transcriptional Programming.

[0234] dCas9-mediated protection with synthetic TFs from the Transcriptional Programming (z.e., decision-making) toolkit (Figure 6e-f, also see Figure 20), enabling the study to unify tenets 1 and 2 in a single chassis cell. Namely, the study demonstrated that three of the synthetic TFs - that constitute fundamental BUFFER operations - could be used to form simple programs that run orthogonally to MEMORY inputs. Herein, the study refers to the programmable iteration of dCas9-mediated protection of DNA as CRISPR protection (CRISPRp). The inventors demonstrated in previous work that the development of BUFFER operations using the synthetic TFs correlates with the ability to construct complex Boolean decision-making

[0041] . Collectively, this result demonstrates that EcMem chassis cells are capable of MEMORY operations via Marionette regulators, with concurrent (and orthogonal) T-Pro-regulated CRISPRp of specific att sites in a complex memory circuit.

[0235] Engineering a MEMORY -controlled next-generation recombinase-based state machine. To demonstrate how CRISPRp can be used in conjunction with the MEMORY platform for a specific application, the study engineered a next-generation recombinase-based state machine (ngRSM) (Figure 7). In an elegant study, Roquet el al. developed a collection of RSMs in E. colin. Briefly, said RSMs used input-driven recombinases to manipulate DNA registers made up of overlapping and orthogonal pairs of recombinase att sites via a maximum of three regulated recombinases. DNA registers were designed to adopt a distinct DNA state (predicated on the concurrent recombination of all pairs of cognate att sites) for every possible permuted substring of inputs (Figure 21). For example, a 2-input system mapped to a register containing two sets of orthogonal attachment sites - i.e., where recombinase 1 corresponds to an inversion att configuration, and recombinase 2 corresponds to two sets of att sites distinguished by variation in the central dinucleotide - resulting in 5 unique states.

[0236] A limitation of current RSM technology is that DNA registers require complete sets (i.e., even-numbered pairs) of att sites to function - such that all att sites are recombined in the presence of a cognate recombinase. In principle, a canonical 2-input 5- state RSM can be expanded to a 2-input 16- state RSM via CRISPRp of single att sites (Figure 22). Conceptually, the number of inputs that the EcMem chassis can sense and respond to includes the six recombinase inducers, and any additional T-Pro signals corresponding to CRISPRp regulators - e.g., TFs regulating sgRNAs for CRISPRp - including multiple-input T-Pro operations (Figure 6e). To date, 5 signal-distinct syntheticrepressors [4] and 5 signal-distinct anti-repressors [5],

[0050] ,

[0067] have been developed. In principle, this system of network-capable transcription factors can be used to develop more than 100 2-input T-Pro operations that can be used to regulate and program multiple CRISPRp operations. This creates a rich design space for the development of a vast number of next-generation RSMs where specific recombinases must be induced in the correct order, with CRISPRp providing a method for post-translationally controlling the site of recombinase action.

[0237] As a proof-of-concept, the study designed, built, and tested a 3-input ngRSM - specifically in the form of a gene-regulatory RSM (GRSM), as defined by Roquet et al. (Figure 7). As designed, the register of the ngGRSM contains 2 sets of odd-numbered attachment sites (z.e., an attB / attP set with a duplicated all site) corresponding to Bxbl and Int3, and one even-numbered set corresponding to Int8. In principle, given the correct sequence of inputs, a functional circuit is formed (recombined) - resulting in the constitutive production of green fluorescent protein.

[0238] Without CRISPRp, this would result in four discrete states; however, if the same register is adapted with CRISPRp, this would result in nine discrete states (Figure 7a). The output gene (gfp) is initially inaccessible based on a protected Int3 excision GOF circuit. The Int3 excision circuit only becomes deprotected if Int8 is first induced, followed by Bxbl. If any MEMORY recombinase is induced out of sequence, a permanent change occurs via nested at sites that would otherwise be removed by the correct recombination sequence, permanently preventing the functional circuit from being formed (Figure 7b). The study tested all six possible induction patterns for the ngGRSM in EcMem and observed nearperfect performance for the prescribed sequences corresponding to their respective expression states (Figure 7c-d).

[0239] Design of PAM variants for CRISPRp. Given that the protospacer adjacent motif (PAM) sequence 5’-NGG-3’ is required for effective sgRNA-dCas9 binding of DNA

[0072] ,

[0073] , three different schemes were designed for directing dCas9 to an att site: i) addition of a synthetic PAM sequence immediately upstream or downstream of the -50-60 bp att sequence, ii) modification of the central core sequence of attB and attP sites to either CC or GG, creating two potential sgRNA binding sites, and iii) directing dCas9 via a naturally occurring PAM site located in an att sequence (Figure 18). The first design - i.e., adding synthetic PAM sequences adjacent to att sites - was most appealing as this would not modify the att sequence itself, and could provide up to four different targets per attB-attP pair (namely, one PAM at the 5’ or 3’ end of each att site). The study designated these targets asP1-P4, moving from 5’ to 3’ in a given recombinase’s inversion GOF circuit DNA sequence. Remarkably, near-perfect protection was observed from recombination for several of the tested sgRNA targets (Figure 6d, also see Figure 18). While a specific design rule did not emerge regarding optimal placement, the design heuristic held given that all three schemes yielded protection levels of >95% when applied to certain recombinases. Variable levels of protection were observed from different sgRNA targets, likely due to individual sgRNA-dCas9 binding efficiencies and sgRNA misfolding, which has been reported previously

[0074] , [75,

[0076] . Notably, the use of RNA folding tools did not reveal obvious connections between successful sgRNAs and proper folding. The study also experienced instances of overprotection, specifically with the Int8 att core-targeting circuits. Initially, Int8 was unable to fully recombine its target when induced, which we posited was due to leaky sgRNA production. Weakening of the sgRNA promoter successfully restored Int8 recombination activity while still maintaining strong protection. In contrast, while the study was able to demonstrate successful CRISPRp applied to Al 18, this required the use of an inducible dCas9, as leaky Al 18 activity was observed when using constitutive dCas9 (Figure 19). This collection of circuits highlights that CRISPRp is highly generalizable - i.e., in principle, can be applied to any recombinase system.

[0240] Engineering communication between MEMORY chassis cells. Having demonstrated synthetic memory and the foundation for decision-making in EcMem chassis cells, the study wanted to incorporate tenet 3 (see Figure 1) of intelligence in the context of MEMORY by including an intercellular communication component. Highlighting that MEMORY inputs DAPG, 3OC6 AHL, and vanillic acid can be synthesized in vivo through their corresponding synthase pathways, the study sought to optimize the performance of autoinduction programs that correspond to the cognate biosynthesis pathways for these putative MEMORY communication signals. To this end, the study used LacI to regulate the phlACBD operon for DAPG production, luxl for 3OC6 AHL production, or an asbF and HsOMT operon for vanillic acid production

[0068] . Each regulated biosynthetic pathway was designed to function as an inducible input for its cognate biosensor present in the genome- integrated MEMORY system, such that induction would cause a corresponding recombinase to activate an inversion GOF circuit located on the same plasmid containing the synthase pathway (Figure 8a-b). The design goal for each autoinduction program was to achieve near digital recombination performance - i.e., successful recombination of an inversion GOF target with >95% efficiency while exhibiting <5% recombination in the uninduced state. This required synthase pathway tuning via optimization of promoters, RBSs, and degradation tagsfor each set of genes. In all cases, the study was able to achieve the desired autoinduction effect - i.e., near digital recombination performance quantified by flow cytometry (Figure 8c-e). In turn, the study validated these synthase pathways as effective intercellular communication channels by co-culturing EcMem “sender” strains harboring the inducible biosynthetic pathways with EcMem “receiver” strains harboring the appropriate inversion GOF circuits (Figure 8f-i). Congruent with the design goal, the study observed near digital performance for MEMORY -mediated intercellular communication measured by flow cytometry.

[0241] Engineering a probiotic MEMORY strain for therapeutic applications.While the EcMem strain should allow for diverse applications in metabolic engineering and cellular programming, it is envisioned that the recombinase-based MEMORY platform could be useful for engineering advanced functionalities into the probiotic E. coli Nissle 1917. Therefore, the study transferred the MEMORY system into the genome of the Nissle chassis cell to create a probiotic memory strain (EcMempro). The study characterized the performance of all 24 recombinase circuits in EcMemproboth aerobically and anaerobically (Figure 23), as the typical application of Nissle is in the gastrointestinal (GI) tract. Interestingly, the performance of certain circuits varied unpredictably under anaerobic conditions, but the majority behaved as expected. In principle, the EcMemprostrain could be exogenously regulated to produce up to six separate therapeutic modalities by mapping them to orthogonal recombinase circuits.

[0242] Programmed information exchange between EcMemproand Bacteroides thetaiotaomicron. Given that Nissle does not stably colonize the human GI tract, it must be administered regularly for it to be effective. Bacteroides species, however, are long-term residents of the human colon and are gaining attention as live therapeutic candidates. Having the ability to program information exchange between transient probiotics such as EcMemproand stably colonizing species such as B. thetaiotaomicron would represent a paradigm shift in consortium-based living therapeutic technology. To date, there are no reports of synthetic communication systems developed for Bacteroides species. To address this challenge, the study developed a vanillic acid-inducible circuit in B. thetaiotaomicron with Nanoluc as the output (Figure 24). Next, the study repurposed the Intl2 autoinduction program to produce the vanillic acid biosynthetic pathway as the output instead of GFP (Figure 8j). The study then co-cultured EcMemprocells harboring this program with B. thetaiotaomicron cells containing the vanillic acid sensor regulating Nanoluc. The addition of IPTG to the co-culture resulted in a significant increase in Nanoluc expression at levels comparable to when purevanillic acid was added (Figure 8k). This result demonstrates the unification of tenets 1, 2, and 3 in an engineered system, which should facilitate the development of myriad applications in personalized medicine and beyond.

[0243] Methods

[0244] Bacterial strains and media. E. coli strains used were NEB® 10-beta (for routine cloning), TransforMax™ EPI 300™ (for BAC amplification), TransforMax™ EC100D pir+ (for R6K plasmid propagation), S17-1 pir (for conjugation), MG1655 Marionette-Wild9, and Nissle 1917 (Mutaflor). E. coli were routinely cultured aerobically in LB Miller Medium (Fisher BP9723) at 37°C (unless otherwise specified) with shaking, on LB Miller agar (Fisher BP1425), or in M9 Minimal Medium (MM) (MM contains 3 g / L KH2PO4, 0.5 g / L NaCl, 6.78 g / L Na2HPO4, 1 g / L NHrCl, 0.1 mM CaCL, 2 mM MgSCh, 1 mM thiamine hydrochloride, 0.4% D-glucose, and 0.2% casamino acids). B. thetaiotaomicron (ATCC 29148) was routinely cultured anaerobically at 37°C in TYG broth or BHI Agar (Difco), unless otherwise specified. One liter of TYG broth contains: [10 g tryptone, 5 g yeast extract, 2.5 g D-glucose, 0.5 g L-cysteine, 13.6 g KH2PO4, 9.2 mg MgSO4, 1 g NaHCOs, 80 mg NaCl, 8 mg CaCh, 1 mg menadione, 0.218 mg FeSO4, 5 pg vitamin B12, and 1 ml histidine hematin solution (1.2 mg / ml hematin in 0.2 M histidine, pH 8.0)]. L- cysteine was resuspended in water and sterile filtered (0.2 pm VWR 28145-477). Menadione was resuspended in 100% ethanol. L-cysteine and menadione were prepared and added to autoclaved media immediately prior to inoculation. Anaerobic culturing was performed in a Whitley DG250 anaerobic chamber with an atmosphere of 10% H2, 10% CO2, and 80% N2 (Airgas X03NI80C2000511). Antibiotics for plasmid selection in E. coli were used at the following concentrations: carbenicillin (Goldbio C- 103-25)- 100 pg / ml; chloramphenicol (Goldbio C- 105-25)- 25 pg / ml; kanamycin (Goldbio K- 120-25)- 35 pg / ml. Antibiotics for Bacteroides were used as appropriate: erythromycin (Alfa Aesar J62279)-25 pg / ml and gentamycin (VWR 0304-500G)- 200 pg / ml.

[0245] Chemical inducers. The following chemicals were used as inducers: Isopropyl-beta-D-thiogalactoside (IPTG, Goldbio 12481C); 2,4-Diacetylphloroglucinol (DAPG, Acros Organics 15214288); Anhydrotetracycline HC1 (aTc, Alfa Aesar AAJ66688MA); L-arabinose (L-ara, Carbosynth MA02043); Cuminic acid (cuminic acid, Sigma 268402); Vanillic acid (vanillic acid, Alfa Aesar A12074); 3 -Oxohexanoy 1- homoserine lactone (3OC6 AHL, Sigma K3007); D-Ribose (Alfa Aesar A17894 ); Cellobiose (Acros Organics 108461000). The final concentrations used for each inducer were: 1 mMIPTG; 25 pM DAPG; 100 ng / ml aTc; 5 mM L-ara; 100 pM cuminic acid; 100 pM vanillic acid; 10 pM 3OC6 AHL; 10 mM Ribose; 10 mM Cellobiose.

[0246] Cloning and plasmid construction. The BAC backbone vector was a kind gift from J. J. Collins (MIT) and J. W. Lee (POSTECH). Recombinase genes were synthesized as gene fragments and subcloned using standard molecular biology techniques. All BAC constructs were created using Golden Gate assembly69. pSClOl constructs were created using Golden Gate assembly, inverse PCR, and Gibson cloningvo. Q5 polymerase (NEB M0491L) was used for PCR. T4 DNA ligase (NEB M0202L), BsmBLv2 (R0739L), and BsaI-HFv2 (NEB R3733L) were used for Golden Gate cloning. NEBuilder HiFi DNA Assembly Master Mix (NEB E2621X) was used for Gibson cloning. All DNA primers were synthesized by Eurofins Genomics. The DNA sequences of all constructs were verified by Sanger sequencing (Eurofins Genomics). Relevant plasmid maps are given in Figure 27.

[0247] Conjugation of Bacteroides. E. coli S17-1 pir was used for conjugation of plasmids into Bacteroides. The pNBU2 vector harbors intN2 which mediates site-specific recombination of the attN2 site of pNBU2 and one of two attB2 sites located at the 3' ends of tRNA-Ser genes in Bacteroides genomes. Simultaneous insertion of pNBU2 vectors at both sites was not observed, likely due to the necessity of having at least one functional tRNA-Ser gene. Donor cultures of E. coli S17-1 pir transformed with the appropriate pNBU2 construct and recipient cultures of Bacteroides were separately grown to OD600-0.5. 1 ml of donor culture and 1 ml of recipient culture were pelleted by centrifugation (5000 x g, 5 min.) separately and resuspended in 1 ml of PBS. This step was then repeated for a second wash. The cultures were then mixed at a ratio of 1:10 (donor: receiver) and pelleted again by centrifugation. Cells were resuspended in 100 pL PBS and spot plated on a BHI agar plate. The mating lawn was grown aerobically at 37 °C for >16 h before being scraped into 3 ml of PBS. Serial dilutions were plated on BHI agar supplemented with gentamicin and erythromycin. Resultant colonies were picked into TYG after 24-48 h of anaerobic growth. Site-specific integration was confirmed using genome- specific primers.

[0248] Recombinase memory assay. Cells harboring a specific recombinase in the genome or on a BAC were transformed with the desired pSClOl output plasmid and plated on LB agar supplemented with chloramphenicol and kanamycin. After overnight incubation, three colonies were picked into separate 200 pL LB cultures supplemented with chloramphenicol and kanamycin in a flat-bottom 96-well plate (Coming 3370) and sealed with a Breathe Easier membrane (Electron Microscopy Sciences 70536-20). After 8 hours of growth in a Thermo Scientific MaxQ 4000 shaker at 300 rpm, these cultures were diluted1:200 into 200 pL M9 minimal medium with and without the inducer of the specific recombinase. These cultures were sealed with a Breathe Easy membrane (Electron Microscopy Sciences 70536-10) and grown for 12 hours, then diluted 1:200 into fresh medium of the same inducer conditions and grown for an additional 12 hours. These cultures were then diluted 1:200 into 200 pL M9 minimal medium containing no inducers and grown for 12-14 hours. After this final growth period, the cells were diluted 1:50 into PBS with 2 mg / ml kanamycin to arrest protein production. After greater than 1 hour of incubation at room temperature, samples were processed by flow cytometry to assess recombinase activity (see Cytometry analysis).

[0249] Genomic integration of inducible recombinases - EcMem construction.The inducible recombinase cassettes were serially integrated using the lambda red recombineering met hod? i. Briefly, the Al 18, Intl2, Bxbl, and Int8 genes were cloned into an R6K vector along with a kanamycin resistance cassette, upstream homology to araE, and downstream homology to the glvC pseudogene. The Int3 and Int5 genes were cloned into a second R6K vector along with a chloramphenicol resistance cassette, upstream homology to Int8, and downstream homology to the glvC pseudogene. Bsal sites were incorporated upstream and downstream of the homology regions to allow for linearization of the DNA to be integrated. Marionette -Wild was transformed with pKD46?i and made recombineering- ready. Briefly, transformants were selected on LB agar with carbenicillin at 30°C. A single colony was used to inoculate LB medium with carbenicillin and grown at 30°C overnight. The following morning this culture was diluted 1:200 into 50 ml fresh LB and grown for 1.5 hours. At this point, L-arabinose was added (5 mM) to induce recombineering proteins. Cells were grown for approximately 3 more hours until an OD600-0.5.

[0250] Cells were then chilled on ice for 15 minutes, pelleted by centrifugation (10 minutes at 4300xg), and resuspended in 50 ml ice-cold 10% glycerol. Cells were then pelleted again and resuspended in 25 ml ice-cold 10% glycerol.

[0251] Cells were pelleted a final time and resuspended in 500 pL ice-cold 10% glycerol. 100 ng of Bsal- linearized DNA (Al 18, Intl2, Bxbl, Int8, and kanR) was electroporated into 50 pL recombineering-ready Marionette-Wild. Transformants were then selected on LB agar with kanamycin and grown at 37 °C. Single colonies were picked into LB medium with kanamycin, grown for 12 hours at 37°C, and then streaked onto fresh LB agar with kanamycin.

[0252] Resultant colonies were screened for the correct genomic insertion by colony PCR and sequencing of the inserted DNA region. These cells were then maderecombineering-ready and the insertion process was repeated with the last two recombinase cassettes, conferring chloramphenicol resistance. This EcMem strain was also modified to remove the chloramphenicol resistance through Flp-mediated excision of the resistance cassette. EcMempro was created in an analogous fashion, but the Marionette transcription factor operons were inserted first. Integration was performed at the LacI locus of EcN. The only difference between the EcMem and EcMempro memory arrays is that the Al 18 gene has a GTG start codon in EcMempro.

[0253] Recombinase kinetic assay. The EcMem strain was transformed with each of the six inversion GOF and excision GOF circuits. The following day, individual colonies were used to inoculate 200 pL LB precultures supplemented with chloramphenicol and kanamycin and grown for 10 hours in 96-well plates sealed with a Breathe Easier membrane. These cultures were then used to seed MM cultures (1:200 dilution) which were grown for an additional 10 hours in 96-well plates sealed with a Breathe Easy membrane. These MM cultures were then used to seed fresh 500 pL MM cultures with the appropriate inducer for a given circuit (1:100 dilution), in deep-well plates (Greiner 780271) sealed with a Breathe Easier membrane. At the same time, an additional set of MM cultures (without inducers) was seeded (1:200 dilution). These uninduced cultures were grown for 12 hours and analyzed by flow cytometry to assess recombination levels (designated as the 0-hour time point). The inducing cultures were grown for a total of 16 hours. To maintain cells in exponential phase, the inducing cultures were used to seed fresh inducer containing media (1:100 dilution) at 8 hours. Every 4 hours during the induction period, a fresh set of MM cultures without inducers was inoculated using the inducing cultures (1:200 dilution). These inducer- free cultures were all grown for 12 hours prior to being analyzed by flow cytometry.

[0254] Genetic stability assay. The EcMem strain was first transformed with the six inversion GOF circuits. Individual colonies were used to inoculate LB medium supplemented with chloramphenicol and kanamycin in 200 pL cultures sealed with a Breathe Easier membrane. These LB precultures were grown for 8 hours before being diluted 1:200 into MM with no inducers (sealed with Breathe Easy membranes hereafter). After 12 hours of growth, cultures were diluted 1:200 into fresh MM (designated as the start of Day 2). Cells were passaged in this manner every 12 hours for the remainder of the experiment. Every other day (Days 2, 4, 6, 8, and 10) a separate set of cultures was inoculated from the master set, each containing the inducer corresponding to the recombinase circuit of interest. These inducing cultures were grown for 24 hours, with a passaging step at 12 hours, and then allowed to grow for 12 hours in MM with no inducers. These outgrowth cultures wereassayed alongside the uninduced master cultures using flow cytometry. Cells during the final assay had been growing continuously in liquid culture for 11 days.

[0255] Quantification of origin eraser efficacy. After the first day of induction, cells were diluted 1:200 into MM containing L-arabinose and chloramphenicol and grown for an additional 24 hours with a passaging step at 12 hours. Cells were then diluted 1:200 into MM with chloramphenicol and no inducers and grown for 12 hours. After this final growth period, cells were analyzed by flow cytometry to check for pSClOl plasmid loss through GFP fluorescence. These final cultures were also diluted in sterile PBS with no antibiotics over 8 orders of magnitude and spot plated on LB agar with chloramphenicol only, and with chloramphenicol plus kanamycin. After overnight incubation at 37°C, colony-forming units (CFU) were counted for each condition.

[0256] CRISPR protection assay. For IPTG-inducible sgRNA CRISPRp circuits, cells transformed with a given circuit were precultured in LB medium supplemented with chloramphenicol and kanamycin with and without IPTG for 8 hours in a flat-bottom 96-well plate sealed with a Breathe Easier membrane. After 8 hours, the IPTG-free preculture was used to seed MM with and without the cognate inducer of a given recombinase (sealed with a Breathe Easy membrane). The IPTG-containing preculture was used to seed MM with IPTG or IPTG plus the cognate inducer of a given recombinase. These MM cultures were grown for 12 hours and then used to seed fresh media (with the same inducer combinations) at a 1:200 dilution. These cultures were grown for an additional 12 hours before being diluted 1:200 into MM without any inducers. After a final 12-hour growth period, these cultures were diluted 1:50 into PBS with 2 mg / ml kanamycin for flow cytometry analysis.

[0257] Inducible integration with the memory recorder. The first genomic safe harbor (aGSHl) based on the attP sites of Bxbl and Int8 was integrated into EcMem through the recombineering method described above. The promoter and attP sites of Bxbl and Int8 were cloned into the R6K vector along with the kanamycin resistance cassette, upstream homology to Int5, and downstream homology to the glvC pseudogene. The desired insert was digested with Bsal and electroporated into recombineering-ready EcMem cells. Confirmation of genomic insertion was performed as described above. The kanamycin resistance gene was then removed using FLP recombination. EcMem with aGSHl was transformed with a pSClOl plasmid (equipped with the origin eraser) containing the first gene to be integrated and a kanamycin resistance gene flanked by Int5 and Inti 2 attP sites (aGSH2), all nested between Bxbl and Int8 attB sites. Inducible integration was achieved by performing the Memory Assay in MM with kanamycin and inducing cells for 24 hours with aTc and vanillicacid. A second 24-hour induction with L-arabinose in the absence of kanamycin was performed to erase the pSClOl plasmid. After each induction period, cells were diluted 1:50 into PBS with 2 mg / ml kanamycin for cytometry analysis. After L-arabinose induction, cells were streaked on LB agar with 5% sucrose and kanamycin and grown at 37°C. Correct genomic insertion and pSClOl deletion were confirmed with colony PCR. A single integrated colony was picked and made chemically competent so that a second inducible integration could be performed. These cells were transformed with a new pSClOl plasmid containing the second gene to be integrated and an ampicillin resistance gene (nested between new Bxbl and Int8 attP sites), all nested between Int5 and Intl2 attB sites. These cells were induced in the same manner as the first round, with a 24-hour growth period in MM with cuminic acid plus 3OC6 AHL and carbenicillin, followed by a 24-hour growth period in MM with L-arabinose and no carbenicillin. After each induction period, cells were diluted 1:50 into PBS with 2 mg / ml kanamycin for cytometry analysis. After L-arabinose induction, cells were streaked on LB agar with 5% sucrose and carbenicillin and grown at 37°C. Correct genomic insertion and pSClOl deletion were confirmed with colony PCR.

[0258] Colony PCR for inducible integration genotyping. Colony PCR was conducted to confirm the insertion of the memory circuit and the deletion of the pSClOl plasmid after inducible integration. After pSClOl deletion with L-arabinose, cells were streaked on LB agar plates and individual colonies were randomly selected for colony PCR. Each colony was diluted in 100 pL DI H2O and 1 pL was added directly to the PCR reaction as a template. One set of primers was designed to specifically bind upstream and downstream of the inserted region to determine if the integration worked correctly. A second set of primers was designed to check the presence of pSClOl, testing the deletion of residual DNA sequences. The colony PCR reaction was performed with Q5 polymerase. A 7-minute incubation at 98°C (5 minutes for lysis, and 2 minutes for denaturation of DNA) was followed by a 30-second annealing step, a 30-second extension step, and a 30-second denaturation step (25 cycles). After the PCR, gel electrophoresis was performed with 1:12 diluted PCR products on 0.8% agarose gel with Ikb DNA Ladder (NEB #N3232). The gel bands are imaged by ChemiDoc XRS+ System (Bio-Rad). In the first integration colony PCR, the primers named CPlINT_fwd and CPlINT_rev bind to Bxbl attP and Int8 attP, respectively, checking the length of integration. Primers CPlERA_fwd and CPlERA_rev bind to Bxbl atB and Int3 atB, respectively, checking the presence of pSClOl plasmid. In the second integration colony PCR, the primers named CP2INT_fwd and CP2INT_rev bind downstream of the Int5 gene and downstream of glvC gene, respectively, checking the wholelength of the insertion. Primers CP2ERA_fwd and CP2ERA_rev bind to the kanR gene, linearizing the pSClOl plasmid. The sequences of colony PCR primers are as follows: CPHNT.fwd: GTCGGGGTTTGTACCG TACACCAC, CPlINT_rev: TTAATAAACTATGGAAGTATGTACAGTCTTGC, CPlERA.fwd: GCCCGGATGATCCTGACGAC, CPlERA.rev: TTTGTAAAGGAGAC TGATAATGGC, CP2INT_fwd: ATCCGCAGGCAAGCGAAGATG. CP2INT_rev: GTTGAGGATTTTCGCATTCGG, CP2ERA_fwd: TGGATACTTTCTCGGCAGGAG, CP2ERA_rev: TCATGGCTGATGCAATGCG.

[0259] E. coli intercellular communication assay. Sender cells (lacking chloramphenicol resistance) were transformed with the appropriate synthase plasmid while receiver cells (having chloramphenicol resistance) were transformed with the appropriate inversion GOF circuit. Individual 200 pL LB precultures were inoculated for the sender and receiver cells using single colonies. These cultures were grown for 8 hours in a flat-bottom 96-well plate sealed with a Breathe Easier membrane. Following this, the receiver cells were diluted with fresh MM to the following degrees: 1:100 for the Al 18 and Inti 2 circuits, and 1:20 for the Int8 circuit. Next, 2.5 pL of the diluted receiver cells and 2.5 pL of the precultured sender cells were seeded together into 1 ml of fresh MM with kanamycin, with and without 1 mM IPTG in deep- well plates (Greiner 780271) sealed with a Breathe Easier membrane. These cultures were grown for 12 hours and then diluted 1:200 into 200 pL of fresh MM with kanamycin (with the same IPTG conditions). After 12 hours of growth, cultures were diluted 1:200 into fresh MM containing both kanamycin and chloramphenicol (to kill the sender cells). After a final 12 hour growth period, cells were prepared for cytometry analysis.

[0260] Co-culture of EcMempro and B. thetaiotaomicron. A single colony of B. thetaiotaomicron (harboring the VanRNanoluc circuit) was used to inoculate 1 ml TYG and grown anaerobically overnight for 16 hours. Meanwhile, EcMemprowas transformed with the autoinduction-quorum sensing program. The next day, a single colony of EcMemprowas used to inoculate 200 pL LB with kanamycin (to be grown aerobically) while the B. thetaiotaomicron culture was diluted 1:200 into fresh TYG. These cultures were grown for 8 hours and the B. thetaiotaomicron cells were diluted 1:10 with fresh TYG. 5 pL of the diluted B. thetaiotaomicron cells and 5 pL of the precultured EcMemprocells were then used to seed 1 ml of TYG cultures without ligand, with IPTG, or with vanillic acid. These cultures were grown anaerobically for 16 hours, and then gently mixed with pipetting. 500 pL of cells was then pelleted by centrifugation (10,000xg for 5 minutes) and the supernatant was carefullyaspirated. The cell pellet was then resuspended in 30 pL Bugbuster Mastermix (Millipore 71456) and incubated at room temperature for 15 minutes to facilitate cell lysis. Nanoluc production was then quantified using a luminescence assay.

[0261] Luminescence assay. The Promega Nano-Gio assay kit was used to determine expression of NanoLuc. Assay buffer and substrate were mixed as per the manufacturer recommendation (1:50 ratio of substrate to buffer). 30 pL of this mixture was transferred to a well of a flat-bottom white 96-well microplate (Costar 3912) containing 40 pL DI water. Following cell lysis, 30 pL of lysate was added to the microplate well and mixed by pipetting. After 5 minutes of incubation, the luminescence was measured with a Spectramax M2e plate reader (Molecular devices) with 800 v gain and 30 reads per well. Data was collected with SoftMax Pro Software. Background luminescence generated from an equal mix of EcMempro and wildtype B. thetaiotaomicron cells lysed with Bugbuster was subtracted from each sample. Luminescence was then normalized to B. thetaiotaomicron colony forming units (CFUs). CFUs were determined for each co-culture by serially diluting the samples in sterile PBS and spot plating 5 pL of the lowest 3 dilutions ( 10“4- 10“6) in triplicate. Dilution plating was done on BHI agar supplemented with erythromycin (to select for B. thetaiotaomicron) and gentamycin (to kill EcMempro). Data was analyzed using Microsoft Excel and Graphpad Prism.

[0262] Cytometry analysis. Fluorescence analysis was performed with a Beckman Coulter Cytoflex S flow cytometer. Cells were diluted 1:50 into PBS with 2 mg / ml kanamycin and incubated for at least 1 hour at room temperature. Cells were processed at 10- 30 pL / min and monitored through the FITC channel for GFP expression and the ECD channel for mKate expression. Events were gated by forward scatter area vs. side scatter area to eliminate debris and then gated by side scatter height vs. side scatter area to discriminate doublets. More than 10,000 events were collected for final analysis. A representative gating schematic is shown in Figure 26.

[0263] Discussion

[0264] In this study, intelligent chassis cells were engineered capable of concurrent decision-making, memory storage, and intercellular communication by way of a MEMORY platform, significantly advancing the field of synthetic biology. By strategically mapping six optimized biosensors to six orthogonal recombinases, the instant study developed the largest integrated memory circuit platform to date. The optimization of recombinase activity was achieved by the development of near-perfect units of fundamental GOF and LOF operations,which serve as the building blocks for bespoke cellular programs. Specifically, the study demonstrated that the MEMORY platform can facilitate programmed inheritable modifications to extrachromosomal DNA and genomic DNA with high efficiency. To complement the synthetic memory system, the study introduced a means to post- translationally regulate recombinase action via CRISPRp.

[0265] In turn, the study demonstrated that CRISPRp can be regulated orthogonally using synthetic transcription factors from the Transcriptional Programming toolkit. Complementary to CRISPRp, the inventors recently developed a new form of synthetic memory termed "Interception”

[0039] (see

[0084] ). Interception is operational with the entire collection of synthetic transcription factors and runs cooperatively with the compressed Boolean logic programs.

[0266] In principle, CRISPRp can be used concurrently with interception - even on a shared att site - which should provide a powerful tool to expand the capabilities of MEMORY chassis cells. Moreover, CRISPRp can be used concurrently with CRISPRi, enabling the coordination of synthetic memory with transient gene knock-down(s), which can be used to increase the versatility of MEMORY chassis cells. The scale-up of recombinasebased genetic programs has been limited by the number of independently inducible recombinases, as well as the cellular burden they impose when overexpressed from multicopy plasmids

[0020] . As the engineered EcMem and EcMemprochassis cells double the number of inducible recombinases that can be used in a single E. coli cell compared to previous studies, they have significantly expanded the capacity for recombinase-based programming. Given that the MEMORY system is integrated into the genome and optimized for single-copy performance, the platform technology is operational with minimal metabolic burden. With the array of inducible recombinases modulating DNA-based memory circuits, CRISPRp provides the ability to couple Transcriptional Programming with recombination events, and intercellular communication allowing for multicellular applications; the instant study has provided a platform technology for advanced control over cellular behavior. The instant study demonstrated this capability by programming information exchange between the EcMemProstrain and Bacteroides thetaiotaomicron, presenting consortium-based living therapeutic technologies. This is the first system that allows for the direct integration of decision-making, memory, and communication in living cells. While the study have shown how to apply this platform in the area of living therapeutics, the combined technologies can be used to guide cellular processes in countless ways. The study shows that MEMORY strains are of great usein diverse applications in the areas of metabolic engineering, biosecurity, DNA information storage, and human health.TABLES

[0267] Table 1 : Plasmids created in this study.REFERENCES

[0268] The following patents, applications and publications as listed below and throughout this document are hereby incorporated by reference in their entirety herein.[1] Nielsen, A. A. & Voigt, C.A. Multi-input CRISPR / Cas genetic circuits that interface host regulatory networks. Mol Syst Biol 10, 763 (2014).[2] Nielsen, A. A. et al. Genetic circuit design automation. Science 352, aac7341 (2016).[3] Gander, M.W., Vrana, J.D., Voje, W.E., Carothers, J.M. & Klavins, E. Digital logic circuits in yeast with CRISPR-dCas9 NOR gates. Nat Commun 8, 15459 (2017).[4] Rondon, R.E., Groseclose, T.M., Short, A.E. & Wilson, C.J. Transcriptional programming using engineered systems of transcription factors and genetic architectures. Nat Commun 10, 4784 (2019).[5] Groseclose, T.M., Rondon, R. E., Herde, Z.D., Aldrete, C.A. & Wilson, C.J. Engineered systems of inducible antirepressors for the next generation of biological programming. Nat Commun 11, 4440 (2020).[6] Taketani, M. et al. Genetic circuit design automation for the gut resident species Bacteroides thetaiotaomicron. Nat Biotechnol 38, 962-969 (2020).[7] Guet, C.C., Elowitz, M.B., Hsing, W. & Leibler, S. Combinatorial synthesis of genetic networks. Science 296, 1466-1470 (2002).[8] Balazsi, G., van Oudenaarden, A. & Collins, J.J. Cellular decision making and biological noise: from microbes to mammals. Cell 144, 910-925 (2011).[9] Meyer, A.J., Segall-Shapiro, T.H., Glassey, E., Zhang, J. & Voigt, C.A. Escherichia coli "Marionette" strains with 12 highly optimized small-molecule sensors. Nat Chem Biol 15, 196-204 (2019).

[0010] Auslander, D. et al. Programmable full-adder computations in communicating three- dimensional cell cultures. Nat Methods 15, 57-60 (2018).

[0011] Tekel, S.J. et al. Engineered Orthogonal Quorum Sensing Systems for Synthetic Gene Regulation in Escherichia coli. Front Bioeng Biotechnol 7, 80 (2019).

[0012] Du, P. et al. De novo design of an intercellular signaling toolbox for multi-channel cell-cell communication and biological computation. Nat Commun 11, 4226 (2020).

[0013] Scott, S.R. & Hasty, J. Quorum Sensing Communication Modules for Microbial Consortia. ACS Synth Biol 5, 969-977 (2016).

[0014] Balagadde, F.K. et al. A synthetic Escherichia coli predator-prey ecosystem. Mol Syst Biol 4, 187 (2008).

[0015] Kylilis, N., Tuza, Z.A., Stan, G.B. & Polizzi, K.M. Tools for engineering coordinated system behaviour in synthetic microbial consortia. Nat Commun 9, 2677 (2018).

[0016] Sexton, J.T. & Tabor, J.J. Multiplexing cell-cell communication. Mol Syst Biol 16, e9618 (2020).

[0017] Bonnet, J., Subsoontorn, P. & Endy, D. Rewritable digital data storage in live cells via engineered control of recombination directionality. Proc Natl Acad Sci U SA 109, 8884-8889 (2012).

[0018] Bonnet, J., Yin, P., Ortiz, M.E., Subsoontorn, P. & Endy, D. Amplifying genetic logic gates. Science 340, 599-603 (2013).

[0019] Siuti, P., Yazbek, J. & Lu, T.K. Synthetic circuits integrating logic and memory in living cells. Nat Biotechnol 31, 448-452 (2013).

[0020] Yang, L. et al. Permanent genetic memory with >l-byte capacity. Nat Methods 11, 1261- 1266 (2014).

[0021] Farzadfard, F. & Lu, T.K. Synthetic biology. Genomically encoded analog memory with precise in vivo DNA writing in living cell populations. Science 346, 1256272 (2014).

[0022] Roquet, N., Soleimany, A.P., Ferris, A.C., Aaronson, S. & Lu, T.K. Synthetic recombinasebased state machines in living cells. Science 353, aad8559 (2016).

[0023] Weinberg, B.H. et al. Large-scale design of robust genetic circuits with multiple inputs and outputs for mammalian cells. Nat Biotechnol 35, 453-462 (2017).

[0024] Friedland, A.E. et al. Synthetic gene networks that count. Science 324, 1199-1202 (2009).

[0025] Tang, W. & Liu, D.R. Rewritable multi-event analog recording in bacterial and mammalian cells. Science 360, eaap8992 (2018).

[0026] Li, H., Sharp, R., Rutherford, K., Gupta, K. & Van Duyne, G.D. Serine Integrase attP Binding and Specificity. J Mol Biol 430, 4401-4418 (2018).

[0027] Olorunniji, F.J., Rosser, S.J. & Stark, W.M. Site-specific recombinases: molecular machines for the Genetic Revolution. Biochem J 473, 673-684 (2016).

[0028] Ghosh, P., Kim, A.I. & Hatfull, G.F. The orientation of my cobacteriophage Bxbl integration is solely dependent on the central dinucleotide of attP and attB. Mol Cell 12, 1101- 1111 (2003).

[0029] Loessner, M.J., Inman, R.B., Lauer, P. & Calendar, R. Complete nucleotide sequence, molecular analysis and genome structure of bacteriophage Al 18 of Listeria monocytogenes'. implications for phage evolution. Mol Microbiol 35, 324- 340 (2000).

[0030] Zuniga, A. et al. Rational programming of history-dependent logic in cellular populations. Nat Commun 11, 4758 (2020).

[0031] Ham, T.S., Lee, S.K., Keasling, J.D. & Arkin, A.P. Design and construction of a double inversion recombination switch for heritable sequential genetic memory. PLoS One 3, e2815 (2008).

[0032] Kim, T., Weinberg, B., Wong, W. & Lu, T.K. Scalable recombinase-based gene expression cascades. Nat Commun 12, 2711 (2021).

[0033] Archer, E.J., Robinson, A.B. & Siiel, G.M. Engineered E. coli that detect and respond to gut inflammation through nitric oxide sensing. ACS Synth Biol 1, 451-457 (2012).

[0034] Lapique, N. & Benenson, Y. Digital switching in a biosensor circuit via programmable timing of gene availability. Nat Chem Biol 10, 1020-1027 (2014).

[0035] Lapique, N. & Benenson, Y. Genetic programs can be compressed and autonomously decompressed in live cells. Nat Nanotechnol 13, 309-315 (2018).

[0036] Tang, H.L., Tang, H.M., Fung, M.C. & Hardwick, J.M. In vivo CaspaseTracker biosensor system for detecting anastasis and non-apoptotic caspase activity. Sci Rep 5, 9015 (2015).

[0037] Slomovic, S., Pardee, K. & Collins, J.J. Synthetic biology devices for in vitro and in vivo diagnostics. Proc Natl Acad Sci U SA 112, 14429-14435 (2015).

[0038] Courbet, A., Endy, D., Renard, E., Molina, F. & Bonnet, J. Detection of pathological biomarkers in human clinical samples via amplifying genetic switches and logic gates. Sci Transl Med 7, 289ra283 (2015).

[0039] Short, A.E., Kim, D., Milner, P.T. & Wilson, C.J. Next generation synthetic memory via intercepting recombinase function. Nat Commun 14, 5255 (2023).

[0040] Groseclose, T.M., Hersey, A.N., Huang, B.D., Realff, M.J. & Wilson, C.J. Biological signal processing filters via engineering allosteric transcription factors. Proc Natl Acad Sci U SA 118, e2111450118 (2021).

[0041] Huang, B.D., Groseclose, T.M. & Wilson, C.J. Transcriptional programming in a Bacteroides consortium. Nat Commun 13, 3901 (2022).

[0042] Chen, Y. et al. Genetic circuit design automation for yeast. Nat Microbiol 5, 1349-1360 (2020).

[0043] Salis, H.M., Mirsky, E.A. & Voigt, C.A. Automated design of synthetic ribosome binding sites to control protein expression. Nat Biotechnol 27, 946-950 (2009).

[0044] Lee, J.W. et al. Creating Single-Copy Genetic Circuits. Mol Cell 63, 329-336 (2016).

[0045] Guiziou, S., Mayonove, P. & Bonnet, J. Hierarchical composition of reliable recombinase logic devices. Nat Commun 10, 456 (2019).

[0046] Mimee, M., Tucker, A.C., Voigt, C.A. & Lu, T.K. Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst 1, 62-71 (2015).

[0047] Liu, Q., Schumacher, J., Wan, X., Lou, C. & Wang, B. Orthogonality and Burdens of Heterologous AND Gate Gene Circuits in E. coli. ACS Synth Biol 7, 553-564 (2018).

[0048] Espah Borujeni, A., Zhang, J., Doosthosseini, H., Nielsen, A.A.K. & Voigt, C.A. Genetic circuit characterization by inferring RNA polymerase movement and ribosome usage. Nat Commun 11, 5001 (2020).

[0049] Davey, J.A. & Wilson, C.J. Engineered signal-coupled inducible promoters: measuring the apparent RNA-polymerase resource budget. Nucleic Acids Res 48, 9995-10012 (2020).

[0050] Ceroni, F., Algar, R., Stan, G.B. & Ellis, T. Quantifying cellular capacity identifies gene expression designs with reduced burden. Nat Methods 12, 415-418 (2015).

[0051] Bittihn, P., Din, M.O., Tsimring, L.S. & Hasty, J. Rational engineering of synthetic microbial systems: from single cells to consortia. Curr Opin Microbiol 45, 92-99 (2018).

[0052] Venayak, N., Raj, K., Jaydeep, R. & Mahadevan, R. An Optimized Bistable Metabolic Switch To Decouple Phenotypic States during Anaerobic Fermentation. ACS Synth Biol 7, 2854-2866 (2018).

[0053] Riglar, D.T. & Silver, P.A. Engineering bacteria for diagnostic and therapeutic applications. Nat Rev Microbiol 16, 214-225 (2018).

[0054] Qian, Y., Huang, H.H., Jimenez, J.I. & Del Vecchio, D. Resource Competition Shapes the Response of Genetic Circuits. ACS Synth Biol 6, 1263-1272 (2017).

[0055] Gorochowski, T.E., Avcilar-Kucukgoze, L, Bovenberg, R.A., Roubos, J.A. & Ignatova, Z. A Minimal Model of Ribosome Allocation Dynamics Captures Trade-offs in Expression between Endogenous and Synthetic Genes. ACS Synth Biol 5, 710-720 (2016).

[0056] Darlington, A.P.S., Kim, J., Jimenez, J.L & Bates, D.G. Dynamic allocation of orthogonal ribosomes facilitates uncoupling of co-expressed genes. Nat Commun 9, 695 (2018).

[0057] Carbonell-Ballestero, M., Garcia-Ramallo, E., Montanez, R., Rodriguez-Caso, C. & Macia, J. Dealing with the genetic load in bacterial synthetic biology circuits: convergences with the Ohm's law. Nucleic Acids Res 44, 496-507 (2016).

[0058] Park, Y., Espah Borujeni, A., Gorochowski, T.E., Shin, J. & Voigt, C.A. Precision design of stable genetic circuits carried in highly-insulated E. coli genomic landing pads. Mol Syst Biol 16, e9584 (2020).

[0059] Triassi, A. J. et al. Redesign of an Escherichia coli Nissle treatment for phenylketonuria using insulated genomic landing pads and genetic circuits to reduce burden. Cell Systems 14, 512-524.e512 (2023).

[0060] Rankin, D.J., Rocha, E.P. & Brown, S.P. What traits are carried on mobile genetic elements, and why? Heredity (Edinb) 106, 1-10 (2011).

[0061] Ochman, H., Lawrence, J.G. & Groisman, E.A. Lateral gene transfer and the nature of bacterial innovation. Nature 405, 299-304 (2000).

[0062] Bergstrom, C.T., Lipsitch, M. & Levin, B.R. Natural selection, infectious transfer and the existence conditions for bacterial plasmids. Genetics 155, 1505-1519 (2000).

[0063] Chen, Y.J. et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nat Methods 10, 659-664 (2013).

[0064] Santos, C.N., Regitsky, D.D. & Yoshikuni, Y. Implementation of stable and complex biological systems through recombinase-assisted genome engineering. Nat Commun 4, 2503 (2013).

[0065] Shur, A. & Murray, R.M. Repressing Integrase attachment site operation with CRISPR- Cas9 in E. coli. bioRxiv (2017).

[0066] Qi, L.S. et al. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173-1183 (2013).

[0067] Richards, D.H., Meyer, S. & Wilson, C.J. Fourteen Ways to Reroute Cooperative Communication in the Lactose Repressor: Engineering Regulatory Proteins with Alternate Repressive Functions. ACS Synth Biol 6, 6-12 (2017).

[0068] Kunjapur, A.M., Tarasova, Y. & Prather, K.L. Synthesis and accumulation of aromatic aldehydes in an engineered strain of Escherichia coli. J Am Chem Soc 136, 11644-11654 (2014).

[0069] Engler, C., Kandzia, R. & Marillonnet, S. A one pot, one step, precision cloning method with high throughput capability. PLoS One 3, e3647 (2008).

[0070] Gibson, D.G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6, 343-345 (2009).

[0071] Datsenko, K.A. & Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U SA 97, 6640-6645 (2000).

[0072] Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012).

[0073] Sternberg, S.H., Redding, S., Jinek, M., Greene, E.C. & Doudna, J.A. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507, 62-67 (2014).

[0074] Thyme, S.B., Akhmetova, L., Montague, T.G., Valen, E. & Schier, A.F. Internal guide RNA interactions interfere with Cas9-mediated cleavage. Nat Commun 7, 11750 (2016).

[0075] Li, Y., Teng, X., Zhang, K., Deng, R. & Li, J. RNA Strand Displacement Responsive CRISPR / Cas9 System for mRNA Sensing. Anal Chem 91, 3989-3996 (2019).

[0076] Riesenberg, S., Helmbrecht, N., Kanis, P., Maricic, T. & Paabo, S. Improved gRNA secondary structures allow editing of target sites resistant to CRISPR-Cas9 cleavage. Nat Commun 13, 489 (2022).SEQUENCES

[0269] Table 2: Sequences of genetic parts used in this work.

Claims

CLAIMSWhat is claimed is:

1. A programmable drug-delivery system comprising a chassis cell, wherein the chassis cell (e.g., a Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)) comprises, a. an inducible promoter; b. a modified ribosome-binding site (RBS); c. one or more genes expressing one or more orthogonal inducible recombinase(s), d. one or more transcription factor(s), wherein the one or more transcription factor(s) regulate the one or more orthogonal inducible recombinase(s) expression; e. one or more degradation tag(s); f. a variable start codon; and g. a terminator, wherein the terminator provides transcriptional insulation, wherein the chassis cell is engineered to produce an orthogonal inducible recombinase, wherein the chassis cell facilitates discrete multi-input regulation of recombinase function to alter extrachromosomal nucleic acid, wherein chromosomal nucleic acid of the chassis cell is not altered.

2. The programmable drug-delivery system of claim 1, further comprising a drug.

3. The programmable drug-delivery system of any one of claim 1 or claim 2, wherein the chassis cell is a non-colonizing bacterium.

4. The programmable drug-delivery system of claim 3, wherein the non-colonizing bacterium is Escherichia coli.

5. The programmable drug-delivery system of any one of claims 1-4, wherein the inducible promoter is selected from a group consisting of PLacIR, PPhlF, PCymRC, Pvan, PLuxB, cH OsymC*, dH OsymC*, fH OsymC*, bH OttaC*, cG OttaC*, pPhl, pBAD, pTet, and PvanBT.

6. The programmable drug-delivery system of any one of claims 1-5, wherein the modified RBS is selected from a group consisting of phl3, cym2, lux2, van3, lac2, tet2, ara2, el, Al, BX, 13, 15, 18, and 112.

7. The programmable drug-delivery system of any one of claims 1-6, wherein the one or more orthogonal inducible recombinase(s) is selected from a group consisting of Al 18, Bxbl,Int3, Int5, Int8, and Inti 2.

8. The programmable drug-delivery system of any one of claims 1-7, wherein Al 18 comprises at least 70% of SEQ ID NO: 73.

9. The programmable drug-delivery system of any one of claims 1-8, wherein Al 18 comprises SEQ ID NO: 73.

10. The programmable drug-delivery system of any one of claims 1-9, wherein Bxbl comprises at least 70% of SEQ ID NO: 74.

11. The programmable drug-delivery system of any one of claims 1-10, wherein Bxbl comprises SEQ ID NO: 74.

12. The programmable drug-delivery system of any one of claims 1-11, wherein Int3 comprises at least 70% of SEQ ID NO: 75.

13. The programmable drug-delivery system of any one of claims 1-12, wherein Int3 comprises SEQ ID NO: 75.

14. The programmable drug-delivery system of any one of claims 1-13, wherein Int5 comprises at least 70% of SEQ ID NO: 76.

15. The programmable drug-delivery system of any one of claims 1-14, wherein Int5 comprises SEQ ID NO: 76.

16. The programmable drug-delivery system of any one of claims 1-15, wherein Int8 comprises at least 70% of SEQ ID NO: 77.

17. The programmable drug-delivery system of any one of claims 1-16, wherein Int8 comprises SEQ ID NO: 77.

18. The programmable drug-delivery system of any one of claims 1-17, wherein Intl2 comprises at least 70% of SEQ ID NO: 78.

19. The programmable drug-delivery system of any one of claims 1-18, wherein Intl2 comprises SEQ ID NO: 78.

20. The programmable drug-delivery system of any one of claims 1-19, wherein the one or more orthogonal inducible recombinase(s) is induced by an inducer.

21. The programmable drug-delivery system of claim 20, wherein the inducer is selected from a group consisting of 2,4-Diacetylphloroglucinol (DAPG), aTc, L-Ara, cuminic acid, vanillic acid, Isopropyl P-D-l -thiogalactopyranoside (IPTG), and 3OC6 Ahl.

22. The programmable drug-delivery system of any one of claims 1-21, wherein the chassis cell comprises 1, 2, 3, 4, 5, 6 orthogonal inducible recombinases or a combination thereof.

23. The programmable drug-delivery system of any one of claims 1-22, wherein the one or more transcription factor(s) is selected from a group consisting of PhlF, TetR, AraC, CymR, VanR, LacI, AraE, CelR (TAN), RbsR, and LuxR.

24. The programmable drug-delivery system of any one of claims 1-23, wherein the one or more degradation tag(s) is selected from a group consisting of DAS tag, AAV tag, and LAA tag.

25. The programmable drug-delivery system of any one of claims 1-24, wherein the terminator is selected from a group consisting of L3S1P11, L3S1P13, L3S2P21, L3S2P55, L3S3P00, L3S3P21, L3S3P22, L3S3P23, L3S3P41, ECK120010799, ECK120010818, ECK120010858-R, ECK120015170, ECK120015440, ECK120017009, ECK120033736, ECK120035133, rrnB Tl, BBa_B0014, BBa_B0053, BBa_B0062-R, BBa_B1006, and IOT.

26. The programmable drug-delivery system of any one of claims 1-25, wherein the system is configured as a gain-of-function (GOF) memory circuit for both inversion and excision attachment site configuration.

27. The programmable drug-delivery system of any one of claims 1-26, wherein the system is configured as a loss-of-function (LOF) memory circuit for both inversion and excision attachment site configuration.

28. The programmable drug-delivery system of any one of claims 1-27, wherein a catalytically inactive Cas9 (dCas9) is employed to a recombinase attachment site to prevent recombination with high (-99%) efficiency.

29. The programmable drug-delivery system of any one of claims 1-28, wherein extrachromosomal nucleic acid alteration comprises deletion, insertion, or inversion.

30. The programmable drug-delivery system of claim 29, wherein the insertion is a genomic insertion.

31. The programmable drug-delivery system of claim 30, wherein the genomic insertion is a functional element.

32. The programmable drug-delivery system of claim 31 , wherein the functional element comprises a reading frame shift, a promoter, a terminator, or a replication origin.

33. A synthetic probiotic composition comprising the programmable drug-delivery system of any one of claims 1 -32 and a pharmaceutically acceptable carrier.

34. A synthetic probiotic composition comprising a programmable drug-delivery system and a pharmaceutically acceptable carrier, wherein the programmable drug-delivery system comprises a chassis cell, wherein the chassis cell (e.g., a Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)) comprises, a. an inducible promoter; b. a modified ribosome-binding site (RBS); c. one or more genes expressing one or more orthogonal inducible recombinase(s), d. one or more transcription factor(s), wherein the one or more transcription factor(s) regulate the one or more orthogonal inducible recombinase(s) expression; e. one or more degradation tag(s); f. a variable start codon; and g. a terminator, wherein the terminator provides transcriptional insulation, wherein the chassis cell is engineered to produce an orthogonal inducible recombinase, wherein the chassis cell facilitates discrete multi-input regulation of recombinase function to alter extrachromosomal nucleic acid, wherein chromosomal nucleic acid of the chassis cell is not altered.

35. The synthetic probiotic composition of claim 34, further comprising a drug.

36. The synthetic probiotic composition of any one of claim 34 or claim 36, wherein the chassis cell is a non-colonizing bacterium.

37. The synthetic probiotic composition of claim 36, wherein the non-colonizing bacterium is Escherichia coli.

38. The synthetic probiotic composition of any one of claims 34-37, wherein the inducible promoter is selected from a group consisting of PLacIR, PPhlF, PCymRC, Pvan, PLuxB, cH OsymC*, dH OsymC*, fH OsymC*, bH OttaC*, cG OttaC*, pPhl, pBAD, pTet, and PvanBT.

39. The synthetic probiotic composition of any one of claims 34-38, wherein the modified RBS is selected from a group consisting of phl3, cym2, lux2, van3, lac2, tet2, ara2, el, Al, BX, 13, 15, 18, and 112.

40. The synthetic probiotic composition of any one of claims 34-39, wherein the one or more orthogonal inducible recombinase(s) is selected from a group consisting of Al 18, Bxbl, Int3, Int5, Int8, and Intl2.

41. The synthetic probiotic composition of any one of claims 34-40, wherein Al 18 comprises at least 70% of SEQ ID NO: 73.

42. The synthetic probiotic composition of any one of claims 34-41, wherein Al 18 comprises SEQ ID NO: 73.

43. The synthetic probiotic composition of any one of claims 34-42, wherein Bxbl comprises at least 70% of SEQ ID NO: 74.

44. The synthetic probiotic composition of any one of claims 34-43, wherein Bxbl comprises SEQ ID NO: 74.

45. The synthetic probiotic composition of any one of claims 34-44, wherein Int3 comprises at least 70% of SEQ ID NO: 75.

46. The synthetic probiotic composition of any one of claims 34-45, wherein Int3 comprises SEQ ID NO: 75.

47. The synthetic probiotic composition of any one of claims 34-46, wherein Int5 comprises at least 70% of SEQ ID NO: 76.

48. The synthetic probiotic composition of any one of claims 34-47, wherein Int5 comprises SEQ ID NO: 76.

49. The synthetic probiotic composition of any one of claims 34-48, wherein Int8 comprises at least 70% of SEQ ID NO: 77.

50. The synthetic probiotic composition of any one of claims 34-49, wherein Int8 comprises SEQ ID NO: 77.

51. The synthetic probiotic composition of any one of claims 34-50, wherein Intl2 comprises at least 70% of SEQ ID NO: 78.

52. The synthetic probiotic composition of any one of claims 34-51, wherein Intl2 comprises SEQ ID NO: 78.

53. The synthetic probiotic composition of any one of claims 34-52, wherein the one or more orthogonal inducible recombinase(s) is induced by an inducer.

54. The synthetic probiotic composition of claim 53, wherein the inducer is selected from a group consisting of 2,4-Diacetylphloroglucinol (DAPG), aTc, L-Ara, cuminic acid, vanillic acid, Isopropyl P-D- 1 -thiogalactopyranoside (IPTG), and 3OC6 Ahl.

55. The synthetic probiotic composition of any one of claims 34-54, wherein the chassis cell comprises 1, 2, 3, 4, 5, 6 orthogonal inducible recombinases or a combination thereof.

56. The synthetic probiotic composition of any one of claims 34-55, wherein the one or more transcription factor(s) is selected from a group consisting of PhlF, TetR, AraC, CymR, VanR, LacI, AraE, CelR (TAN), RbsR, and LuxR.

57. The synthetic probiotic composition of any one of claims 34-56, wherein the one or more degradation tag(s) is selected from a group consisting of DAS tag, AAV tag, and LAA tag.

58. The synthetic probiotic composition of any one of claims 34-57, wherein the terminator is selected from a group consisting of L3S1P11, L3S1P13, L3S2P21, L3S2P55, L3S3P00, L3S3P21, L3S3P22, L3S3P23, L3S3P41, ECK120010799, ECK120010818, ECK120010858-R, ECK120015170, ECK120015440, ECK120017009, ECK120033736, ECK120035133, rrnB Tl, BBa_B0014, BBa_B0053, BBa_B0062-R, BBa_B1006, and IOT.

59. The synthetic probiotic composition of any one of claims 34-58, wherein the system is configured as a gain-of-function (GOF) memory circuit for both inversion and excision attachment site configuration.

60. The synthetic probiotic composition of any one of claims 34-59, wherein the system is configured as a loss-of-function (LOF) memory circuit for both inversion and excision attachment site configuration.

61. The synthetic probiotic composition of any one of claims 34-60, wherein a catalytically inactive Cas9 (dCas9) is employed to a recombinase attachment site to prevent recombination with high (-99%) efficiency.

62. The synthetic probiotic composition of any one of claims 34-61, wherein extrachromosomal nucleic acid alteration comprises deletion, insertion, or inversion.

63. The synthetic probiotic composition of claim 62, wherein the insertion is a genomic insertion.

64. The synthetic probiotic composition of claim 63, wherein the genomic insertion is a functional element.

65. The synthetic probiotic composition of claim 64, wherein the functional element comprises a reading frame shift, a promoter, a terminator, or a replication origin.

66. The synthetic probiotic composition of any one of claims 34-65, wherein the chassis cell exchanges information with a stably colonizing species, wherein the stably colonizing species is found in the gut of a subject.

67. The synthetic probiotic composition of claim 66, wherein the stably colonizing species is Bacteroides thetaiotaomicron.

68. A method of preventing or treating gut microbiota dysbiosis in a subject in need thereof, the method comprising administering a therapeutically effective amount of a synthetic probiotic composition of any of claims 34-67 to the subject.

69. A method of preventing or treating gut microbiota dysbiosis in a subject in need thereof, the method comprising administering a therapeutically effective amount of a synthetic probioticcomposition comprising a programmable drug-delivery system and a pharmaceutically acceptable carrier, wherein the programmable drug-delivery system comprises a chassis cell, wherein the chassis cell (e.g., a Molecularly Encoded Memory via an Orthogonal Recombinase arraY (MEMORY)) comprises, a. an inducible promoter; b. a modified ribosome-binding site (RBS); c. one or more genes expressing one or more orthogonal inducible recombinase(s), d. one or more transcription factor(s), wherein the one or more transcription factor(s) regulate the one or more orthogonal inducible recombinase(s) expression; e. one or more degradation tag(s); f. a variable start codon; and g. a terminator, wherein the terminator provides transcriptional insulation, wherein the chassis cell is engineered to produce an orthogonal inducible recombinase, wherein the chassis cell facilitates discrete multi-input regulation of recombinase function to alter extrachromosomal nucleic acid, wherein chromosomal nucleic acid of the chassis cell is not altered.

70. The method of claim 69, further comprising a drug.

71. The method of any one of claim 69 or claim 70, wherein the chassis cell is a noncolonizing bacterium.

72. The method of claim 71, wherein the non-colonizing bacterium is Escherichia coli.

73. The method of any one of claims 69-72, wherein the inducible promoter is selected from a group consisting of PLacIR, PPhlF, PCymRC, Pvan, PLuxB, cH OsymC*, dH OsymC*, fH OsymC*, bH OttaC*, cG OttaC*, pPhl, pBAD, pTet, and PvanBT.

74. The method of any one of claims 69-73, wherein the modified RBS is selected from a group consisting of phl3, cym2, lux2, van3, lac2, tet2, ara2, el, Al, BX, 13, 15, 18, and 112.

75. The method of any one of claims 69-74, wherein the one or more orthogonal inducible recombinase(s) is selected from a group consisting of Al 18, Bxbl, Int3, Int5, Int8, and Intl2.

76. The method of any one of claims 69-75, wherein Al 18 comprises at least 70% of SEQ ID NO: 73.

77. The method of any one of claims 69-76, wherein Al 18 comprises SEQ ID NO: 73.

78. The method of any one of claims 69-77, wherein Bxbl comprises at least 70% of SEQ ID NO: 74.

79. The method of any one of claims 69-78, wherein Bxbl comprises SEQ ID NO: 74.

80. The method of any one of claims 69-79, wherein Int3 comprises at least 70% of SEQ IDNO: 75.

81. The method of any one of claims 69-80, wherein Int3 comprises SEQ ID NO: 75.

82. The method of any one of claims 69-81, wherein Int5 comprises at least 70% of SEQ IDNO: 76.

83. The method of any one of claims 69-82, wherein Int5 comprises SEQ ID NO: 76.

84. The method of any one of claims 69-83, wherein Int8 comprises at least 70% of SEQ IDNO: 77.

85. The method of any one of claims 69-84, wherein Int8 comprises SEQ ID NO: 77.

86. The method of any one of claims 69-85, wherein Intl2 comprises at least 70% of SEQ IDNO: 78.

87. The method of any one of claims 69-86, wherein Intl2 comprises SEQ ID NO: 78.

88. The method of any one of claims 69-87, wherein the one or more orthogonal inducible recombinase(s) is induced by an inducer.

89. The method of claim 88, wherein the inducer is selected from a group consisting of 2,4- Diacetylphloroglucinol (DAPG), aTc, L-Ara, cuminic acid, vanillic acid, Isopropyl P-D-l- thiogalactopyranoside (IPTG), and 3OC6 Ahl.

90. The method of any one of claims 69-89, wherein the chassis cell comprises 1, 2, 3, 4, 5, 6 orthogonal inducible recombinases or a combination thereof.

91. The method of any one of claims 69-90, wherein the one or more transcription factor(s) is selected from a group consisting of PhlF, TetR, AraC, CymR, VanR, LacI, AraE, CelR (TAN), RbsR, and LuxR.

92. The method of any one of claims 69-91 , wherein the one or more degradation tag(s) is selected from a group consisting of DAS tag, AAV tag, and LAA tag.

93. The method of any one of claims 69-92, wherein the terminator is selected from a group consisting of L3S1P11, L3S1P13, L3S2P21, L3S2P55, L3S3P00, L3S3P21, L3S3P22, L3S3P23, L3S3P41, ECK120010799, ECK120010818, ECK120010858-R, ECK120015170, ECK120015440, ECK120017009, ECK120033736, ECK120035133, rrnB Tl, BBa_B0014, BBa_B0053, BBa_B0062-R, BBa_B1006, and IOT.

94. The method of any one of claims 69-93, wherein the system is configured as a gain-of- function (GOF) memory circuit for both inversion and excision attachment site configuration.

95. The method of any one of claims 69-94, wherein the system is configured as a loss-of- function (LOF) memory circuit for both inversion and excision attachment site configuration.

96. The method of any one of claims 69-95, wherein a catalytically inactive Cas9 (dCas9) is employed to a recombinase attachment site to prevent recombination with high (-99%) efficiency.

97. The method of any one of claims 69-96, wherein extrachromosomal nucleic acid alteration comprises deletion, insertion, or inversion.

98. The method of claim 97, wherein the insertion is a genomic insertion.

99. The method of claim 98, wherein the genomic insertion is a functional element.

100. The method of claim 99, wherein the functional element comprises a reading frame shift, a promoter, a terminator, or a replication origin.

101. The method of any one of claims 69-100, wherein the chassis cell exchanges information with a stably colonizing species, wherein the stably colonizing species is found in the gut of the subject.

102. The method of claim 101, wherein the stably colonizing species is Bacteroides thetaiotaomicron.

103. The method of any one of claims 69-102, wherein the synthetic probiotic composition is administered to the subject orally.

104. The method of any one of claims 69-103, wherein the synthetic probiotic composition is administered to the subject daily or multiple times a day.

105. The method of any one of claims 69-104, wherein the synthetic probiotic composition is administered to the subject weekly, monthly, or only once.

106. The method of any one of claims 69-105, wherein the synthetic probiotic composition is administered to the subject daily for at least 1, 2, 3, 4, 5, 6,7, or 8 weeks.

107. The method of any one of claims 69-106, wherein the subject is a human.

Images