Ligand-directed targeting of cancer

WO2025208118A8PCT designated stage Publication Date: 2026-04-02RUTGERS THE STATE UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/022181
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-28
Filing Date
2025-03-28
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

There is a need for novel agents that target cancer cells, particularly colorectal cancer cells, due to the high incidence and mortality rates of colorectal cancer, especially in individuals with Lynch syndrome, where current therapies are inadequate.

Method used

Development of tumor cell targeting peptides, such as CAGWEGRGLC, CEGNHADHIC, CGAFGGGGC, CGWGGLLCC, CLSGTSGRC, CPKMAVVGFC, CSSHFSAMC, and CGWGGLLC, which are attached to or displayed on the surface of solid particles like bacteriophages or nanoparticles, to specifically target and deliver therapeutic agents to tumor cells, including colorectal cancer cells.

Benefits of technology

The peptides effectively target and deliver therapeutic agents to tumor cells, enhancing treatment efficacy by altering the local anti-tumor immune response and directly killing or preventing tumor growth, while also allowing for monitoring and administration of prodrugs based on thymidine kinase expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025022181_02042026_PF_FP_ABST
    Figure US2025022181_02042026_PF_FP_ABST
Patent Text Reader

Abstract

In one aspect, the present disclosure relates to tumor cell targeting peptides. In another aspect, the present disclosure relates to a method of targeting a therapeutic composition to a tumor cell in a subject, the method comprising administering to the subject a composition comprising a tumor cell targeting peptide attached to and / or displayed on the surface of a solid particle or conjugated to a cytotoxic agent.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Attorney Docket No.370602-7079WO1(00272) TITLE Ligand‐Directed Targeting of Cancer CROSS-REFERENCE TO RELATED APPLICATION The present application is entitled to priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No.63 / 571,349, filed March 28, 2024, which is incorporated herein by reference in its entirety. BACKGROUND Lynch syndrome, a subset of hereditary nonpolyposis colorectal cancer (HNPCC) syndrome, affects approximately 1 in 300 people in the United States and heightens the lifetime risk of malignancy. Colorectal cancer can manifest in individuals with this hereditary condition at any age, but it is especially common before the age of 50 years due to the autosomal dominant inheritance of a mutant DNA mismatch repair gene, such as MLH1. Moreover, colorectal cancer has recently become the first- and second-leading causes of cancer-related death among men and women, respectively, in this age range throughout the general population. Hence, the discovery of novel targets for therapeutic intervention in this disease is imperative. Thus, there is a need in the art for novel agents that target cancer cells, including colorectal cancer cells. The present disclosure addresses these needs. SUMMARY As described herein, the present disclosure relates to tumor cell targeting peptides. Also provided are methods of targeting a therapeutic composition to a tumor cell in a subject, the method comprising administering to the subject a composition comprising a tumor cell targeting peptide attached to and / or displayed on the surface of a solid particle or conjugated to a cytotoxic agent. In one aspect, the present invention provides a tumor cell targeting peptide comprising at least one amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO: 22), CGAFGGGGC (SEQ ID NO: 23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO: 28). In certain embodiments, the tumor cell is a colorectal cancer tumor cell. -1- 55335674.2 Attorney Docket No.370602-7079WO1(00272) In certain embodiments, the targeting peptide binds a ligand comprising a protein selected from the group consisting of AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN. In certain embodiments, the targeting peptide binds a ligand comprising an amino acid sequence set forth in any one of SEQ ID NOs: 21-28. In another aspect, the present invention provides a solid particle, wherein the surface of the solid particle displays the tumor cell targeting peptide of any one of the above aspects or embodiments, or any aspect or embodiment disclosed herein, wherein the solid particle is selected from the group consisting of a bacteriophage, engineered cell, tissue fragment, nanoparticle, vesicle, dendrimer, virus-like particle, adenovirus, adeno-associated virus (AAV), adeno-associated virus phage (AAVP), and any combinations thereof. In certain embodiments, the tumor cell targeting peptide is attached to and / or displayed on the surface of the solid particle. In certain embodiments, the solid particle of the above aspects or embodiments or any aspect or embodiment disclosed herein further comprises an agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, radioactive agent, salt, peptide, protein, lipid, nucleic acid, gas, and any combinations thereof, wherein the agent is attached to and / or contained within the solid particle. In certain embodiments, the solid particle is an AAVP. In certain embodiments, the AAVP comprises a therapeutic or suicide gene. In certain embodiments, the therapeutic gene comprises tumor necrosis factor (TNF). In certain embodiments, the suicide gene comprises Herpes simplex virus thymidine kinase (HSVtk). In another aspect, the present invention provides a fusion polypeptide comprising a tumor cell targeting peptide and a cytotoxic peptide, wherein the tumor cell targeting peptide comprises at least one amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28). In certain embodiments, the cytotoxic peptide comprises the amino acid sequence set forth in SEQ ID NO: 31. In certain embodiments, the tumor cell is a colorectal cancer cell. In certain embodiments, the tumor cell targeting peptide binds a ligand expressed by -2- 55335674.2 Attorney Docket No.370602-7079WO1(00272) the tumor cell. In certain embodiments, the ligand is a protein selected from the group consisting of AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN. In certain embodiments, the ligand comprises an amino acid sequence set forth in any one of SEQ ID NOs: 21-28. In another aspect, the present invention provides a fusion polypeptide comprising an antigen-binding domain conjugated to a cytotoxic agent, wherein the antigen-binding domain is derived from an antibody or antigen-binding fragment thereof, and wherein the antigen- binding domain comprises a tumor cell targeting peptide comprising an amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28). In certain embodiments, at least one complementarity determining regions (CDRs) of the antigen-binding domain comprises at least one of the tumor cell targeting peptides of the above aspects or embodiments or any aspect or embodiment disclosed herein. In certain embodiments, the tumor cell targeting peptide binds a ligand expressed by a tumor cell. In certain embodiments, the tumor cell ligand is a protein selected from the group consisting of AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN. In certain embodiments, the tumor cell ligand comprises an amino acid sequence set forth in any one of SEQ ID NOs: 21-28. In certain embodiments, the tumor cell is a colorectal cancer cell. In certain embodiments, the cytotoxic agent is selected from the group consisting of calicheamicin, monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), mertansine (DM1), or a derivative thereof. In another aspect, the present invention provides a method of targeting a solid particle to a tumor cell in a subject, the method comprising: administering to the subject the solid particle, wherein at least one tumor cell targeting peptide of the above aspects or embodiments or any aspect or embodiment disclosed herein is attached to and / or displayed on the surface of the solid particle, wherein the solid particle is selected from the group consisting of a bacteriophage, engineered cell, tissue fragment, nanoparticle, vesicle, -3- 55335674.2 Attorney Docket No.370602-7079WO1(00272) dendrimer, virus-like particle, adenovirus, adeno-associated virus (AAV), adeno-associated virus phage (AAVP), and any combinations thereof. In certain embodiments, the tumor cell targeting peptide comprises the amino acid sequence of SEQ ID NO: 24. In certain embodiments, the tumor cell targeting peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 21-28. In certain embodiments, the solid particle further comprises an agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, radioactive agent, salt, peptide, protein, lipid, nucleic acid, gas, and any combinations thereof, wherein the agent is attached to and / or contained within the solid particle. In certain embodiments, the solid particle is an AAVP. In certain embodiments, the AAVP comprises a therapeutic or suicide gene. In certain embodiments, the therapeutic gene comprises tumor necrosis factor (TNF). In certain embodiments, the suicide gene comprises Herpes simplex virus thymidine kinase (HSVtk). In certain embodiments, the tumor cell is a colorectal tumor cell. In another aspect, the present invention provides a method of treating, killing, and / or preventing growth of a tumor in a subject, the method comprising administering to the subject a solid particle, wherein the tumor cell targeting peptide of the above aspects or embodiments or any aspect or embodiment disclosed herein is attached to and / or displayed on the surface of the solid particle, wherein the solid particle is selected from the group consisting of a bacteriophage, engineered cell, tissue fragment, nanoparticle, vesicle, dendrimer, virus-like particle, adenovirus, adeno-associated virus (AAV), adeno-associated virus phage (AAVP), and any combinations thereof. In certain embodiments, the tumor cell targeting peptide comprises the amino acid sequence of SEQ ID NO: 24. In certain embodiments, the tumor cell targeting peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 21-28. In certain embodiments, the solid particle further comprises an agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, radioactive agent, salt, peptide, protein, lipid, nucleic acid, gas, and any combinations thereof, wherein the agent is attached to and / or contained within the solid particle. In certain embodiments, the solid particle is an AAVP which comprises a therapeutic or suicide gene. -4- 55335674.2 Attorney Docket No.370602-7079WO1(00272) In certain embodiments, the therapeutic gene comprises tumor necrosis factor (TNF). In certain embodiments, the suicide gene comprises Herpes simplex virus thymidine kinase (HSVtk). In certain embodiments, the method further comprises: monitoring the tumor for elevated thymidine kinase expression; and administering a prodrug selected from ganciclovir, ganciclovir elaidic acid ester, penciclovir, acyclovir, valacyclovir, (E)-5-(2-bromovinyl)-2′-deoxyuridine, zidovuline, 2′- exo-methanocarbathymidine, and combinations thereof to the subject when elevated thymidine kinase expression is detected in the tumor. In certain embodiments, the method further comprises evaluating the efficacy of the prodrug in treating, killing, and / or preventing growth of the tumor. In certain embodiments, the method further comprises monitoring the tumor for elevated TNF expression. BRIEF DESCRIPTION OF THE DRAWINGS The following detailed description of specific embodiments of the disclosure will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the disclosure, exemplary embodiments are shown in the drawings. It should be understood, however, that the disclosure is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. FIGs.1A-1C illustrate an overview of in vivo phage-displayed peptide library screenings for the discovery of ligand-receptors in non-human primates with hereditary colon adenocarcinoma. (FIG.1A) DNA-encoded peptides in the form of CX7C or CX8C (C = L- cysteine; X = any L-amino acid) are displayed on the pIII minor coat protein of filamentous phage particles. (FIG.1B) Intravenous administration and circulation of phage-displayed peptide libraries in a rhesus macaque with colon adenocarcinoma facilitates peptide ligand binding to accessible receptors throughout the vasculature and in the tumor microenvironment. Schematic created with BioRender. (FIG.1C) Experimental workflow for the discovery and validation of tumor-shared / exclusive targets. FIGs.2A-2C illustrate the set of 532 genes affected by high-impact germline mutations in the whole exomes of either or both screened rhesus macaques categorized by (FIG.2A) molecular function, (FIG.2B) biological process, and (FIG.2C) protein class. FIGs.3A-3B illustrate the identification of high-impact germline mutations in select genes via whole-exome sequencing of the two screened rhesus macaques, (FIG.3A) J615 and -5- 55335674.2 Attorney Docket No.370602-7079WO1(00272) (FIG.3B) J737. Genes are subdivided by COSMIC Cancer Gene Census tier one (red) and tier two (orange) along with additional DNA repair genes (blue). Incidence values were calculated by combining both alleles of each rhesus macaque. FIGs.4A-4B illustrate the correlation of 79 single-base substitution (SBS) mutational signatures between the screened rhesus macaques. Mutational signatures are quantified by (FIG.4A) absolute count and (FIG.4B) relative count based on opportunity. Pearson correlation coefficient R with corresponding two-tailed p-value was calculated between the two rhesus macaque (J615 and J737) datasets. FIGs.5A-5B illustrate the quantification of phage genomes across over 50 tissue types from the two rhesus macaques, (FIG.5A) J615 and (FIG.5B) J737, that were screened in vivo with phage-displayed peptide libraries based on quantitative PCR per 50 ng of DNA (n = 3 technical replicates). Data presented as mean ± SEM. FIGs.6A-6B illustrate the Peptide reads for each tissue type of the two screened rhesus macaques, (FIG.6A) J615 and (FIG.6B) J737, following next-generation sequencing (NGS) and bioinformatic analysis of phage-displayed DNA-encoded peptides. Whole bar represents total accumulated peptides, while colored bar represents distinct peptide sequences. CX7C and CX8C (grey-colored bar) correspond to sequencing results from phage-displayed peptide libraries. The total number of peptide reads from all tissues (excluding libraries) per animal subject is listed. FIGs.7A-7C illustrate the identification of homing peptides shared by colon tumors from the two screened rhesus macaques. (FIG.7A) Venn diagram of distinct peptide sequences identified across the two tumors. (FIG.7B) Amino acid motifs enriched among the 510 shared peptides. (FIG.7C) Number of sequencing reads for each of the 510 tumor-shared peptides across all tissue types of J615 (blue) and J737 (orange) rhesus macaques. FIGs.8A-8C illustrate the identification and clustering of 107 colon tumor-shared and -exclusive peptides from the combined repertoire of two screened rhesus macaques. (FIG. 8A) Sequencing reads of the 25 most abundant peptides (according to animal-combined read count). (FIG.8B) Unsupervised alignment and clustering of the peptides. The optimal number of clusters for the core amino acid sequences (i.e., excluding flanking cysteine residues) according to greatest Kullback-Leibler distance (KLD) was selected for classification. Underlined amino acid residues depict enriched motifs in the larger set of 510 tumor-shared (though not necessarily tumor-exclusive) peptides. Peptides denoted in bold were selected as representative ligands for further investigation. (FIG.8C) The most tumor- specific five-mer motifs among the seven peptides selected for further investigation. -6- 55335674.2 Attorney Docket No.370602-7079WO1(00272) FIGs.9A-9B illustrate the binding of peptide-displaying phage to the cell surface in comparison to insertless phage (negative control) using the Biopanning and Rapid Analysis of Selective Interactive Ligands (BRASIL) assay in HCT 116 (FIG.9A) and SNU-407 (FIG. 9B) cells. Bound phage are represented by transducing units (TU). Technical replicates (n=6) from a representative experiment are shown. Data presented as mean ± SEM. One-way ANOVA and post hoc Dunnett’s multiple comparisons test were conducted to calculate multiplicity-adjusted p-values. FIGs.10A-10B illustrate the internalization of peptide-displaying phage by HCT 116 cells after incubation for (FIG.10A) 2h and (FIG.10B) 18h. Phage internalization was evaluated by immunofluorescence. Representative images from a single experiment are shown (scale bar, 20 µm). Positive control is CDCRGDCFC (SEQ ID NO: 30)-displaying phage and negative controls are insertless phage and CDCRGDCFC (SEQ ID NO: 30)- displaying phage without primary antibody. FIGs.11A-11B illustrate the identification of potential binding partners for the representative colon tumor-shared and -exclusive peptides. (FIG.11A) Receptor isolations performed for peptide-affinity chromatography and liquid chromatography—tandem mass spectrometry (LC-MS / MS) from colon tumor specimens obtained from the rhesus macaques (blue) and human patients (pink). (FIG.11B) The repertoire of 12 potential targets for the pursued representative peptides. Within each three-dimensional (3D) atomic structure, regions unique to each protein (relative to the respective proteome) that were identified with LC-MS / MS are highlighted (blue for rhesus macaque, pink for human, and purple if shared). FIGs.12A-12B illustrate the validation of CGWGGLLCC (SEQ ID NO: 24) binding to hornerin (HRNR) in vitro. (FIG.12A) Binding of CGWGGLLCC (SEQ ID NO: 24)- displaying phage to immobilized human HRNR132–199 in comparison to insertless phage and BSA (negative controls). Bound phage are represented by transducing units (TU). Technical replicates (n=6) from a representative experiment are shown. Data presented as mean ± SEM. Two-way ANOVA and post hoc Bonferroni’s multiple comparisons test were conducted to calculate multiplicity-adjusted p-values. (FIG.12B) Binding of CGWGGLLCC (SEQ ID NO: 24)-displaying phage to immobilized human HRNR132–199 in the absence or presence of the synthetic corresponding peptide or unrelated peptide (amino acid sequence CAPAC (SEQ ID NO: 32)) at varying concentrations. Bound phage are represented by TU. Technical replicates (n=12 for no-peptide condition; n=6 for other conditions) from a representative experiment are shown. Data presented as mean ± SEM. Two-way ANOVA and post hoc Dunnett’s multiple comparisons test were conducted to calculate multiplicity- -7- 55335674.2 Attorney Docket No.370602-7079WO1(00272) adjusted p-values. FIG.13 illustrates immunohistochemical staining of hornerin (HRNR) in colon adenocarcinoma tissue sections obtained from five patients with mismatch repair deficiencies. Rabbit isotype IgG control antibody and no primary antibody were used as negative controls (scale bar, 100 µm). FIG.14 illustrates immunohistochemical staining of hornerin (HRNR) in normal tissue adjacent to the tumor (NAT) obtained from five patients with mismatch repair deficiencies. Rabbit isotype IgG control antibody and no primary antibody were used as negative controls (scale bar, 100 µm). FIGs.15A-15B illustrate a fluorescence-activated cell sorting (FACS) analysis of hornerin (HRNR) on the surface of an MLH1-deficient human colon adenocarcinoma cell line (HCT 116). (FIG.15A) Representative histograms of HRNR in addition to isotype control antibody and no primary antibody (negative controls). (FIG.15B) Percentage of cells positive for fluorescence. Technical replicates (n=2) from a representative experiment are shown. Data presented as mean ± SEM. Two-tailed independent-samples t-test was conducted to calculate the p-value. FIG.16 illustrates the identification of high-impact germline mutations in select genes via whole-exome sequencing of the two screened rhesus macaques, J615 and J737. Genes are subdivided and ordered by COSMIC Cancer Gene Census Tier 1 and Tier 2 followed by additional DNA repair genes. High-impact mutations are colored according to frameshift mutation (black), stop codon gain (white), or splice variant (grey). DETAILED DESCRIPTION In one aspect, the present disclosure relates to certain peptides that target tumor cells or ligands expressed preferentially by tumor cells. In some embodiments, the peptide is attached to and / or displayed on the surface of a solid particle. In some embodiments, the peptide is part of a fusion polypeptide with a cytotoxic peptide. In some embodiments, the peptide is comprised within the antigen-binding domain of a fusion polypeptide which is conjugated to a cytotoxic agent. One of skill in the art will understand that the solid particle can be any solid particle or fusion polypeptide thought and / or known to be safe for administration to a subject. In some embodiments, the solid particle is selected from the group consisting of a phage, engineered cell, tissue fragment, nanoparticle, vesicle, dendrimer, virus-like particle (VLP), adenovirus, adeno-associated virus (AAV), adeno- associated virus phage (termed AAVP), and any combinations thereof. In other embodiments, -8- 55335674.2 Attorney Docket No.370602-7079WO1(00272) the solid particle is a phage including, but not limited to, an adeno-associated virus phage (AAVP). In some embodiments, the solid particle further comprises a therapeutic agent, biologically active molecule, imaging agent, or radioactive agent which is contained in and / or attached to the solid particle. In some embodiments, a composition comprising the solid particle further comprises a therapeutic agent, biologically active molecule, imaging agent, or radioactive agent. In another aspect, the present disclosure relates to a method of targeting a solid particle to a tumor cell within a subject, wherein the method comprises administering to the subject a tumor cell targeting peptide attached to and / or displayed on the surface of the solid particle. In some embodiments, the administration occurs intravenously. In some embodiments, the tumor cell is a colorectal tumor cell. In another aspect, the present disclosure relates to a method of treating, killing, and / or preventing growth of a tumor in a subject, the method comprising administering to the subject an effective amount of a tumor targeting peptide. In some embodiments, the administration occurs intravenously. In yet another aspect, the present disclosure relates to a method of treating, killing, and / or preventing growth of a tumor in a subject, the method comprising administering to the subject a tumor targeting peptide attached to and / or displayed on the surface of a solid particle. In some embodiments, the administration occurs intravenously. In some embodiments, the tumor targeting peptide attached to and / or displayed on the surface of a solid particle treats and / or kills and / or prevents growth of the tumor by altering the local anti- tumor immune response in the subject. In some embodiments, the solid particle comprises a cytotoxic payload which directly kills and / or prevents growth of the tumor cells. In some embodiments, the solid particle is a phage, such as but not limited an AAVP, comprising any gene(s) contemplated in the art. In some embodiments, the phage comprises at least one therapeutic gene, such as but not limited to, Rb, CFTR, p16, p21, p27, p57, p73, C-CAM, APC, CTS-1, zac1, ras, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, BRCA1, VHL, MMAC1, FCC, MCC, BRCA2, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL- 11 IL-12, GM-CSF, G-CSF, thymidine kinase, Bax, Bak, Bik, Bim, Bid, Bad, Harakiri, Fas- L, mda-7, fus, interferon α, interferon β, interferon γ, ADP, p53, ABLI, BLC1, BLC6, CBFA1, CBL, CSFIR, ERBA, ERBB, EBRB2, ETS1, ETS2, ETV6, FGR, FOX, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCL1, MYCN, NRAS, PIM1, PML, RET, SRC, TAL1, TCL3, YES, MADH4, RB1, TP53, WT1, TNF, BDNF, CNTF, NGF, IGF, GMF, aFGF, bFGF, NT3, NT5, ApoAI, ApoAIV, ApoE, Rap1A, cytosine -9- 55335674.2 Attorney Docket No.370602-7079WO1(00272) deaminase, Fab, ScFv, BRCA2, zac1, ATM, HIC-1, DPC-4, FHIT, PTEN, ING1, NOEY1, NOEY2, OVCA1, MADR2, 53BP2, IRF-1, zac1, DBCCR-1, rks-3, COX-1, TFPI, PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst, abl, E1A, p300, VEGF, FGF, thrombospondin, BAI-1, GDAIF, MCC, and combinations thereof. In some embodiments, the phage comprises at least one “suicide” gene. Exemplary suicide genes include, but are not limited to, Herpes simplex virus thymidine kinase (HSVtk), Cytosine Deaminase (CD), Purine nucleoside phosphorylase (PNP), Cytochrome p450 enzymes (CYP), Carboxypeptidases (CP), Caspase-9, Carboxylesterase (CE), Nitroreductase (NTR), Horse radish peroxidase (HRP), Guanine Ribosyltransferase (XGRTP), Glycosidase enzymes, Methionine-α,γ-lyase (MET), Thymidine phosphorylase (TP), Oxidoreductase, Cytosine deaminase, Thymidine kinase thymidilate kinase (Tdk::Tmk), deoxycytidine kinase and combinations thereof. Examples of suicide gene / prodrug combinations which may be used are Herpes simplex virus thymidine kinase (HSVtk) and ganciclovir (GCV), acyclovir, or FIAU; oxidoreductase and cycloheximide; cytosine deaminase and 5-fluorocytosine; thymidine kinase thymidilate kinase (Tdk::Tmk) and AZT; and deoxycytidine kinase and cytosine arabinoside. In some embodiments, the solid particle is an AAVP comprising the Herpes simplex virus thymidine kinase (HSVtk) gene. In some embodiments wherein the solid particle is an AAVP comprising the HSVtk gene, the method further comprises the steps of monitoring the tumor for elevated thymidine kinase expression and administering ganciclovir (GCV) to the subject when elevated thymidine kinase expression is detected. In some embodiments, the method further comprises evaluating the efficacy of GCV in treating, killing, and / or preventing growth of the tumor. Reference will now be made in detail to certain embodiments of the disclosed subject matter, examples of which are illustrated in part in the accompanying drawings. While the disclosed subject matter will be described in conjunction with the enumerated claims, it will be understood that the exemplified subject matter is not intended to limit the claims to the disclosed subject matter. Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present disclosure, selected materials and methods are described herein. In describing and claiming the present disclosure, the -10- 55335674.2 Attorney Docket No.370602-7079WO1(00272) following terminology will be used. Throughout this document, values expressed in a range format should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, a range of "about 0.1% to about 5%" or "about 0.1% to 5%" should be interpreted to include not just about 0.1% to about 5%, but also the individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g., 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the indicated range. The statement "about X to Y" has the same meaning as "about X to about Y," unless indicated otherwise. Likewise, the statement "about X, Y, or about Z" has the same meaning as "about X, about Y, or about Z," unless indicated otherwise. In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, pharmacology, protein chemistry, and organic chemistry are those well- known and commonly employed in the art. Standard techniques are used for biochemical and / or biological manipulations. The techniques and procedures are generally performed according to conventional methods in the art and various general references, which are provided throughout this document. In this document, the terms "a," "an," or "the" are used to include one or more than one unless the context clearly dictates otherwise. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated. The statement "at least one of A and B" or "at least one of A or B" has the same meaning as "A, B, or A and B." In addition, it is to be understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading can occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference. "About" as used herein when referring to a measurable value such as an amount, a -11- 55335674.2 Attorney Docket No.370602-7079WO1(00272) temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. The term "ameliorating" or "treating" means that the clinical signs and / or the symptoms associated with a disease are lessened as a result of the actions performed. The signs or symptoms to be monitored will be well known to the skilled clinician. As used herein, by "combination therapy" is meant that a first agent is administered in conjunction with another agent. "In combination with" or "in conjunction with" refers to administration of one treatment modality (e.g., an AAVP targeted to a specific target) in addition to another treatment modality (e.g., another AAVP targeted to the same or different target). As such, "in combination with" refers to administration of one treatment modality before, during, or after delivery of the other treatment modality to the individual. Such combinations are considered to be part of a single treatment regimen or regime. As used herein, the term "conservative sequence modifications" is intended to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the peptide containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into a peptide of the disclosure by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues within a peptide of the disclosure can be replaced with other amino acid residues from the same side chain family and the altered peptide can be tested for the ability to bind tumor cells. A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate. In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it -12- 55335674.2 Attorney Docket No.370602-7079WO1(00272) would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health. "Encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA. As used herein "endogenous" refers to any material from or produced inside an organism, cell, tissue or system. The term "expression" as used herein is defined as the transcription and / or translation of a particular nucleotide sequence driven by its promoter. "Expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide. Herein in certain embodiments, a "gene" refers to a nucleic acid that is transcribed. In certain aspects, the gene includes regulatory sequences involved in transcription, or message production or composition. As will be understood by those in the art, this functional term "gene" includes both genomic sequences, RNA or cDNA sequences or smaller engineered nucleic acid segments, including nucleic acid segments of a non-transcribed part of a gene, including but not limited to the non-transcribed promoter or enhancer regions of a gene. Smaller engineered gene nucleic acid segments may express, or may be adapted to express using nucleic acid manipulation technology, proteins, polypeptides, domains, peptides, fusion proteins, mutants and / or such like. "Homologous" as used herein, refers to the subunit sequence identity between two -13- 55335674.2 Attorney Docket No.370602-7079WO1(00272) polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous. "Identity" as used herein refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an Arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e.g., five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 of 10), are matched or identical, the two amino acids sequences are 90% identical. "Isolated" means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell. By the term "modified" as used herein, is meant a changed state or structure of a molecule or cell of the disclosure. Molecules can be modified in many ways, including chemically, structurally, and functionally. Cells can be modified through the introduction of nucleic acids. By the term "modulating," as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and / or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and / or affecting a native signal or response thereby mediating a beneficial therapeutic -14- 55335674.2 Attorney Docket No.370602-7079WO1(00272) response in a subject, preferably, a human. "Parenteral" administration of an immunogenic composition includes, e.g., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, or infusion techniques. As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof. The peptide can be linear or branched, can comprise modified amino acids, and can be interrupted by non-amino acids. The terms also encompass an amino acid polymer modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides and proteins containing one or more analogs of an amino acid (including, for example, unnatural amino acids, and so forth), as well as other modifications known in the art. Polypeptides can occur as single chains or associated chains. As used herein, the term "pharmaceutical composition" refers to a mixture of at least one compound useful within the disclosure with other chemical components, such as carriers, stabilizers, diluents, adjuvants, dispersing agents, suspending agents, thickening agents, and / or excipients. The pharmaceutical composition facilitates administration of the compound to an organism. Multiple techniques of administering a compound exist in the art including, but not limited to: intravenous, oral, aerosol, parenteral, ophthalmic, pulmonary, and / or topical administration. The language "pharmaceutically acceptable carrier" includes a pharmaceutically acceptable salt, pharmaceutically acceptable material, composition or carrier, such as a liquid -15- 55335674.2 Attorney Docket No.370602-7079WO1(00272) or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a compound(s) of the present disclosure within or to the subject such that it can perform its intended function. Typically, such compounds are carried or transported from one organ, or portion of the body, to another organ, or portion of the body. Each salt or carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation, and not injurious to the subject. Some examples of materials that can serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; diluent; granulating agent; lubricant; binder; disintegrating agent; wetting agent; emulsifier; coloring agent; release agent; coating agent; sweetening agent; flavoring agent; perfuming agent; preservative; antioxidant; plasticizer; gelling agent; thickener; hardener; setting agent; suspending agent; surfactant; humectant; carrier; stabilizer; and other non-toxic compatible substances employed in pharmaceutical formulations, or any combination thereof. As used herein, "pharmaceutically acceptable carrier" also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound, and are physiologically acceptable to the subject. Supplementary active compounds can also be incorporated into the compositions. The term "polynucleotide" as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric "nucleotides." The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means. -16- 55335674.2 Attorney Docket No.370602-7079WO1(00272) The term "subject" is intended to include living organisms in which an immune response can be elicited (e.g., mammals). A "subject" or "patient," as used therein, can be a human or non-human mammal. Non-human mammals include, for example, non-human primates, and livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human. The term “suicide gene” as used herein is defined as a nucleic acid which, upon administration of a prodrug, effects transition of a gene product to a compound which kills its host cell. Examples of suicide gene / prodrug combinations which may be used are Herpes Simplex Virus-thymidine kinase (HSVtk) and ganciclovir, acyclovir, or FIAU; oxidoreductase and cycloheximide; cytosine deaminase and 5-fluorocytosine; thymidine kinase thymidilate kinase (Tdk::Tmk) and AZT; and deoxycytidine kinase and cytosine arabinoside. A "target site" or "target sequence" refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule can specifically bind under conditions sufficient for binding to occur. The term "therapeutic" as used herein means a treatment and / or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state. To "treat" a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject. A "vector" is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, Sendai viral vectors, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like. Ranges: throughout this disclosure, various aspects of the disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to -17- 55335674.2 Attorney Docket No.370602-7079WO1(00272) have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. Compounds and Compositions In one aspect, the present disclosure relates to certain peptides that target a tumor cells. In some embodiments, the present disclosure further relates to the identification of a peptide that targets a tumor cell. In some embodiments, the tumor cell targeting peptide targets colorectal cancer cells. In some embodiments, the tumor cell targeting peptide targets a surface receptor or ligand expressed by a tumor cell. In some embodiments, the tumor cell targeting peptide targets a protein comprising AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN. In some embodiments, the tumor cell targeting peptide binds to a ligand comprising an amino acid set forth in SEQ ID NOs: 21-28. In certain embodiments, the tumor cell targeting peptides contemplated within the disclosure include, but are not limited to, CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28). In certain embodiments, the tumor cell targeting peptides of the disclosure are cyclic, wherein the cysteine at position n and the cysteine at position n+8 form a disulfide bond. In other embodiments, the transport peptides of the disclosure are not cyclic. In yet other embodiments, the tumor cell targeting peptide consists of CAGWEGRGLC (SEQ ID NO:21). In yet other embodiments, the tumor cell targeting peptide consists of CEGNHADHIC (SEQ ID NO:22). In yet other embodiments, the tumor cell targeting peptide consists of CGAFGGGGC (SEQ ID NO:23). In yet other embodiments, the tumor cell targeting peptide consists of CGWGGLLCC (SEQ ID NO: 24). In yet other embodiments, the tumor cell targeting peptide consists of CLSGTSGRC (SEQ ID NO: 25). In yet other embodiments, the tumor cell targeting peptide consists of CPKMAVVGFC (SEQ ID NO: 26). In yet other embodiments, the tumor cell targeting peptide consists of CSSHFSAMC (SEQ ID NO: 27). In yet other embodiments, the tumor cell targeting peptide consists of CGWGGLLC (SEQ ID NO:28). In yet other embodiments, the tumor cell targeting peptide consists essentially of CAGWEGRGLC (SEQ ID NO:21). In yet other embodiments, the tumor cell targeting -18- 55335674.2 Attorney Docket No.370602-7079WO1(00272) peptide consists essentially of CEGNHADHIC (SEQ ID NO:22). In yet other embodiments, the tumor cell targeting peptide consists essentially of CGAFGGGGC (SEQ ID NO:23). In yet other embodiments, the tumor cell targeting peptide consists essentially of CGWGGLLCC (SEQ ID NO: 24). In yet other embodiments, the tumor cell targeting peptide consists essentially of CLSGTSGRC (SEQ ID NO: 25). In yet other embodiments, the tumor cell targeting peptide consists essentially of CPKMAVVGFC (SEQ ID NO: 26). In yet other embodiments, the tumor cell targeting peptide consists essentially of CSSHFSAMC (SEQ ID NO: 27). In yet other embodiments, the tumor cell targeting peptide consists essentially of and CGWGGLLC (SEQ ID NO:28). In yet other embodiments, the tumor cell targeting peptide comprises CAGWEGRGLC (SEQ ID NO:21). In yet other embodiments, the tumor cell targeting peptide comprises CEGNHADHIC (SEQ ID NO:22). In yet other embodiments, the tumor cell targeting peptide comprises CGAFGGGGC (SEQ ID NO:23). In yet other embodiments, the tumor cell targeting peptide comprises CGWGGLLCC (SEQ ID NO: 24). In yet other embodiments, the tumor cell targeting peptide comprises CLSGTSGRC (SEQ ID NO: 25). In yet other embodiments, the tumor cell targeting peptide comprises CPKMAVVGFC (SEQ ID NO: 26). In yet other embodiments, the tumor cell targeting peptide comprises CSSHFSAMC (SEQ ID NO: 27). In yet other embodiments, the tumor cell targeting peptide comprises CGWGGLLC (SEQ ID NO:28). In yet other embodiments, the tumor cell targeting peptide has at least 70%, 80%, 90%, or 100% homology with the peptide of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO: 23, SEQ ID NO:24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, or SEQ ID NO: 28. In yet other embodiments, the tumor cell targeting peptide has at least 70%, 80%, 90%, or 100% identity with the peptide of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO: 23, SEQ ID NO:24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, or SEQ ID NO: 28. In certain embodiments, the tumor cell targeting peptide contemplated in the invention is part of a polypeptide, wherein the N-terminus of the tumor cell targeting peptide is the N-terminus of the polypeptide (i.e., the N-terminus of the tumor cell targeting peptide is not coupled to other amino acids / peptides). In certain embodiments, the tumor cell targeting peptide contemplated in the invention is part of a polypeptide, wherein the N-terminus of the tumor cell targeting peptide is not the N-terminus of the polypeptide. In certain embodiments, the tumor cell targeting peptide contemplated in the invention is part of a polypeptide, wherein the N-terminus of the tumor cell targeting peptide is coupled through an amide bond to the C-terminus of a first amino acid (which is a single amino acid or the C-terminus of a -19- 55335674.2 Attorney Docket No.370602-7079WO1(00272) (poly)peptide). In certain embodiments, the first amino acid is aspartate. In certain embodiments, the first amino acid is glutamate. In certain embodiments, the first amino acid is lysine. In certain embodiments, the first amino acid is arginine. In certain embodiments, the first amino acid is histidine. In certain embodiments, the first amino acid is alanine. In certain embodiments, the first amino acid is valine. In certain embodiments, the first amino acid is leucine. In certain embodiments, the first amino acid is isoleucine. In certain embodiments, the first amino acid is proline. In certain embodiments, the first amino acid is phenylalanine. In certain embodiments, the first amino acid is methionine. In certain embodiments, the first amino acid is tryptophan. In certain embodiments, the first amino acid is glycine. In certain embodiments, the first amino acid is asparagine. In certain embodiments, the first amino acid is glutamine. In certain embodiments, the first amino acid is cysteine. In certain embodiments, the first amino acid is serine. In certain embodiments, the first amino acid is threonine. In certain embodiments, the first amino acid is tyrosine. In certain embodiments, the first amino acid is not aspartate. In certain embodiments, the first amino acid is not glutamate. In certain embodiments, the first amino acid is not lysine. In certain embodiments, the first amino acid is not arginine. In certain embodiments, the first amino acid is not histidine. In certain embodiments, the first amino acid is not alanine. In certain embodiments, the first amino acid is not valine. In certain embodiments, the first amino acid is not leucine. In certain embodiments, the first amino acid is not isoleucine. In certain embodiments, the first amino acid is not proline. In certain embodiments, the first amino acid is not phenylalanine. In certain embodiments, the first amino acid is not methionine. In certain embodiments, the first amino acid is not tryptophan. In certain embodiments, the first amino acid is not glycine. In certain embodiments, the first amino acid is not asparagine. In certain embodiments, the first amino acid is not glutamine. In certain embodiments, the first amino acid is not cysteine. In certain embodiments, the first amino acid is not serine. In certain embodiments, the first amino acid is not threonine. In certain embodiments, the first amino acid is not tyrosine. In certain embodiments, the tumor cell targeting peptide contemplated in the invention is part of a polypeptide, wherein the C-terminus of the tumor cell targeting peptide is the C-terminus of the polypeptide (i.e., the C-terminus of the tumor cell targeting peptide is not coupled to other amino acids / peptides). In certain embodiments, the tumor cell targeting peptide contemplated in the invention is part of a polypeptide, wherein the C-terminus of the tumor cell targeting peptide is not the C-terminus of the polypeptide. In certain embodiments, the tumor cell targeting peptide contemplated in the invention is part of a polypeptide, -20- 55335674.2 Attorney Docket No.370602-7079WO1(00272) wherein the C-terminus of the tumor cell targeting peptide is coupled through an amide bond to the N-terminus of a second amino acid (which is a single amino acid or the N-terminus of a (poly)peptide). In certain embodiments, the second amino acid is aspartate. In certain embodiments, the second amino acid is glutamate. In certain embodiments, the second amino acid is lysine. In certain embodiments, the second amino acid is arginine. In certain embodiments, the second amino acid is histidine. In certain embodiments, the second amino acid is alanine. In certain embodiments, the second amino acid is valine. In certain embodiments, the second amino acid is leucine. In certain embodiments, the second amino acid is isoleucine. In certain embodiments, the second amino acid is proline. In certain embodiments, the second amino acid is phenylalanine. In certain embodiments, the second amino acid is methionine. In certain embodiments, the second amino acid is tryptophan. In certain embodiments, the second amino acid is glycine. In certain embodiments, the second amino acid is asparagine. In certain embodiments, the second amino acid is glutamine. In certain embodiments, the second amino acid is cysteine. In certain embodiments, the second amino acid is serine. In certain embodiments, the second amino acid is threonine. In certain embodiments, the second amino acid is tyrosine. In certain embodiments, the second amino acid is not aspartate. In certain embodiments, the second amino acid is not glutamate. In certain embodiments, the second amino acid is not lysine. In certain embodiments, the second amino acid is not arginine. In certain embodiments, the second amino acid is not histidine. In certain embodiments, the second amino acid is not alanine. In certain embodiments, the second amino acid is not valine. In certain embodiments, the second amino acid is not leucine. In certain embodiments, the second amino acid is not isoleucine. In certain embodiments, the second amino acid is not proline. In certain embodiments, the second amino acid is not phenylalanine. In certain embodiments, the second amino acid is not methionine. In certain embodiments, the second amino acid is not tryptophan. In certain embodiments, the second amino acid is not glycine. In certain embodiments, the second amino acid is not asparagine. In certain embodiments, the second amino acid is not glutamine. In certain embodiments, the second amino acid is not cysteine. In certain embodiments, the second amino acid is not serine. In certain embodiments, the second amino acid is not threonine. In certain embodiments, the second amino acid is not tyrosine. Conservative amino acid replacements, i.e., replacements of one amino acid with another which has a related side chain, are also contemplated herein. Genetically-encoded amino acids are generally divided into four families: (1) acidic, i.e., aspartate, glutamate; (2) basic, i.e., lysine, arginine, histidine; (3) non polar, i.e., alanine, valine, leucine, isoleucine, -21- 55335674.2 Attorney Docket No.370602-7079WO1(00272) proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar, i.e., glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. In general, substitution of single amino acids within these families does not have a major effect on the biological activity. The polypeptides can have one or more (e.g., 1, 2, 3, and so forth) single amino acid deletions relative to the exemplified sequences. The polypeptides can also include one or more (e.g., 1, 2, 3, and so forth) insertions relative to the exemplified sequences. The disclosure further contemplates any nucleic acid sequences encoding any of the tumor cell targeting peptides of the disclosure, as well as any vectors comprising any nucleic acid sequences encoding any of the tumor cell targeting peptides of the disclosure, as well as any cells comprising any vector comprising any nucleic acid sequences encoding any of the tumor cell targeting peptides of the disclosure. The disclosure further contemplates nucleic acid sequences that have about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleic acid sequences provided herein. In certain embodiments, at least one residue within the tumor cell targeting peptide, and / or at the carboxy-terminus of the tumor cell targeting peptide, and / or at the amino- terminus of the tumor cell targeting peptide is methylated, amidated, acylated (such as, but not limited to, acetylated), and / or substituted with any other chemical group without adversely affecting activity of the tumor cell targeting peptide within the compositions and / or methods of the disclosure. In other embodiments, the N-terminus of the tumor cell targeting peptide is acylated, such as but not limited to acetylated. In other embodiments, the C- terminus of the tumor cell targeting peptide is amidated. In certain embodiments, the disclosure provides a fusion polypeptide, comprising a tumor cell targeting peptide and a cytotoxic peptide, wherein the tumor cell targeting peptide comprises at least one amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28). In some embodiments, the cytotoxic peptide comprises a D-(KLAKLAK)2 peptide and comprises the amino acid sequence set forth in SEQ ID NO: 31. The 14-amino- acid amphipathic α-helical peptide D-(KLAKLAK)2 is known in the art to induce apoptosis in cancer cells. This peptide does not directly disrupt the zwitterionic plasma membranes of eukaryotic cells but instead disrupts anionic prokaryotic cytoplasmic membranes and -22- 55335674.2 Attorney Docket No.370602-7079WO1(00272) eukaryotic mitochondrial membranes. When internalized, for example by a target cell (e.g., a tumor cell), D-(KLAKLAK)2 can disrupt the negatively charged mitochondrial membrane, resulting in cell death by mitochondrial-dependent apoptosis. In some embodiments, the conjugation of this peptide with the tumor cell targeting peptides of the current disclosure results in a therapeutic molecule that is capable of binding and killing tumor cells exclusively. In some embodiments, the tumor cells targeted by the fusion polypeptides of the current disclosure are colorectal cancer tumor cells. In certain embodiments, the disclosure provides a fusion polypeptide comprising an antigen-binding domain conjugated to a cytotoxic agent, wherein the antigen-binding domain is derived from an antibody or antigen-binding fragment thereof, and wherein the antigen- binding domain comprises a tumor cell targeting peptide comprising an amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28). In some embodiments, at least one of the complementarity determining region (CDRs) of the antigen-binding domain comprises at least one of the tumor cell targeting peptides. Complementarity determining regions are antigen-binding domains which determine the binding specificity of antibody or antibody- derived molecules which are normally part of larger framework regions within variable domains. There are three CDRs in each of the heavy and light chain variable domains that make up an antibody molecule or fragment thereof. In some embodiments, the tumor cell targeting peptide binds a ligand expressed by a tumor cell, and thus lends a binding specificity to the fusion polypeptide. In some embodiments, the tumor cell ligand is a protein selected from the group consisting of AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN. In some embodiments, the tumor cell ligand comprises an amino acid sequence set forth in any one of SEQ ID NOs: 21-28. In some embodiments, the cytotoxic agent is selected from the group consisting of calicheamicin, monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), mertansine (DM1), or a derivative thereof. It is also contemplated that the fusion polypeptides of the current disclosure can be used with any cytotoxic molecule or agent which known in the art which is capable of successful conjugation to an antibody or antibody-derived, antigen binding fragment. One who is skilled in the art would be able to select a cytotoxic agent appropriate for use with the fusion polypeptides of the current disclosure. In this way, the tumor-specific antigen binding domain of the fusion polypeptide -23- 55335674.2 Attorney Docket No.370602-7079WO1(00272) targets the molecule specifically to cancer cells, which are then killed through the action of the cytotoxic agent. In some embodiments, the tumor cell is a colorectal cancer tumor cell. In certain embodiments, the disclosure provides a solid particle, wherein the tumor cell targeting peptide is displayed on the surface of the solid particle. In some embodiments, the tumor cell targeting peptide is attached to the surface of the solid particle. In some embodiments, the tumor cell targeting peptide is covalently attached to the surface of the solid particle. In some embodiments, the solid particle is selected from the group consisting of a phage, engineered cell, tissue fragment, nanoparticle, vesicle, dendrimer, virus-like particle (VLP), adenovirus, adeno-associated virus (AAV), adeno-associated virus phage (termed AAVP), and any combinations thereof. In some instances, a nanoparticle has a diameter on the nanometer scale, and can vary from about 1 nm in diameter to about 5,000 nm in diameter. In some instances, a phage has a diameter that is lower than about 10 nm, such as but not limited to about 1 nm, 2 nm, 3 nm, 4 nm, 5 nm, 6 nm, 7 nm, 8 nm, 9 nm, or 10 nm. In some instances, a phage has a length that is lower than 1,000 nm, such as but not limited to about 100 nm, 200 nm, 300 nm, 400 nm, 500 nm, 600 nm, 700 nm, 800 nm, 900 nm, or 1,000 nm. In other instances, a phage has a length that is lower than 5,000 nm, such as but not limited to about 1,000 nm, 1,500 nm, 2,000 nm, 2,500 nm, 3,000 nm, 3,500 nm, 4,000 nm, 4,500 nm, or 5,000 nm. In certain embodiments, the tumor cell targeting peptide is attached to and / or displayed on the whole surface of the solid particle. In other embodiments, the tumor cell targeting peptide is attached to and / or displayed on at least a fraction of the surface of the solid particle. The solid particles can be prepared using methods known to those skilled in the art or purchased from commercial sources. In another embodiment, the solid particle is a phage, such as but not limited to an AAVP. In some embodiments, the phage carries any gene(s) contemplated in the art. In one embodiment, the phage comprises a therapeutic gene. The present disclosure contemplates the use of a variety of different therapeutic genes. For example, genes encoding enzymes, hormones, cytokines, oncogenes, receptors, ion channels, tumor suppressors, transcription factors, drug selectable markers, toxins, and various antigens are contemplated as suitable genes for use according to the present invention. In addition, antisense and inhibitory RNA constructs derived from oncogenes are other “genes” of interest according to the present invention. A therapeutic gene or polypeptide is a gene or polypeptide which can be administered to a subject for the purpose of treating or preventing a disease. For example, a therapeutic gene can be a gene administered to a subject for treatment or prevention of cancer. Exemplary therapeutic genes include, but are not limited to, Rb, CFTR, p16, p21, -24- 55335674.2 Attorney Docket No.370602-7079WO1(00272) p27, p57, p73, C-CAM, APC, CTS-1, zac1, ras, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, BRCA1, VHL, MMAC1, FCC, MCC, BRCA2, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 IL-12, GM-CSF, G-CSF, thymidine kinase, Bax, Bak, Bik, Bim, Bid, Bad, Harakiri, Fas-L, mda-7, fus, interferon α, interferon β, interferon γ, ADP, p53, ABLI, BLC1, BLC6, CBFA1, CBL, CSFIR, ERBA, ERBB, EBRB2, ETS1, ETS2, ETV6, FGR, FOX, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCL1, MYCN, NRAS, PIM1, PML, RET, SRC, TAL1, TCL3, YES, MADH4, RB1, TP53, WT1, TNF, BDNF, CNTF, NGF, IGF, GMF, aFGF, bFGF, NT3, NT5, ApoAI, ApoAIV, ApoE, Rap1A, cytosine deaminase, Fab, ScFv, BRCA2, zac1, ATM, HIC-1, DPC-4, FHIT, PTEN, ING1, NOEY1, NOEY2, OVCA1, MADR2, 53BP2, IRF-1, zac1, DBCCR-1, rks-3, COX-1, TFPI, PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst, abl, E1A, p300, VEGF, FGF, thrombospondin, BAI-1, GDAIF, MCC, and combinations thereof. In one embodiment, the phage comprises a “suicide” gene. Examples of suicide gene / prodrug combinations which may be used include, but are not limited to, Herpes simplex virus thymidine kinase (HSVtk) and ganciclovir, acyclovir, or FIAU; oxidoreductase and cycloheximide; cytosine deaminase and 5-fluorocytosine; thymidine kinase thymidilate kinase (Tdk::Tmk) and AZT; and deoxycytidine kinase and cytosine arabinoside. In certain embodiments, a suicide gene may act in the manner of a therapeutic gene by providing a therapeutic effect on a disease or medical condition as a result of the killing of its host cell. In some embodiments, the phage carries the Herpes simplex virus thymidine kinase (HSVtk) gene which enables targeted suicide therapy of tumors when used in combination with ganciclovir (GCV), ganciclovir elaidic acid ester, penciclovir (PCV), acyclovir (ACV), valacyclovir (VCV), (E)-5-(2-bromovinyl)-2′- deoxyuridine (BVDU), zidovuline (AZT), 2′-exo-methanocarbathymidine (MCT), and combinations thereof. In some embodiments, the suicide gene / prodrug combination is a combination found in Table 1. Table 1. Exemplary suicide genes and prodrugs Suicide Gene Prodrug -25- 55335674.2 Attorney Docket No.370602-7079WO1(00272) (E)-5-(2-bromovinyl)-2′- deoxyuridine (BVDU) embodiments, the imaging agent is a fluorescent dye or a contrast agent. In some embodiments, the fluorescent dye is rhodamine B. In some embodiments, the contrast agent is Gd-BOA. In some embodiments, the imaging agent is not attached to and / or contained within the solid particle. In another embodiment, the imaging agent is attached to and / or contained within the solid particle. In yet another embodiment, the composition further comprises an agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, radioactive agent, salt, peptide, protein, lipid, nucleic acid, gas, and any combinations thereof. In some embodiments, the agent is not attached to and / or contained within the solid particle. In another embodiment, the agent is attached to and / or contained within the solid particle. -26- 55335674.2 Attorney Docket No.370602-7079WO1(00272) In some embodiments, the composition comprises at least one therapeutic agent selected from a checkpoint inhibitor, a poly ADP-ribose polymerase (PARP) inhibitor, an immunomodulator, or a combination thereof. In some embodiments, the composition comprises a therapeutic agent which is known or believed to treat a cancer associated with tumor cell infiltrated tumors. In some embodiments, the composition comprises a therapeutic agent which is known or believed to treat triple negative breast cancer (TNBC). Exemplary therapeutic agents include, but are not limited to, capecitabine, anthracyclines, taxanes, gemcitabine, eribulin, atezolizumab, albumin-bound paclitaxel (Abraxane), pembrolizumab, sacituzumab govitecan-hziy (Trodelvy), pamidronate (Aredia), zoledronic acid (Zometa), trabectedin (Yondelis), imatinib (Gleevec), dasatinib (Sprycel), sunitinib (Sutent), nilotinib (Tasigna), and combinations thereof. In some embodiments, the therapeutic agent is displayed on or attached to the surface of the solid particle. In another embodiment, the therapeutic agent is contained within the solid particle. In some embodiments, the composition comprises a pharmaceutically acceptable carrier. In some embodiments, the composition comprises a solvent. In some embodiments, the solvent is an aqueous solvent. Exemplary aqueous solvents include, but are not limited to, sterile water, tap water, deionized water, distilled water, saline, and combinations thereof. The tumor cell targeting peptides of the disclosure can be synthesized using chemical and biochemical methods known to those skilled in the art of chemical synthesis or peptide synthesis. The tumor cell targeting peptides can be attached to the surface of a solid particle using any method known to those skilled in the art. In certain embodiments, the tumor cell targeting peptides can be attached to the surface of a solid particle via a covalent bond. In a non-limiting example, a free amino group in the tumor cell targeting peptide can be attached to free carboxylate groups on the surface of a solid particle via covalent amide bonds. In a non-limiting example, a free carboxylic acid group in the tumor cell targeting peptide can be attached to free amino groups on the surface of a solid particle via covalent amide bonds. In other embodiments, the tumor cell targeting peptide can be attached to the surface of a solid particle via a non-covalent bond. Various methods of phage display and methods for producing diverse populations of peptides are well known in the art. For example, U.S. Patent No.5,223,409; No.5,622,699; No.5,866,363; and No.6,068,829; and JP Patent No.4,875,497 B2; each of which is incorporated herein by reference, describe methods for preparing a phage library. The phage display technique involves genetically manipulating bacteriophage so that small peptides can -27- 55335674.2 Attorney Docket No.370602-7079WO1(00272) be expressed on their surface [Smith, 1985, Science 228(4705):1315-1317]. In this technique, an oligonucleotide encoding a peptide of interest is inserted into a phage coat protein gene, causing the phage to "display" the protein on its outside while containing the genetic sequence for the peptide on its inside, resulting in a connection between genotype and phenotype. It should be noted that phage display methods can be applied not only to the tumor cell targeting peptides but also to any peptide and / or protein that should be displayed on the surface of the phage (such as, but not limited to, a biologically active peptide and / or antigen). Peptides and proteins contemplated in the disclosure can be prepared in several known ways, e.g., by chemical synthesis (in whole or in part), by digesting longer polypeptides using proteases, by translation from RNA, by purification from cell culture (e.g., from recombinant expression), from the organism itself (e.g., after bacterial culture, or direct from patients), and so forth. Processes for producing proteins of the disclosure are known to those skilled in the art. For example, protein production can comprise the step of culturing a host cell of the disclosure under conditions which induce protein expression. A non-limiting method for production of peptides less than about 40 amino acids long involves in vitro chemical synthesis (Raddrizzani, et al., 2000, Briefs in Bioinformatics 14(2):121-130; Fields, et al., 1997, Principles of Peptide Synthesis. ISBN: 0387564314). Solid-phase peptide synthesis is available, such as methods based on tPoc or Fmoc chemistry (Chan, et al., 2000, Fmoc solid phase peptide synthesis. ISBN:0849368413). Enzymatic synthesis can also be used in part or in full. As an alternative to chemical synthesis, biological synthesis can be used, e.g., the polypeptides can be produced by translation. This can be carried out in vitro or in vivo. Biological methods are in general restricted to the production of polypeptides based on L-amino acids, but manipulation of translation machinery (e.g., of aminoacyl tRNA molecules) can be used to allow the introduction of D-amino acids (or of other non-natural amino acids, such as iodotyrosine or methylphenylalanine, azidohomoalanine, and so forth) (Ibba, 1996, Biotechnology and Genetic Engineering Review 13:197-216). Where D-amino acids are included, however, it is possible to use chemical synthesis. Proteins of the disclosure can have covalent modifications at the C- terminus and / or N-terminus. Proteins useful within the disclosure can take various forms (e.g., native, fusions, glycosylated, non-glycosylated, lipidated, non-lipidated, phosphorylated, non- phosphorylated, myristoylated, non-myristoylated, monomeric, multimeric, particulate, denatured, and so forth). Proteins of the disclosure can be provided in purified or -28- 55335674.2 Attorney Docket No.370602-7079WO1(00272) substantially purified form, i.e., substantially free from other polypeptides (e.g., free from naturally occurring polypeptides), and are generally at least about 50% pure (by weight), and usually at least about 90% pure, i.e., less than about 50%, and more preferably less than about 10% (e.g.5%) of a composition, is made up of other expressed proteins. Polypeptides of the disclosure can comprise a detectable label (e.g., a radioactive or fluorescent label, or a biotin label). Proteins of the disclosure can be naturally or non- naturally glycosylated (i.e., the polypeptide has a glycosylation pattern that differs from the glycosylation pattern found in the corresponding naturally occurring polypeptide). Methods Methods of targeting a tumor cell in a subject In another aspect, the present disclosure provides a method of targeting a solid particle to a tumor cell (e.g. a colorectal tumor cell) in a subject. In some embodiments, the method comprises administering to the subject a tumor cell targeting peptide attached to and / or displayed on the surface of the solid particle. In some embodiments, the method comprises administering to the subject an effective amount of a tumor cell targeting peptide. In some embodiments, the subject has been diagnosed with a solid tumor cancer wherein the solid tumor is infiltrated with a tumor cell. In some embodiments, the subject has been diagnosed with colorectal cancer. In other embodiments, the subject has been diagnosed with a cancer that is not colorectal cancer. In some embodiments, the tumor cell is found in the microenvironment of a solid tumor. In some embodiments, the tumor cell is found in the microenvironment of a colorectal cancer tumor. In another embodiment, the tumor cell is found in the microenvironment of a tumor which is not colorectal cancer. The tumor cell targeting peptide can be any tumor cell targeting peptide described elsewhere herein. In some embodiments, the tumor cell targeting peptide is CGWGGLLCC (SEQ ID NO: 24). The solid particle can be any solid particle described elsewhere herein. In some embodiments, the solid particle is a phage. In some embodiments, the solid particle is an AAVP. In some embodiments, the solid particle is a phage or AAVP which carries a therapeutic gene, a suicide gene, or a combination thereof. Exemplary therapeutic genes and suicide genes are described elsewhere herein. In some embodiments, the AAVP carries the HSVtk gene. In some embodiments, the solid particle comprises at least one agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, or -29- 55335674.2 Attorney Docket No.370602-7079WO1(00272) radioactive agent. Exemplary agents are described elsewhere herein. In some embodiments, the agent is displayed on and / or attached to the surface of the solid particle. In another embodiment, the agent is contained within the solid particle. In some embodiments, the tumor cell targeting peptide attached to and / or displayed on the surface of a solid particle is a component of a composition. In some embodiments, the composition comprises one or more pharmaceutically acceptable carriers. Exemplary pharmaceutically acceptable carriers are described elsewhere herein. In some embodiments, the composition comprises one or more agents selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, or radioactive agent. Exemplary agents are described elsewhere herein. In some embodiments, the composition comprises an aqueous solvent. The tumor cell targeting peptide attached to and / or displayed on the surface of the solid particle can be administered to the subject using any administration method known to a person of skill in the art. Exemplary administration methods are described elsewhere herein. In some embodiments, the administration occurs intravenously. Methods of treating a tumor in a subject In yet another aspect, the present disclosure provides a method of treating, killing, and / or preventing growth of a tumor in a subject, the method comprising administering to the subject a tumor cell targeting peptide attached to and / or displayed on the surface of a solid particle or a fusion polypeptide comprising a tumor cell targeting peptide. In some embodiments, the subject has been diagnosed with a solid tumor cancer. In some embodiments, the subject has been diagnosed with colorectal cancer. In other embodiments, the subject has been diagnosed with a cancer that is not colorectal cancer. In some embodiments, the tumor cell is found in the microenvironment of a solid tumor. In some embodiments, the tumor cell is found in the microenvironment of a colorectal cancer tumor. In another embodiment, the tumor cell is found in the microenvironment of a tumor which is not colorectal cancer. The tumor cell targeting peptide can be any tumor cell targeting peptide described elsewhere herein. In some embodiments, the tumor cell targeting peptide is selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28). The solid particle can be any solid particle described -30- 55335674.2 Attorney Docket No.370602-7079WO1(00272) elsewhere herein. In some embodiments, the solid particle is a phage In some embodiments, the solid particle is an AAVP. In some embodiments, the AAVP encodes a suicide gene, a therapeutic gene, or a combination thereof. Exemplary suicide genes and therapeutic genes are described elsewhere herein. In some embodiments, the AAVP encodes the HSVtk gene. In some embodiments, the AAVP encodes the TNF gene. In some embodiments, the solid particle comprises at least one agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, or radioactive agent. Exemplary agents are described elsewhere herein. In some embodiments, the agent is displayed on or attached to the surface of the solid particle. In another embodiment, the agent is contained within the solid particle. In some embodiments, the tumor cell targeting peptide attached to and / or displayed on the surface of a solid particle is a component of a composition. In some embodiments, the composition comprises one or more pharmaceutically acceptable carriers. Exemplary pharmaceutically acceptable carriers are described elsewhere herein. In some embodiments, the composition comprises one or more agents selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, or radioactive agent. Exemplary agents are described elsewhere herein. In some embodiments, the composition comprises an aqueous solvent. The tumor cell targeting peptide attached to and / or displayed on the surface of the solid particle can be administered to the subject using any administration method known to a person of skill in the art. Exemplary administration methods are described elsewhere herein. In some embodiments, the administration occurs intravenously. In some embodiments, the tumor cell targeting peptide attached to and / or displayed on the surface of a solid particle binds to the tumor cell in the subject. In some embodiments, the tumor cell targeting peptide attached to and / or displayed on the surface of a solid particle binds to a vitamin D receptor on the cell surface of the tumor cell. In some embodiments, the tumor cell targeting peptide attached to and / or displayed on the surface of a solid particle binds to PDIA3 on the cell surface of the tumor cell. In some embodiments, the step of administering to the subject the tumor cell targeting peptide attached to and / or displayed on the surface of the solid particle treats, kills, and / or prevents growth of the tumor by promoting an enhanced immune response in the subject. In some embodiments, the enhanced immune response comprises an anti-tumor immune response mediated by changes in cytokine production. In some embodiments, the tumor cell targeting peptide attached to and / or displayed on the surface of the solid particle treats the tumor by promoting a local -31- 55335674.2 Attorney Docket No.370602-7079WO1(00272) inflammatory immune response in the subject. In some embodiments, the local inflammatory immune response is mediated by IL-6, IL-1β, and / or TNF-α. In some embodiments, the step of administering to the subject a tumor cell targeting peptide attached to the surface of a solid particle further comprises administering to the subject a therapeutic agent. The therapeutic agent can be any agent which is known or believed to treat a tumor infiltrated with a tumor cell and / or a colorectal cancer tumor. Exemplary therapeutic agents are described elsewhere herein. The therapeutic agent can be administered to the subject before, after, with the tumor cell targeting peptide attached to and / or displayed on the surface of the solid particle. In some embodiments wherein the solid particle comprises a therapeutic agent or wherein the composition comprises a therapeutic agent, the method further comprises the step of evaluating the efficacy of the therapeutic agent in treating, killing, and / or preventing growth of the tumor. In other embodiments wherein the solid particle is a phage which encodes a therapeutic gene, the method further comprises the step of evaluating the efficacy of a therapeutic protein encoded by the gene in treating, killing, and / or preventing growth of the tumor. In yet other embodiments wherein the solid particle is a phage which encodes a suicide gene, the method further comprises the step of evaluating the efficacy of a prodrug administered after the phage in treating, killing, and / or preventing growth of the tumor. The efficacy of the therapeutic agent, therapeutic protein, and / or suicide gene / prodrug combination can be evaluated using any method known to a person of skill in the art. In one embodiment, an imaging agent on the attached to the surface or contained within the solid particle is used to monitor the efficacy of the therapeutic agent in treating, killing, and / or preventing growth of the tumor. In other embodiments wherein the solid particle is a phage, a composition comprising an imaging agent is administered to the subject after a tumor cell targeting peptide attached to and / or displayed on the surface the phage is administered to the subject. The imaging agent can be any imaging agent known to a person of skill in the art. In some embodiments, the imaging agent is a fluorescent dye or a contrast agent. In some embodiments, the solid particle comprising a therapeutic agent, the composition comprising a therapeutic agent, or phage encoding a therapeutic gene is administered to the subject once. In other embodiments, the solid particle comprising a therapeutic agent, the composition comprising a therapeutic agent, or phage encoding a therapeutic gene is administered to the subject more than once, such as but not limited to multiple times a day, daily, every other day, weekly, and monthly. In some embodiments, the solid particle comprising a therapeutic agent, the composition comprising a therapeutic agent, -32- 55335674.2 Attorney Docket No.370602-7079WO1(00272) or phage encoding a therapeutic gene is administered to the subject is administered until the therapeutic agent or therapeutic protein encoded by the therapeutic gene is determined to have effectively treated, killed, or prevented the growth of the tumor. In some embodiments wherein a tumor cell targeting peptide attached to and / or displayed on the surface of an AAVP carrying the HSVtk gene is administered to the subject, the method further comprises the step of monitoring the tumor for elevated thymidine kinase expression. In some embodiments, the method further comprises the step of administering a prodrug selected from ganciclovir (GCV), ganciclovir elaidic acid ester, penciclovir (PCV), acyclovir (ACV), valacyclovir (VCV), (E)-5-(2-bromovinyl)-2′-deoxyuridine (BVDU), zidovuline (AZT), 2′-exo-methanocarbathymidine (MCT), and combinations thereof to the subject when elevated thymidine kinase expression is detected. In some embodiments, the prodrug is administered to the subject when maximum thymidine kinase expression is detected. Although not wishing to be limited by theory, it is believed that HSVtk converts the prodrug into a toxic product that allows for the selective elimination of TK+ cells in vivo. Therefore, it is believed that the combination of a tumor cell targeting peptide attached to the surface of an AAVP carrying the HSVtk gene and the prodrug will reduce tumor size, reduce the number of tumor cells, and / or shift the cytokine profile toward an inflammatory response in the tumor microenvironment, thus treating the tumor. In some embodiments, the method further comprises the step of evaluating the efficacy of the prodrug in treating, killing, and / or preventing growth of the tumor. In one embodiment, a composition comprising an imaging agent is administered to the subject before the efficacy of the prodrug is evaluated. Exemplary imaging agents are described elsewhere herein. In some embodiments, the prodrug is administered to the subject once when elevated and / or maximum thymidine kinase expression is detected. In other embodiments, the prodrug is administered to the subject more than once, such as but not limited to, multiple times a day, daily, every other day, weekly, and monthly. In some embodiments, the prodrug is administered until it is determined to have effectively treated, killed, or prevented the growth of the tumor. In one embodiment, the prodrug is GCV. In some embodiments wherein a tumor cell targeting peptide attached to and / or displayed on the surface of an AAVP carrying the TNF gene is administered to the subject, the method further comprises the step of monitoring the tumor for elevated TNF expression. Compositions of the present disclosure can be administered in a manner appropriate to treat the tumor. The quantity and frequency of administration will be determined by such -33- 55335674.2 Attorney Docket No.370602-7079WO1(00272) factors as the condition of the patient, and the type and severity of the patient's tumor, although appropriate dosages and schedules can be determined by clinical trials. Compositions of the disclosure can generally be administered directly to a patient. Direct delivery can be accomplished by parenteral injection (e.g., subcutaneously, intraperitoneally, intravenously, intramuscularly, or to the interstitial space of a tissue), or by rectal, oral, vaginal, topical, transdermal, intranasal, sublingual, ocular, aural, pulmonary or other mucosal administration. In certain embodiments, the administration is intravenous. Pharmaceutical compositions Certain embodiments of the disclosure are directed to therapeutically treating an individual in need thereof. As used herein, the term "therapeutically" includes, but is not limited to, the administration of a treatment comprising a tumor cell targeting peptide to a subject who displays symptoms or signs of pathology, disease, or disorder, in which treatment is administered to the subject for the purpose of diminishing or eliminating those signs or symptoms of pathology, disease, or disorder. As used herein, the term "subject" is intended to include living organisms such as mammals. Examples of subjects include, but are not limited to, horses, cows, sheep, pigs, goats, dogs, cats, rabbits, guinea pigs, rats, mice, gerbils, non-human primates, humans and the like, non-mammals, including, e.g., non-mammalian vertebrates, such as birds (e.g., chickens or ducks) fish or frogs (e.g., Xenopus), and a non-mammalian invertebrates, as well as transgenic species thereof. Preferably, the subject is a human. Administration / Dosage / Formulations The regimen of administration can affect what constitutes an effective amount. The therapeutic formulations can be administered to the subject either prior to or after the onset of a disease or disorder contemplated in the disclosure. Further, several divided dosages, as well as staggered dosages can be administered daily or sequentially, or the dose can be continuously infused, or can be a bolus injection. Further, the dosages of the therapeutic formulations can be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation. Administration of the compositions of the present disclosure to a patient, such as a mammal, such as a human, can be carried out using known procedures, at dosages and for periods of time effective to treat a disease or disorder contemplated in the disclosure. An effective amount of the therapeutic compound necessary to achieve a therapeutic effect can -34- 55335674.2 Attorney Docket No.370602-7079WO1(00272) vary according to factors such as the state of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound to treat a disease or disorder contemplated in the disclosure. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses can be administered daily or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation. A non-limiting example of an effective dose range for a therapeutic compound of the disclosure is from about 1 and 5,000 mg / kg of body weight / per day. One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation. In certain embodiments, the effective dose range is measured in units known to a person of skill in the art to be suitable for the description of phage doses. In some embodiments, the effective dose range for a vaccine or therapeutic compound of the disclosure is measured by transducing units (TU) / kg / dose or genome copies(GC) / kg / dose or particles / kg / dose. In some embodiments, the dosage provided to a patient is between about 106– 1012TU / kg. In some embodiments, the dosage provided to a patient is between about 106– 1012GC / kg. In some embodiments, the effective dose range is measured by colony forming units (CFU), 50% tissue culture infectious dose (TCID50), plaque reduction neutralization test (PRNT), and combinations thereof. Actual dosage levels of the active ingredients in the pharmaceutical compositions of this disclosure can be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The therapeutically effective amount or dose of a compound of the present disclosure depends on the age, sex and weight of the patient, the current medical condition of the patient and the progression of a disease or disorder contemplated in the disclosure. A medical doctor, e.g., physician or veterinarian, having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. In certain embodiments, the compositions of the disclosure are administered to the patient in dosages that range from one to five times per day or more. In other embodiments, the compositions of the disclosure are administered to the patient in range of dosages that -35- 55335674.2 Attorney Docket No.370602-7079WO1(00272) include, but are not limited to, once every day, every two, days, every three days to once a week, and once every two weeks. It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions of the disclosure varies from individual to individual depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors. Thus, the disclosure should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient is determined by the attending physical taking all other factors about the patient into account. In some embodiments, the compositions of the disclosure are administered to the patient while evaluating the efficacy of the compositions at treating, killing, or preventing the growth of a tumor. In some embodiments, the compositions of the disclosure are administered to the patient until it has been determined that the tumor has been treated, killed, or stopped growing. In some embodiments wherein the composition comprises a phage encoding a suicide gene, a prodrug which effects the transition of a gene product encoded by the suicide gene to a compound which kills its host cell is administered until it has been determined that the tumor has been treated, killed, or stopped growing. In some embodiments wherein the composition comprises a phage encoding a TNF gene, a HSVtk gene, a prodrug selected from ganciclovir (GCV), ganciclovir elaidic acid ester, penciclovir (PCV), acyclovir (ACV), valacyclovir (VCV), (E)-5-(2-bromovinyl)-2′-deoxyuridine (BVDU), zidovuline (AZT), 2′-exo-methanocarbathymidine (MCT), and combinations thereof is administered until it has been determined that the tumor has been treated, killed, or stopped growing. In some embodiments, the prodrug is administered daily until it has been determined that the tumor has been treated, killed, or stopped growing. In one embodiment, the prodrug is GCV. In some embodiments, the efficacy of the compositions of the disclosure are determined by monitoring the elevated expression of the gene or genes delivered by the composition. In some embodiments, the gene is HSVtk. In some embodiments, the gene is TNF. In some embodiments, both HSVtk and TNF are monitored. It is understood that the amount of compound dosed per day can be administered, in non-limiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, every 5 days, every week, every two weeks, every three weeks, every four weeks, or every month. For example, with every other day administration, a 5 mg per day dose can be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on. As a second example, with every four week administration for immunization purposes, each dose can be -36- 55335674.2 Attorney Docket No.370602-7079WO1(00272) administered every 28 days. In certain embodiments wherein the disclosed formulations or compositions are administered for immunization purposes every 28 days, serum is collected every 14 days. In the case wherein the patient's status does improve, upon the doctor's discretion the administration of the composition of the disclosure is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). The length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday includes from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, is reduced, as a function of the disease or disorder, to a level at which the improved disease is retained. In certain embodiments, patients require intermittent treatment on a long- term basis upon any recurrence of symptoms and / or infection. The compounds for use in the method of the disclosure can be formulated in unit dosage form. The term "unit dosage form" refers to physically discrete units suitable as unitary dosage for patients undergoing treatment, with each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form can be for a single daily dose or one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form can be the same or different for each dose. Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. The data obtained from cell culture assays and animal studies are optionally used in formulating a range of dosage for use in human. The dosage of such compounds lies in certain embodiments within a range of circulating concentrations that include the ED50with minimal toxicity. The dosage optionally varies within this range depending upon the dosage -37- 55335674.2 Attorney Docket No.370602-7079WO1(00272) form employed and the route of administration utilized. In certain embodiments, the compositions of the disclosure are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions of the disclosure comprise a therapeutically effective amount of a compound of the disclosure and a pharmaceutically acceptable carrier. The carrier can be a solvent or dispersion medium containing, for example, saline, buffered saline, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. In many cases, it is advisable to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. In certain embodiments, the present disclosure is directed to a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a compound of the disclosure, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of a disease or disorder contemplated in the disclosure. Formulations can be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for any suitable mode of administration, known to the art. The pharmaceutical preparations can be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and / or aromatic substances and the like. They can also be combined where desired with other active agents, e.g., analgesic agents. Routes of administration of any of the compositions of the disclosure include, oral, nasal, pulmonary, rectal, intravaginal, parenteral, buccal, sublingual, or topical. The compounds for use in the disclosure can be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal, transmucosal (e.g., sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, -38- 55335674.2 Attorney Docket No.370602-7079WO1(00272) inhalation, and topical administration. In certain embodiments, routes of administration of any of the compositions of the disclosure include nasal, buccal, inhalational, intratracheal, intrapulmonary, and intrabronchial. Suitable compositions and dosage forms include, for example, dispersions, suspensions, solutions, syrups, granules, beads, powders, pellets, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, and the like. It should be understood that the formulations and compositions that would be useful in the present disclosure are not limited to the particular formulations and compositions that are described herein. Powdered and granular formulations of a pharmaceutical preparation of the disclosure can be prepared using known methods. Such formulations can be administered directly to a subject, used, for example, to form a material that is suitable to administration to a subject. Each of these formulations can further comprise one or more of dispersing or wetting agent, a suspending agent, and a preservative. Additional excipients, such as fillers and sweetening, flavoring, or coloring agents, can also be included in these formulations. Oral Administration For oral application, particularly suitable are tablets, dragees, liquids, drops, suppositories, or capsules, caplets and gelcaps. The compositions intended for oral use can be prepared according to any method known in the art and such compositions can contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutically excipients that are suitable for the manufacture of tablets. Such excipients include, for example an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate. The tablets can be uncoated or they can be coated by known techniques for elegance or to delay the release of the active ingredients. Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent. Parenteral Administration As used herein, "parenteral administration" of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical -39- 55335674.2 Attorney Docket No.370602-7079WO1(00272) wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, subcutaneous, intravenous, intraperitoneal, intramuscular, intrasternal injection, and kidney dialytic infusion techniques. Buccal, Pulmonary, Inhalational, Intranasal Administration, and So Forth A pharmaceutical composition of the disclosure can be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity. Such a formulation can be a liquid or dry / powder formulation comprising one or more targeting peptides of the disclosure. In some embodiments, the formulation comprises an active ingredient described elsewhere herein. In some embodiments, the particles of the dry / powder formulation have a diameter in the range from about 0.5 to about 7 micrometers, and in certain embodiments from about 1 to about 6 micrometers. Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant can be directed to disperse the powder or using a self-propelling solvent / powder-dispensing container such as a device comprising the active ingredient dissolved or suspended in a low-boiling propellant in a sealed container. In certain embodiments, such powders comprise particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 micrometers and at least 95% of the particles by number have a diameter less than 7 micrometers. In certain embodiments, at least 95% of the particles by weight have a diameter greater than 1 micrometer and at least 90% of the particles by number have a diameter less than 6 micrometers. Dry powder compositions can include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form. See also EP Patents No. EP 0212753B1 and No.1370318B1. Low boiling propellants generally include liquid propellants having a boiling point of below 65oF at atmospheric pressure. Generally the propellant can constitute 50 to 99.9% (w / w) of the composition, and the active ingredient can constitute 0.1 to 20% (w / w) of the composition. The propellant can further comprise additional ingredients such as a liquid non- ionic or solid anionic surfactant or a solid diluent (in certain embodiments having a particle size of the same order as particles comprising the active ingredient). Pharmaceutical compositions of the disclosure formulated for pulmonary delivery can also provide the active ingredient in the form of droplets of a solution or suspension. Such formulations can be prepared, packaged, or sold as aqueous or dilute alcoholic solutions or suspensions, optionally sterile, comprising the active ingredient, and can conveniently be administered using any nebulization or atomization device. Such formulations can further -40- 55335674.2 Attorney Docket No.370602-7079WO1(00272) comprise one or more additional ingredients including, but not limited to, a flavoring agent such as saccharin sodium, a volatile oil, a buffering agent, a surface active agent, or a preservative such as methylhydroxybenzoate. The droplets provided by this route of administration in certain embodiments have an average diameter in the range from about 0.1 to about 200 micrometers. The pharmaceutical composition of the disclosure can be delivered using an inhalator such as those recited in U.S. Patent No. US 8,333,192 B2, which is incorporated herein by reference in its entirety. The formulations described herein as being useful for pulmonary delivery are also useful for intranasal delivery of a pharmaceutical composition of the disclosure. Another formulation suitable for intranasal administration is a coarse powder comprising the active ingredient and having an average particle from about 0.2 to 500 micrometers. Such a formulation is administered in the manner in which snuff is taken, i.e., by rapid inhalation through the nasal passage from a container of the powder held close to the nares. Formulations suitable for nasal administration may, for example, comprise from about as little as 0.1% (w / w) and as much as 100% (w / w) of the active ingredient, and can further comprise one or more of the additional ingredients described herein. Additional Administration Forms Additional dosage forms of this disclosure include dosage forms as described in U.S. Patents Nos.6,340,475; 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Additional dosage forms of this disclosure also include dosage forms as described in U.S. Patent Applications Nos.20030147952; 20030104062; 20030104053; 20030044466; 20030039688; and 20020051820. Additional dosage forms of this disclosure also include dosage forms as described in PCT Applications Nos. WO 03 / 35041; WO 03 / 35040; WO 03 / 35029; WO 03 / 35177; WO 03 / 35039; WO 02 / 96404; WO 02 / 32416; WO 01 / 97783; WO 01 / 56544; WO 01 / 32217; WO 98 / 55107; WO 98 / 11879; WO 97 / 47285; WO 93 / 18755; and WO 90 / 11757. Controlled Release Formulations and Drug Delivery Systems In certain embodiments, the formulations of the present disclosure can be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release and pulsatile release formulations. The term sustained release is used in its conventional sense to refer to a drug -41- 55335674.2 Attorney Docket No.370602-7079WO1(00272) formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period. The period of time can be as long as a month or more and should be a release which is longer that the same amount of agent administered in bolus form. For sustained release, the compounds can be formulated with a suitable polymer or hydrophobic material that provides sustained release properties to the compounds. As such, the compounds for use the method of the disclosure can be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation. In certain embodiments of the disclosure, the compounds of the disclosure are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation. The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that may, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours. The term pulsatile release is used herein in its conventional sense to refer to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profiles of the drug after drug administration. The term immediate release is used in its conventional sense to refer to a drug formulation that provides for release of the drug immediately after drug administration. As used herein, short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration. As used herein, rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents were considered to be within the scope of this disclosure and covered by the claims appended hereto. For example, it should be understood, that modifications in reaction conditions, including but not limited to reaction times, reaction size / volume, and experimental reagents, such as solvents, catalysts, pressures, -42- 55335674.2 Attorney Docket No.370602-7079WO1(00272) atmospheric conditions, e.g., nitrogen atmosphere, and reducing / oxidizing agents, with art- recognized alternatives and using no more than routine experimentation, are within the scope of the present application. It is to be understood that wherever values and ranges are provided herein, all values and ranges encompassed by these values and ranges, are meant to be encompassed within the scope of the present disclosure. Moreover, all values that fall within these ranges, as well as the upper or lower limits of a range of values, are also contemplated by the present application. The following examples further illustrate aspects of the present disclosure. However, they are in no way a limitation of the teachings or disclosure of the present disclosure as set forth herein. The practice of the present disclosure employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", 4th edition (Sambrook, 2012); "Oligonucleotide Synthesis" (Gait, 1984); "Culture of Animal Cells" (Freshney, 2010); "Methods in Enzymology" "Handbook of Experimental Immunology" (Weir, 1997); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Short Protocols in Molecular Biology" (Ausubel, 2002); "Polymerase Chain Reaction: Principles, Applications and Troubleshooting", (Babar, 2011); "Current Protocols in Immunology" (Coligan, 2002). These techniques are applicable to the production of the polynucleotides and polypeptides of the disclosure, and, as such, can be considered in making and practicing the disclosure. It should be understood that the method and compositions that would be useful in the present disclosure are not limited to the particular formulations set forth in the examples. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the cells, expansion and culture methods, and therapeutic methods of the disclosure, and are not intended to limit the scope of what the inventors regard as their disclosure. EXPERIMENTAL EXAMPLES The disclosure is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only, and the disclosure is not limited to these Examples, but rather encompasses all variations that are evident as a result of the -43- 55335674.2 Attorney Docket No.370602-7079WO1(00272) teachings provided herein. Materials and Methods In Vivo Screenings of Rhesus Macaques with Phage-Displayed Peptide Libraries Rhesus macaques (Macaca mulatta) with MLH1-rheMac HNPCC syndrome were used in these studies. These rhesus macaques originated from an established colony characterized by colon adenocarcinomas with loss of MLH1 expression. Two female rhesus macaques (J615 and J737) of approximately 20 years of age with gross tumor lesions were selected for this study. J615 had colon carcinoma that was transmurally invasive and had metastasized to local lymph nodes; J737 had colon carcinoma that was transmurally invasive without any observed metastasis. Under deep anesthesia, the two rhesus macaques were intravenously infused with an admixed phage-displayed CX7C:CX8C (where C is L-cysteine and X is any L-amino acid) peptide library in phosphate-buffered saline (PBS). The library circulated for up to 6 h, which was followed by euthanasia and exsanguination. A veterinary pathologist dissected and isolated over 50 tissues from each rhesus macaque. All isolated tissues were individually wrapped in aluminum foil and stored at -80° C. DNA Extraction from Tissues DNA extraction from tissues was performed by using the DNeasy®Blood & Tissue Kit (QIAGEN #69506). Tissues were thawed on ice, cut with sterile instruments, and weighed. Samples were subsequently transferred to individual Precellys Lysing Kits (Hard Tissue Grinding MK28, 2 mL) (Bertin Technologies #KT03961-1-001.2) containing Buffer ATL (180 µL) and Proteinase K (20 µL). Samples were homogenized with a Precellys 24 Tissue Homogenizer (Bertin Technologies) at 5,000 rpm. Samples were then incubated at 56° C with occasional vortexing until complete lysis. Next, Buffer AL (200 µL) was added to the samples coupled with vortexing, followed by ethanol (200 µL) coupled with vortexing. Sample solutions were then transferred to individual DNeasy®Mini Spin Columns and centrifuged at 6,010×g for 1 min. Buffer AW1 (500 µL) was added to each DNeasy®Mini Spin Column and centrifuged at 6,010×g for 1 min. Buffer AW2 (500 µL) was added to each DNeasy®Mini Spin Column and centrifuged at 18,407×g for 3 min. For DNA elution, Buffer AE was added to each DNeasy® Mini Spin Column (varying volumes depending on desired concentration), followed by incubation for 1 min at RT, and centrifugation at 18,407×g for 1 -44- 55335674.2 Attorney Docket No.370602-7079WO1(00272) min. DNA concentration was then measured by using a SpectraMax QuickDrop Micro- Volume Spectrophotometer (Molecular Devices). Whole-Exome Sequencing of Rhesus Macaque Genomic DNA DNA extracted from tumor lesion and non-tumor colon from the two screened rhesus macaques was purified by using AMPure XP beads (Beckman Coulter #A63881). DNA concentration was measured by using the Qubit™ 1X dsDNA HS Assay Kit (Thermo Fisher Scientific™ #Q33231) with a Qubit 4 Fluorometer (Thermo Fisher Scientific™). Library preparation, multiplexing, whole exome capture with the Twist Comprehensive Exome Panel (Twist Bioscience), and sequencing with an Illumina HiSeq®were performed at Azenta Life Sciences (South Plainfield, NJ, USA). Bioinformatic Analysis of Whole Exomes of Rhesus Macaques Raw sequencing data were analyzed in collaboration with Dr. Israel Tojal da Silva (AC Camargo Cancer Center, São Paulo, SP, Brazil). Probed exomes in the sequencing result file were located by using the Browser Extensible Data (BED) file corresponding to the Twist Comprehensive Exome Panel (i.e., twist_Comprehensive_Exome_Covered_Targets_ hg38.bed). Single-nucleotide variants (SNVs) were called by using an in-house pipeline developed based on the Genome Analysis Toolkit (GATK) Best Practices workflows. The raw reads from the non-tumor colons of the two rhesus macaques were each aligned to the Macaca mulatta reference genome (Mmul10) by using the Burrows-Wheeler Alignment (BWA) tool in mem mode according to the default settings. The generated alignment files were converted to Binary Alignment Map (BAM) format, sorted, and filtered for the exclusion of reads with mapping quality scores less than 15 by using SAMtools version 1.19. The remaining aligned reads were subsequently processed for the exclusion of duplicate PCR reads by using MarkDuplicates (Picard) version 3.0.0. To call SNVs, BaseRecalibrator and Mutect2 version 4.4 were used for the BAM files generated for the colon tumor samples and their corresponding non-tumor colon samples. Filtering was extensively applied to account for strand and position biases and oxo-guanine oxidative artifacts and, for somatic mutations, potential germline association and weak somatic evidence. Mutational impact was classified as high, moderate, low, or modifier according to protein deleteriousness by using SnpEff version 5.1d. Single-base substitution (SBS) mutational signatures among the set of somatic mutations from each tumor were identified and analyzed by using signeR based on the -45- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Catalogue of Somatic Mutations in Cancer (COSMIC) version 3.2. Affected cancer-related genes were identified by cross-referencing the COSMIC Cancer Gene Census (Tier 1 and Tier 2) (as of February 13th, 2024). Affected DNA repair genes were identified by cross-referencing a database maintained by the Wood Laboratory at the University of Texas MD Anderson Cancer Center. Affected genes in the Macaca mulatta genome were inputted into PANTHER version 18.0 and classified according to Gene Ontology (GO) slim biological process, GO slim molecular function, and PANTHER protein class. Quantitative PCR of Phage Genomes Quantitative PCR of phage genomes in tissues based on the tetracycline repressor gene (TetR) was performed as previously described. The following 15-µL reaction mix was prepared and distributed into each individual well of a MicroAmp™ Fast Optical 96-Well Reaction Plate with Barcode (0.1 mL) (Applied Biosystems™ #4346906): • Fast SYBR™ Green Master Mix (Applied Biosystems™ #4385612) (1X) •Forward DNA primer for fUSE5 TetR gene (2.5 pmol)•5’ TGAGGTGGTATCGGCAATGA (SEQ ID NO: 1)•Reverse DNA primer for fUSE5 TetR gene (2.5 pmol)• 5’ GGATGCTGTATTTAGGCCGTTT (SEQ ID NO: 2) • DNA input (2×10nphage genomes or 50 ng of tissue-extracted DNA) Quantitative PCR was performed by using a QuantStudio™ 5 Real-Time PCR System (96-well, 0.2 mL) (Applied Biosystems™). Standards with the following numbers of phage genomes were defined and included: 2×108, 2×107, 2×106, 2×105, 2×104, and 2×103. Each standard and sample of tissue-extracted DNA (50 ng) underwent three technical replicates (i.e., three wells). PCR was performed with the following parameters: (i) Hold stage: 95° C for 20 s (ii) PCR stage (40 cycles): 95° C for 1 s and 60° C for 20 s (iii)Melt curve stage: 95° C for 1 s, 60° C for 20 s, and 95° C for 1 s PCR Amplification and NGS of Phage-Encoded Peptides PCR amplicon generation of the pIII-encoded peptide was performed as previously described. The following 50-µL reaction mix was prepared and distributed into each individual well of a 96-well reaction plate: • NEBNext® Ultra™ II Q5® Master Mix (New England Biolabs #M0544X) (1X) -46- 55335674.2 Attorney Docket No.370602-7079WO1(00272) • Forward DNA primer for fUSE5 pIII-encoded flanking region of peptide (25 pmol) •5’ AGCAAGCTGATAAACCGATACAATT 3’ (SEQ ID NO: 3)• Reverse DNA primer for fUSE5 pIII-encoded flanking region of peptide (25 pmol) •5’ CCCTCATAGTTAGCGTAACGATCT 3’ (SEQ ID NO: 4)•DNA input (200 ng of tissue-extracted DNA)PCR was performed by using a Mastercycler®Pro S Thermal Cycler (Eppendorf®). Each standard and sample of tissue-extracted DNA (200 ng) underwent multiple replicates. PCR was performed with the following parameters: (i) Initial stage: 98° C for 30 s (ii) PCR stage (25 cycles): 98° C for 10 s, 55° C for 30 s, and 72° C for 30 s (iii)Final stage: 72° C for 2 min Amplicon DNA was pooled by organism / tissue and purified by using AMPure XP beads (Beckman Coulter #A63881). A volume of beads at a ratio of 1.8:1 was added to the sample and mixed by pipetting. Following incubation for 10 min at RT, the tubes were placed on a magnetic stand for 5 min and the solution was aspirated. Next, with the tubes still on the magnetic stand, the beads were washed with 70% ethanol for 30 s and aspirated, for a total of two washes. The beads were then air-dried. Next, the DNA was eluted by adding Ambion™ Nuclease-Free Water (Invitrogen™ #AM9937) (at a volume of 40 µL per PCR reaction) and mixing by pipetting. Following incubation for 5 min at RT on the magnetic stand, the solution was isolated into new tubes. DNA concentration was measured by using the Qubit™ 1X dsDNA HS Assay Kit (Thermo Fisher Scientific™ #Q33231) with a Qubit 4 Fluorometer (Thermo Fisher Scientific™). When necessary, DNA was concentrated with a Savant™ DNA120 SpeedVac™ (Thermo Fisher Scientific™). Quality analysis, library preparation, multiplexing, and sequencing with an Illumina HiSeq®were performed at Azenta Life Sciences (South Plainfield, NJ, USA). Bioinformatic Analysis of Phage-Encoded Peptides Raw sequencing data were analyzed in collaboration with Dr. Israel Tojal da Silva (AC Camargo Cancer Center, São Paulo, SP, Brazil). A Python script was used to search for the following nucleotide pattern, wherein nucleotides in green correspond to the DNA- encoded peptide within the pIII gene of the phage and nucleotides in orange correspond to the pIII-native regions flanking the peptide: GCGGCCC[ACGT](ACA.+ACA)AGCC -47- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Next, identified nucleotide sequences of the peptides were filtered to include reads with exactly 21 or 24 nucleotides between the ACA codons (i.e., cysteine residues) in order to assemble a list of CX7C and CX8C peptide hits. The nucleotide sequences were subsequently translated to their corresponding amino acid sequences (Appendix C). After integrating the datasets obtained from read 1 (R1) and read 2 (R2), Tab-separated values (TSV) files were assembled for each amino acid k-mer (3-mer, 4-mer, 5-mer, 6-mer, 7-mer, 8-mer, 9-mer, and 10-mer). Commands within a Bash script were used to search for and process specific motifs by using Terminal version 2.10 (Apple Inc.). De novo motif discovery and analysis were performed by using XSTREME (meme- suite dot org / meme / tools / xstreme). Distinct amino acid sequences without flanking cysteine residues of peptides identified in both J615 colon tumor and J737 colon tumor were inputted. Settings included motif site distribution of zero or one site per sequence, objective function of E-value of product of p-values, starting point function of E-value of product p-values, motif E-value threshold of 0.05, minimum motif width of three, maximum width of eight, minimum of two sites per motif, and bias on number of sites of 0.8. The control set of sequences was set as shuffled input sequences. Enriched motifs (i.e., E<0.05) were compared with known motifs in the PROSITE database (2021_04) Peptide clustering was performed by using GibbsCluster version 2.0. Distinct amino acid sequences without flanking cysteine residues of peptides identified in both J615 colon tumor and J737 colon tumor and not in any other tissue were inputted. Settings included 1–15 clusters, motif length of 7, maximum deletion length of 1, maximum insertion length of 1, 5 seeds for initial conditions, penalty factor of 0.8 for inter-cluster similarity, weight of 5 on small clusters, 10 iterations per sequence per temperature step, initial Monte Carlo temperature of 1.5, temperature steps of 20, interval of 10 between indel moves, interval of 20 between single peptide moves, interval of 100 between phase shift moves, pre-calculated (UniProt) background amino acid frequencies, heuristic sequence weighting type, and activation of shift moves and cluster moves. Given that the list of distinct peptide sequences can be separate into variable numbers of clusters, the number of clusters with the greatest Kullback-Leibler distance (KLD) was selected for further analysis. The peptide alignments and KLD of each cluster were visualized. Phage Cloning and Titering Phage constructs displaying each of the seven lead peptide candidates on the pIII minor coat protein were individually cloned for use in phage-based experiments. All steps -48- 55335674.2 Attorney Docket No.370602-7079WO1(00272) were performed by using a Mastercycler®Pro S Thermal Cycler (Eppendorf®). The following oligonucleotides encoding the forward and reverse complementary nucleotide sequences of the seven lead peptide candidates were synthesized and provided in desalted form by Integrated DNA Technologies (Coralville, IA, USA) (N.B.: forward-strand TGT and reverse-strand ACA correspond to the codons encoding the flanking cysteine residues): •CAGWEGRGLC (SEQ ID NO: 21)•FW: 5’ GGGCTTGTGCGGGCTGGGAAGGCCGCGGCCTGTGTGGGGCCGCTG3’ (SEQ ID NO: 5) •RV: 5’ CGGCCCCACACAGGCCGCGGCCTTCCCAGCCCGCACAAGCCCCGT3’ (SEQ ID NO: 6) •CEGNHADHIC (SEQ ID NO: 22)•FW: 5’ GGGCTTGTGAAGGCAACCATGCGGATCATATCTGTGGGGCCGCTG3’ (SEQ ID NO: 7) •RV: 5’ CGGCCCCACAGATATGATCCGCATGGTTGCCTTCACAAGCCCCGT3’ (SEQ ID NO: 8) •CGAFGGGGC (SEQ ID NO: 23)• FW: 5’ GGGCTTGTGGCGCGTTCGGCGGCGGCGGCTGTGGGGCCGCTG 3’ (SEQ ID NO: 9) •RV: 5’ CGGCCCCACAGCCGCCGCCGCCGAACGCGCCACAAGCCCCGT 3’(SEQ ID NO: 10) •CGWGGLLCC (SEQ ID NO: 24)•FW: 5’ GGGCTTGTGGCTGGGGCGGCCTGCTGTGTTGTGGGGCCGCTG 3’(SEQ ID NO: 11) •RV: 5’ CGGCCCCACAACACAGCAGGCCGCCCCAGCCACAAGCCCCGT 3’(SEQ ID NO: 12) •CLSGTSGRC (SEQ ID NO: 25)•FW: 5’ GGGCTTGTCTGAGCGGCACCAGCGGCCGCTGTGGGGCCGCTG 3’(SEQ ID NO: 13) •RV: 5’ CGGCCCCACAGCGGCCGCTGGTGCCGCTCAGACAAGCCCCGT 3’(SEQ ID NO: 14) •CPKMAVVGFC (SEQ ID NO: 26)-49- 55335674.2 Attorney Docket No.370602-7079WO1(00272) •FW: 5’ GGGCTTGTCCGAAAATGGCGGTGGTGGGCTTCTGTGGGGCCGCTG3’ (SEQ ID NO: 15) •RV: 5’ CGGCCCCACAGAAGCCCACCACCGCCATTTTCGGACAAGCCCCGT3’ (SEQ ID NO: 16) •CSSHFSAMC (SEQ ID NO: 27)• FW: 5’ GGGCTTGTAGCAGCCATTTCAGCGCGATGTGTGGGGCCGCTG 3’ (SEQ ID NO: 17) •RV: 5’ CGGCCCCACACATCGCGCTGAAATGGCTGCTACAAGCCCCGT 3’(SEQ ID NO: 18) The forward and reverse oligonucleotides were annealed (500 µmol each) with the following parameters: (iv) 93° C for 3 min (v) 80° C for 20 min (vi) 75° C for 20 min (vii) 70° C for 20 min (viii) 65° C for 20 min (ix) 40° C for 60 min The fUSE55 vector (~9 kb) was digested at the two adjacent SfiI sites in order to both linearize the vector and remove the stuffer region within the pIII gene by incubating the following 50-µL reaction for 1 h at 50° C (negative control did not contain restriction enzyme): •fUSE55 plasmid (1 µg)•rCutSmart™ Buffer (New England Biolabs #B6004S) (1X)•SfiI (New England Biolabs #R0123S) (1X)Vector digestion was assessed by running samples with TAE buffer on an E-Gel™ Agarose Gel with SYBR™ Safe DNA Gel Stain, 1% (Invitrogen™ #A45203). Annealed oligonucleotides and digested linear vector were then ligated at ratios of 1:1 and 3:1 by incubating the following 20-µL reaction for 960 min at 16° C then 10 min at 65° C (negative controls included reaction without annealed insert and reaction without enzyme): •Annealed oligonucleotides reaction product (1 µL or 3 µL)•Digested vector reaction product (1 µL)-50- 55335674.2 Attorney Docket No.370602-7079WO1(00272) • T4 DNA Ligase Reaction Buffer (New England Biolabs #B0202S) (1X) •T4 DNA Ligase (New England Biolabs #M0202L) (1X)Ligation products (both 1:1 and 3:1) were next used to transform MC1061 F- Electrocompetent Cells (LGC Bioresearch Technologies #60514-2). Cells were thawed on ice. Ligation product (1 µL) was mixed with cells (20 µL). The mixture was transferred to an E. coli Pulser Cuvette (BioRad #165-2089) and electroporated with the following parameters: 10 µF, 600 Ω, 1,800 V for a 1.0 mm cuvette. Electroporated cells were then shaken with Recovery Medium for 1 h at 37° C. Cells in different dilutions were plated on lysogeny broth (LB) agar plates with streptomycin (100 µg / mL) and tetracycline (40 µg / mL) and incubated overnight (ON) at 37° C. Individual colonies were resuspended separately in LB medium (50 µL). Colony PCR was performed to confirm ligation with the following 20-uL reaction: •Bacterial suspension (2 µL)•Dimethylsulfoxide (2%)• Deoxynucleotide (dNTP) Solution Mix (New England Biolabs #N0446S) (5 nmol) • Forward DNA primer for fUSE55 pIII-encoded flanking region of peptide (10 pmol) •5’ AGCAAGCTGATAAACCGATACAATT 3’ (SEQ ID NO: 19)• Reverse DNA primer for fUSE55 pIII-encoded flanking region of peptide (10 pmol) •5’ CCCTCATAGTTAGCGTAACGATCT 3 ’(SEQ ID NO: 20)•GoTaq® DNA Polymerase (Promega #M3008) (1X)•Green GoTaq® Reaction Buffer (Promega #M7911) (1X)PCR was performed with the following parameters: (i) Initial stage: 94° C for 30 s (ii) PCR stage (35 cycles): 94° C for 10 s, 60° C for 30 s, and 72° C for 1 min (iii)Final stage: 72° C for 3 min Colonies infected with phage-encoding peptides displayed on the pIII minor coat protein were assessed by running PCR products with TAE buffer on E-Gel™ Agarose Gels with SYBR™ Safe DNA Gel Stain, 4% (Invitrogen™ #A45206). Larger PCR products according to the gels (measuring 275 or 278 bp in total for CX7C or CX8C peptide format, respectively) underwent Sanger sequencing by GENEWIZ (South Plainfield, NJ, USA). Sequence trace files were reviewed with 4Peaks version 1.8 to confirm sequence identity and proper in-frame cloning. -51- 55335674.2 Attorney Docket No.370602-7079WO1(00272) For each peptide-displaying phage construct, phage were grown and purified according to standard protocol. K91KanRE. coli were grown in terrific broth (TB) medium (10 mL) until an optical density (600 nm absorbance) of 1.4–1.8 (i.e., exponential growth phase) was reached. The corresponding MC1061 F- bacterial suspension containing successfully cloned peptide-displaying phage (5–10 µL) was incubated with the K91KanRE. coli culture (0.5–1 mL) for 30 min at room temperature (RT). The culture was then transferred to LB (500 mL) containing kanamycin (100 µg / mL) and tetracycline (40 µg / mL) and shaken ON at 37° C. During the following day, each culture was centrifuged at 27×g for 15 min at 4° C by using a Sorvall LYNX 4000 Centrifuge (Thermo Scientific™) and the supernatant was reserved for phage purification. The supernatant was then incubated with 21.1% polyethylene glycol (PEG), 24.6% sodium chloride (NaCl) (37.5 mL) for 3 h on ice to precipitate the phage. The solution was then centrifuged at 27×g for 45 min at 4° C. After discarding the supernatant, the remaining solution was then centrifuged at 27×g for 15 min at 4° C. After removing any remaining supernatant, the pellet containing phage was resuspended in PBS (2 mL) and shaken for 30 min at 37° C to ensure adequate resuspension. Next, the solution was centrifuged at 18,407×g for 5 min at RT and the supernatant was incubated with 21.1% PEG, 24.6% NaCl (150 µL) for 1 h on ice. Subsequently, the solution was centrifuged at 6,797×g for 15 min at 4° C by using a Centrifuge 5430 R (Eppendorf®). After discarding the supernatant, the solution was again centrifuged at 6,797×g for 15 min at 4° C. After removing any remaining supernatant, the pellet was resuspended in PBS and centrifuged at 18,407×g for 5 min at RT. The supernatant containing the purified phage was then stored at 4° C. Each stock of phage requires titering (i.e., quantification of viable phage particles) prior to use in experiments. Stock phage were first centrifuged at 18,407×g for 5 min at RT. Next, K91KanRE. coli were grown in terrific broth (TB) medium (10 mL) until an optical density (600 nm absorbance) of 1.4–1.8 was reached. The K91KanRE. coli culture (200 µL) was then incubated separately with serial dilutions (1:106, 1:107, 1:108, and / or 1:109) of stock phage in PBS (20 uL each) for at least 30 min. To confirm lack of cross-contamination with phage, the K91KanRE. coli culture (not infected with phage) was plated on LB agar plates with kanamycin (100 µg / mL) and tetracycline (40 µg / mL) before and after handling phage. After 30 min, the infected K91KanRE. coli cultures were plated (three replicates per phage dilution) as well. All plates were incubated ON at 37° C. During the following day, the number of colonies per plate was counted (each colony corresponds to one viable phage particle) and the overall titer of the stock phage was then calculated. -52- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Cell Culture HCT 116 (American Type Culture Collection) is an immortalized human colon cancer cell line isolated from an adult male. HCT 116 cells were maintained in McCoy’s 5A Modified Medium (Gibco™ #16600082) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Cells were grown as a monolayer in a T75 flask at 37°C and 5% CO2, and regularly tested for Mycoplasma contamination by using the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318) with a Varioskan™ LUX Multimode Microplate Reader (Thermo Scientific™). Cells were routinely split by rinsing once with PBS and incubating with TrypLE™ Express Enzyme (Gibco™ #12605-010) for 5 min at 37° C. Cells were appropriately discarded after the tenth passage and a new frozen vial was thawed for renewed use as needed. Cell-Based Phage-Binding Assay Phage-displayed peptides were evaluated for cell surface binding by using the Biopanning and Rapid Analysis of Selective Interactive Ligands (BRASIL) approach. HCT 116 (American Type Culture Collection) and SNU-407 (AddexBio) are immortalized human colon cancer cell lines isolated from male adults. HCT 116 cells were maintained in McCoy's 5A Modified Medium (Gibco™ #16600082) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. SNU-407 cells were maintained in Roswell Park Memorial Institute (RPMI) 1640 Medium (Gibco™ #11875119) supplemented with 10% FBS and 1% penicillin-streptomycin. Cells were grown as a monolayer in a T75 flask at 37°C and 5% CO2, and regularly tested for Mycoplasma contamination by using the MycoAlert® Mycoplasma Detection Kit (Lonza #LT07-318) with a Varioskan™ LUX Multimode Microplate Reader (Thermo Scientific™). Cells were routinely split by rinsing once with PBS and incubating with TrypLET™ Express Enzyme (Gibco™#12605-010) for 5 min at 37° C. Cells were appropriately discarded after the tenth passage and a new frozen vial was thawed for renewed use as needed. For the BRASIL assay, cells were washed twice with PBS and then detached via incubation with ACCUTASE™ Cell Detachment Solution (MilliporeSigma™ #SCR005) for 5 min at 37° C. After adding McCoy’s 5A Modified Medium supplemented with 10% FBS and 1% penicillin-streptomycin, cells were centrifuged for 5 min at 400×g by using a Centrifuge 5702 (Eppendorf®) and resuspended in supplemented medium. Viable cells were -53- 55335674.2 Attorney Docket No.370602-7079WO1(00272) counted by mixing with the azo dye, Trypan Blue (Bio-Rad #1450021), and using a TC20 Automated Cell Counter (Bio-Rad). A total of 106live cells was distributed into separate tubes, placed on ice immediately, and centrifuged at 239×g for 5 min at 4° C. Each set of cells was resuspended and incubated with McCoy’s 5A Modified Medium (200 µL) containing 1% bovine serum albumin (BSA) (Sigma-Aldrich® #A3059) (without FBS or penicillin-streptomycin) and 109TU of peptide-displaying or insertless phage for 2 h on ice (with occasional resuspension via tapping). Of note, two sets of 106cells were assigned to each phage construct. Next, each cell suspension was transferred to the surface of an immiscible organic phase (90% dibutyl phthalate, 10% cyclohexane) (180 µL) in individual 400-µL microcentrifuge tubes (Bio Plas #4003). The two-phase mixture (aqueous on top and organic on bottom) was then centrifuged at 9,391×g for 10 min at RT. After incubating the mixture at -80° C until complete freezing, the bottom of each tube (containing the pellet of cells and any bound phage) was physically cut into separate tubes and excess organic phase was removed via pipetting without disturbing the pellet. K91KanRE. coli grown in TB medium until an optical density (600 nm absorbance) of 1.4–1.8 was distributed to each tube (200 µL) for infection with any cell-bound phage for at least 30 min at RT. To confirm lack of cross-contamination with phage, the K91KanRE. coli culture (not infected with phage) was plated on LB agar plates with kanamycin (100 µg / mL) and tetracycline (40 µg / mL) before and after handling phage. After 30 min at RT, each set of infected K91KanRE. coli cultures was diluted in LB medium and plated (three replicates per plated volume) as well. All plates were incubated ON at 37° C. During the following day, the number of colonies per plate was counted (each colony corresponds to one viable phage particle). Cell-Based Phage Internalization Assay Phage-displayed peptides were evaluated for cell internalization. First, individual wells of the Nunc™ Lab-Tek™ II CC2™ Chamber Slide System (Thermo Scientific™ #154941) were incubated with McCoy’s 5A Modified Medium supplemented with 10% FBS and 1% penicillin-streptomycin (200 µL) for 1 h at RT. Next, HCT 116 cells were seeded at a density of 5×104cells in McCoy’s 5A Modified Medium supplemented with 10% FBS and 1% penicillin-streptomycin (300 µL) per well and grown for two ONs at 37° C. Next, cells were blocked with McCoy’s 5A Modified Medium supplemented with 30% FBS and 1% penicillin-streptomycin (100 µL) for 1 h at 37° C. Cells were then incubated with 109TU of phage in McCoy’s 5A Modified Medium supplemented with 2% FBS and 1% penicillin- streptomycin (100 µL) per well for either 2 h or 18 h at 37° C. Cells were then rinsed five -54- 55335674.2 Attorney Docket No.370602-7079WO1(00272) times with PBS containing 10% BSA (200 µL), three times with glycine buffer (50 mM glycine, 150 mM NaCl, pH 2.8) (200 µL), and two times with PBS (200 µL). Cells were then fixed with PBS containing 4% paraformaldehyde (PFA) (300 µL) for 5 min at RT and washed two times with PBS (200 µL). Cells were permeabilized by incubating with PBS containing 0.2% Triton X-100 and 1% BSA (300 µL) for 5 min at RT. After three rinses with PBS (300 µL), cells were blocked with PBS containing 1% BSA (300 µL) for 1 h at RT. Cells were incubated with 1:1,000 rabbit anti-fd bacteriophage antibody (MilliporeSigma™ #B7786, lot #0000282619) in PBS containing 1% BSA (150 µL) for 1 h at RT, rinsed three times with PBS containing 1% BSA (200 µL) at RT, and incubated with 1:500 Cy3- conjugated donkey anti-rabbit antibody (Jackson ImmunoResearch #711-166-152, lot #109771) in PBS containing 1% BSA (150 µL) for 30 min at RT in the dark. Cells were then rinsed three times with PBS containing 1% BSA (200 µL), fixed with PBS containing 4% PFA (300 µL) for 5 min, and rinsed three times with PBS at RT. After removing any residual liquid in the chambers, the eight-well chamber was separated and removed from the slide. VECTASHIELD Vibrance® Antifade Mounting Medium with DAPI (Vector Laboratories #H-1800, lot #ZJ0331) was added to each section, a Fisherbrand™ Superslip Cover Slip (Fisher Scientific #12-545-88) was gently placed onto the slide, and clear nail polish was applied to seal the edges of the slide. After drying at RT, cells were imaged with an Olympus BX63 Automated Fluorescence Microscope attached to a Hamamatsu C11440 Digital Camera. Peptide Conjugation to Magnetic Beads Cyclic peptides containing a flanking Cys-Cys disulfide bridge were synthesized and stored with acetate counterion by CPC Scientific (San Jose, CA, USA). For CGWGGLLCC (SEQ ID NO: 24), the synthetic peptide excluded the last cysteine residue (i.e., CGWGGLLC; SEQ ID NO: 28) as recommended in order to avoid a free cysteine residue which can serve as a site of oxidation. For all synthetic peptides, purity of >96% was confirmed via reversed-phase high-performance liquid chromatography and identity was confirmed via amino acid analysis and mass spectrometry by CPC Scientific. Upon delivery, peptide identities and the presence of disulfide bridge were confirmed with an Orbitrap Fusion™ Lumos™ Tribrid™ Mass Spectrometer (Thermo Fisher Scientific™) by the Center for Advanced Proteomics Research at Rutgers New Jersey Medical School (Newark, NJ, USA). Amine-activated (NHS-group, long-arm) magnetic beads (LifeTein #13513) were -55- 55335674.2 Attorney Docket No.370602-7079WO1(00272) conjugated to the synthetic peptides. For each peptide, 4 mg of beads were washed once with coupling buffer (10 mM monopotassium phosphate, 0.15 M NaCl, pH 5.5). Peptide (0.4 mg in 1 mL coupling buffer) was added to the beads with subsequent rotation for 4 h at RT (for negative control no-peptide beads, coupling buffer without peptide was added). Beads were then washed with washing buffer (1 mL) (0.05 M Tris-HCl, 0.5 M NaCl, pH 8) via vortexing for 30 s, for a total of four washes. Next, beads were incubated with blocking buffer (1 mL) (1 M ethanolamine, pH 9) via shaking at 4° C ON. During the following day, beads were washed with cold washing buffer (1 mL) via vortexing for 30 s, for a total of three washes. Beads were then kept in storage buffer (1 mL) (PBS, 0.1% BSA, 0.1% sodium azide, pH 7.4) at 4° C until use. Protein Extraction from Rhesus Macaque and Human Tissues Protein was extracted from tumor and non-tumor colon tissue from the two screened rhesus macaques and tumor (i.e., colon adenocarcinoma) from five human patients with defective mismatch repair genes (Table 2). De-identified human tissue samples were obtained from the Biospecimen Repository and Histopathology Service at Rutgers Cancer Institute of New Jersey (New Brunswick, NJ, USA). Table 2: Description of human colon adenocarcinoma samples that underwent protein extraction for receptor isolation with peptide-conjugated magnetic beads. Tumor Tumor P Known Defective Patient athology Treatment Tumor Cell Mismatch Repair Tissues were thawed on ice, cut with sterile instruments, and weighed. The tissue -56- 55335674.2 Attorney Docket No.370602-7079WO1(00272) samples were subsequently ground in cold Tris-buffered saline (TBS) (1 mL) by using glass tissue grinders. Ground tissues were then centrifuged at 4,000×g for 5 min at 4° C. Supernatant was stored at -80° C, while the pellet was resuspended with protein extraction buffer (5 mL) (1 mM phenylmethane sulfonylfluoride, 1 mM calcium chloride, 1 mM magnesium chloride, 50 mM octylglucoside, 0.01% Triton X-100 in TBS) and shaken ON at 4° C. During the following day, the resuspension was centrifuged at 3,214×g for 10 min at 4° C. The supernatant was stored at -80° C, while the pellet was resuspended with protein extraction buffer (1 mL) and transferred to a Precellys Lysing Kit (Hard Tissue Grinding MK28, 2 mL). Of note, Precellys Lysing Kits had been blocked with TBS containing 10% BSA ON at 4° C, washed three times with TBS (500 µL) for 10 min each at RT, and stored in TBS at 4° C. Samples were homogenized with a Precellys 24 Tissue Homogenizer (Bertin Technologies) at 5,000 rpm. Samples were left rotating ON at 4° C. Samples were then recovered and centrifuged at 10,621×g for 15 min at 4° C. The supernatant was stored at -80° C, while the pellet was resuspended with protein extraction buffer (1 mL) and rotated ON at 4° C. Protein extract concentrations were measured by using the Pierce™ BCA Protein Assay Kit (Thermo Scientific™ #23227) with a Varioskan™ LUX Multimode Microplate Reader (Thermo Scientific™). Candidate Receptor Isolation and Identification Peptide-conjugated magnetic beads were used to isolate receptors from the protein extracts of tumor and non-tumor colon. The beads were first washed with PBS (1 mL) by vortexing for 30 s, for a total of three washes. Next, 2 mg of peptide-conjugated beads were incubated with either 0.1 mg or 2 mg of combined protein extract from either tumor or non- tumor colon and shaken ON at 4° C. Of note, protein extracts were combined from either the two rhesus macaques (tumor or non-tumor colon) (0.1 mg) or the five human patients (tumor only) (0.1 mg or 2 mg). During the following day, the beads were washed with PBS, 1 M NaCl, pH 7.4 (1 mL) by vortexing for 10–20 s, for a total of 10 washes. Bound proteins were then eluted by adding elution buffer (0.1 M glycine, 0.1 M NaCl, pH 2.5) (100 µL) and vortexing. The eluant was then buffered by adding 1 M Tris, pH 9 (25 µL). The elution was performed a total of three times. The eluants were then combined and concentrated by using an Amicon™ Ultra-0.5 Centrifugal Filter Unit (MilliporeSigma™ #UFC501096). Eluted proteins were then incubated with NuPAGE™ LDS Sample Buffer (Invitrogen™ NP0008) with 5% β-mercaptoethanol for 5 min at 98° C. Negative controls included (i) peptide- conjugated beads with combined protein extract from the non-tumor colons for the rhesus -57- 55335674.2 Attorney Docket No.370602-7079WO1(00272) macaques, and (ii) non-conjugated beads with combined protein extract from the tumors for the human patients. All eluted proteins were loaded and run on NuPAGE 4–12% Bis Tris Gel (Invitrogen™ #NP0322BOX) with NuPAGE MES SDS Running Buffer (Invitrogen™ #NP0002-02) via the following parameters: (i) 100 V, 120 mA, 25.0 W for 10 min, then (ii) 200 V, 120 mA, 25.0 W for 35 min. After completion, the gel was (i) rinsed with water three times, (ii) fixed with 50% methanol, 10% acetic (50 mL) for 1 h at RT, (iii) washed with water for 5 min at RT, for a total of three washes, and (iv) stained with SimplyBlue™ SafeStain (Invitrogen™ #LC6060) ON at RT. During the following day, the gel was washed with water multiple times until the SimplyBlue™ SafeStain was fully removed. Candidate receptor identification was performed at the Center for Advanced Proteomics Research at Rutgers New Jersey Medical School (Newark, NJ, USA). Full lane in-gel trypsin digestion, C18 desalting, and liquid chromatography with tandem mass spectrometry (LC-MS / MS) via an Orbitrap Fusion™ Lumos™ Tribrid™ Mass Spectrometer (Thermo Fisher Scientific™) were performed. The MS / MS spectra were searched against the UniProt Macaca mulatta or Homo sapiens database by using the SEQUEST search engine on Proteome Discoverer version 2.4 with a false-discovery rate of 1%. Label-free quantification of the proteins provided relative values. Proteins that (i) had ratios of at least 2:1 compared to the respective negative control and (ii) were shared by the human tumors 2 mg isolation and at least one other isolation (rhesus macaque tumors 0.1 mg or human tumors 0.1 mg) were defined as potential binding partners. Moreover, an increasing trend in ratio value for a protein was expected to be observed between human tumors 0.1 mg and human tumors 2 mg given the likelihood of increased signal-to-noise ratio. Protein-Based Phage-Binding Assay Protein-based phage-binding assays were performed to assess lead peptide binding to potential binding partners. First, 200 ng of recombinant HRNR (aa 132–199) (Novus Biologicals #NBP1-80807PEP, lot #000041425) in PBS (50 µL) were added to individual wells of a Nunc™ Clear Flat-Bottom Immuno Nonsterile 96-Well Plate with MaxiSorp™ (Thermo Scientific™ #439454) sealed with SealPlate® (Excel Scientific #100-SEAL-PLT) and incubated ON at 4° C to allow protein immobilization. BSA was used as a negative control. During the following day, each well was rinsed once with PBS (200 µL) and blocked with PBS (200 µL) containing 2% non-fat milk, 1% casein, 0.01% Tween 20, and 0.01% -58- 55335674.2 Attorney Docket No.370602-7079WO1(00272) sodium azide for 2 h at RT for blocking. Next, each well was incubated with 2×109TU of the corresponding peptide-displaying or insertless phage in PBS containing 1% BSA (50 µL) for 2 h at RT to allow phage binding to immobilized proteins. Individual wells were then thoroughly washed 10 times with PBS (200 µL) to reduce non-specific phage binding. K91KanRE. coli grown in TB medium until an optical density (600 nm absorbance) of 1.4– 1.8 was distributed to each well (100 µL) for infection with any protein-bound phage for at least 30 min at RT. To confirm lack of cross-contamination with phage, the K91KanRE. coli culture (not infected with phage) was plated on LB agar plates with kanamycin (100 µg / mL) and tetracycline (40 µg / mL) before and after handling phage. After 30 min at RT, each set of infected K91KanRE. coli cultures were prepared in LB medium (200 µL each) was directly plated (three replicates each) as well. All plates were incubated ON at 37° C. During the following day, the colonies were counted (each colony corresponds to one viable phage particle). For protein-based phage-binding assays including synthetic peptides, the same protocol was maintained with minor additions and adjustments. Namely, immediately after blocking, the immobilized recombinant proteins were incubated with synthetic peptide at a concentration of either 1, 3, 10, 30, or 100 µg / mL in PBS containing 1.5% BSA (90 µL) for 2 h at RT. Next, 109TU of phage in PBS containing 1.5% BSA (10 µL) were directly added and incubated with the synthetic peptide and immobilized recombinant protein for 2 h at RT. The subsequent steps were identical. Immunohistochemistry Formalin-fixed paraffin-embedded (FFPE) human tumor and normal tissue adjacent to the tumor (NAT) sections baked for 1 h at 60° C, including hematoxylin and eosin staining, were obtained from the Biospecimen Repository and Histopathology Service at Rutgers Cancer Institute of New Jersey (New Brunswick, NJ, USA). These de-identified specimens correspond to those used in the receptor isolation (Table 2). -59- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Table 3: Description of human colon adenocarcinoma samples that underwent immunohistochemical staining along with corresponding normal tissue adjacent to the tumor (NAT). Tumor Patholo Tumor Known Defective Patient Tumor St gy Treatmen Location atus Report t Status Cell Mismatch Repair Fraction Genes p y xylene substitute (VWR® #89370-090) twice for 3 min each, 100% ethanol twice for 3 min each, 95% ethanol twice for 3 min each, and 80% ethanol once for 3 min. Tissue sections were then transferred to TBS containing 0.025% Triton X-100. Antigen retrieval was performed with Antigen Retrieval Citrasolution (Biogenex #HK086-9K) by using the PT Module (Epredia); slides were pre-heated from RT to 85° C in 7 min, heated at 100° C for 20 min, and cooled to 65° C in 20 min. Tissue sections were stained by using the Autostainer 360 (Epredia). Slides were first rinsed with TBS. Proteins were blocked with TBS (200 µL) containing 1% goat gamma globulin (Jackson ImmunoResearch #005-000-002, lot #124909) for 1 h at RT. Next, horseradish peroxidase (HRP) and alkaline phosphatase (AP) enzymes were blocked with Peroxidase and Alkaline Phosphatase Blocking Reagent (Dual Endogenous Enzyme-Blocking Reagent) (Agilent DAKO #S2003) for 20 min at RT. After rinsing with TBS, tissue sections were stained with TBS (200 µL) containing 2 µg / mL of rabbit polyclonal anti-HRNR antibody (antigen of aa 132–199) (Novus Biologicals #NBP1- 80807 lot #000041277) and 0.025% Triton X-100 for 1 h at RT. Rabbit IgG isotype control (Invitrogen™ #10500C, lot #1117925A) (1:500) was used as a negative control. After rinsing with TBS, tissue sections were incubated with TBS (200 µL) containing 1:1,000 goat anti- rabbit antibody conjugated to HRP (G-Biosciences #786-R39, lot #190102) and 0.025% -60- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Triton X-100 for 1 h at RT. After rinsing with TBS, tissue sections were incubated with betazoid 3, 3' diaminobenzidine (DAB) (BioCare Medical #BDB2004L) (200 µL) for 5 min at RT. After rinsing with TBS, tissue sections were stained with Mayer’s Hematoxylin (Thermo Scientific™ #TA-060-MH) (100 µL) for 1 min at RT. Tissue sections were then rinsed with TBS followed by water. Tissue sections were dehydrated and deparaffinized via incubation in 95% ethanol three times for 5 min each, 100% ethanol three times for 5 min each, and xylene substitute three times for 10 min each. Tissue sections were dried ON at RT. DPX Mountant (Sigma-Aldrich®#06522) was added to each section and a Fisherbrand™ Superslip Cover Slip (Fisher Scientific #12-545-88) was gently placed onto the slide. After drying at RT, tissue sections were imaged with an Olympus BX63 Automated Fluorescence Microscope attached to an Olympus DP27 Microscope Digital Camera. Tissue sections were reviewed by a certified pathologist at Rutgers New Jersey Medical School. In Silico Analysis of Ligand-Receptors Atomic structural visualization and analysis of proteins in 3D were performed by using UCSF ChimeraX version 1.7. Representative PDB files containing atomic coordinates of human proteins of interest were identified by using PDBe-KB and downloaded from the RCSB Protein Data Bank. If the 3D atomic structure of a protein did not have sufficient coverage or had not been previously experimentally determined, the corresponding UniProt accession number was searched on AlphaFoldDB and the corresponding predicted 3D atomic structure was downloaded. Highly disordered large regions were excluded from visualization. If AlphaFoldDB did not contain a predicted 3D atomic structure for a given human protein, then the amino acid sequence was manually entered into ColabFold with default settings for prediction by AlphaFold2. In particular, the latter option was utilized for human HRNR (a 2,850-residue protein); only aa 1–120 were inputted for structural modeling based on the highly disordered configuration observed for mouse HRNR in AlphaFoldDB. Source files for 3D atomic structure representation are listed in Table 4. Table 4: Source files for analyzed three-dimensional (3D) atomic structures of each protein. Protein Source of 3D Atomic Structure -61- 55335674.2 Attorney Docket No.370602-7079WO1(00272) FABP5 PDB (7FWI-A) HNRNPR AlphaFoldDB (O43390-F1-model_v4) Data were plotted by using GraphPad Prism 10. E-values for motif identification and analysis were calculated by XSTREME. The remaining statistical analyses were performed with GraphPad Prism 10 as described in the figure legends. Example 1: In Vivo Phage-Displayed Peptide Library Screenings of Rhesus Macaques with Hereditary Colon Cancer To characterize the repertoire of homing peptides across the full diversity of physiologic and pathologic tissues, two rhesus macaques with MLH1-rheMac HNPCC syndrome were screened in vivo with a phage-displayed peptide library. At the end of life and after symptoms of advanced disease were identified, the animal subjects underwent infusion with and systemic circulation of admixed CX7C and CX8C peptide libraries, followed by euthanization and necropsy. Over 50 tissues, including colon tumor, colon tumor-adjacent tissue, and non-tumor colon, from each monkey were processed for DNA extraction and downstream characterization of (i) genomic profiles via whole-exome sequencing and (ii) phage particles via quantitative PCR and NGS. The two rhesus macaques in this study originated from an established colony with MLH1-rheMac HNPCC syndrome. A previous study identified the loss of DNA mismatch repair protein, MLH1, in colon tumors from all animals; targeted sequencing of MLH1 attributed this phenomenon to either multiple single-nucleotide polymorphisms (SNPs) throughout the gene or a deletion in its promoter. However, the complete exomes of these rhesus macaques have previously not been sequenced. Hence, whole-exome sequencing of the non-tumor colon and colon tumor from each of the screened animal subjects was performed in order to identify germline and somatic mutations among their protein-coding -62- 55335674.2 Attorney Docket No.370602-7079WO1(00272) genes. By comparison with a reference Macaca mulatta genome, germline mutations were identified and classified according to impact. Across both animal subjects, several high- impact mutations (e.g., frameshift, start codon loss, stop codon gain or loss, etc.), which are anticipated to severely disrupt physiologic protein function, affect over 500 different genes. On PantherDB, the 532 genes were recognized for 622 molecular function hits, 958 biological process hits, and 532 protein class hits. The encoded proteins are from a diversity of molecular functions, biological processes, and protein classes. In terms of molecular function, the majority of assigned genes are involved in binding (n=138), catalytic activity (n=92), or molecular transducer activity (n=55) (FIG.2A). With regard to biological processes, the most abundant assigned classes are cellular process (n=195), biological regulation (n=144), response to stimulus (n=124), and metabolic process (n=107) (FIG.2B). Assigned protein classes are also extensive, with the greatest numbers in defense / immunity protein (n=57), transmembrane signal receptor (n=50), metabolic interconversion enzyme (n=45), and protein-modifying enzyme (n=44) (FIG.2C). Upon focused analysis, the set of genes with high-impact germline mutations contain multiple tier-one and tier-two genes of the COSMIC Cancer Gene Census along with additional established DNA repair genes (FIGs.3A, 3B, and 16). Among the tier-one genes (i.e., genes with activity related to cancer and evidence of oncogenic-promoting mutations), MLH1 contains a point mutation leading to the gain of a stop codon in J615 rhesus macaque. BRCA2, another well-characterized DNA repair gene, also contains several mutations, leading to a frameshift variant along with splice acceptor variant coupled with an intron variant in both alleles of each rhesus macaque. Other genes with high-impact mutations in one or both rhesus macaques that are responsible for DNA repair include ERCC4, FANCD2, and RECQL4 in tier one in addition to DNTT, HERC2, HFM1, MSH4, NUDT1, and NUDT15 (which are not members of the COSMIC Cancer Gene Census). These findings corroborate the complex hereditary predisposition for cancer in the screened animals and provide a more comprehensive view of sample genetic profiles originating from the colony of rhesus macaques with MLH1-rheMac HNPCC syndrome. By comparing the exome profile of the colon tumor specimen to that of the corresponding non-tumor colon specimen, somatic mutations were identified in each rhesus macaque. The tumor mutational burdens of J615 (24.6 mutations / Mb) and J737 (35.8 mutations / Mb) rhesus macaques are both defined as high (≥20 mutations / Mb). Mutational signatures were quantified as a way to broadly classify patterns of mutations; namely, the -63- 55335674.2 Attorney Docket No.370602-7079WO1(00272) mutations were categorized according to the established single-base substitution (SBS) signatures, which are dependent on the specific substitution (six different substitutions are possible in the genetic code) and its context (i.e., immediately adjacent nucleotides). These mutational signatures often have proposed etiologies that may be expected given known information about the animal of origin or may suggest novel insights that were previously unanticipated. Quantification of mutational signatures from each rhesus macaque revealed strong correlation between the two animals (FIG.4A). Dominant mutational signatures in the tumors of both animals include SBS3, SBS40, SBS6, and SBS46. SBS3 is likely caused by impaired homologous recombination-mediated DNA damage repair and is closely linked with mutations in BRCA2 and BRCA1. Given that BRCA2 has several high-impact mutations in both alleles of the two animals, it is expected that SBS3 is common. SBS40 is also highly present; this signature currently does not have a proposed etiology, though it tends to be correlated with patient age for some cancers. SBS6 is most likely attributed to faulty DNA mismatch repair and primarily detected in tumor samples with a high degree of microsatellite instability. These observations are consistent with the set of highly impacted DNA mismatch repair genes (including MLH1) across both animals. SBS46 had previous been found frequently in colorectal cancer in early datasets, though it is now considered to be a plausible sequencing artifact. An additional analysis of mutational signatures relative to opportunity in the exomes revealed an even stronger correlation between the two rhesus macaques and marked relative abundance of SBS87, SBS37, SBS1, and SBS39 (FIG.4B). SBS87 is known to be linked to treatment with thiopurines (a class of chemotherapeutic agents), though the rhesus macaques had not received any form of cancer treatment. SBS1 has been described to arise due to the inability to repair the deamination of 5-methylcytosine to thymine. It tends to be highly frequent in colorectal adenocarcinoma and, similar to SBS40, its frequency correlates with patient age. SBS37 and SBS39 have unknown etiologies. Next, for evaluation of the phage-displayed peptide library screenings, quantitative PCR revealed the relative distribution of phage particles across the full collection of tissues per monkey (FIG.5A and FIG.5B). The most phage-abundant tissues included liver, spleen, and lymph nodes. These findings are expected as these organs and tissues are substantial components of the mononuclear phagocytic system and therefore continuously traffic phage particles from the systemic circulation. Conversely, the least phage-abundant tissues included those that comprise the brain and spinal cord. These organs are indeed among the most physiologically restrictive due to their respective blood-brain and blood-spinal cord barriers. -64- 55335674.2 Attorney Docket No.370602-7079WO1(00272) The vast majority of remaining tissues captured amounts of phage particles between these upper and lower limits, suggesting preferential homing. This assessment confirmed a successful in vivo screening strategy consistent with the expected recovery of phage particles across a comprehensive set of tissues. Subsequently, NGS was performed to identify and quantify the DNA-encoded peptides displayed on the phage particles that homed to each tissue of the two rhesus macaques. After identifying and translating nucleotide sequences that are (i) located at the insertion site within the pIII minor coat protein, (ii) in-frame, and (iii) lacking a stop codon, over 600 million reliable CX7C and CX8C peptide reads were identified across all tissue types from both animals (FIG.6A and FIG.6B). A key concept in in vivo phage display that confirms the specificity of ligand-directed homing as opposed to random accumulation of phage particles in a tissue is peptide saturation. Namely, if interactions with specific receptors facilitate phage homing, then distinct peptides would comprise a smaller fraction of total accumulated peptides in a tissue type in comparison to the peptide library. In the conducted screens, all tissues averaged across the two rhesus macaques demonstrate saturation of peptides (2.6–33.1%) in comparison to the sequenced CX7C and CX8C peptide libraries (75.9% and 76.7%, respectively). The major tissues of the mononuclear phagocytic system (liver, spleen, and lymph nodes) demonstrate higher percentages in comparison to most other tissues, consistent with the aforementioned clearance of phage particles from systemic circulation. Conversely, highly selective tissues demonstrate markedly low percentages, including cerebellum (3.7%), cerebrum (3.4%), and different sections of the spinal cord (2.6–3.6%). Furthermore, the high degree of variability of the peptide libraries demonstrate their quality for screening purposes. It is worth noting that the ratio of distinct peptides to total peptide reads for the libraries is not expected to be 1:1 (i.e., 100%) as a single amino acid sequence can be translated from a multitude of different nucleotide sequences; due to the degeneracy of the genetic code, each amino acid can be encoded by two to six different tri-nucleotide codons. These findings further validate the quality of the screenings in the two rhesus macaques. Example 2: Selection of Lead Peptide Candidates for Colon Adenocarcinoma The compiled repertoire of over 600 million homing peptides from diverse tissues, including colon adenocarcinoma, of the two rhesus macaques presents an opportunity for the identification of tumor-specific receptors accessible to circulating ligands. About 300 thousand distinct peptides were identified in each tumor, of which 510 were shared by both -65- 55335674.2 Attorney Docket No.370602-7079WO1(00272) rhesus macaques (FIG.7A). Computational analysis of these peptides revealed four enriched motifs (FIG.7B). One such motif is RGD, the well-characterized three-mer that binds several integrins targetable in cancer and other diseases. It is notable that the naïve peptide library screenings and bioinformatic analysis were able to identify established tumor-targeting motifs as a positive control, further validating the integrated strategy. A second enriched motif corresponds to a signature of the ETS domain, a highly conserved DNA-binding motif found in the ETS family of transcription factors. These transcription factors are often upregulated in solid tumors and their binding altered due to promoter mutations. The other two enriched motifs do not demonstrate any overlap with known motifs, providing an opportunity for novel characterization. The 510 peptides found in the tumors of both rhesus macaques vary in terms of distribution in the non-tumor tissues of the animals (FIG.7C). Firstly, some peptides deemed “pan-vascular” are found in nearly all tissues likely due to ubiquitous receptors present throughout the vasculature. In comparison, certain peptides are only found in a smaller subset of tissues. Of the 510 tumor-shared peptides, 107 were found exclusively in the tumors of both animals (i.e., not in any other tissue type from either subject). Without wishing to be bound by theory, this finding suggests that certain receptors in the tumors are exclusively accessible to circulating ligands. In the context of discovering novel targets, this subset of tumor-selective peptides provides a pathway for further investigation. The 107 tumor-shared and -exclusive peptides represent a subset of homing ligands that likely bind to selectively accessible proteins in the microanatomic context of colon cancer. The read counts for the top 25 peptides vary between the two rhesus macaques and are often overrepresented in a single animal (FIG.8A). The heterogeneity may be attributed to the multi-step strategy of sampling, DNA extraction, downstream amplification, and NGS, which naturally render differences in the quantification of phage-displayed peptides. However, certain peptides (such as CEGNHADHIC (SEQ ID NO: 22) and CLSGTSGRC (SEQ ID NO: 25)) demonstrate substantial read counts across both animals. Next, unsupervised alignment and clustering of the 107 peptides (specifically the core amino acid sequences between the flanking cysteine residues) with a permitted single insertion and deletion facilitated their categorization into separate groups. The optimal number of clusters (three) was determined according to the greatest Kullback-Leibler distance (KLD). The three generated clusters are depicted (FIG.8B). Some of the motifs enriched in the larger set of 510 tumor-shared peptides are notably still present in this subset (i.e., EGNHADHIC (SEQ ID NO: 29) and PKM). Given the interest in identifying not only homing peptides but also their targeted proteins for functional evaluation of ligand-receptor interactions, seven peptides -66- 55335674.2 Attorney Docket No.370602-7079WO1(00272) were selected as representative candidates for further investigation. Motif analysis of all possible five-mers from the seven representative peptides revealed marked tumor specificity (FIG.8C). Example 3: Functional Targeting of Human Colon Cancer The next step is to determine whether the findings obtained from the non-human primates are relevant in the setting of human disease. In particular, it is important to evaluate whether the seven-representative tumor-shared and -exclusive peptides are capable of targeting human colon cancer in the in vitro setting. First, individual phage constructs were cloned to display one of the seven peptides on the pIII minor coat protein. Subsequently, each of the peptide-displaying phage constructs was evaluated for binding to the surface of human colon cancer cells. If the corresponding receptor(s) of a peptide is expressed, localized to the membrane, accessible, and conformationally compatible with ligand-binding on the cell surface, then the peptide-displaying phage would be expected to interact with this protein(s). Four peptide-displaying phage constructs (CAGWEGRGLC (SEQ ID NO: 21), CEGNHADHIC (SEQ ID NO: 22), CGAFGGGGC (SEQ ID NO: 23), and CGWGGLLCC (SEQ ID NO: 24)) remained bound to the cell surface to a greater degree than insertless phage (i.e., no displayed peptide) (negative control) (FIG.9A). A similar study was conducted using the SNU-407 cell line, which found similar results (FIG.9B) ) and CPKMAVVGFC-displaying phage was also found to be bound to the cell surface. Next, each phage construct was qualitatively evaluated for internalization by the human colon cancer cells after 2 h or 18 h of incubation. If bound to the corresponding receptor(s), peptide- displaying phage may undergo internalization depending on the nature of the ligand-receptor interaction. The peptide-displaying phage constructs were able to be internalized by the cells to varying degrees. At 2 h, CGWGGLLCC (SEQ ID NO: 24)-displaying phage was internalized in a similar manner as CDCRGDCFC (SEQ ID NO:30) -displaying phage, a positive control which binds to αV integrins (FIG.10A). In comparison, the other peptide- displaying phage were unable to be internalized at this time point and achieved qualitatively comparable results as insertless phage. However, at 18 h, most of these peptides demonstrated internalization to varying degrees (FIG.10B). The variability may be attributed to the nature of ligand-receptor interactions, as internalization mechanisms in biology can vary. These data support the human relevance of the screening strategy in a non-human primate model integrated with bioinformatic analysis for the identification of tumor-specific peptides. -67- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Example 4: Isolation and Identification of Potential Binding Partners The discovery of tumor-homing ligands necessitates the identification of their corresponding receptors in order to fully characterize the nature of the ligand-receptor interaction. For the set of seven tumor-shared and -exclusive peptides, it is anticipated that their receptors are selectively accessible in the tumor microenvironment. Therefore, an integrated biochemical and proteomic approach was utilized to isolate and identify potential binding partners of each peptide. First, cyclic peptide-conjugated magnetic beads were incubated with protein extract from colon tumors to isolate candidate receptors. In an effort to increase the stringency of candidate receptor identification and enable cross-species translation, resected tumor specimens from human patients with colon cancer were also incorporated. Hence, separate isolations were performed for two different samples of protein extract per peptide: (i) combined colon adenocarcinoma of J615 and J737 rhesus macaques, and (ii) combined colon adenocarcinoma of five human patients with mismatch repair deficiencies (namely MLH1 and PMS2). An additional set of receptor isolation with a greater amount (20 times) of protein extract was incorporated for the human samples in order to increase the signal-to-noise ratio for protein identification. For the three separate sets of receptor isolations, the negative control included (i) isolation from rhesus macaque non- tumor colon protein extract by using peptide-conjugated beads, or (ii) isolation from human tumor protein extract by using non-conjugated magnetic beads. Next, the isolated proteins underwent LC-MS / MS for identification and relative quantification. Overlapping proteins that met the defined criteria were deemed as potential binding partners (see Materials and Methods) (FIG.11A). Across the pursued representative peptides, 12 candidate protein binders were identified (FIG.11B and Table 5). A candidate partner was not identified for CSSHFSAMC (SEQ ID NO: 27) based on the defined criteria, indicating that less stringent analytical strategies may be required. Alternatively, its potential binding partner may not be a protein and may instead be another type of molecule (e.g., lipid, carbohydrate, nucleic acid, etc.). Table 5: Potential binding partners identified by liquid chromatography with tandem mass spectrometry (LC-MS / MS) of the representative colon tumor-shared and - exclusive peptides. -68- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Code Possible Full Name PANTHER UniProt Peptide Ligands SEQ Target Protein Class Accession ID NO: limitations of free cysteine residue (i.e., oxidation). Note 2: No potential binding partner for CSSHFSAMC (SEQ ID NO: 27) based on the defined criteria (see Materials and Methods) was identified. Example 5: Validation of Hornerin (HRNR) as a Candidate Receptor The identification of potential binding partners provides an opportunity to explore the relevance of these specific proteins in the context of colon cancer. Moreover, the investigation of select candidates is necessary for the validation of the integrated strategy of naïve peptide library screening and lead ligand selection in a non-human primate model of hereditary colon cancer. Thus, the ligand peptide with the strongest binding to the human colon cancer cell line as well as robust and rapid internalization, CGWGGLLCC (SEQ ID -69- 55335674.2 Attorney Docket No.370602-7079WO1(00272) NO: 24), along with its candidate receptor, hornerin (HRNR), was pursued. HRNR is a 2,850-residue protein in the S100-fused protein family. It mainly consists of an S100-like region, comprised of two EF-hand domains, and a large, repeated region predominantly containing glycine, serine, and glutamine amino acids. Similar to profilaggrin, it plays a critical role in epidermal cornification. In the tumor-relevant context, it has been shown to regulate tumor vascularity in a VEGF-independent manner in pancreatic cancer. Given the previously observed binding of CGWGGLLCC (SEQ ID NO: 24)- displaying phage to the surface of the human colon adenocarcinoma cell line, HCT 116, in addition to its internalization, the presence of HRNR on the cell surface was assessed via FACS. Cells possessed high levels of fluorescence corresponding to the candidate receptor in comparison to the negative controls (FIG.15A). Moreover, a notably high fraction of cells was positive for HRNR (FIG.15B). These findings reveal that HRNR is indeed accessible on the surface of colon cancer cells, providing a plausible explanation for its potential targeting In order to validate its candidacy as a receptor for CGWGGLLCC (SEQ ID NO: 24), phage-binding assays in microtiter plates were performed wherein CGWGGLLCC (SEQ ID NO: 24)-displaying phage particles bound specifically to immobilized recombinant human HRNR132–199 (a representative section of the large, highly repeated region) in comparison to the negative controls (FIG.12A). The targeting specificity of CGWGGLLCC (SEQ ID NO: 24) was further confirmed by performing a phage-binding inhibition assay, wherein phage binding was assessed in the presence of increasing concentrations of the cognate synthetic cyclic peptide. CGWGGLLCC (SEQ ID NO: 24)-displaying phage binding to HRNR was inhibited in the presence of at least 10 µg / mL of peptide, with maintained inhibition at 30 µg / mL and 100 µg / mL (FIG.12B). Conversely, phage binding to HRNR was not inhibited in the presence of an unrelated cyclic peptide (amino acid sequence CAPAC), further supporting the specific binding of CGWGGLLCC (SEQ ID NO: 24) to HRNR. These in vitro assays support the biochemical isolation and identification of at least one ligand-receptor. Example 6: Histological Analysis of HRNR in Human Colon Cancer Given the validation of the physical interaction between HRNR and CGWGGLLCC (SEQ ID NO: 24), the presence and distribution of HRNR in human colon cancer were assessed to determine its candidacy as a target. Tissue sections of colon adenocarcinoma and NATs obtained from the aforementioned five patients with mismatch repair deficiencies underwent histological analysis. In particular, immunohistochemical staining of HRNR qualitatively demonstrated a markedly higher presence of HRNR in all samples in -70- 55335674.2 Attorney Docket No.370602-7079WO1(00272) comparison to the negative controls, isotype antibody and no primary antibody (FIG.13). HRNR was largely localized to cytoplasmic granules of the cancer cells, which are particularly prominent around the mucin vacuoles. It was also detected in inflammatory cells, predominantly the plasma cells. In comparison, staining of HRNR in NATs from the corresponding patients revealed lower levels of the protein (FIG.14). HRNR was mainly detected in the mucosal layer and limited to the inflammatory cells, again the plasma cells, and the basal cells at the pits of the intestinal glands. In certain cases, tubulovillous changes in the form of deepening lumina and bifurcation of the glands were observed in the mucosa, consistent with pre-malignant transformations. Overall, a certified pathologist graded the staining as moderate to high in the tumors with clear distinction from the NATs. Example 7: Selected Discussion Colorectal cancer is currently the second-leading cause of cancer-related death in the world and is a growing threat for the population under 50 years of age in certain countries. Thus, the discovery of novel targets for therapeutic exploitation is imperative. The current efforts based on in vivo phage display screenings in non-human primates with MLH1-rheMac HNPCC syndrome and naturally developed colon adenocarcinoma have generated a comprehensive assembly of vascular ligands in non-human primates, which is the most extensive in terms of both peptide quantity and tissue diversity in any mammal to date. The repertoire of recovered peptides from tumor and all organ systems is a valuable resource for the investigation of tumor-homing ligands and their binding partners in the context of whole animals. The work described herein validates the merits of this dataset in discovering novel tumor-specific ligand-receptors, with HRNR serving as the primary example of a novel target for colorectal carcinoma. Extensive Genomic Profiling of MLH1-rheMac HNPCC Syndrome Since the reporting of MLH1-rheMac HNPCC syndrome in the originating colony of the screened rhesus macaques, large-scale genomic profiling had not previously been performed. Such an analysis can provide valuable information for further investigation of tumor characteristics in this setting. The original report had primarily focused on the assessment of protein expression of three key genes involved in the hereditary condition: MLH1, MSH2, and MSH6. The identification of MLH1 as the deficient mismatch repair protein had then guided its targeted sequencing, establishing a deletion in its promoter or several SNPs within the gene as the cause. In this study, comprehensive genomic assessment -71- 55335674.2 Attorney Docket No.370602-7079WO1(00272) for the two screened animal subjects via whole-exome sequencing led to the identification of high-impact germline mutations in not only MLH1, but also over 530 other characterized genes with a high diversity of molecular functions, associated biological processes, and originating protein classes. Remarkably, BRCA2 was severely mutated (including frameshift variants) in both alleles of each rhesus macaque. BRCA1 / 2 has recently been implicated in certain patients who meet the criteria for Lynch syndrome and hence may play a larger role in the hereditary condition. Several other genes with well-documented oncogenic roles according to COSMIC Cancer Gene Census are affected by high-impact germline mutations in both subjects, including FANCD2 (tumor suppressor gene), FLT3 (oncogene), JAK3 (oncogene), PPP6C (tumor suppressor gene), RECQL4 (oncogene and tumor suppressor gene), and TERT (oncogene and tumor suppressor gene). Moreover, NUDT15, a DNA repair enzyme that hydrolyzes nucleoside diphosphates, is also severely mutated in both rhesus macaques. The somatic mutations identified in the tumors reveal a high tumor mutational burden, which is characteristic of cancer defined by mismatch repair deficiencies. The dominant somatic mutational signatures found in the tumors of both rhesus macaques align with their germline mutations and phenotype. For example, SBS3 is associated with deficient BRCA2, SBS6 is likely due to defective mismatch repair and commonly found in microsatellite-unstable tumors, and SBS1 is frequently found in cases of colorectal cancer. Interestingly, SBS87 was also prominently found and is associated with exposure to thiopurines. However, the rhesus macaques in this study were raised in a controlled laboratory environment and had not received any cancer-specific treatment. Given that NUDT15 negatively regulates thiopurine activation and toxicity and was found to possess high-impact germline mutations in both rhesus macaques, it is tempting to speculate that faulty NUDT15 function may have predisposed these animals to developing the SBS87 mutational signature, potentially mimicking thiopurine exposure. Further investigations are required to explore this potential phenomenon. Overall, these findings from the non-human primates not only complement the in vivo screenings, but may also serve to better define the genetic basis of Lynch syndrome and colorectal cancer in humans. Identification of Shared and Exclusive Tumor-Homing Ligands Analysis of over 50 tissue types from each animal subject generated over 600 million recovered peptides from the rhesus macaques, compiling the largest and most diverse assembly of vascular ligands in any mammal to my knowledge. Moreover, it can provide valuable insights into the proteomic profile of the vasculature in non-human primates in -72- 55335674.2 Attorney Docket No.370602-7079WO1(00272) conjunction with other studies that have primarily assembled the transcriptomes of various tissues. With respect to the tumors, about 300 thousand distinct phage-displayed peptides were identified in each animal subject. These peptides may be bound to receptors accessible on not only endothelial cells, but also on other cell types and even in the extracellular matrix of the tumor microenvironment. The enrichment of motifs among the 510 distinct ligand peptides shared by the tumors from both animals is a noteworthy observation. Firstly, one enriched motif, RGD, was present in several different peptides. As previously noted, RGD is a well-characterized integrin-binding motif with highly efficient tumor-homing capabilities. The enrichment of this particular motif serves as one positive control for the integrated screening and analytical strategy and provides credence to the combined set of tumor-shared peptides. A separate enriched motif is a DNA-binding signature found in the ETS transcription factors, which have a prominent role in cancer biology. Extracellular DNA is indeed present in the tumor microenvironment as a result of active release or extravasation by cancer cells or simply cell death. It is tempting to speculate that the ligand peptides containing this motif were possibly bound to DNA, as the vascular targets of ligands identified by in vivo phage display are not always proteins. Indeed, a lung-homing peptide was recently reported to target the sphingolipid, C16-ceramide, and elicit downstream ceramide-based platform assembly upon binding. Such observations indicate that the heterogeneity of the vasculature is vast in the context of targetable zip codes. The prioritization of ligand peptides exclusively found in tumors from both animals comprises a stringent strategy for target discovery. A limitation of this approach is the inherent exclusion of additional promising tumor-homing ligands for consideration, as certain peptides recovered from these lesions may have been detected in negligible quantities across physiologic tissues. Alternative approaches that focus on analyzing the datasets in terms of smaller k-mers (such as tripeptides, quadripeptides, and pentapeptides) may be used for the selection of highly tumor-specific motifs. However, in the context of discovering tumor targets with exclusive accessibility, the strict selection of peptides not found in any other tissues is appropriate. This is especially true given that the panel of tumor-exclusive ligands was comprised of 107 distinct peptides. Moreover, the screening of two rhesus macaques as opposed to one reduces the likelihood of false-positives (i.e., phage particles that randomly accumulate in tissues irrespective of the displayed peptide) upon analysis of tumor-exclusive peptides shared by both animals. The findings generated from this strict methodology serve as an ideal base for the downstream identification of tumor-exclusive targets. Further narrowing the pool of 510 tumor-shared ligand peptides, 107 were identified -73- 55335674.2 Attorney Docket No.370602-7079WO1(00272) as tumor-exclusive. Seven were selected as lead candidates for functional validation in human samples. Findings generated from non-human primates are expected to possess a high rate of recapitulation in humans due to genetic conservation. Previously conducted in vivo phage-displayed peptide library screenings have been shown to reveal homing capabilities of certain motifs in both rhesus macaques and humans. Specifically, a human screening study had identified peptides resembling a white adipose-targeting peptide found in obese mice which bind to prohibitin and mimic the endogenous ligand, annexin A2 (ANXA2). The developed anti-obesity drug, PTP-1 (also known as Adipotide), efficiently reduced white adipose tissue by ablation of its vasculature in obese rhesus macaques, confirming the interspecies targeting capabilities of certain motifs. The current study disclosed herein is unique as it describes the first in vivo phage-displayed peptide library screenings of non- human primates and evaluates human applicability with rhesus macaques as the starting point. Several of the seven selected peptide candidates displayed on phage successfully targeted a human colon cancer cell line in the form of cell surface binding and even internalization, indicating potential functional applicability in human disease. CGWGGLLCC (SEQ ID NO: 24)-displaying phage, in particular, demonstrated the most robust binding in addition to a high degree of internalization as early as 2 h of incubation. It is important to note that cell surface binding does not necessarily result in internalization, both of which are dependent on the biology of the ligand-receptor interaction. As the in vitro experimental conditions cannot replicate the complex nature of the tumor microenvironment, the performed assays cannot preclude the targeting capabilities of the selected candidates in the case of non-observed binding for several reasons. First, the peptides may have had binding partners in the tumor microenvironment of the rhesus macaques that are not present on the surface of the utilized cancer cell line due to absent or limited expression or extracellular presentation. Their targets may instead be on other cell types or in the extracellular matrix. Second, immortalized cancer cell lines differ from primary cancer cells due to their altered genetic makeup for the purpose of continual passaging; cancer cell lines often have markedly altered molecular profiles that may not sufficiently reflect their corresponding primary carcinomas. Moreover, differential targeting may be observed for other colorectal cancer cell lines, which would require further investigation. Thus, the described in vitro cell-targeting assays cannot negate the targeting capabilities of the selected lead peptide candidates but can indirectly provide helpful insights into their function and biological relevance. Discovery of Promising Targets for Colorectal Cancer -74- 55335674.2 Attorney Docket No.370602-7079WO1(00272) For the pursued representative ligand peptides, a total of 12 promising protein binding partners was identified. For characterization of the ligand-receptor interactions, the experimental strategy centered on the isolation of binding proteins from not only primary colon adenocarcinoma samples of the two screened rhesus macaques, but also several patients with known mismatch repair deficiencies (including mutant MLH1) and varying tumor differentiation profiles. It was reasoned that similarities between profiles of the two originating groups would enhance the likelihood of isolating universal candidates. Strict quantitative criteria facilitated the stringent selection of probable binding partners, with nearly all filtered candidates found in samples from both species. It is encouraging that several candidates have either been targeted with inhibitors in the clinical setting or have extensively documented associations with cancer, while others possess limited or no direct insights in this context thus far. Heat Shock Protein 90 (HSP90)-α1 Heat shock protein 90 (HSP90)-α1 is a stress-inducible chaperone within the HSP90 family of proteins. HSP90-α1 along with HSP90-α2 is only expressed under conditions of stress as opposed to the constitutive expression of HSP90-β. Despite being classified as the cytosolic paralogs in the HSP90 family, these proteins (primarily the α isoform) can be trafficked to the extracellular region via exosomes and thereafter remain bound to the cell surface or secreted into the extracellular space. In tumors, this phenomenon facilitates invasion because of extracellular HSP90-α-mediated activation of several proteins, including matrix metalloproteinase (MMP)-2, MMP-9, and human epidermal growth factor receptor-2. The role of HSP90 in cancer has been extensively supported by both high expression and / or presence on the cell surface in several tumor types, including colorectal cancer. As a result, experimental HSP90 inhibitors are prevalent, with several being evaluated in ongoing clinical trials. Fatty Acid-Binding Protein 5 (FABP5) Fatty acid-binding protein 5 (FABP5) is a cytoplasmic protein responsible for the cellular uptake and transport of long-chain fatty acids. It is highly abundant in the epidermis, specifically the stratum corneum due to its role in keratinocyte differentiation, and also endothelial cells in several organs. Though several FABP proteins are implicated in cancer, FABP5 has been studied extensively in this context in recent years. Due to its role in lipid metabolism, it promotes proliferation and / or metastasis in numerous malignancy types, -75- 55335674.2 Attorney Docket No.370602-7079WO1(00272) including colon, gastric, prostate, liver, breast, cervical, central nervous system, bone, bladder, and renal cancer, in addition to pancreatic neuroendocrine tumors and multiple myeloma. However, Mujie Ye et al. (Communications Biology volume 6, Article number: 714 (2023)) reported downregulation and tumor suppressor activity of FABP5 in a separate study. Additional studies into its pathophysiological role are required. Stratifin (SFN) Stratifin (SFN), also known as 14-3-3 σ, is a marker of the epithelium. It is primarily found in keratinocytes, from which it is expelled via exosomes and thereafter stimulates the release of MMP-1 from adjacent fibroblasts. Prior studies have suggested its role as a tumor suppressor given observed downregulation or inactivation in tumorigenesis or metastasis. Others, in turn, have demonstrated that its expression is not downregulated and instead tends to be upregulated in various cancers, including colorectal cancer, with suggested roles in cytoskeletal remodeling, cell proliferation, apoptosis, invasion, and metastasis. In colorectal cancer, conflicting findings have been reported. With the lens of in vivo targeting, the upregulation or downregulation of the protein is not as critical as its physical translocation. Accessibility to the systemic circulation requires exposure of the protein, whether on the cell surface or in the extracellular matrix. Wenyun Hou et al. (Front Oncol.2022;12:912584) in particular revealed extracellular SFN in exosomes as a biomarker for perineural invasion in colorectal cancer. Exosomes and other types of extracellular vesicles containing cargos of various molecules are indeed important for cell-to-cell communication, especially in cancer. Moreover, the presence of potential binding partners in exosomes would indicate an extracellular avenue for targeting. Junction Plakoglobin (JUP) Junction plakoglobin (JUP), also known as γ-catenin, is involved in cell-cell adhesion and cell signaling. As an intracellular protein predominantly in epithelial cells, it is bound to (i) α-catenin and E-cadherin in the adherens junction, and (ii) plakophilin, desmoglein, desmocollin, and desmoplakin in the desmosome. These complexes serve as mechanical intermediaries between cells and either the actin cytoskeleton for adherens junctions or intermediate filament cytoskeleton for desmosomes. In addition, JUP also functions as a mediator of cross-talk between the two junction types. In terms of cell signaling, JUP activity can be linked to several pathways, including Wnt, Sonic hedgehog, Src, and Ras. It exhibits a tumorigenesis- and metastasis-inhibiting phenotype which may be largely attributed to its -76- 55335674.2 Attorney Docket No.370602-7079WO1(00272) interaction with TP53 in the cytoplasm and nucleus, a well-established tumor suppressor that is mutated in about half of all cancers. Interestingly, JUP increases the transcriptional activity of TP53 and is associated with TP53 at the promoter of SFN, another potential target discovered in our study. Given that both JUP and SFN were identified as possible binding partners of a single peptide, CEGNHADHIC, it is probable that a complex containing the two proteins was isolated for this ligand. In the context of colorectal cancer, JUP may be responsible for lung-specific metastasis via lymphatic invasion. Moreover, it is a physical interactor of adenomatous polyposis coli (APC), a tumor suppressor classically inactivated in colorectal cancer. Ribophorin I (RPN1) and Malectin (MLEC) Ribophorin I (RPN1) is a type I integral membrane protein and malectin (MLEC) is a carbohydrate-binding lectin protein, both of which are found in the rough endoplasmic reticulum and involved in the N-glycosylation of proteins. RPN1 improves N-glycosylation of select substrates, namely single-spanning membrane proteins, as part of the mammalian oligosaccharyltransferase complex. Moreover, RPN1 is also a subunit of the proteasome, where it binds ubiquitin and ubiquitin-like proteins for degradation. In turn, MLEC specifically binds to gylcosylated proteins at the attached N-glycan for quality control. Carmela Galli et al. proposed that this activity of MLEC is limited to stress conditions, upon which it undergoes activation to prevent the secretion of faulty, misfolded proteins. Interestingly, this phenomenon is dependent on the interaction of MLEC with RPN1, which regulates the quality control mechanism in two ways: (i) recognizing the backbone of the misfolded protein and (ii) physically anchoring MLEC to the endoplasmic reticulum, potentially in a specialized, quality control compartment. Under stress, MLEC is highly expressed and the resulting excess non-RPN1-bound copies localize to the Golgi apparatus. Qin-Peng Yang et al. (Glycobiology.2018;28(6):374-381) reasoned that this event may occur in order to reduce the burden of misfolded proteins in the endoplasmic reticulum. This “backup check” involving RPN1 and MLEC may conceivably be induced in the setting of cancer, which is characterized by endoplasmic reticulum stress due to hypoxia, insufficient nutrients, acidification, and oxidative stress. In breast cancer, RPN1 is often upregulated and promotes cell proliferation and invasion via the PI3K / AKT / mTOR pathway. Additional investigations into the roles of RPN1 and MLEC in cancer are necessary. Aldo-Keto Reductase Family 1 Member A1 (AKR1A1) -77- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Aldo-keto reductase family 1 member A1 (AKR1A1), commonly known as aldehyde reductase, is a well-established enzyme that reduces various carbonyl-containing molecules to their corresponding alcohols with a nicotinamide adenine dinucleotide phosphate hydrogen (NADPH)-dependent mechanism. It is also capable of metabolizing several chemotherapeutic agents and other drugs, which can be countered with an AKR1A1 inhibitor in colorectal cancer cell lines. Furthermore, it has been implicated in enabling resistance to radiation therapy in various cancer cell lines (including HCT 116), potentially due to its regulation of p53 regulation. Crooked Neck-Like Protein 1 (CRNKL1) Crooked neck-like protein 1 (CRNKL1), also known as human crooked neck homolog (hCrn), is involved in pre-mRNA splicing as a member of the spliceosome. Dysregulation of this process is a known feature of cancer. In addition, spliceosomal activity is positively correlated with tumor mutational burden, potentially supporting the plausibility of CRNKL1 as a target for colorectal cancer. However, its documented role in cancer is limited. It has been reported to be differentially expressed in esophageal, bladder, and breast cancers. Along with several other splicing factors, it may also be critical for cell proliferation in triple- negative breast cancer. Citrate Synthase (CS) Citrate synthase (CS) is a classic biological enzyme in the citric acid cycle (commonly known as the tricarboxylic acid cycle or Krebs cycle). In particular, it catalyzes the synthesis of citrate from acetyl coenzyme A (acetyl-CoA) and oxaloacetate in the mitochondrial matrix. Its increased expression and / or activity in pancreatic and ovarian cancer have been shown to drive proliferation. Though its knockdown in ovarian cancer reduces proliferation, a contrasting result was achieved in cervical carcinoma; it reduced adenosine triphosphate (ATP) production, increased activity of the glycolytic pathway, promoted changes consistent with epithelial-mesenchymal transition, and increased proliferation and metastasis. These findings are consistent with the Warburg effect, which is the higher propensity of cancer cells to utilize aerobic glycolysis and lactic acid fermentation for energy production despite the presence of oxygen. Philippe Icard et al. (Int J Mol Sci. 2021;22(12)) hypothesized that low levels of citrate, a common feature of cancer cells, is the driver of the Warburg effect. High levels of citrate can indeed play an inhibitory role in cell proliferation for various malignancies, including mesothelioma, gastric cancer, ovarian -78- 55335674.2 Attorney Docket No.370602-7079WO1(00272) cancer, lung cancer, and colon cancer. However, very low levels of citrate may also be detrimental to cancer cells, as it is required for fatty acid metabolism. Maria Mycielska et al. (Cancer Res.2018;78(10):2513-2523) found that the uptake of extracellular citrate by cancer cells promotes tumor growth. Moreover, Drexler et al. determined that extracellular citrate is made available due to synthesis and release by cancer-associated stroma. Hence, it has been hypothesized that cancer cells need to maintain intracellular citrate within an optimal zone. Further studies are needed on the role of CS in cancer and the mechanism through which it may be targetable via the circulation. Pre-B-Cell Leukemia Transcription Factor-Interacting Protein 1 (PBXIP1) Pre-B-cell leukemia transcription factor-interacting protein 1 (PBXIP1), also known as hematopoietic PBX interacting protein (HPIP), is a transcriptional regular with several roles in erythroid and epithelial cell differentiation and cell cycle progression. It is also an established proto-oncogene with documented roles in over 15 different types of cancer through multiple mechanisms, including the promotion of the epithelial-mesenchymal transition and regulation of mitosis. For colorectal cancer specifically, it is a marker for poor outcome. Yingying Feng et al. demonstrated that PBXIP1 is upregulated and promotes proliferation and invasion by facilitating transitions in key mitotic checkpoints and the activation of two signaling pathways: MAPK / ERK and PI3k / AKT / mTOR. Heterogeneous Nuclear Ribonucleoprotein R (HNRNPR) Heterogeneous nuclear ribonucleoprotein R (HNRNPR) is an RNA-binding protein that, together with other members of the HNRNP family, is involved in pre- mRNA maturation and transport. It has been found to be upregulated in several cancers, including colorectal cancer, in a pan-cancer study. Interestingly, Yixin Li et al. discovered that the upregulation of HNRNPR serves as a favorable prognostic factor. However, investigations into its role in several other cancers contrastingly revealed that it facilitates progression and metastasis. Further investigation into the role of HNRNPR in colorectal cancer is imperative. Hornerin (HRNR) HRNR is an S100 fused-type protein with a primary role in epidermal cornification. This process involves the terminal differentiation of keratinocytes to corneocytes for the formation of the “dead,” outermost layer of the epidermis, the stratum corneum. In terms of subcellular location, HRNR is predominantly located in the periphery of cytoplasmic -79- 55335674.2 Attorney Docket No.370602-7079WO1(00272) granules, which is consistent with our immunohistochemical findings in human colon adenocarcinoma and NAT samples. In this study, it was also found in the mucosal layer of the NATs, particularly in the inflammatory cells and basal cells at the pits of the intestinal glands. These findings provide insights into its physiologic distribution in the colon, though NATs in general may not be completely benign. The role of HRNR in cancer has only begun to be elucidated recently and the insights are premature. In hepatocellular carcinoma, it is often upregulated, linked to vascular invasion and poor differentiation, and independently associated with poor disease outcomes. This phenomenon may be linked to the phosphorylation of protein kinase B (PKB or AKT), which induces its activation and downstream oncogenesis. Similarly, HRNR expression is increased in breast cancer. In the context of pancreatic ductal carcinoma, Michael Gutknecht et al. previously identified HRNR as a non-VEGF binder of a tumor-targeting peptide (amino acid sequence SLLNRMP) in the tumor vasculature. They had specifically performed an in vivo phage-displayed peptide library (X7format) screening of a xenograft mouse model orthotopically implanted with a human cell line. The authors discovered that HRNR expression was markedly higher in tumor endothelial cells in comparison to non-tumor pancreatic endothelial cells; moreover, knockdown of HRNR induced a reduction in tumor growth due to a decrease in vascularity and perfusion. The authors broadly report the presence of HRNR in various cancers, including colorectal adenocarcinoma, through immunohistochemical staining, but limit their functional investigation of HRNR to pancreatic ductal adenocarcinoma. Validation of HRNR in Colorectal Cancer The findings disclosed herein reveal the targetability of HRNR from the systemic circulation in colon adenocarcinoma. The validation of a shared target that was also identified in a phage display screening of a separate tumor type is remarkable given the complexities of the tumor microenvironment. The xenograft mouse model used in the other study is a highly valuable resource, however it may not fully represent the native microanatomic context. For example, vascularization of a human-derived tumor by murine-origin endothelial cells introduces a cross-species factor of uncertainty, and human cancer cell lines are not fully representative of human disease due to their immortalization. The identification of HRNR as a circulation-accessible target in non-human primates with naturally occurring tumors further validates the integrated strategy of screening and bioinformatic analysis. In terms of microanatomic distribution, HRNR can be found in the tumor infiltrates, predominantly in the -80- 55335674.2 Attorney Docket No.370602-7079WO1(00272) cytoplasmic granules. However, it is likely that HRNR is translocated and displayed on the cell surface (and possibly released into the extracellular matrix) given the in vivo targeting capabilities and positive in vitro cell surface binding by CGWGGLLCC (SEQ ID NO: 24)- displaying phage. Moreover, previous studies have reported that intact HRNR is predominantly localized to the membrane in addition to the cytoplasm in a human breast cancer cell line. This phenomenon has been previously observed for receptors of ligands identified through phage display in the setting of cancer, including Crk-like protein (CRKL), 78-kDa glucose-regulated protein (GRP78), and HSP90. The identification of HRNR as a potential target for colorectal cancer can yield translational applications. HRNR has been previously knocked out with short hairpin RNA (shRNA) in a hepatocellular carcinoma cell line and small interfering RNA (siRNA) in a pancreatic ductal adenocarcinoma cell-line xenograft mouse model, but heretofore not targeted with ligand-directed therapeutics. First, the tumor-exclusive ligand peptide, CGWGGLLCC (SEQ ID NO: 24), can undergo development into a peptidomimetic conjugated to a toxic agent. For example, BMTP-11 and PTP-1 are peptidomimetics comprised of a ligand discovered by in vivo phage display and an apoptosis-inducing D- enantiomeric peptide, D(KLAKLAK)2 (SEQ ID NO: 31). HRNR-targeting ligands discovered by in vitro screening methodologies would require extensive in vivo validation to assess tumor-homing given the presumed variability in structural conformations of a protein in vitro versus in its native environment in vivo. Table 6: Statistics for next-generation sequencing (NGS) of captured whole exomes from genomic DNA extracted from colon adenocarcinoma and non-tumor colon of the two rhesus macaques with MLH1-rheMac hereditary nonpolyposis colorectal cancer (HNPCC) syndrome which had been screened with phage-displayed peptide libraries. Animal Yield Mean Quality Tissue # Reads % Bases ≥ 30 -81- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Table 7: Statistics for next-generation sequencing (NGS) of amplified DNA-encoded peptide inserts of phage that homed to various tissues of the two rhesus macaques with MLH1-rheMac hereditary nonpolyposis colorectal cancer syndrome (HNPCC) syndrome which had been screened with phage-displayed peptide libraries (Batch 1). Yield Mean Quality Animal ID Tissue # Reads % Bases ≥ 30 (Mbases) Score -82- 55335674.2 Attorney Docket No.370602-7079WO1(00272) J615 Dura Mater 7,735,958 2,321 35.78 92.79 J615 Uterus 9,895,933 2,969 35.79 92.86 Table 8: Statistics for next-generation sequencing (NGS) of amplified DNA-encoded peptide inserts of phage that homed to various tissues of the two rhesus macaques with MLH1-rheMac hereditary nonpolyposis colorectal cancer (HNPCC) syndrome which had been screened with phage-displayed peptide libraries (Batch 2). Yield Mean Quality Animal ID Tissue # Reads % Bases ≥ 30 -83- 55335674.2 Attorney Docket No.370602-7079WO1(00272) J615 Cerebellum* 4,073,430 1,222 34.61 87.05 J615 Ovaries* 4,761,222 1,428 35.08 89.21 -84- 55335674.2 Attorney Docket No.370602-7079WO1(00272) J737 Bone Marrow (Red) 4,061,244 1,218 35.42 90.86 J737 Spinal Cord (Thoracic) 4,666,390 1,400 35.33 90.43 Table 9: Bioinformatic analysis of next-generation sequencing (NGS) raw nucleotide data for the identification of DNA-encoded CX7C and CX8C peptides displayed on the pIII minor coat protein. # # Peptide # # Distinct ct s 82 20 30 -85- 55335674.2 Attorney Docket No.370602-7079WO1(00272) - CX8C R1+R2 7,534,172 4,231,267 7,563 613 3,294,729 2,513,120 2,499,180 - CX8C R1 3,767,086 2,085,702 3,147 5 1,678,232 1,294,392 1,289,586 20 4 2 1 2 9 3 6 2 76 93 32 8 5 8 0 5 -86- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Bone J615 Marrow R2 10,227,331 5,750,527 7,334 142 4,469,328 137,916 123,903 8 2 8 8 2 7 7 6 7 5 4 4 8 0 2 6 4 4 -87- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Tumor- Adjacent 4 4 4 1 7 6 5 6 9 9 3 9 6 3 2 1 2 1 6 8 -88- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Inguinal J615 R1 10,071,151 4,952,589 8,013 207 5,110,342 538,287 510,565 Lymph Node 8 5 1 5 9 9 2 5 3 00 05 35 80 82 03 58 49 27 95 06 -89- 55335674.2 Attorney Docket No.370602-7079WO1(00272) J615 Liver (Right) R2 8,960,853 5,127,712 8,469 121 3,824,551 1,328,397 1,309,143 Lung 615 R1+R2 15643950 8232594 9613 270 7401473 168130 143760 6 6 8 5 5 5 2 6 -90- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Mammary J615 R1+R2 18,145,262 9,992,280 10,171 315 8,142,496 267,892 239,978 Tissue 1 2 4 1 4 2 1 8 5 9 3 2 2 0 1 9 8 3 6 -91- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Spinal Cord J615 R1 10,137,547 7,449,475 6,493 53 2,681,526 120,115 108,032 (Cervical) 2 9 1 87 42 54 6 7 0 8 8 2 2 6 1 4 -92- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Adrenal J737 R2 5,170,151 3,075,167 5,182 737 2,089,065 325,198 302,366 Gland (Left) 9 8 9 0 8 2 1 5 0 9 2 2 8 6 6 3 -93- 55335674.2 Attorney Docket No.370602-7079WO1(00272) (Yellow) Bone 1 0 8 9 6 9 8 7 8 2 3 7 2 2 1 5 6 -94- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Colon Tumor- J737 R2 4771882 2679303 5845 759 2085975 151166 130732 0 4 4 6 3 6 6 8 4 7 3 5 8 4 0 9 6 3 8 2 7 2 8 3 -95- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Lymph Node Inguinal 737 R1 7020240 3705886 5588 11 3308755 408954 384261 3 2 9 0 22 04 20 5 0 8 74 25 03 4 3 8 89 2 3 34 -96- 55335674.2 Attorney Docket No.370602-7079WO1(00272) J737 Liver (Right) R1 5,242,908 2,951,466 5,171 8 2,286,263 1,026,910 1,008,132 J737 Liver (Right) R2 5,242,908 3,001,962 6,596 786 2,233,564 1,053,594 1,028,953 6 1 7 6 5 8 6 1 1 0 0 4 8 0 0 9 4 -97- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Lung (Right, J737 R2 4,492,640 2,549,160 5,192 665 1,937,623 187,962 166,955 Middle) 6 0 1 8 3 4 9 0 0 0 7 7 6 7 6 5 4 2 5 0 3 2 8 6 -98- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Spinal Cord J737 R1+R2 7,792,938 4,383,747 8,054 623 3,400,514 141,525 123,683 (Cervical) 7 1 5 75 28 25 0 6 8 2 4 6 8 3 8 8 5 1 -99- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Table 10: Distinct peptides identified per tissue as a percentage of respective total accumulated peptides (i.e., reliable peptide reads). This metric serves as a readout of peptide saturation. J615 J737 Sample Distinct Peptides vs. Distinct Peptides Mean Percentage -100- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Colon 3.0% 6.0% 4.5% Bone Marrow 4.4% 4.4% Table 11: Enriched motifs identified in the set of 510 tumor-shared peptides by XSTREME. E- PROSITE Motif (p- Motif Scores Alignments (p-Value) -101- 55335674.2 Attorney Docket No.370602-7079WO1(00272) DCRGDCF DCRGDCF (1.94e-10) • RGD (PS00016) DCRWDCF Log Likelihood: 163 DCRWDCF (2.19e-10) (8.43e-5) BI - 2 Table 12: Ratios of proteins identified by receptor isolation with peptide-conjugated magnetic beads and liquid chromatography with tandem mass spectrometry (LC-MS / MS) after filtering with defined criteria (see Materials and Methods). For rhesus macaque samples, the ratio of colon tumor to non-tumor colon (negative control) was calculated for a given peptide. For human samples, the ratio of peptide to non-peptide (negative control) was calculated for the colon tumor. -102- 55335674.2 Attorney Docket No.370602-7079WO1(00272) Monkey 0. Human Human I 1 mg Ratio Peptide dentified Peptide + Tumor 0.1 mg Ratio 2 mg Ratio r or -103- 55335674.2 Attorney Docket No.370602-7079WO1(00272) a HRNR is a low-quality protein in the Macaca mulatta proteome (NCBI Reference Sequence: XP_028702526.1) and a corresponding region may not have been assigned by the SEQUEST search engine on Proteome Discoverer version 2.4 if present in the LC-MS / MS dataset. b Two structural variants in LC-MS / MS dataset. c Excluded as a candidate due to lower Human 0.1 mg Ratio compared to Human 2 mg Ratio. The ratio is expected to increase due to greater signal-to-noise with 20X protein extract. d No proteins identified by LC-MS / MS met the defined criteria for CSSHFSAMC (SEQ ID NO: 27) (see Materials and Methods). Enumerated Embodiments: The following enumerated embodiments are provided, the numbering of which is not to be construed as designating levels of importance. Embodiment 1 provides a tumor cell targeting peptide comprising at least one amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28). Embodiment 2 provides the tumor cell targeting peptide of embodiment 1, wherein the tumor cell is a colorectal cancer tumor cell. Embodiment 3 provides the tumor cell targeting peptide of any one of embodiments 1-2, wherein the targeting peptide binds a ligand comprising a protein selected from the group consisting of AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN. Embodiment 4 provides tumor cell targeting peptide of any one of embodiments 1-3, wherein the targeting peptide binds a ligand comprising an amino acid sequence set forth in any one of SEQ ID NOs: 21-28. Embodiment 5 provides a solid particle, wherein the surface of the solid particle displays the tumor cell targeting peptide of any one of embodiments 1-4, wherein the solid particle is selected from the group consisting of a bacteriophage, engineered cell, tissue fragment, nanoparticle, vesicle, dendrimer, virus-like particle, adenovirus, adeno-associated virus (AAV), adeno-associated virus phage (AAVP), and any combinations thereof. Embodiment 6 provides the solid particle of embodiment 5, wherein the tumor cell targeting peptide is attached to and / or displayed on the surface of the solid particle. Embodiment 7 provides the solid particle of any one of embodiments 5-6, which further comprises an agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, radioactive agent, salt, peptide, protein, lipid, -104- 55335674.2 Attorney Docket No.370602-7079WO1(00272) nucleic acid, gas, and any combinations thereof, wherein the agent is attached to and / or contained within the solid particle. Embodiment 8 provides the solid particle of any one of embodiments 5-7, wherein the solid particle is an AAVP. Embodiment 9 provides the solid particle of embodiment 8, wherein the AAVP comprises a therapeutic or suicide gene. Embodiment 10 provides the solid particle of embodiment 9, wherein the therapeutic gene comprises tumor necrosis factor (TNF). Embodiment 11 provides the solid particle of embodiment 9, wherein the suicide gene comprises Herpes simplex virus thymidine kinase (HSVtk). Embodiment 12 provides a fusion polypeptide comprising a tumor cell targeting peptide and a cytotoxic peptide, wherein the tumor cell targeting peptide comprises at least one amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28). Embodiment 13 provides the fusion polypeptide of embodiment 12, wherein the cytotoxic peptide comprises an amino acid sequence of D(KLAKKLAK)2 (SEQ ID NO: 31). Embodiment 14 provides the fusion polypeptide of any one of embodiments 12-13, wherein the tumor cell is a colorectal cancer cell. Embodiment 15 provides the fusion polypeptide of any one of embodiments 12-14, wherein the tumor cell targeting peptide binds a ligand expressed by the tumor cell. Embodiment 16 provides the fusion polypeptide of embodiment 15, wherein the ligand is a protein selected from the group consisting of AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN. Embodiment 17 provides the fusion polypeptide of any one of embodiments 15-16, wherein the ligand comprises an amino acid sequence set forth in any one of SEQ ID NOs: 21-28. Embodiment 18 provides a fusion polypeptide comprising an antigen-binding domain conjugated to a cytotoxic agent, wherein the antigen-binding domain is derived from an antibody or antigen-binding fragment thereof, and wherein the antigen-binding domain comprises a tumor cell targeting peptide comprising an amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC -105- 55335674.2 Attorney Docket No.370602-7079WO1(00272) (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28). Embodiment 19 provides the fusion polypeptide of embodiment 18, wherein at least one complementarity determining regions (CDRs) of the antigen-binding domain comprises at least one of the tumor cell targeting peptides. Embodiment 20 provides the fusion polypeptide of any one of embodiment 18-19, wherein the tumor cell targeting peptide binds a ligand expressed by a tumor cell. Embodiment 21 provides the fusion polypeptide of embodiment 20, wherein the tumor cell ligand is a protein selected from the group consisting of AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN. Embodiment 22 provides the fusion polypeptide of any one of embodiments 20-21, wherein the tumor cell ligand comprises an amino acid sequence set forth in any one of SEQ ID NOs: 21-28. Embodiment 23 provides the fusion polypeptide of any one of embodiments 18-22, wherein the tumor cell is a colorectal cancer cell. Embodiment 24 provides the fusion polypeptide of any one of embodiments 18-23, wherein the cytotoxic agent is selected from the group consisting of calicheamicin, monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), mertansine (DM1), or a derivative thereof. Embodiment 25 provides a method of targeting a solid particle to a tumor cell in a subject, the method comprising administering to the subject the solid particle, wherein the tumor cell targeting peptide of any one of embodiments 1-4 is attached to and / or displayed on the surface of the solid particle, wherein the solid particle is selected from the group consisting of a bacteriophage, engineered cell, tissue fragment, nanoparticle, vesicle, dendrimer, virus-like particle, adenovirus, adeno-associated virus (AAV), adeno-associated virus phage (AAVP), and any combinations thereof. Embodiment 26 provides the method of embodiment 25, wherein the tumor cell targeting peptide comprises the amino acid sequence of SEQ ID NO: 23. Embodiment 27 provides the method of any one of embodiments 25-26, wherein the tumor cell targeting peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 21-28. Embodiment 28 provides the method of any one of embodiments 25-27, wherein the solid particle further comprises an agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, radioactive agent, salt, peptide, protein, -106- 55335674.2 Attorney Docket No.370602-7079WO1(00272) lipid, nucleic acid, gas, and any combinations thereof, wherein the agent is attached to and / or contained within the solid particle. Embodiment 29 provides the method of any one of embodiments 25-28, wherein the solid particle is an AAVP. Embodiment 30 provides the method of embodiment 29, wherein the AAVP comprises a therapeutic or suicide gene. Embodiment 31 provides the method of embodiment 30, wherein the therapeutic gene comprises tumor necrosis factor (TNF). Embodiment 32 provides the method of embodiment 30, wherein the suicide gene comprises Herpes simplex virus thymidine kinase (HSVtk). Embodiment 33 provides the method of any one of embodiments 25-32, wherein the tumor cell is a colorectal tumor cell. Embodiment 34 provides a method of treating, killing, and / or preventing growth of a tumor in a subject, the method comprising administering to the subject a solid particle, wherein the tumor cell targeting peptide of any one of embodiments 1-4 is attached to and / or displayed on the surface of the solid particle, wherein the solid particle is selected from the group consisting of a bacteriophage, engineered cell, tissue fragment, nanoparticle, vesicle, dendrimer, virus-like particle, adenovirus, adeno-associated virus (AAV), adeno-associated virus phage (AAVP), and any combinations thereof. Embodiment 35 provides the method of embodiment 34, wherein the tumor cell targeting peptide comprises the amino acid sequence of SEQ ID NO: 24. Embodiment 36 provides the method of any one of embodiments 34-35, wherein the tumor cell targeting peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 21-28. Embodiment 37 provides the method of any one of embodiments 34-36, wherein the solid particle further comprises an agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, radioactive agent, salt, peptide, protein, lipid, nucleic acid, gas, and any combinations thereof, wherein the agent is attached to and / or contained within the solid particle. Embodiment 38 provides the method of any one of embodiments 34-37, wherein the solid particle is an AAVP which comprises a therapeutic or suicide gene. Embodiment 39 provides the method of embodiment 38, wherein the therapeutic gene comprises tumor necrosis factor (TNF). Embodiment 40 provides the method of embodiment 38, wherein the suicide gene -107- 55335674.2 Attorney Docket No.370602-7079WO1(00272) comprises Herpes simplex virus thymidine kinase (HSVtk). Embodiment 41 provides the method of any one of embodiments 34-40, wherein the method further comprises: monitoring the tumor for elevated thymidine kinase expression; and administering a prodrug selected from ganciclovir, ganciclovir elaidic acid ester, penciclovir, acyclovir, valacyclovir, (E)-5-(2-bromovinyl)-2′-deoxyuridine, zidovuline, 2′- exo-methanocarbathymidine, and combinations thereof to the subject when elevated thymidine kinase expression is detected in the tumor. Embodiment 42 provides the method of embodiment 41, wherein the method further comprises evaluating the efficacy of the prodrug in treating, killing, and / or preventing growth of the tumor. Embodiment 43 provides the method of any one of embodiments 34-42, wherein the method further comprises monitoring the tumor for elevated TNF expression. Other Embodiments: The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof. The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this disclosure has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this disclosure can be devised by others skilled in the art without departing from the true spirit and scope of the disclosure. The appended claims are intended to be construed to include all such embodiments and equivalent variations. -108- 55335674.2

Claims

Attorney Docket No.370602-7079WO1(00272) CLAIMS What is claimed is:

1. A tumor cell targeting peptide comprising at least one amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28).

2. The tumor cell targeting peptide of claim 1, wherein the tumor cell is a colorectal cancer tumor cell.

3. The tumor cell targeting peptide of claim 1, wherein the targeting peptide binds a ligand comprising a protein selected from the group consisting of AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN.

4. The tumor cell targeting peptide of claim 1, wherein the targeting peptide binds a ligand comprising an amino acid sequence set forth in any one of SEQ ID NOs: 21-28.

5. A solid particle, wherein the surface of the solid particle displays the tumor cell targeting peptide of any one of claims 1-4, wherein the solid particle is selected from the group consisting of a bacteriophage, engineered cell, tissue fragment, nanoparticle, vesicle, dendrimer, virus-like particle, adenovirus, adeno-associated virus (AAV), adeno-associated virus phage (AAVP), and any combinations thereof.

6. The solid particle of claim 5, wherein the tumor cell targeting peptide is attached to and / or displayed on the surface of the solid particle.

7. The solid particle of claim 5, which further comprises an agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, radioactive agent, salt, peptide, protein, lipid, nucleic acid, gas, and any combinations thereof, wherein the agent is attached to and / or contained within the solid particle.

8. The solid particle of claim 5, wherein the solid particle is an AAVP. -109- 55335674.2Attorney Docket No.370602-7079WO1(00272) 9. The solid particle of claim 8, wherein the AAVP comprises a therapeutic or suicide gene.

10. The solid particle of claim 9, wherein the therapeutic gene comprises tumor necrosis factor (TNF).

11. The solid particle of claim 9, wherein the suicide gene comprises Herpes simplex virus thymidine kinase (HSVtk).

12. A fusion polypeptide comprising a tumor cell targeting peptide and a cytotoxic peptide, wherein the tumor cell targeting peptide comprises at least one amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28).

13. . The fusion polypeptide of claim 12, wherein the cytotoxic peptide comprises the amino acid sequence set forth in SEQ ID NO:

31.

14. The fusion polypeptide of claim 12, wherein the tumor cell is a colorectal cancer cell.

15. The fusion polypeptide of claim 12, wherein the tumor cell targeting peptide binds a ligand expressed by the tumor cell.

16. The fusion polypeptide of claim 15, wherein the ligand is a protein selected from the group consisting of AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN.

17. The fusion polypeptide of claim 15, wherein the ligand comprises an amino acid sequence set forth in any one of SEQ ID NOs: 21-28.

18. A fusion polypeptide comprising an antigen-binding domain conjugated to a cytotoxic agent, wherein the antigen-binding domain is derived from an antibody or antigen-binding -110- 55335674.2Attorney Docket No.370602-7079WO1(00272) fragment thereof, and wherein the antigen-binding domain comprises a tumor cell targeting peptide comprising an amino acid sequence selected from the group consisting of CAGWEGRGLC (SEQ ID NO:21), CEGNHADHIC (SEQ ID NO:22), CGAFGGGGC (SEQ ID NO:23), CGWGGLLCC (SEQ ID NO: 24), CLSGTSGRC (SEQ ID NO: 25), CPKMAVVGFC (SEQ ID NO: 26), CSSHFSAMC (SEQ ID NO: 27), and CGWGGLLC (SEQ ID NO:28).

19. The fusion polypeptide of claim 18, wherein at least one complementarity determining regions (CDRs) of the antigen-binding domain comprises at least one of the tumor cell targeting peptides.

20. The fusion polypeptide of claim 18, wherein the tumor cell targeting peptide binds a ligand expressed by a tumor cell.

21. The fusion polypeptide of claim 20, wherein the tumor cell ligand is a protein selected from the group consisting of AKR1A1, CRNKL1, CS, FABP5, HNRNPR, HRNR, HSP90AA1, JUP, MLEC, PBXIP1, RPN1, and SFN.

22. The fusion polypeptide of claim 20, wherein the tumor cell ligand comprises an amino acid sequence set forth in any one of SEQ ID NOs: 21-28.

23. The fusion polypeptide of claim 18, wherein the tumor cell is a colorectal cancer cell.

24. The fusion polypeptide of claim 18, wherein the cytotoxic agent is selected from the group consisting of calicheamicin, monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), mertansine (DM1), or a derivative thereof.

25. A method of targeting a solid particle to a tumor cell in a subject, the method comprising administering to the subject the solid particle, wherein the tumor cell targeting peptide of any one of claims 1-4 is attached to and / or displayed on the surface of the solid particle, wherein the solid particle is selected from the group consisting of a bacteriophage, engineered cell, tissue fragment, nanoparticle, vesicle, dendrimer, virus-like particle, -111- 55335674.2Attorney Docket No.370602-7079WO1(00272) adenovirus, adeno-associated virus (AAV), adeno-associated virus phage (AAVP), and any combinations thereof.

26. The method of claim 25, wherein the tumor cell targeting peptide comprises the amino acid sequence of SEQ ID NO:

24.

27. The method of claim 25, wherein the tumor cell targeting peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 21-28.

28. The method of claim 25, wherein the solid particle further comprises an agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, radioactive agent, salt, peptide, protein, lipid, nucleic acid, gas, and any combinations thereof, wherein the agent is attached to and / or contained within the solid particle.

29. The method of claim 25, wherein the solid particle is an AAVP.

30. The method of claim 29, wherein the AAVP comprises a therapeutic or suicide gene.

31. The method of claim 30, wherein the therapeutic gene comprises tumor necrosis factor (TNF).

32. The method of claim 30, wherein the suicide gene comprises Herpes simplex virus thymidine kinase (HSVtk).

33. The method of claim 25, wherein the tumor cell is a colorectal tumor cell.

34. A method of treating, killing, and / or preventing growth of a tumor in a subject, the method comprising administering to the subject a solid particle, wherein the tumor cell targeting peptide of any one of claims 1-4 is attached to and / or displayed on the surface of the solid particle, wherein the solid particle is selected from the group consisting of a bacteriophage, engineered cell, tissue fragment, nanoparticle, vesicle, dendrimer, virus-like particle, adenovirus, adeno-associated virus (AAV), adeno-associated virus phage (AAVP), and any combinations thereof. -112- 55335674.2Attorney Docket No.370602-7079WO1(00272) 35. The method of claim 34, wherein the tumor cell targeting peptide comprises the amino acid sequence of SEQ ID NO:

24.

36. The method of claim 34, wherein the tumor cell targeting peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 21-28.

37. The method of claim 34, wherein the solid particle further comprises an agent selected from the group consisting of a therapeutic agent, biologically active molecule, imaging agent, radioactive agent, salt, peptide, protein, lipid, nucleic acid, gas, and any combinations thereof, wherein the agent is attached to and / or contained within the solid particle.

38. The method of claim 34, wherein the solid particle is an AAVP which comprises a therapeutic or suicide gene.

39. The method of claim 38, wherein the therapeutic gene comprises tumor necrosis factor (TNF).

40. The method of claim 38, wherein the suicide gene comprises Herpes simplex virus thymidine kinase (HSVtk).

41. The method of claim 34, wherein the method further comprises: monitoring the tumor for elevated thymidine kinase expression; and administering a prodrug selected from ganciclovir, ganciclovir elaidic acid ester, penciclovir, acyclovir, valacyclovir, (E)-5-(2-bromovinyl)-2′-deoxyuridine, zidovuline, 2′- exo-methanocarbathymidine, and combinations thereof to the subject when elevated thymidine kinase expression is detected in the tumor.

42. The method of claim 34, wherein the method further comprises evaluating the efficacy of the prodrug in treating, killing, and / or preventing growth of the tumor.

43. The method of claim 34, wherein the method further comprises monitoring the tumor for elevated TNF expression. -113- 55335674.2