Products and methods for treating diseases or disorders associated with DUX4 overexpression

Abstract

Disclosed herein are products, methods, and uses for treating, ameliorating, delaying the progression of, and / or preventing a muscular dystrophy or a cancer including, but not limited to, facioscapulohumeral muscular dystrophy (FSHD) or a cancer associated with DUX4 expression or overexpression. More particularly, disclosed herein are RNA interference-based products, methods, and uses for inhibiting or downregulating the expression of double homeobox 4 (DUX4). Even more particularly, the disclosure provides microRNA (miRNA) (and vectors and compositions comprising the miRNA encoding polynucleotides) for inhibiting or downregulating the expression of DUX4 and methods of using said miRNA to inhibit or downregulate DUX4 expression in cells and / or in cells of a subject having a muscular dystrophy or a cancer associated with DUX4 expression or overexpression including, but not limited to, FSHD or a cancer associated with DUX4 expression or overexpression.

Description

PRODUCTS AND METHODS FOR TREATING DISEASES OR DISORDERS ASSOCIATED WITH DUX4 OVEREXPRESSIONINCORPORATION BY REFERENCE OF THE SEQUENCE LISTING

[0001] This application contains, as a separate part of disclosure, a Sequence Listing in computer-readable form (Filename: 70266_SeqListing.xml; Size: 22,072 bytes; Created: March 25, 2025) which is incorporated by reference herein in its entirety.FIELD

[0002] This disclosure relates to the field of gene therapy in the treatment of diseases or disorders associated with the overexpression of the double homeobox 4 (DUX4) gene. More particularly, the disclosure provides RNA interference-based products, methods, and uses for treating, ameliorating, delaying the progression of, and / or preventing a muscular dystrophy or cancer associated with DUX4 expression or overexpression of the DUX4 gene. Specifically, the disclosure provides products and methods for inhibiting or downregulating the expression of the DUX4 gene. More specifically, the disclosure provides microRNA (miRNA) for inhibiting or downregulating the expression of DUX4 and methods of using said miRNA to inhibit or downregulate DUX4 expression in cells and / or in a subject having a muscular dystrophy including, but not limited to, facioscapulohumeral muscular dystrophy (FSHD), or a cancer associated with overexpressed DUX4. Additionally, the disclosure provides an estrogen, synthetic estrogen, progesterone, progestin, melatonin, bleomycin, pyrazinamide, sorafenib, or a derivative thereof, or a combination of any thereof for upregulating expression of microRNA-675, inhibiting DUX4 expression, and / or for treating, ameliorating, delaying the progression of, and / or preventing a muscular dystrophy or a cancer including, but not limited to, FSHD or a cancer associated with DUX4 expression or overexpression.BACKGROUND

[0003] Muscular dystrophies (MDs) are a group of genetic diseases. The group is characterized by progressive weakness and degeneration of the skeletal muscles that control movement. Some forms of MD develop in infancy or childhood, while others may not appear until middle age or later. The disorders differ in terms of the distribution and extent of muscle weakness (some forms of MD also affect cardiac muscle), the age of onset, the rate of progression, and the pattern of inheritance.

[0004] Facioscapulohumeral dystrophy (FSHD) is among the most commonly inherited muscular dystrophies, estimated to affect as many as 870,000 individuals. Classicaldescriptions of FSHD presentation include progressive muscle weakness in the face, shoulder-girdle and arms, but disease can manifest more broadly, including in muscles of the trunk and lower extremities. Variability is also commonly seen within individuals, as asymmetrical weakness is common. Age-at-onset can range from early childhood to adulthood, and is usually related to disease severity, where earlier onset is often associated with more severe muscle weakness. Although most patients with FSHD have a normal life span, respiratory insufficiency can occur, and the disease can be debilitating, as approximately 25% of affected individuals may become wheelchair dependent by their fifties, and even earlier in more severe forms of the disease, while others maintain lifelong ambulation.

[0005] FSHD is caused by aberrant expression of the double homeobox 4 gene (DUX4), which produces a transcription factor that is toxic to skeletal muscle. DUX4 is normally functional during the two-cell stage of human development but repressed thereafter in essentially all other tissues, except perhaps the testes. In skeletal muscles of people with FSHD, specific genetic and epigenetic factors conspire to permit DUX4 de-repression, where it then initiates several aberrant gene expression cascades, including those involved in differentiation abnormalities, oxidative stress, inflammatory infiltration, cell death and muscle atrophy.

[0006] Effective FSHD-targeted therapies would dramatically improve patient quality of life, but currently there are no approved treatments that slow FSHD progression or improve muscle weakness. Since FSHD arises from DLIX4 de-repression, the most direct route to a therapy will involve inhibiting DLIX4 in muscle. Gene silencing by RNA interference (RNAi) is one powerful approach to inhibit DUX4. Historically, RNAi-based therapies have relied upon two major strategies to silence dominant disease genes: (1) delivery of siRNA oligonucleotide drugs to permissive target cells or tissues; or (2) gene therapy in which designed microRNA or shRNA expression cassettes are packaged within a viral vector and expressed intracellularly following delivery.

[0007] RNA interference (RNAi) is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases. RNAi refers to post- transcriptional control of gene expression mediated by microRNAs (miRNAs). The miRNAs are small (21-25 nucleotides), noncoding RNAs that share sequence homology and basepair with 3' untranslated regions of cognate messenger RNAs (mRNAs). The interaction between the miRNAs and mRNAs directs cellular gene silencing machinery to prevent the translation of the mRNAs. The RNAi pathway is summarized in Duan (Ed.), Section 7.3 of Chapter 7 in Muscle Gene Therapy, Springer Science + Business Media, LLC (2010).

[0008] As an understanding of natural RNAi pathways has developed, researchers have designed artificial miRNAs for use in regulating expression of target genes for treating disease. As described in Section 7.4 of Duan, supra, artificial miRNAs can be transcribed from DNA expression cassettes. The miRNA sequence specific for a target gene is transcribed along with sequences required to direct processing of the miRNA in a cell. Viral vectors, such as adeno-associated virus (AAV) have been used to deliver miRNAs to muscle [Fechner et al., J. Mol. Med., 86 987-997 (2008)].

[0009] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. Moreover, AAV transduces slowly dividing and nondividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. The rep and cap proteins may be provided in trans. Another significant feature of AAV is that it is an extremely stable and hardy virus. It easily withstands the conditions used to inactivate adenovirus (56° to 65°C for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0010] There remains a need in the art for products and methods for treating diseases associated with overexpressed DUX4 including muscular dystrophies, such as FSHD, and cancer.SUMMARY

[0011] The disclosure provides products, methods, and uses for inhibiting DUX4 expression and for treating, ameliorating, delaying the progression of, and / or preventing a muscular dystrophy or cancer associated with the expression or overexpression of DUX4.

[0012] The disclosure provides nucleic acids designed to inhibit DLIX4 expression, viral vectors comprising the nucleic acids, compositions comprising the nucleic acids and vectors, methods for using these products for inhibiting and / or interfering with expression of a DLIX4 gene in a cell, and methods for treating or ameliorating disease or disorder in a subject suffering from a disease resulting from elevated expression of DLIX4.

[0013] The disclosure provides a nucleic acid encoding a double homeobox 4 (DUX4)- targeting microRNA (miRNA) comprising a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 11 .

[0014] The disclosure provides a recombinant adeno-associated virus (AAV) vector comprising a nucleic acid encoding a double homeobox 4 (DUX4)-targeting microRNA (miRNA) comprising a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 11 . In some aspects, the vector is a self-complementary recombinant AAV (scAAV) or a single-stranded vector (ssAAV). In some aspects, the vector comprises a capsid of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAV rh.74, AAV rh.8, AAVrh.10, AAVB1 , myoAAV, AAVMYO, modified AAV9 (mAAV9), or AAV-SLB101 . In some aspects, the vector comprises a capsid of modified AAV9 vector (mAAV9) or AAV-SLB101 . In some aspects, the mAAV9 capsid comprises a capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12. In some aspects, the AAV-SLB101 capsid comprises a capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13.

[0015] The disclosure provides a recombinant adeno-associated virus (AAV) vector comprising a capsid of a modified AAV9 (mAAV9) or an AAV-SLB101 ; and a nucleotide sequence encoding miDUX4.405. In some aspects, the vector comprises a mAAV9 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12. In some aspects, the vector comprises an AAV-SLB101 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13. In some aspects, the nucleotide sequence encoding miDUX4.405 comprises a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 3, 6, 8, or 11 ; or the amino acid sequence of SEQ ID NO: 3, 6, 8, or 11 .

[0016] The disclosure provides a composition comprising a nucleic acid encoding a double homeobox 4 (DUX4)-targeting microRNA (miRNA) comprising a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 11 and a pharmaceutically acceptable carrier.

[0017] The disclosure provides a composition comprising a recombinant adeno- associated virus (AAV) vector comprising a nucleic acid encoding a double homeobox 4 (DUX4)-targeting microRNA (miRNA) comprising a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 11 , and a pharmaceutically acceptable carrier. In some aspects, the vector is a self-complementary recombinant AAV (scAAV) or a singlestranded vector (ssAAV). In some aspects, the vector comprises a capsid of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAV rh.74, AAV rh.8, AAVrh.10, AAVB1 , myoAAV, AAVMYO, modified AAV9 (mAAV9), or AAV-SLB101 . In some aspects, the vector comprises a capsid of modified AAV9 vector (mAAV9) or AAV-SLB101 . In some aspects, the mAAV9 capsid comprises a capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12. In some aspects, the AAV-SLB101 capsid comprises a capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13.

[0018] The disclosure provides a composition comprising a recombinant adeno- associated virus (AAV) vector comprising a capsid of a modified AAV9 (mAAV9) or an AAV- SLB101 ; a nucleotide sequence encoding miDUX4.405; and a pharmaceutically acceptable carrier. In some aspects, the vector comprises a mAAV9 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12. In some aspects, the vector comprises an AAV-SLB101 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13. In some aspects, the nucleotide sequence encoding miDUX4.405 comprises a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 3, 6, 8, or 11 ; or the amino acid sequence of SEQ ID NO: 3, 6, 8, or 11 .

[0019] The disclosure provides a method of inhibiting and / or interfering with expression of a double homeobox 4 (DUX4) gene in a cell comprising contacting the cell with a nucleic acid encoding a double homeobox 4 (DUX4)-targeting microRNA (miRNA) comprising a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 11 . In some aspects, the cell is in a subject. In some aspects, the subject is a human subject.

[0020] The disclosure provides a method of inhibiting and / or interfering with expression of a double homeobox 4 (DUX4) gene in a cell comprising contacting the cell with a recombinant adeno-associated virus (AAV) vector comprising a nucleic acid encoding a double homeobox 4 (DUX4)-targeting microRNA (miRNA) comprising a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 11 . In some aspects, the vector is a self-complementary recombinant AAV (scAAV) or a single-stranded vector (ssAAV). In some aspects, the vector comprises a capsid of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAV rh.74, AAV rh.8, AAVrh.10, AAVB1 , myoAAV, AAVMYO, modified AAV9 (mAAV9), or AAV- SLB101 . In some aspects, the vector comprises a capsid of modified AAV9 vector (mAAV9) or AAV-SLB101 . In some aspects, the mAAV9 capsid comprises a capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12. In some aspects, the AAV-SLB101 capsid comprises a capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13. In some aspects, the cell is in a subject. In some aspects, the subject is a human subject.

[0021] The disclosure provides a method of inhibiting and / or interfering with expression of a double homeobox 4 (DUX4) gene in a cell comprising contacting the cell with a recombinant adeno-associated virus (AAV) vector comprising a capsid of a modified AAV9 (mAAV9) or an AAV-SLB101 ; and a nucleotide sequence encoding miDUX4.405. In some aspects, the vector comprises a mAAV9 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12. In some aspects, the vector comprises an AAV-SLB101 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13. In some aspects, the nucleotide sequence encoding miDUX4.405 comprises a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 3, 6, 8, or 11 ; or the amino acid sequence of SEQ ID NO: 3, 6, 8, or 11 . In some aspects, the cell is in a subject. In some aspects, the subject is a human subject.

[0022] The disclosure provides a method of inhibiting and / or interfering with expression of a double homeobox 4 (DUX4) gene in a cell comprising contacting the cell with a composition comprising a recombinant adeno-associated virus (AAV) vector comprising a capsid of a modified AAV9 (mAAV9) or an AAV-SLB101 ; a nucleotide sequence encodingmiDUX4.405; and a pharmaceutically acceptable carrier. In some aspects, the vector comprises a mAAV9 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12. In some aspects, the vector comprises an AAV-SLB101 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13. In some aspects, the nucleotide sequence encoding miDUX4.405 comprises a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 3, 6, 8, or 11 ; or the amino acid sequence of SEQ ID NO: 3, 6, 8, or 11 . In some aspects, the cell is in a subject. In some aspects, the subject is a human subject.

[0023] The disclosure provides a method of treating a subject having a muscular dystrophy or a cancer or a subject at risk of having a muscular dystrophy or a cancer comprising administering to the subject an effective amount of a nucleic acid encoding a double homeobox 4 (DUX4)-targeting microRNA (miRNA) comprising a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 11 .

[0024] The disclosure provides a method of treating a subject having a muscular dystrophy or a cancer or a subject at risk of having a muscular dystrophy or a cancer comprising administering to the subject an effective amount of a recombinant adeno- associated virus (AAV) vector comprising a nucleic acid encoding a double homeobox 4 (DUX4)-targeting microRNA (miRNA) comprising a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 11 . In some aspects, the vector is a self- complementary recombinant AAV (scAAV) or a single-stranded vector (ssAAV). In some aspects, the vector comprises a capsid of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAV rh.74, AAV rh.8, AAVrh.10, AAVB1 , myoAAV, AAVMYO, modified AAV9 (mAAV9), or AAV-SLB101 . In some aspects, the vector comprises a capsid of modified AAV9 vector (mAAV9) or AAV-SLB101 . In some aspects, the mAAV9 capsid comprises a capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12. In some aspects, the AAV-SLB101 capsid comprises a capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13.

[0025] The disclosure provides a method of treating a subject having a muscular dystrophy or a cancer or a subject at risk of having a muscular dystrophy or a cancer comprising administering to the subject an effective amount of a recombinant adeno- associated virus (AAV) vector comprising a capsid of a modified AAV9 (mAAV9) or an AAV- SLB101 ; a nucleotide sequence encoding miDUX4.405; and a pharmaceutically acceptable carrier. In some aspects, the vector comprises a mAAV9 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12. In some aspects, the vector comprises an AAV-SLB101 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13. In some aspects, the nucleotide sequence encoding miDUX4.405 comprises a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 3, 6, 8, or 11 ; or the amino acid sequence of SEQ ID NO: 3, 6, 8, or 11 .

[0026] The disclosure provides a method of treating a subject having a muscular dystrophy or a cancer or a subject at risk of having a muscular dystrophy or a cancer comprising administering to the subject an effective amount of a composition comprising a recombinant adeno-associated virus (AAV) vector comprising a capsid of a modified AAV9 (mAAV9) or an AAV-SLB101 ; a nucleotide sequence encoding miDUX4.405; and a pharmaceutically acceptable carrier. In some aspects, the vector comprises a mAAV9 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12. In some aspects, the vector comprises an AAV-SLB101 capsid protein comprising an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13. In some aspects, the nucleotide sequence encoding miDUX4.405 comprises a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 3, 6, 8, or 11 ; or the amino acid sequence of SEQ ID NO: 3, 6, 8, or 11 .

[0027] The disclosure provides a method of treating a subject having a muscular dystrophy or a cancer comprising administering to the subject an effective amount of a composition comprising a nucleic acid, a vector comprising the nucleic acid, or a composition as described herein the disclosure. In some aspects, the muscular dystrophy is facioscapulohumeral muscular dystrophy (FSHD). In some aspects, the cancer is a cancer associated with expression or overexpression of DUX4. In some aspects, the cancer is a sarcoma, a B-cell lymphoma, or a DUX4-expressing cancer of the adrenal, bile duct, bladder, breast, cervix, colon, endometrium, esophagus, head / neck, liver, brain, lung,mesothelium, neural crest, ovary, pancreas, prostate, kidney, skin, soft tissue, stomach, testicles, or thymus.

[0028] In some aspects, the effective amount of the vector is a dose of about 1 .0x1011vg / kg to about 1 .0x1015vg / kg. In some aspects, the effective amount of the vector is a dose of about 1 .0x1012vg / kg to about 5.0x1014vg / kg. In some aspects, the effective amount of the vector is a dose of about 1 .0x1013vg / kg to about 1 .0x1014vg / kg. In some aspects, the effective amount of the vector is a dose of about 3.0x1013vg / kg or about 6.0x1013vg / kg.

[0029] The disclosure provides uses of a nucleic acid, a vector, or a composition, as described herein the disclosure, for the preparation of a medicament for inhibiting expression of a double homeobox 4 (DUX4) gene in a cell, for treating or ameliorating a muscular dystrophy or a cancer, and / or for the preparation of a medicament for treating or ameliorating a muscular dystrophy or a cancer. In some aspects, the muscular dystrophy is facioscapulohumeral muscular dystrophy. In some aspects, the cancer is a cancer associated with expression or overexpression of DUX4. In some aspects, the cancer is a sarcoma, a B-cell lymphoma, or a DUX4-expressing cancer of the adrenal, bile duct, bladder, breast, cervix, colon, endometrium, esophagus, head / neck, liver, brain, lung, mesothelium, neural crest, ovary, pancreas, prostate, kidney, skin, soft tissue, stomach, testicles, or thymus.

[0030] The disclosure provides a nucleic acid, vector, or composition, as described herein throughout the disclosure, wherein the nucleic acid, vector, or medicament is formulated for intramuscular injection, oral administration, subcutaneous administration or injection, intradermal administration or injection, intraventricular delivery or injection, transdermal transport, injection into the blood stream, or for aerosol administration.

[0031] Further aspects and advantages of the disclosure will be apparent to those of ordinary skill in the art from a review of the following detailed description, taken in conjunction with the drawings. It should be understood, however, that the detailed description (including the drawings and the specific examples), while indicating embodiments of the disclosed subject matter, are given by way of illustration only, because various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Fig. 1 shows the ITR-U6-mi405-ITR sequence (SEQ ID NO: 11 ) of the disclosure. From 5’ to 3’, the first highlighted nucleotides (solid line) represent the 5’ ITR. The second highlighted nucleotides (dashed line 1 ) represent the U6 promoter. The third highlighted nucleotides (dashed line 2) represent the mi405 sequence. The fourth highlightednucleotides (dashed line 3) represent the T6 termination signal. The fifth highlighted nucleotides (highlighted in gray) represent the partial COL2A1 intron (stuffer sequence). The bold and underlined nucleotides at the 3’ terminus represent the 3’ full-length ITR.

[0033] Fig. 2 shows AAV9-mi405 expression in mice muscles 6 months after dosing at a low (3x1013vg / kg), medium (3x1014vg / kg) or high (6x1014vg / kg) amount. Medium and high expression of mi405 was evident in gastrocnemius and triceps muscles after 6 months. The results demonstrate sustained, dose-responsive expression in both upper and lower limb muscles in FSHD mice.

[0034] Fig. 3 shows that AAV9-mi405 improves mobility in a mouse model of FSHD in a dose-dependent manner in an open field test in TIC-DUX4 mice (i.e., a mouse model of FSHD (Giesige et al. AAV-mediated follistatin gene therapy improves functional outcomes in the TIC-DUX4 mouse model of FSHD. JCI lnsight;3. Epub ahead of print November 15, 2018. DOI: 10.1 172 / jci.insight.123538)), and that the payload dose correlates with neurofunctional behavior. Fig. 3 shows total activity off the mice and rearing on hind legs over 10 weeks after dosing.

[0035] Fig. 4 shows a table of comparison of second generation myotropic capsids tested for delivering mi405. Multiple 1 st and 2nd generation vectors were administered to wild-type mice (C57BL / 6) and to TIC-DUX4 mice (i.e., the FSHD mouse model) to test for biodistribution and expression levels of the DLIX4 miRNA. Results showed that the SLB-101 capsid described herein achieved a therapeutic effect at 1013vg / kg dosing which was significantly lower than other 1 st and 2nd generation vectors.

[0036] Fig. 5 shows mi405 copy number after treatment of TIC-DUX4 mice with SLB-101 - U6-mi405 versus AAV9-U6-mi405. Mice treated with the SLB-101 capsid showed increased levels of mi405 expression in gastrocnemius and triceps muscles and lower levels in liver compared to mice treated with AAV9. This data shows that SLB-101 achieves significantly higher transduction than AAV9. There was increased transduction with SLB-101 in muscle (i.e., 23X and 28X more expression in skeletal muscle) and decreased transduction in liver compared to AAV9. Moreover, a minimum effective dose at one log lower was achieved with SLB-101 compared to AAV9.

[0037] Fig. 6 shows AAV packaging efficiency comparison. The results show SLB101 -U6- mi405 is significantly better at production of full-length transcripts rather than truncated transcripts compared to AAV9-U6-mi405. There was a significantly higher percentage of truncated genomes in the AAV9 preparation compared to the SLB101 preparation.

[0038] Fig. 7A-D shows a comparison of mi405 or Wfdc3 expression levels or ITR2 copy numbers in muscles or organs after administration of five increasing doses, i.e., 6E12 vg / kg,9E12 vg / kg, 3E13 vg / kg, 6E13 vg / kg, and 1 E14 vg / kg, of SLB101-U6-mi405 in comparison to one high dose, i.e., 1 E14 vg / kg, of AAV9-U6-mi405 in TIC-DUX4 mice. Fig. 7A shows expression levels in gastrocnemius muscle. Fig. 7B shows expression levels in triceps muscle. Fig. 7C shows expression levels in liver. Fig. 7D shows expression levels in ovaries and testes.DETAILED DESCRIPTION

[0039] The disclosure provides a novel strategy to accomplish double homeobox protein 4 (DUX4) gene expression post-transcriptionally by repressing or inhibiting DUX4 protein production because the expression of DUX4 in muscle is known to cause cancer and muscular dystrophy including, but not limited to, facioscapulohumeral muscular dystrophy (FSHD). Thus, in some aspects, the products and methods described herein are used in treating, ameliorating, delaying the progression of, and / or preventing a muscular dystrophy in a subject suffering from or at risk of suffering from a muscular dystrophy associated with elevated DUX4 expression. In some aspects, the muscular dystrophy associated with elevated DUX4 expression includes, but is not limited to, facioscapulohumeral muscular dystrophy (FSHD). In some other aspects, the products and methods described herein are used in treating, ameliorating, delaying the progression of, and / or preventing a cancer in a subject suffering from or at risk of suffering from a cancer associated with elevated DUX4 expression.

[0040] The DLIX4 gene encodes an approximately 45kDA protein; see UniProtKB - Q9LIBX2 (DUX4 HUMAN). De-repression of the DLIX4 gene is involved in disease pathogenesis of FSHD. De-repression can occur through two known mechanisms: D4Z4 repeat contraction, or mutation in chromatin modifier genes SMCHD1 or DNMT3B. For the former, in unaffected subjects, the D4Z4 array consists of 11-100 repeats, while in FSHD1 patients, the array is reduced to 1-10 repeats (Mostacciuolo et al., Clin. Genet. Jun;75(6):550-5 (2009); PubMed:19320656). Either condition can cause DNA hypomethylation at chromosome 4q35, thereby creating a chromosomal environment permissive for DLIX4 expression.

[0041] DLIX4 is located in D4Z4 macrosatellite which is epigenetically repressed in somatic tissues. D4Z4 chromatin relaxation in FSHD1 results in inefficient epigenetic repression of DUX4 and a variegated pattern of DUX4 protein expression in a subset of skeletal muscle nuclei. Ectopic expression of DUX4 in skeletal muscle activates the expression of stem cell and germline genes, and, when overexpressed in somatic cells, DUX4 can ultimately lead to cell death.

[0042] Each D4Z4 repeat unit has an open reading frame (named DUX4) that encodes two homeoboxes; the repeat-array and ORF is conserved in other mammals. The encoded protein has been reported to function as a transcriptional activator of numerous genes, including some considered to be FSHD disease biomarkers, including ZSCAN4, PRAMEF12, TRIM43, and MBD3L2 (Yao et al., Hum Mol Genet. 2014 Oct15;23(20):5342- 52; PMID: 24861551 ). Contraction of the macrosatellite repeat causes autosomal dominant FSHD. Alternative splicing results in multiple transcript variants.

[0043] In some aspects, the nucleic acid encoding human DUX4 is set forth in the nucleotide sequence set forth in SEQ ID NO: 1 . In some aspects, the amino acid sequence of human DLIX4 is set forth in the amino acid sequence set forth in SEQ ID NO: 2. In various aspects, the products and methods of the disclosure also target isoforms and variants of the nucleotide sequence set forth in SEQ ID NO: 1 . In some aspects, the variants comprise 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91 %, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71 %, and 70% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1 . In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, the products and methods of the disclosure target isoforms and variants of nucleic acids comprising nucleotide sequences encoding the amino acid sequence set forth in SEQ ID NO: 2. In some aspects, the variants comprise 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91 %, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% sequence identity to a nucleotide sequence that encodes the amino acid sequence set forth in SEQ ID NO: 2. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0044] Table 1. Human DUX4 DNA and Amino Acid Sequences.

[0045] There is currently no treatment for FSHD, and despite its relative abundance among the various muscular dystrophies, very few FSHD-targeted translational studies have been published. Several FSHD candidate genes have been identified, but numerous recent studies support that the primary contributor to FSHD pathogenesis is the pro-apoptotic DLIX4 gene, which encodes a transcription factor. Thus, in the simplest terms, DUX4- overexpression is a primary pathogenic insult underlying FSHD [Chen et al., (2016) Mol Ther 24: 1405-1411 ; Ansseau et al., (2017) Genes 8(3): 93; Lek et al., (2020) Sci Transl Med 12(536); Himeda et al., (2016) Mol Ther 24: 527-535; DeSimone et al., (2019) Sci Adv 5:12; Lim et al., (2020) Proc Natl Acad Sci USA 117: 16509-16515; Wallace et al., (2018), supra; Rojas et al., (2020) J Pharmacol Exp Ther. 374(3): 489-498].

[0046] In some aspects, the disclosure includes the use of RNA interference to downregulate or inhibit DUX4 expression or over-expression. RNA interference (RNAi) is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases. RNAi refers to post-transcriptional control of gene expression mediated by miRNAs. The miRNAs are small (about 21 -25 nucleotides), noncoding RNAs that sharesequence homology and base-pair with sequence target sites of cognate messenger RNAs (mRNAs). The interaction between the miRNAs and mRNAs directs cellular gene silencing machinery inducing mRNA decay and / or preventing mRNA translation into protein.

[0047] As an understanding of natural RNAi pathways has developed, researchers have designed artificial shRNAs and snRNAs for use in regulating expression of target genes for treating disease. Several classes of small RNAs are known to trigger RNAi processes in mammalian cells, including short (or small) interfering RNA (siRNA), and short (or small) hairpin RNA (shRNA) and microRNA (miRNA), which constitute a similar class of vector- expressed triggers [Davidson et al., Nat. Rev. Genet. 12:329-40, 2011 ; Harper, Arch. Neurol. 66:933-8, 2009]. shRNA and miRNA are expressed in vivo from plasmid- or virus-based vectors and may thus achieve long term gene silencing with a single administration, for as long as the vector is present within target cell nuclei and the driving promoter is active (Davidson et al., Methods Enzymol. 392:145-73, 2005). Importantly, this vector-expressed approach leverages the decades-long advancements already made in the muscle gene therapy field, but instead of expressing protein coding genes, the vector cargo in RNAi therapy strategies are artificial shRNA or miRNA cassettes targeting disease genes-of- interest. This strategy is used to express a natural miRNA. MicroRNA 675 has its own structure. Each other miRNA described herein is based on hsa-miR-30a sequences and structure. The natural mir-30a mature sequences are replaced by unique sense and antisense sequences derived from the target gene.

[0048] In some embodiments, the products and methods of the disclosure comprise microRNA (miRNA). MicroRNAs (miRNAs) are a class of non-coding RNAs that play important roles in RNA silencing and in regulating gene expression. The majority of miRNAs are transcribed from DNA sequences into primary miRNAs and processed into precursor miRNAs, and finally mature miRNAs. In most cases, miRNAs interact with the 3' untranslated region (3' UTR) of target mRNAs to induce mRNA degradation and translational repression. However, interaction of miRNAs with other regions, including the 5' UTR, coding sequence, and gene promoters, have also been reported. Under certain conditions, miRNAs can also activate translation or regulate transcription. The interaction of miRNAs with their target genes is dynamic and dependent on many factors, such as subcellular location of miRNAs, the abundancy of miRNAs and target mRNAs, and the affinity of miRNA-mRNA interactions.

[0049] Most studies to date have shown that miRNAs bind to a specific sequence at the 3' UTR of their target mRNAs to induce translational repression and mRNA deadenylation and decapping. miRNA binding sites have also been detected in other mRNA regions including the 5' UTR and coding sequence, as well as within promoter regions. The binding of miRNAsto 5' UTR and coding regions have silencing effects on gene expression while miRNA interaction with promoter region has been reported to induce transcription.

[0050] The disclosure provides nucleic acids encoding microRNA (miRNA) targeting DLIX4 and inhibiting the expression of DLIX4. In some aspects, the miRNA targeting DLIX4 and inhibiting the expression of DLIX4 is the miDUX4.405 sequence comprising the nucleotide sequence of TGAGCGATCCAGGATTCAGATCTGGTTTCTGAAAGCCACAGATGGGAAACCAGATCTG AATCCTGGACTGCCT (SEQ ID NO: 3) or sequence variant comprising at least or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0051] The DLIX4 miRNA mi405 sequence is also referred to herein as miDUX4.405 or mi405. Additionally, U.S. Patent Nos. 9,469,851 , 10,301 ,649, and 11 ,802,291 disclose experimental data for miDUX4.405. Each of these patents, i.e., U.S. Patent Nos. 9,469,851 , 10,301 ,649, and 11 ,802,291 , are incorporated herein by reference in its entirety. These patents show that there is a vast body of in vitro and in vivo pre-clinical data demonstrating safety and efficacy of miDUX4.405 in human myoblasts, in wild-type mice, and in a mouse model of FSHD.

[0052] In some aspects, the disclosure provides a nucleic acid comprising a nucleotide sequence encoding the miDUX4.405 sequence and further comprising a U6 promoter sequence. In some aspects, the U6 promoter sequence is the mouse U6 promoter sequence comprising the nucleotide sequence of ACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTC GGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTA ATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGG CTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGA AACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAA AGCCTTGTTTG (SEQ ID NO: 4) or a sequence variant comprising at least or about or a sequence comprising at least or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 4. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0053] In some aspects, the disclosure provides a nucleic acid comprising a nucleotide sequence encoding the miDUX4.405 sequence and a U6 promoter sequence and further comprising T6 termination signal. In some aspects, the T6 termination sequence is the nucleotide sequence of TTTTTT (SEQ ID NO: 5). In some aspects, the nucleotide sequence comprising the sequence encoding the miDUX4.405 sequence, a U6 promoter sequence, and a T6 termination signal comprises the nucleotide sequence of ACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTC GGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTA ATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGG CTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGA AACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAA AGCCTTGTTTGCGTTTAGTGAACCGTCAGATGGTACCGTTTAAACTCGAGTGAGCGATC CAGGATTCAGATCTGGTTTCTGAAAGCCACAGATGGGAAACCAGATCTGAATCCTGGAC TGCCTACTAGAGCGGCCGCCACAGCGGGGAGATCCAGACATGATAAGATACATTTTTT (SEQ ID NO: 6) or a sequence variant comprising at least or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 6. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0054] In some aspects, the disclosure provides a nucleic acid comprising a nucleotide sequence encoding the miDUX4.405 sequence, a U6 promoter sequence, and a T6 termination signal and further comprising a partial collagen intron stuffer sequence. In some aspects, the partial collagen intron stuffer sequence is the nucleotide sequence of

[0055] CTTTATGTTCCTGCTGACATTTTTTCTAAGTTTTCTCTTGCTTTCCTCTTAAATG CCAATCTGGAGAGTCTCCGTTAGGAGAAATGGACCCCAGCCAGGAAGAAGAGTTGAGT TGTATTTAAAACACGAGCTCCCCCTAAAGCATCCTTCTTTAGCTTCTAAGGAGAGGCAG AGACTGACAGGCAGGACTCAGCAGGAAAAGCTACCCCCCTGACCTGCTCAGTCAGGC CCTAGGCCCAGCTCCACCCAGCCTGTGGCCCCCAGAGTTTCGGTAAAGAGTTCCCTGG GCCTTAAGGAACCTTGAGAGAGCATTTGAGGGGTGCCACCACAAACTTGGCAGAAAAA ACCCTCCCCCTCCAAGTCCAGTCCTAGAGAAGGAGCTGGCAACCTTGCCTTGCTTTGT AAGCAAAAGCCTCTTAGGGCTTGAGCTCAGATGTAGTGTTTGAGCTGTGGCTGGTGCC CTGCCCCATCAGGGAGCCAATGGTAGACATCCTATGGGCATCTTTGTTTTCCGTAAGAG CAGGCTGTCTGGGGATGGGCCAGAGGAAGAGGCGACCTGGAGTCAACCAAGAGGAG GCCTTAACCAAGCCTTAACCACAGAGGTTAACCAAGCCTTGAAAGCGCTTCCCCCTGA GCAGGCAGGAAGCACTGAGTCCACATGGTTGCCTCGCTGTTTCATTTCCTTACACTCAATTCTCTCAGTCTTTAAATGATCACTTGGCCTTGAAGTTACGGATATTTGGGGTCTGAACT GAAGTTGAAGAAAAGAGGAAATGATTTAGGCTTTGTTTAAGATTAGGGGCCAGGTGCG GTGGCTCACGCCTGTAATCCCAGCACCTTGGGAGCCTGAGGCGGGTGGATCACCTGA GGTCAGGAGTTCCAGACCAGCCTGGCCAACATAGCAAAACCCAGTCTCTACTAAAAATA ACAATAAAAAAATTAGCCAGGTGTGGTGACACATGCCTGTAATCCCAGTTACTCAGGAG GCTGAGGCAGAATTGCTTGAACTTGAGAGGTGGAGGTTGTAGTGAGCCAAGACCGCAC CACTGCACTCCAGCCTGGCGACAGAGCCAGACTCCGTCTCAAAAACAACAACAAAAAA GATTAGAAGAAGCCCATTACTG (SEQ ID NO: 7) or a sequence variant comprising at least or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 7. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0056] In some aspects, the nucleotide sequence comprising the sequence encoding the miDUX4.405 sequence, a U6 promoter sequence, a T6 termination signal, and a partial collagen intron stuffer sequence (e.g., partial COL2A1 intron) comprises the nucleotide sequence of ACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTC GGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTA ATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGG CTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGA AACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAA AGCCTTGTTTGCGTTTAGTGAACCGTCAGATGGTACCGTTTAAACTCGAGTGAGCGATC CAGGATTCAGATCTGGTTTCTGAAAGCCACAGATGGGAAACCAGATCTGAATCCTGGAC TGCCTACTAGAGCGGCCGCCACAGCGGGGAGATCCAGACATGATAAGATACATTTTTT GAATTGCGTACGCTTTATGTTCCTGCTGACATTTTTTCTAAGTTTTCTCTTGCTTTCCTCT TAAATGCCAATCTGGAGAGTCTCCGTTAGGAGAAATGGACCCCAGCCAGGAAGAAGAG TTGAGTTGTATTTAAAACACGAGCTCCCCCTAAAGCATCCTTCTTTAGCTTCTAAGGAGA GGCAGAGACTGACAGGCAGGACTCAGCAGGAAAAGCTACCCCCCTGACCTGCTCAGT CAGGCCCTAGGCCCAGCTCCACCCAGCCTGTGGCCCCCAGAGTTTCGGTAAAGAGTTC CCTGGGCCTTAAGGAACCTTGAGAGAGCATTTGAGGGGTGCCACCACAAACTTGGCAG AAAAAACCCTCCCCCTCCAAGTCCAGTCCTAGAGAAGGAGCTGGCAACCTTGCCTTGC TTTGTAAGCAAAAGCCTCTTAGGGCTTGAGCTCAGATGTAGTGTTTGAGCTGTGGCTGG TGCCCTGCCCCATCAGGGAGCCAATGGTAGACATCCTATGGGCATCTTTGTTTTCCGTA AGAGCAGGCTGTCTGGGGATGGGCCAGAGGAAGAGGCGACCTGGAGTCAACCAAGAG GAGGCCTTAACCAAGCCTTAACCACAGAGGTTAACCAAGCCTTGAAAGCGCTTCCCCCTGAGCAGGCAGGAAGCACTGAGTCCACATGGTTGCCTCGCTGTTTCATTTCCTTACACT CAATTCTCTCAGTCTTTAAATGATCACTTGGCCTTGAAGTTACGGATATTTGGGGTCTGA ACTGAAGTTGAAGAAAAGAGGAAATGATTTAGGCTTTGTTTAAGATTAGGGGCCAGGTG CGGTGGCTCACGCCTGTAATCCCAGCACCTTGGGAGCCTGAGGCGGGTGGATCACCT GAGGTCAGGAGTTCCAGACCAGCCTGGCCAACATAGCAAAACCCAGTCTCTACTAAAA ATAACAATAAAAAAATTAGCCAGGTGTGGTGACACATGCCTGTAATCCCAGTTACTCAG GAGGCTGAGGCAGAATTGCTTGAACTTGAGAGGTGGAGGTTGTAGTGAGCCAAGACCG CACCACTGCACTCCAGCCTGGCGACAGAGCCAGACTCCGTCTCAAAAACAACAACAAA AAAGATTAGAAGAAGCCCATTACTG (SEQ ID NO: 8) or a sequence variant comprising at least or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 8. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0057] In some aspects, the disclosure provides a nucleic acid comprising a nucleotide sequence encoding the miDUX4.405 sequence, a U6 promoter sequence, a T6 termination signal and a partial collagen intron stuffer sequence and further comprises an inverted terminal repeat at the 5’ and the 3’ end.

[0058] In some aspects, the inverted terminal repeat sequence at the 5’ end of the sequence is the nucleotide sequence of

[0059] CAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCG TCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAG (SEQ ID NO: 9) or a sequence variant comprising at least or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 9. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0060] In some aspects, the inverted terminal repeat sequence at the 3' end of the sequence is the nucleotide sequence of ACAAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCAC TGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAG TGAGCGAGCGAGCGCGC (SEQ ID NO: 10) or a sequence variant comprising at least or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 10. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0061] In some aspects, the disclosure provides a nucleic acid comprising a nucleotide sequence encoding the miDUX4.405 sequence, a U6 promoter sequence, a T6 termination signal and a partial collagen intron stuffer sequence and further comprises an inverted terminal repeat at the 5' and the 3' end, wherein the nucleotide sequence comprises the nucleotide sequence ofCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGC GACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGGGT TCCTGCTATTGTCTTCGGCGCGCCCAATTCACGCCGCCATCTCTAGGCCCGCGCCGGC CCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCA TATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTC TTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACT AAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGT GTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTTGCGTTTAGTGAACCGTCAG ATGGTACCGTTTAAACTCGAGTGAGCGATCCAGGATTCAGATCTGGTTTCTGAAAGCCA CAGATGGGAAACCAGATCTGAATCCTGGACTGCCTACTAGAGCGGCCGCCACAGCGG GGAGATCCAGACATGATAAGATACATTTTTTGAATTGCGTACGCTTTATGTTCCTGCTGA CATTTTTTCTAAGTTTTCTCTTGCTTTCCTCTTAAATGCCAATCTGGAGAGTCTCCGTTAG GAGAAATGGACCCCAGCCAGGAAGAAGAGTTGAGTTGTATTTAAAACACGAGCTCCCC CTAAAGCATCCTTCTTTAGCTTCTAAGGAGAGGCAGAGACTGACAGGCAGGACTCAGC AGGAAAAGCTACCCCCCTGACCTGCTCAGTCAGGCCCTAGGCCCAGCTCCACCCAGC CTGTGGCCCCCAGAGTTTCGGTAAAGAGTTCCCTGGGCCTTAAGGAACCTTGAGAGAG CATTTGAGGGGTGCCACCACAAACTTGGCAGAAAAAACCCTCCCCCTCCAAGTCCAGT CCTAGAGAAGGAGCTGGCAACCTTGCCTTGCTTTGTAAGCAAAAGCCTCTTAGGGCTT GAGCTCAGATGTAGTGTTTGAGCTGTGGCTGGTGCCCTGCCCCATCAGGGAGCCAATG GTAGACATCCTATGGGCATCTTTGTTTTCCGTAAGAGCAGGCTGTCTGGGGATGGGCC AGAGGAAGAGGCGACCTGGAGTCAACCAAGAGGAGGCCTTAACCAAGCCTTAACCACA GAGGTTAACCAAGCCTTGAAAGCGCTTCCCCCTGAGCAGGCAGGAAGCACTGAGTCCA CATGGTTGCCTCGCTGTTTCATTTCCTTACACTCAATTCTCTCAGTCTTTAAATGATCACT TGGCCTTGAAGTTACGGATATTTGGGGTCTGAACTGAAGTTGAAGAAAAGAGGAAATGA TTTAGGCTTTGTTTAAGATTAGGGGCCAGGTGCGGTGGCTCACGCCTGTAATCCCAGC ACCTTGGGAGCCTGAGGCGGGTGGATCACCTGAGGTCAGGAGTTCCAGACCAGCCTG GCCAACATAGCAAAACCCAGTCTCTACTAAAAATAACAATAAAAAAATTAGCCAGGTGTG GTGACACATGCCTGTAATCCCAGTTACTCAGGAGGCTGAGGCAGAATTGCTTGAACTTGAGAGGTGGAGGTTGTAGTGAGCCAAGACCGCACCACTGCACTCCAGCCTGGCGACAG AGCCAGACTCCGTCTCAAAAACAACAACAAAAAAGATTAGAAGAAGCCCATTACTGCAT GGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGA TTTCCAGGCGCCGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGG CCGCCACCGCGGTGGGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAAC CCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCG GGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAG CGAGCGCGC (SEQ ID NO: 11 ) or a sequence variant comprising at least or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 11 . In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0062] Table 2. Human miDUX4.405 sequence and its components.

[0063] In exemplary aspects, a nucleic acid of the disclosure comprises the sequence encoding a DLIX4 miRNA, i.e., miDUX4.405, comprising the nucleotide sequence of SEQ ID NO: 3 or a sequence comprising at least or about 70% sequence identity to the nucleotide sequence of SEQ ID NO: 3. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In exemplary aspects, a nucleic acid of the disclosure comprises the sequence encoding miDUX4.405 with a 116 promoter, wherein the 116 promoter comprises the nucleotide sequence of SEQ ID NO: 4 or a sequence comprising at least or about 70% sequence identity to the nucleotide sequence of SEQ ID NO: 4. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In exemplary aspects, a nucleic acid of the disclosure comprises the sequence encoding miDUX4.405 and a U6 promoter sequence and further comprises a T6 termination signal sequence (SEQ ID NO: 5). In exemplary aspects, a nucleic acid of the disclosure comprises the sequence encoding the miDUX4.405 miRNA sequence, a U6 promoter sequence, and a T6 termination signal sequence (SEQ ID NO: 6) or a sequence comprising at least or about 70% sequence identity to the nucleotide sequence of SEQ ID NO: 6. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In exemplary aspects, a nucleic acid of the disclosure comprises the sequence encoding the miDUX4.405 miRNA sequence, a U6 promoter sequence, a T6 termination signal sequence, and a partial collagen intron stuffer sequence (e.g., partial COL2A1 intron), wherein the stuffer sequence comprises at least or about 70% sequence identity to the nucleotide sequence of SEQ ID NO: 7. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In exemplary aspects, a nucleic acid of the disclosure comprises a nucleotide sequence comprising the sequence encoding the miDUX4.405 miRNA sequence, a LI6 promoter sequence, a T6 termination signal sequence, and a partial collagen intron stuffer sequence (e.g., partial COL2A1 intron), wherein the nucleotide sequence comprises at least or about70% sequence identity to the nucleotide sequence of SEQ ID NO: 8. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In exemplary aspects, a nucleic acid of the disclosure further comprises a 5’ ITR sequence and / or a 3’ ITR sequence. In some aspects, the 5’ ITR sequence is the nucleotide sequence comprising at least or about 70% sequence identity to the nucleotide sequence of SEQ ID NO: 9. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full- length sequence. In some aspects, the 3’ ITR sequence is the nucleotide sequence comprising at least or about 70% sequence identity to the nucleotide sequence of SEQ ID NO: 10. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In exemplary aspects, a nucleic acid of the disclosure comprises a nucleotide sequence comprising the sequence encoding the miDUX4.405 miRNA sequence, a U6 promoter sequence, a T6 termination signal sequence, a partial collagen intron stuffer sequence (e.g., partial COL2A1 intron), and a 5’ ITR sequence and a 3’ ITR sequence, wherein the nucleotide sequence comprises at least or about 70% sequence identity to the nucleotide sequence of SEQ ID NO: 11 . In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0064] In some aspects of the disclosure, a different promoter is contemplated for delivery of the miDUX4.405 miRNA. In such instances, the LI6 promoter (i.e., SEQ ID NO: 4) present in the larger nucleotide sequence of SEQ ID NO: 6, 8, or 11 is removed and another promoter is inserted in its place in the nucleotide sequence of SEQ ID NO: 6, 8, or 11 or a sequence comprising at least or about 70% sequence identity to the sequence of SEQ ID NO: 6, 8, or 11 . In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, various other flanking sequences are also included.

[0065] In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in any one of SEQ ID NOs: 1-11. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence comprising at least 80% sequence identity to the sequence set forth in any one of SEQ ID NOs: 1-11. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, a nucleic acid of the disclosure comprises anucleotide sequence comprising at least 90% sequence identity to the sequence set forth in any one of SEQ ID NOs: 1 -11. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence comprising at least or about 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in any one of SEQ ID NOs: 1-11. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0066] The disclosure includes various nucleic acids comprising, consisting essentially of, or consisting of the various nucleotide sequences described herein. In some aspects, the nucleic acid comprises the nucleotide sequence. In some aspects, the nucleic acid consists essentially of the nucleotide sequence. In some aspects, the nucleic acid consists of the nucleotide sequence.

[0067] In various aspects, a nucleic acid of the disclosure comprising the nucleotide sequence encoding the miDUX4.405 miRNA further comprises a promoter sequence. In some aspects, the promoter is a polymerase II promoter or a polymerase III promoter. In some aspects, the promoter is any of LI6, LI7, tRNA, H1 , minimal CMV, T7, EF1 -alpha, Minimal EF1 -alpha, or a muscle-specific promoter. In some aspects, the promoter is U6 or H1 . In some aspects, the muscle-specific promoter is unc45b, tMCK, minimal MCK, CK6, CK7, CK8, MHCK7, or CK1 . In some exemplary aspects, a U6 promoter is used. Traditional small / short hairpin RNA (shRNA) sequences are usually transcribed inside the cell nucleus from a vector containing a Pol III promoter, such as U6. The endogenous U6 promoter normally controls expression of the LI6 RNA, a small nuclear RNA (snRNA) involved in splicing, and has been well-characterized [Kunkel et al., Nature. 322(6074): 73-7 (1986); Kunkel et al., Genes Dev. 2(2):196-204 (1988); Paule et al., Nucleic Acids Res. 28(6):1283-98 (2000)]. In some aspects, the U6 or H1 promoter is used to control vectorbased expression of shRNA molecules in mammalian cells [Paddison et al., Proc. Natl. Acad. Sci. USA 99(3):1443-8 (2002); Paul et al., Nat. BiotechnoL 20(5):505-8 (2002); Medina et al., Curr. Opin. Mol. Ther. 1 :580-94 (1999)] because (1 ) the promoter is recognized by RNA polymerase III (poly III) and controls high-level, constitutive expression of shRNA; (2) the Pol III promoter possesses greater capacity than RNA polymerase II to synthesize shRNA of high yield [Boden et al., Nucleic Acids Res. 32:1154-8 (2004); Xia et al., Neurodegenerative Dis. 2:220-31 (2005)]; (3) the Pol III promoters are consistent of compact sequence and simple terminator that are easy to handle [Medina et al. (1999) supra] and (2) the promoter is active in most mammalian cell types. In some aspects, the promoter is a type III Pol III promoter in that all elements required to control expression ofthe shRNA are located upstream of the transcription start site [Paule et al., Nucleic Acids Res. 28(6):1283-98 (2000)]. The disclosure includes both murine and human U6 promoters. The shRNA containing the sense and antisense sequences from a target gene connected by a loop is transported from the nucleus into the cytoplasm where Dicer processes it into small / short interfering RNAs (siRNAs).

[0068] In various aspects, a nucleic acid of the disclosure comprising the nucleotide sequence encoding the miDUX4.405 miRNA further comprises a collagen intron stuffer sequence or a partial collagen intron stuffer sequence (e.g., partial COL2A1 intron). In some aspects, a collagen intron stuffer sequence is a benign stuffer sequence which serves to increase packaging yield by increasing the size of the sequence. In some aspects, any benign stuffer sequence could be used in combination with

[0069] In some aspects of the disclosure, a different benign stuffer sequence is contemplated for delivery of the miDUX4.405 miRNA. In such instances, the stuffer sequence (i.e., SEQ ID NO: 7) present in the larger nucleotide sequence of SEQ ID NO: 8 or 11 is removed and another promoter is inserted in its place in the nucleotide sequence of SEQ ID NO: 8 or 11 or a sequence comprising at least or about 70% sequence identity to the sequence of SEQ ID NO: 8 or 11 . In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, various other flanking sequences are also included.

[0070] In various aspects, a nucleic acid of the disclosure comprising the nucleotide sequence encoding the miDUX4.405 miRNA further comprises a 5’ ITR sequence and a 3’ ITR sequence flanking the sequence encoding the miDUX4.405 miRNA. In some aspects, the 5’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 9 and / or the 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10 present in the larger nucleotide sequence of SEQ ID NO: 11 or a sequence comprising at least or about 70% sequence identity to the sequence of SEQ ID NO: 11 is removed and another single or pair of AAV ITR sequences are inserted. In some aspects, any appropriate AAV ITR sequence could be used. In some aspects, the single or pair of AAV ITR sequences are AAV2, AAV6, AAV8, AAVrh.74, or AAV9 ITR sequences.

[0071] The disclosure includes a composition comprising any of the nucleic acids described herein in combination with a diluent, excipient, or buffer. In some aspects, the disclosure includes a vector comprising any of the nucleic acids described herein.

[0072] In some embodiments, the disclosure includes a vector comprising any of the nucleic acids described herein. Thus, embodiments of the disclosure utilize vectors (for example, viral vectors, such as adeno-associated virus (AAV), adenovirus, retrovirus,lentivirus, equine-associated virus, alphavirus, pox virus, herpes virus, herpes simplex virus, polio virus, sindbis virus, vaccinia virus or a synthetic virus, e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and / or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule) to deliver the nucleic acids disclosed herein.

[0073] In some aspects, the disclosure provides a viral vector to deliver a nucleic acid encoding the DLIX4 miRNA. In some aspects, the viral vector is an AAV vector. AAV is a replication-deficient parvovirus, the single-stranded DNA genome of which is about 4.7 kb in length including 145 nucleotide inverted terminal repeat (ITRs). There are multiple serotypes of AAV and the nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45: 555-564 {1983); the complete genome of AAV3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV4 is provided in GenBank Accession No. NC_001829; the AAV5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV7 and AAV8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV8); the AAV9 genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004); the AAV10 genome is provided in Mol. Then, 13(1): 67-76 (2006); the AAV11 genome is provided in Virology, 330(2): 375-383 (2004); the AAV12 genome is provided in J. Virol. 2008 Feb; 82(3): 1399-406; and the AAV13 genome is provided in J. Virol. 2008; 82: 8911 .

[0074] Cis-acting sequences directing viral DNA replication (rep), encapsidation / packaging and host cell chromosome integration are contained within the AAV ITRs. Three AAV promoters (named p5, p19, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes. The two rep promoters (p5 and p19), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene. Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1 , VP2, and VP3. Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka (Current Topics in Microbiology and Immunology, 158: 97-129 (1992)).

[0075] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. Moreover, AAV transduces slowly dividing and nondividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. In some aspects, the rep and cap proteins are provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56eto 65eC for several hours), making cold preservation of AAV less critical. AAV may be lyophilized and AAV-infected cells are not resistant to superinfection.

[0076] In some aspects, the AAV vector is recombinant AAV (rAAV) vector. In some aspects, the vector is a single-stranded AAV vector (ss-AAV or ss-rAAV). In some aspects, the vector is a self-complementary AAV vector (sc-AAV or sc-rAAV). In some aspects, the rAAV lack rep and cap genes.

[0077] Thus, in some aspects, the viral vector is an adeno-associated virus (AAV), such as an AAV1 (i.e., an AAV containing AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 capsid proteins), AAV9 (i.e., an AAV containing AAV9 capsid proteins), AAVrh74 (i.e., an AAV containing AAVrh74 capsid proteins), AAVrh.8 (i.e., an AAV containing AAVrh.8 capsid proteins), AAVrh.10 (i.e., an AAV containing AAVrh.10 capsid proteins), AAV11 (i.e., an AAV containing AAV11 capsid proteins), AAV12 (i.e., an AAV containing AAV12 capsid proteins), AAV13 (i.e., an AAV containing AAV13 capsid proteins), AAV-anc80, AAV rh.74, AAV rh.8, AAVrh.10, AAV-B1 , myoAAV, or AAVMYO.

[0078] In some aspects, the AAV used to deliver a nucleic acid encoding the DUX4 miRNA of the disclosure is a modified AAV (mAAV) capsid polypeptide as disclosed by Solid Biosciences Inc. in International Publication No. WO 2021 / 072197, which is incorporated herein by reference in its entirety. WO 2021 / 072197 provides a modified VP1 capsidenabling preferential targeted expression of “gene of interest” (GOI) in muscle tissues, as well as recombinant adeno-associated virus (rAAV) with the GOI packaged with the modified VP1 capsids, and uses thereof. More specifically, in some aspects, a nucleic acid of the disclosure further comprises a nucleotide sequence encoding a modified AAV9 (mAAV9) capsid polypeptide (SEQ ID NO: 13 of WO 2021 / 072197) or an AAV-SLB101 capsid polypeptide (SEQ ID NO: 14 of WO 2021 / 072197), i.e., SEQ ID NOs: 12 or 13, respectively, as disclosed herein, or a sequence variant comprising at least or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 12 or 13 (see Table 3). In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0079] Table 3. Modified AAV capsids for delivery of the DUX4 miRNA.

[0080] The modified AAV9 VP1 capsids and SLB101 capsids, as described in WO 2021 / 072197, enable preferential targeted expression of the DLIX4 miRNA from rAAV packaged in such modified AAV9 VP1 capsids, especially in muscle tissues, including cardiac muscles (i.e., muscles in the heart), skeletal muscles (e.g., the quadriceps), and / or smooth muscles (e.g., the diaphragm muscles).

[0081] In some embodiments, DNA plasmids of the disclosure are provided which comprise rAAV genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1 -deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art.

[0082] In certain embodiments, the subject rAAV is produced based on the helper-virus- free transient transfection method, with all cis and trans components (vector plasmid and packaging plasmids, along with helper genes isolated from adenovirus) in suitable host cells such as 293 cells. The transient-transfection method is simple in vector plasmid construction and generates high-titer AAV vectors that are free of adenovirus. The modified VP1 capsid proteins can be encoded by one of the plasmids used in transient transfection of the producer cell line.

[0083] In certain embodiments, the subject rAAV is produced using a recombinant herpes simplex virus (rHSV)-based AAV production system, which utilizes rHSV vectors to bring the AAV vector and the Rep and Cap genes (i.e., the modified VP1 capsid gene of the invention) into the producer cells. The modified cap gene can be present in the rHSV vector that may also hosts the rAAV genome.

[0084] In certain embodiments, the subject rAAV is produced using a baculovirus system that requires simultaneous infection of insect cells with several baculovirus vectors to deliver the AAV vector cassette and the Rep and Cap genes (i.e., the modified VP1 capsid gene of the invention).

[0085] In certain embodiments, the subject rAAV is produced based on certain AAV producer cell lines derived from, e.g., HeLa or A549 or HEK293 cells, which stably harbored AAV Rep / cap genes (i.e., the modified VP1 capsid gene of the invention). The AAV vector cassette can either be stably integrated in the host genome or be introduced by an adenovirus that contained the cassette.

[0086] In certain embodiments, such producer cell line for rAAV production comprises an rAAV provirus that encodes the DLIX4 miRNA sequence of interest flanked by the AAV ITR sequences, wherein the rAAV provirus is integrated into the genome of the producer cell line for rAAV production.

[0087] In certain embodiments, production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAV rh.74, AAV rh.8, AAVrh.10, AAVB1 , myoAAV, or AAVMYO. In some aspects, AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAV rh.74, AAV rh.8, AAVrh.10, AAVB1 , myoAAV, or AAVMYO. Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11 ): 1900- 1909 (2014). More specifically, rAAV variants, as disclosed in WO 2021 / 072197 are included in the disclosure. WO 2021 / 072197 is incorporated by reference herein in its entirety As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.

[0088] Recombinant AAV genomes of the disclosure comprise one or more AAV ITRs flanking at least one nucleotide sequence encoding the miDUX4.405 miRNA sequence. In some aspects, it is contemplated that the nucleotide sequence encoding the DUX4 miRNA is administered with other polynucleotide constructs targeting DUX4. In various aspects, the miRNA is expressed under various promoters including, but not limited to, such promoters as a U6 promoter, a U7 promoter, a T7 promoter, a tRNA promoter, an H1 promoter, an EF1 -alpha promoter, a minimal EF1 -alpha promoter, an unc45b promoter, a CK1 promoter, a CK6 promoter, a CK7 promoter, a CK8 promoter, a miniCMV promoter, a CMV promoter, amuscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), a tMCK promoter, a minimal MCK promoter, or a desmin promoter as described herein above.

[0089] DNA plasmids of the disclosure comprise rAAV genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1 -deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAVrh.74, AAV rh.8, AAVrh.10, AAV-B1 , myoAAV, AAVMYO, mAAV9, or AAV-SLB101 . In some aspects, AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAVrh.74, AAV rh.8, AAVrh.10, AAV- B1 , myoAAV, AAVMYO, mAAV9, or AAV-SLB101 . Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.

[0090] In some embodiments, packaging cells are provided. Packaging cells are created in order to have a cell line that stably expresses all the necessary components for AAV particle production. Retroviral vectors are created by removal of the retroviral gag, pol, and env genes. These are replaced by the therapeutic gene. In order to produce vector particles, a packaging cell is essential. Packaging cell lines provide all the viral proteins required for capsid production and the virion maturation of the vector. Thus, packaging cell lines are made so that they contain the gag, pol and env genes. Following insertion of the desired gene into in the retroviral DNA vector, and maintenance of the proper packaging cell line, it is now a simple matter to prepare retroviral vectors. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycinresistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing [Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081], addition of synthetic linkers containing restriction endonuclease cleavage sites [Laughlin et al., 1983, Gene, 23:65-73] or by direct, blunt-end ligation [Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666]. The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.

[0091] In some embodiments, therefore, a method of generating a packaging cell to create a cell line that stably expresses all the necessary components for AAV particle production is provided. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing [Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077- 2081], addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation (Senapathy et al., 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.

[0092] General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbiol, and Immunol. 158:97-129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81 :6466 (1984); Tratschin et al., Mo1. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al., J. Virol., 63:3822- 3828 (1989); U.S. Patent No. 5,173,414; WO 95 / 13365 and corresponding U.S. Patent No. 5,658.776 ; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298 (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO 97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al., Vaccine, 13:1244-1250 (1995); Paul et al., Human Gene Therapy, 4:609-615 (1993); Clark et al., Gene Therapy, 3:1124-1132 (1996); U.S. Patent. No. 5,786,211 ; U.S. Patent No. 5,871 ,982; U.S. Patent. No. 6,258,595; and McCarty, Mol. Then, 16(10): 1648-1656 (2008). The foregoingdocuments are hereby incorporated by reference in their entirety herein, with particular emphasis on those sections of the documents relating to rAAV production. The production and use of various types of rAAV are specifically contemplated and exemplified.Recombinant AAV ( / .e., infectious encapsidated rAAV particles) are thus provided herein. In some aspects, genomes of the rAAV lack AAV rep and cap genes; that is, there is no AAV rep or cap DNA between the ITRs of the genomes of the rAAV. In some embodiments, the AAV is a recombinant linear AAV (rAAV), a single-stranded AAV (ssAAV), or a recombinant self-complementary AAV (scAAV).

[0093] The disclosure thus provides in some embodiments packaging cells that produce infectious rAAV. In one embodiment, packaging cells are stably transformed cancer cells, such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line). In another embodiment, packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).

[0094] The rAAV, in some aspects, are purified by methods standard in the art, such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark et al., Hum. Gene Then, 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002); U.S. Patent No. 6,566,118 and WO 98 / 09657.

[0095] In some embodiments, the disclosure provides a composition or compositions comprising a nucleic acid or a vector, e.g., such as a viral vector, as described herein. Thus, compositions comprising delivery vehicles (such as rAAV) described herein are provided. In various aspects, such compositions also comprise a pharmaceutically acceptable carrier. In general, as used herein, "pharmaceutically acceptable carrier" means all aqueous and nonaqueous solutions, sterile solutions, solvents, buffers, e.g. phosphate buffered saline (PBS) solutions, water, suspensions, emulsions, such as oil / water emulsions, various types of wetting agents, liposomes, dispersion media and coatings, which are compatible with pharmaceutical administration, in particular with parenteral administration. The use of such media and agents in pharmaceutical compositions is well known in the art, and the compositions comprising such carriers can be formulated by well-known conventional methods.

[0096] In some aspects, the disclosure provides AAV transducing cells for the delivery of nucleic acids encoding the DUX4 miRNA as described herein. Methods of transducing a target cell with rAAV, in vivo or in vitro, are included in the disclosure. The methods comprise the step of administering an effective dose, or effective multiple doses, of acomposition comprising a rAAV of the disclosure to a subject, including an animal (such as a human being) in need thereof. If the dose is administered prior to development of the muscular dystrophy, the administration is prophylactic. If the dose is administered after the development of the muscular dystrophy, the administration is therapeutic. In embodiments of the disclosure, an effective dose or a therapeutically effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the muscular dystrophy being treated, that slows or prevents progression of the muscular dystrophy, that slows or prevents progression of the muscular dystrophy, that diminishes the extent of disease, that results in remission (partial or total) of the muscular dystrophy, and / or that prolongs survival. In some aspects, the muscular dystrophy is FSHD.

[0097] In some embodiments, the disclosure includes a composition comprising any of the nucleic acids or any of the vectors described herein with other ingredients, such as a carrier, diluent, excipient, buffer, or adjuvant. Acceptable carriers, diluents, excipients, buffers, and / or adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; saltforming counterions such as sodium; and / or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).

[0098] In some other aspects, a nucleic acid of the disclosure is introduced into the cell via non-vectorized delivery. Thus, in an embodiment, the disclosure includes non-vectorized delivery of a nucleic acid encoding the DUX4-targeting miRNAs. In some aspects, in this context, synthetic carriers able to form complexes with nucleic acids, and protect them from extra- and intracellular nucleases, are an alternative to viral vectors. In some aspects, such non-vectorized delivery includes the use of nanoparticles, extracellular vesicles, or exosomes comprising the nucleic acids of the disclosure. The disclosure also includes compositions comprising any of the constructs described herein alone or in combination.

[0099] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods ofpreparation are vacuum drying and the freeze-drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.

[0100] Titers of rAAV to be administered in methods of the disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1 x106, about 1 x107, about 1 x108, about 1x109, about 1 x1010, about 1x1011, about 1x1012, about 1x1013, about 1 x1014, about 1 x1015, about 1 x1016, to about 1x1017or more DNase resistant particles (DRP) per ml. Dosages may also be expressed in units of viral genomes (vg) (e.g., 1 x107vg, 1 x108vg, 1 x109vg, 1 x1010vg, 1 x1011vg, 1 x1012vg, 1 x1013vg, 1 x1014vg, 1 x1015vg, 1 x1016vg, and 1 x1017vg, respectively). In some aspects, dosages are expressed in units of viral genomes (vg) per kilogram (kg) body weight (e.g., 1 x107vg / kg, 1x108vg / kg, 1x109vg / kg, 1x1 O10vg / kg, 1x1011vg / kg, 1 x1012vg / kg, 1x1013vg / kg, 1 x1014vg / kg, 1x1015vg / kg, 1 x1016vg / kg, and 1 x1017vg / kg, respectively). Additional information regarding an effective dose, or a therapeutically effective dose, as used herein, is provided herein below.

[0101] In some aspects, the disclosure provides a method of delivering to a cell or to a subject any one or more nucleic acids of the disclosure. In some aspects, the disclosure provides a method of inhibiting and / or interfering with expression of a DLIX4 gene in a cell comprising contacting the cell with a nucleic acid encoding a DUX4-targeting microRNA (miRNA) comprising a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 11 . In some aspects, the nucleic acid is delivered in a vector as described herein. In some aspects, the nucleic acid or vector is provided in a composition. Thus, in some aspects, the composition is delivered to the cell. In some aspects, the cell is in a human subject.

[0102] In some aspects, the disclosure provides a method of treating a subject having a muscular dystrophy or a cancer or a subject at risk of having a muscular dystrophy or a cancer comprising administering to the subject an effective amount of a nucleic acid encoding a DUX4-targeting microRNA (miRNA) comprising a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 1 1 . In some aspects, the nucleic acid is administered to the subject in a vector as described herein. In some aspects, the nucleic acid or vector is provided in a composition which is administered to the subject. In some aspects, the subject is in a human subject. In some aspects, the muscular dystrophy is facioscapulohumeral muscular dystrophy (FSHD). In some aspects, the canceris a cancer associated with DUX4 overexpression. In some aspects, the cancer is a sarcoma, a B-cell lymphoma, or a DUX4-expressing cancer of the adrenal, bile duct, bladder, breast, cervix, colon, endometrium, esophagus, head / neck, liver, brain, lung, mesothelium, neural crest, ovary, pancreas, prostate, kidney, skin, soft tissue, stomach, testicles, or thymus.

[0103] In some aspects, the disclosure provides a method of treating muscular dystrophy (such as FSHD) or a cancer associated with DUX4 overexpression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a recombinant AAV (rAAV) vector encoding a DLIX4 miRNA. In some aspects, the rAAV vector comprises an amino acid sequence comprising at least or about 80% sequence identity to the amino sequence of SEQ ID NO: 12 or 13; or comprises the amino sequence of SEQ ID NO: 12 or 13. In some aspects, the DLIX4 miRNA is mi405.

[0104] In some aspects, expression of DLIX4 or the expression of functional DLIX4 is decreased in a cell or in a subject by the methods provided herein by at least or about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 96, about 97, about 98, about 99, or 100 percent.

[0105] Combination therapies are also contemplated by the disclosure. Combination as used herein includes simultaneous treatment or sequential treatments. Combinations of methods of the disclosure with standard medical treatments (e.g., corticosteroids and / or immunosuppressive drugs) or with other inhibitory RNA constructs are specifically contemplated, as are combinations with other therapies such as those disclosed in International Publication No. WO 2013 / 016352, which is incorporated by reference herein in its entirety.

[0106] Administration of an effective dose of the compositions, including AAV, nanoparticles, extracellular vesicles, and exosomes comprising the compositions and nucleic acids of the disclosure, may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal. Route(s) of administration and serotype(s) of AAV components of rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure may be chosen and / or matched by those skilled in the art taking into account the disease state being treated and the target cells / tissue(s), such as cells that express DUX4. In some embodiments, the composition or medicament is formulated for intramuscular injection, oral administration, subcutaneous, intradermal, intraventricular, or transdermal transport, injection into the blood stream, or foraerosol administration. In some embodiments, the route of administration is intramuscular. In some embodiments, the route of administration is intravenous.

[0107] In some aspects, actual administration of rAAV of the present disclosure may be accomplished by using any physical method that will transport the rAAV recombinant vector into the target tissue of an animal. Administration according to the disclosure includes, but is not limited to, injection into muscle, the bloodstream, the central nervous system, and / or directly into the brain or other organ. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV). Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as muscle. See, for example, WO 02 / 053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared for oral administration, as injectable formulations, or as topical formulations to be delivered to the muscles by subcutaneous, intradermal, intraventricular, and / or transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the disclosure. The rAAV can be used with any pharmaceutically acceptable carrier for ease of administration and handling.

[0108] For purposes of intramuscular injection, solutions in an adjuvant such as sesame or peanut oil or in aqueous propylene glycol can be employed, as well as sterile aqueous solutions. Such aqueous solutions can be buffered, if desired, and the liquid diluent first rendered isotonic with saline or glucose. Solutions of rAAV as a free acid (DNA contains acidic phosphate groups) or a pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxpropylcellulose. A dispersion of rAAV can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.

[0109] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersionmedium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof, and vegetable oils. In some aspects, proper fluidity is maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0110] In some aspects, the formulation comprises a stabilizer. The term "stabilizer" refers to a substance or excipient which protects the formulation from adverse conditions, such as those which occur during heating or freezing, and / or prolongs the stability or shelflife of the formulation in a stable state. Examples of stabilizers include, but are not limited to, sugars, such as sucrose, lactose and mannose; sugar alcohols, such as mannitol; amino acids, such as glycine or glutamic acid; and proteins, such as human serum albumin or gelatin.

[0111] In some aspects, the formulation comprises an antimicrobial preservative. The term "antimicrobial preservative" refers to any substance which is added to the composition that inhibits the growth of microorganisms that may be introduced upon repeated puncture of the vial or container being used. Examples of antimicrobial preservatives include, but are not limited to, substances such as thimerosal, 2-phenoxyethanol, benzethonium chloride, and phenol.

[0112] The term "transduction" is used to refer to the administration / delivery of one or more of the DLIX4 targeting constructs, e.g., DLIX4 miRNA or nucleic acid encoding DUX miRNA, described herein to a recipient cell either in vivo or in vitro, via a replication-deficient rAAV of the disclosure resulting in decreased expression of DUX4 by the recipient cell.

[0113] Methods of transducing a target cell with a delivery vehicle (such as rAAV), in vivo or in vitro, are contemplated. Transduction of cells with an rAAV of the disclosure results in sustained expression of DUX4 miRNA sequence. The disclosure thus provides rAAV and methods of administering / delivering rAAV which express DUX4 miRNA sequence in the cell(s) in vitro or in vivo in a subject. In some aspects, the subject is a mammal. In some aspects, the mammal is a human. These methods include transducing cells and tissues (including, but not limited to, tissues such as muscle) with one or more rAAV described herein. Transduction may be carried out with gene cassettes comprising cell-specific control elements. The term “transduction” is used to refer to, as an example, the administration / delivery of a nucleic acid comprising a nucleotide sequence encoding a DUX4 miRNA sequence, e.g., DLIX4 miRNA, to a target cell either in vivo or in vitro, via a replication-deficient rAAV described herein resulting in the decreased expression or inhibition of expression of DLIX4 by the target cell.

[0114] In one aspect, transduction with rAAV is carried out in vitro. In one embodiment, desired target cells are removed from the subject, transduced with rAAV and reintroduced into the subject. Alternatively, syngeneic or xenogeneic cells can be used where those cells will not generate an inappropriate immune response in the subject.

[0115] Suitable methods for the transduction and reintroduction of transduced cells into a subject are known in the art. In one embodiment, cells are transduced in vitro by combining rAAV with cells, e.g., in appropriate media, and screening for those cells harboring the DNA of interest using conventional techniques such as Southern blots and / or PCR, or by using selectable markers. Transduced cells can then be formulated into pharmaceutical compositions, and the composition introduced into the subject by various techniques, such as by intramuscular, intravenous, subcutaneous and intraperitoneal injection, or by injection into smooth and cardiac muscle, using e.g., a catheter.

[0116] The disclosure provides methods of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV that comprise DNA that encodes the DLIX4 microRNA designed to downregulate or inhibit the expression of DUX4 to a cell or to a subject in need thereof. In some aspects, the effective dose is therefore a therapeutically effective dose.

[0117] In some embodiments, the dose or effective dose of rAAV administered is about 1 .0x1010vg / kg to about 1 .0x1016vg / kg. In some embodiments, the dose or effective dose of rAAV administered is about 1.0x1011vg / kg to about 1.0x1015vg / kg. In some embodiments, the dose or effective dose of rAAV administered is from about 9.0x1012vg / kg to about 6x1014vg / kg. In some embodiments, the dose or effective dose of rAAV administered is from about 1 .0x1013vg / kg to about 1 .0x1014vg / kg. In some embodiments, the dose or effective dose of rAAV administered is from about 3.0x1013vg / kg to about 6.0x1013vg / kg. In some embodiments, the dose or effective dose of rAAV administered is about 1 .0x1014vg / kg. In some embodiments, the dose or effective dose of rAAV administered is about 6.0x1012vg / kg. In some embodiments, the dose or effective dose of rAAV administered is about 9.0x1012vg / kg. In some embodiments, the dose or effective dose of rAAV administered is about 3.0x1013vg / kg. In some embodiments, the dose or effective dose of rAAV administered is about 6.0x1013vg / kg. In some aspects the dose or effective dose of rAAV isabout 1 .0x1010vg / kg, about 2.0x1010vg / kg, about 3.0x1010vg / kg, about 4.0x1010vg / kg, about 5.0x1010vg / kg, about 6.0x1010vg / kg, about 7.0x1010vg / kg, about 8.0x1010vg / kg, about 9.0x1010about 1.0x1011vg / kg, about 2.0x1011vg / kg, about 3.0x1011vg / kg, about 4.0x1011vg / kg, about 5.0x1011vg / kg, about 6.0x1011vg / kg, about 7.0x1011vg / kg, about 8.0x1011vg / kg, about 9.0x1011vg / kg, about 1 .0x1012vg / kg, about 2.0x1012vg / kg, about 3.0x1012vg / kg, about 4.0x1012vg / kg, about 5.0x1012vg / kg, about 6.0x1012vg / kg, about 7.0x1012vg / kg, about 8.0x1012vg / kg, about 9.0x1012vg / kg, about 1 .0x1013vg / kg, about 2.0x1013vg / kg, about 3.0x1013vg / kg, about 4.0x1013vg / kg, about 5.0x1013vg / kg, about 6.0x1013vg / kg, about 7.0x1013vg / kg, about 8.0x1013vg / kg, about 9.0x1013vg / kg, about 1 .0x1014vg / kg, about 2.0x1014vg / kg, about 3.0x1014vg / kg, about 4.0x1014vg / kg, about 5.0x1014vg / kg, about 6.0x1014vg / kg, about 7.0x1014vg / kg, about 8.0x1014vg / kg, about 9.0x1014vg / kg, about 1 .0x1015vg / kg, about 2.0x1015vg / kg, about 3.0x1015vg / kg, about 4.0x1015vg / kg, about 5.0x1015vg / kg, about 6.0x1015vg / kg, about 7.0x1015vg / kg, about 8.0x1015vg / kg, about 9.0x1015vg / kg, or about 1 .0x1016vg / kg.

[0118] In some aspects, 1.0x101° vg / kg is also designated 1.0 E10 vg / kg, which is simply an alternative way of indicating the scientific notation. Likewise, 1011is equivalent to E11 , 1012is equivalent to E12, 1013is equivalent to E13, and the like. In some aspects, the dose or effective dose of rAAV administered is about 1 .0x1011vg / kg to about 1.0x1015vg / kg. In some aspects, the dose or effective dose of rAAV administered is about 1 .0x1012vg / kg to about 5.0x1014vg / kg. In some aspects, the dose is about 1 .0x1013vg / kg to about 4.0x1014vg / kg. In some aspects, the dose is about 2.0x1013vg / kg to about 2.0x1014vg / kg.

[0119] In some aspects, an initial dose is followed by a second greater dose. In some aspects, an initial dose is followed by a second same dose. In some aspects, an initial dose is followed by one or more lesser doses. In some aspects, an initial dose is followed by multiple doses which are the same or greater doses.

[0120] The in vivo methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a delivery vehicle (such as rAAV) to a subject (including a human subject) in need thereof. Thus, methods are provided of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV described herein to a subject in need thereof. If the dose or doses is administered prior to development of a disorder / disease, the administration is prophylactic. If the dose or doses is administered after the development of a disorder / disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, that slows or prevents progression to a disorder / disease state, thatslows or prevents progression of a disorder / disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and / or that prolongs survival.

[0121] In some embodiments, compositions and methods of the disclosure are used in treating, ameliorating, or preventing a disease, such as a muscular dystrophy (MD). In various aspects, such MD is FSHD. FSHD is among the most commonly inherited muscular dystrophies, estimated to affect as many as 870,000 individuals. Classical descriptions of FSHD presentation include progressive muscle weakness in the face, shoulder-girdle and arms, but disease can manifest more broadly, including in muscles of the trunk and lower extremities. Variability is also commonly seen within individuals, as asymmetrical weakness is common. Age-at-onset can range from early childhood to adulthood, and is usually related to disease severity, where earlier onset is often associated with more severe muscle weakness. Although most patients with FSHD have a normal life span, respiratory insufficiency can occur, and the disease can be debilitating, as approximately 25% of affected individuals may become wheelchair dependent by their fifties, and even earlier in more severe forms of the disease, while others maintain lifelong ambulation.

[0122] FSHD is caused by aberrant expression of the double homeobox 4 gene (DUX4), which produces a transcription factor that is toxic to skeletal muscle. DUX4 is normally functional during the two-cell stage of human development but repressed thereafter in essentially all other tissues, except perhaps the testes. In skeletal muscles of people with FSHD, specific genetic and epigenetic factors conspire to permit DUX4 de-repression, where it then initiates several aberrant gene expression cascades, including those involved in differentiation abnormalities, oxidative stress, inflammatory infiltration, cell death and muscle atrophy.

[0123] In families known to carry pathological FSHD, the methods of the disclosure, in various aspects, are methods of preventing disease and they are carried out before the onset of disease. In other various aspects, the methods of the disclosure are carried out after diagnosis and, therefore, are methods of treating or ameliorating disease.

[0124] In some embodiments, compositions and methods of the disclosure are used in treating, ameliorating, or preventing a disease, such as a cancer. DUX4 has been shown to be activated in some cancer types, where it functions to mask tumor cells from the immune system [Chew et al., Dev. Cell 50(5):658-71 (2019)]. For example, DUX4 protein fusions are known to cause cancer, such as rhabdomyosarcoma and Ewing's sarcoma. A CIC-DUX4 gene fusion induces sarcomas and drives sarcoma metastasis [Yoshimoto et al., Cancer Res. 2017 Jun 1 ; 77(11 ): 2927-2937; Okimoto et al., J Clin Invest. 2019; 129(8):3401 - 3406)]. Other cancer tissues, such as those tissues from the adrenal, B-cell lymphoma, bile duct, bladder, breast, cervix, colon, endometrium, esophagus, head / neck, liver, brain (e.g.,lower grade glioma), lung, mesothelium, neural crest, ovary, pancreas, prostate, kidney, skin, soft tissue, stomach, testicles, and thymus, also were shown to express DLIX4 [Chew et al., Dev. Cell 50(5):658-71 (2019)]. Thus, the nucleic acids, rAAV and compositions described herein are used in inhibiting DLIX4 expression in the treatment, amelioration, or prevention of cancer.

[0125] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of the products and methods disclosed herein for decreasing the expression of the DUX4 gene and protein and treating muscular dystrophies, such as FSHD. Outcome measures are described, for example, in Chapters 32, 35 and 43 of Dyck and Thomas, Peripheral Neuropathy, Elsevier Saunders, Philadelphia, PA, 4thEdition, Volume 1 (2005) and in Burgess et al., Methods Mol. Biol., 602: 347-393 (2010). Outcome measures include, but are not limited to, reduction or elimination of DLIX4 mRNA or protein in affected tissues. The lack of expression of DUX4 and / or the downregulation of expression of DLIX4 in the cell is detected by measuring the level of DLIX4 protein by methods known in the art including, but not limited to, RT-PCR, QRT-PCR, RNAscope, Western blot, immunofluorescence, or immunohistochemistry in muscle biopsied before and after administration of the rAAV to determine the improvement.

[0126] In some embodiments, the level of DLIX4 gene expression or protein expression in a cell of the subject is decreased after administration of the nucleic acid encoding the DLIX4 miRNA or the vector, e.g., rAAV, comprising the nucleic acid encoding the DLIX4 miRNA as compared to the level of DLIX4 gene expression or protein expression before administration of the nucleic acid encoding the DLIX4 miRNA or the vector, e.g. rAAV. In some aspects, expression of a DUX4 is decreased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100%. In various aspects, improved muscle strength, improved muscle function, and / or improved mobility and stamina show an improvement by at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100%.

[0127] Other outcome measures include measuring the level of serum creatinine kinase (CK) in the subject before and after treatment. Increased CK levels are a hallmark of muscle damage. In muscular dystrophy patients, CK levels are significantly increased above the normal range (10 to 100 times the normal level since birth). When elevated CK levels arefound in a blood sample, it usually means muscle is being disintegrated by some abnormal process, such as a muscular dystrophy or inflammation. Thus, a positive therapeutic outcome for treatment with the methods of the disclosure is a reduction in the level of serum creatinine kinase after administration of the rAAV as compared to the level of serum creatinine kinase before administration of the rAAV.

[0128] Other outcome measures include, but are not limited to, measuring to determine if there is improved muscle strength, improved muscle function, improved mobility, improved stamina, or a combination of two or more thereof in the subject after treatment. Such outcome measures are important in determining muscular dystrophy progression in the subject and are measured by various tests known in the art. Some of these tests include, but are not limited to, the six minute walk test, time to rise test, ascend 4 steps test, ascend and descend 4 steps test, North Star Ambulatory Assessment (NSAA) test, 10 meter timed test, 100 meter timed test, hand held dynamometry (HHD) test, Timed Up and Go test, Gross Motor Subtest Scaled (Bayley-Ill) score, maximum isometric voluntary contraction test (MVICT), or a combination of two or more thereof.

[0129] Combination therapies are also contemplated by the disclosure. A combination therapy, as used herein, includes both simultaneous treatment(s) and sequential treatment(s). Combinations of methods described herein with standard medical treatments and supportive care are specifically contemplated, as are combinations with therapies, such as glucocorticoids. All types of glucocorticoids are included for use in the combination therapies disclosed herein. Such glucocorticoids include, but are not limited to, prednisone, prednisolone, dexamethasone, deflazacort, beclomethasone, betamethasone, budesonide, cortisone, hydrocortisone, methylprednisolone, and triamcinolone.

[0130] Other combination therapies included in the disclosure are the DUX4 miRNAs, as described herein, in combination with other miRNAs, or in combination with U7-snRNA- based gene therapy, a small molecule inhibitor of DUX4 expression, oligonucleotides to inhibit DUX4 through RNAi or RNAse H or exon skipping mechanisms, U7-snRNA plus a theoretical CRISPR-based gene therapy approach.

[0131] Administration of an effective dose of a nucleic acid, viral vector, or composition of the disclosure may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal. In some aspects, an effective dose is delivered by a systemic route of administration, i.e., systemic administration. Systemic administration is a route of administration into the circulatory system so that the entire body is affected. Such systemic administration, invarious aspects, takes place via enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (generally via injection, infusion, or implantation). In various aspects, an effective dose is delivered by a combination of routes. For example, in various aspects, an effective dose is delivered intravenously and / or intramuscularly, or intravenously and intracerebroventricularly, and the like. In some aspects, an effective dose is delivered in sequence or sequentially. In some aspects, an effective dose is delivered simultaneously. Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure, in various aspects, are chosen and / or matched by those skilled in the art taking into account the condition or state of the disease or disorder being treated, the condition, state, or age of the subject, and the target cells / tissue(s) that are to express the nucleic acid or protein.

[0132] In particular, actual administration of delivery vehicle (such as rAAV) may be accomplished by using any physical method that will transport the delivery vehicle (such as rAAV) into a target cell of an animal. Administration includes, but is not limited to, injection into muscle, the bloodstream and / or directly into the nervous system or liver. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV).Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02 / 053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the disclosure. The delivery vehicle (such as rAAV) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.

[0133] A dispersion of delivery vehicle (such as rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques known to those skilled in the art.

[0134] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid tothe extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0135] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.

[0136] "Treating" includes ameliorating or inhibiting one or more symptoms of a muscular dystrophy including, but not limited to, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, facial weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, muscle inflammation, and nonsymmetrical weakness.

[0137] Administration of an effective dose of a nucleic acid, viral vector, or composition of the disclosure may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal. In some aspects, an effective dose is delivered by a systemic route of administration, i.e., systemic administration. Systemic administration is a route of administration into the circulatory system so that the entire body is affected. Such systemic administration, in various aspects, takes place via enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (generally via injection, infusion, orimplantation). In various aspects, an effective dose is delivered by a combination of routes. For example, in various aspects, an effective dose is delivered intravenously and / or intramuscularly, or intravenously and intracerebroventricularly, and the like. In some aspects, an effective dose is delivered in sequence or sequentially. In some aspects, an effective dose is delivered simultaneously. Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure, in various aspects, are chosen and / or matched by those skilled in the art taking into account the condition or state of the disease or disorder being treated, the condition, state, or age of the subject, and the target cells / tissue(s) that are to express the nucleic acid or protein.

[0138] In particular, actual administration of delivery vehicle (such as rAAV) may be accomplished by using any physical method that will transport the delivery vehicle (such as rAAV) into a target cell of an animal. Administration includes, but is not limited to, injection into muscle, the bloodstream and / or directly into the nervous system or liver. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV).Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02 / 053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the disclosure. The delivery vehicle (such as rAAV) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.

[0139] A dispersion of delivery vehicle (such as rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques known to those skilled in the art.

[0140] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions ofmicroorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0141] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.

[0142] The disclosure also provides a kit comprising a nucleic acid, vector, or composition of the disclosure or produced according to a process of the disclosure. In the context of the disclosure, the term "kit" means two or more components, one of which corresponds to a nucleic acid, vector, or composition of the disclosure, and the other which corresponds to a container, recipient, instructions, or otherwise. A kit, therefore, in various aspects, is a set of products that are sufficient to achieve a certain goal, which can be marketed as a single unit.

[0143] The kit may comprise one or more recipients (such as vials, ampoules, containers, syringes, bottles, bags) of any appropriate shape, size and material containing the nucleic acid, vector, or composition of the disclosure in an appropriate dosage for administration (see above). The kit may additionally contain directions or instructions for use (e.g. in the form of a leaflet or instruction manual), means for administering the nucleic acid, vector, or composition, such as a syringe, pump, infuser or the like, means for reconstituting the nucleic acid, vector, or composition and / or means for diluting the nucleic acid, vector, or composition.

[0144] In some aspects, the kit comprises a label and / or instructions that describes useof the reagents provided in the kit. The kits also optionally comprise catheters, syringes or other delivering devices for the delivery of one or more of the compositions used in the methods described herein.

[0145] The disclosure also provides kits for a single dose of administration unit or for multiple doses. In some embodiments, the disclosure provides kits containing singlechambered and multi-chambered pre-filled syringes.

[0146] This entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated, even if the combination of features are not found together in the same sentence, or paragraph, or section of this document. The disclosure also includes, for instance, all embodiments of the disclosure narrower in scope in any way than the variations specifically mentioned above. With respect to aspects of the disclosure described as a genus, all individual species are considered separate aspects of the disclosure. With respect to aspects of the disclosure described or claimed with "a" or "an," it should be understood that these terms mean "one or more" unless context unambiguously requires a more restricted meaning.

[0147] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. Such equivalents are intended to be encompassed by the disclosure.

[0148] The term "and / or" wherever used herein includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term."

[0149] The term "about" or "approximately" as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range. It includes, however, also the concrete number, e.g., about 10 includes 10.

[0150] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term "comprising" can be substituted with the term "containing" or "including" or sometimes when used herein with the term "having."

[0151] When used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element. When used herein, "consisting essentially of" does notexclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0152] In each instance herein any of the terms "comprising", "consisting essentially of" and "consisting of" may be replaced with either of the other two terms.

[0153] It should be understood that this disclosure is not limited to the particular methodology, protocols, material, reagents, and substances, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the subject matter of the disclosure, which is defined solely by the claims.

[0154] All publications and patents cited throughout the text of this specification (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.

[0155] A better understanding of the disclosure and of its advantages will be obtained from the following examples, offered for illustrative purposes only. The examples are not intended to limit the scope of the disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.EXAMPLES

[0156] Additional aspects and details of the disclosure will be apparent from the following examples, which are intended to be illustrative rather than limiting.Example 1 Design of the ITR-U6-mi405-ITR sequence

[0157] The objective of the study was to explore new strategies for the treatment of a muscular dystrophy, such as FSHD, or a cancer associated with expression or an overexpression of DLIX4. FSHD is caused by de-repression of the DLIX4 gene, which is toxic to muscle. FSHD therapies are thus focused on inhibiting DLIX4, which was a main goal of this study. In this study, a novel strategy was developed to direct RNAi against DLIX4 using miDUX4.405, a microRNA specific for DLIX4, and package and deliver the miDUX4.405 in new types of AAV vectors.

[0158] The DLIX4 mi405 miRNA used in this study were designed as previously reported in [Wallace et al., Mol. Ther. Methods Clin. Dev. 8:121-130 (2018)] and cloned into a LI6 construct as previously described [Wallace et al., Mol. Ther. 20:1417-23 (2012)]. The nucleotide sequence for the sequence encoding miDUX4.405 is the nucleotide sequence of SEQ ID NO: 3. For purposes of the disclosure, variants of SEQ ID NO: 3 are included as part of the disclosure.

[0159] A polynucleotide sequence comprising the mi405 sequence targeting DUX4, i.e., designated ITR-U6-mi405-ITR and comprising the nucleotide sequence of SEQ ID NO: 11 , was designed as shown in Fig. 1 . Also see Table 2 for components of the U6-mi405 sequence without the ITR sequences.Example 2Inhibition of DUX4 protein in TIC-DUX4 mouse model

[0160] To assess the inhibition efficiency of SLB101-U6-mi405 with collagen intron stuffer, the U6-mi405 construct was put into the AAV-SBL101 vector or an AAV9 vector and a mouse model of FSHD, TIC-DUX4 mice (Giesige et al. AAV-mediated follistatin gene therapy improves functional outcomes in the TIC-DUX4 mouse model of FSHD. JCI lnsight;3. Epub ahead of print November 15, 2018. DOI: 10.1172 / jci. insight.123538) were treated with the DLIX4 miRNA gene therapy. All animal studies were performed according to the NIH Guide for the Care and Use of Laboratory Animals.

[0161] TIC-DUX4 mice were treated with five increasing doses of SLB101 -U6-mi405, i.e., 6E12 vg / kg, 9E12 vg / kg, 3E13 vg / kg, 6E13 vg / kg, and 1 E14 vg / kg in comparison to one high dose, i.e., 1 E14 vg / kg, of AAV9-U6-mi405. Thus, AAV9 1 E14 vg / kg was compared to SLB101 at five doses: 6E12 vg / kg, 9E12 vg / kg, 3E13 vg / kg, 6E13 vg / kg, and 1 E14 vg / kg.

[0162] This study showed there was durable dose-responsive expression of AAV9- mi405 in FSHD mice in both upper and lower limb muscles (i.e., triceps and gastrocnemius) at 6 months (Fig. 2). Fig. 3 shows that AAV9-mi405 improved mobility in the mouse model of FSHD in a dose-dependent manner in an open field test, and that the payload dose correlates with neurofunctional behavior. Fig. 3 shows total activity and rearing (i.e., mice rearing up on hind legs) over 10 weeks after dosing. A dose-dependent effect was seen at lower doses of 9E13 vg / kg and 6E13 vg / kg. The higher dose cohort (3E13 vg / kg) mimicked wild-type C57BL / 6.Example 3 AAV packaging efficiency comparison

[0163] To test AAV packaging efficiency, scAAV9-U6-mi405 and scSLB101-U6-mi405 were produced and circular consensus sequencing (CCS) was performed to detect scAAVscontaining full length transcripts or truncated transcripts. Since truncated transcripts do not contain promoters, they usually result in low expression of its payload. However, they can still be counted for vector genome numbers because truncated transcripts do contain ITR sequences.

[0164] The data provided in Fig. 6 shows that SLB101-U6-mi405 is significantly better at production of full-length transcripts rather than truncated transcripts compared to AAV9-U6- mi405. There was a significantly higher percentage of truncated genomes in the AAV9 preparation compared to the SLB101 preparation.Example 4 SLB101 -U6-mi405 dose response in a TIC-DUX4 mouse model

[0165] Increasing doses of SLB101 -U6-mi405 (i.e., 6E12 vg / kg, 9E12 vg / kg, 3E13 vg / kg, 6E13 vg / kg, and 1 E14 vg / kg) were administered to a FSHD mouse model (TIC-DUX4). mi405 or Wfdc3 expression levels or ITR2 copy numbers were measured in the FSHD mouse model and the measurements were compared to those measured in mice treated with one high dose, i.e., 1 E14 vg / kg, of AAV9-U6-mi405. The results provided in Fig 7A and Fig. 7B show SLB101 -U6-mi405 increased levels of mi405 expression and decreased Wfdc3 expression at significantly higher levels compared to AAV9-U6-mi405 in the gastrocnemius and triceps muscles. SLB101-U6-mi405 also achieved significantly higher transduction than AAV9, showing greater copy numbers (copies of ITR2) compared to AAV9-U6-mi405 in the gastrocnemius and triceps muscles.

[0166] These differences were not observed in the liver (Fig. 7C) or in the ovaries or testes (Fig. 7D). For example, there was no significant difference in inhibition of Sfdc3 expression in the liver, ovaries or tested between SLB101 -U6-mi405 and AAV9-U6-mi405.Example 5DUX4 mi 405 miRNA decrease DUX4-activated biomarker expression in a mouse model of FSHD

[0167] AAV comprising the DUX4miRNA constructs of the disclosure are injected into a FSHD mouse model (TIC-DUX4) or any other mouse model of FSHD mice intramuscularly (IM) or intravenously (IV). After 4, 8, 12, 16, 20, and 24 weeks, the expression level of a DLIX4 biomarker, such as Wfdc3 or Trim36, are measured by qRT-PCR, RNAscope, or ddPCR.

[0168] Reduced levels of DLIX4 biomarker expression are observed in muscles of mice treated with the U6-mi405 construct compared to the levels in muscles of untreated mice.Example 6 DUX4 miRNA decrease endogenous DUX4 expression in muscle

[0169] AAV comprising the DUX4miRNA constructs of the disclosure are injected into patients suffering from FSHD intramuscularly (IM) or intravenously (IV). Prior to treatment and after 4, 8, 12, 16, 20, 24, 28, 32, 3640, 44, 48, and 52 weeks, the expression level of DLIX4 mRNA in muscle of the patients is measured in biopsied muscle by qRT-PCR, RNAscope, or ddPCR.

[0170] Reduced levels of DLIX4 mRNA are observed in muscles of patients treated with AAV comprising the DUX4miRNA constructs of the disclosure compared to the levels of DLIX4 mRNA in muscles of the same patients prior to treatment. Improvement in FSHD disease symptoms is also observed.

[0171] The foregoing description is given for clearness of understanding only, and no unnecessary limitations should be understood therefrom, as modifications within the scope of the invention may be apparent to those having ordinary skill in the art.

[0172] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise” and variations such as “comprises” and “comprising” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0173] Throughout the specification, where compositions are described as including components or materials, it is contemplated that the compositions can also consist essentially of, or consist of, any combination of the recited components or materials, unless described otherwise. Likewise, where methods are described as including particular steps, it is contemplated that the methods can also consist essentially of, or consist of, any combination of the recited steps, unless described otherwise. The invention illustratively disclosed herein suitably may be practiced in the absence of any element or step which is not specifically disclosed herein.

[0174] The practice of a method disclosed herein, and individual steps thereof, can be performed manually and / or with the aid of or automation provided by electronic equipment. Although processes have been described with reference to particular embodiments, a person of ordinary skill in the art will readily appreciate that other ways of performing the acts associated with the methods may be used. For example, the order of various of the steps may be changed without departing from the scope or spirit of the method, unless described otherwise. In addition, some of the individual steps can be combined, omitted, or further subdivided into additional steps.

[0175] All patents, publications and references cited herein are hereby fully incorporatedby reference. In case of conflict between the present disclosure and incorporated patents, publications and references, the present disclosure should control.

[0176] Table 4. Sequences of the disclosure.

Claims

CLAIMS\Ne claim:1 . A nucleic acid encoding a double homeobox 4 (DUX4)-targeting microRNA (miRNA) comprising: a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 6, 8, or 11 ; or the nucleotide sequence of SEQ ID NO: 6, 8, or 11 .

2. A recombinant adeno-associated virus (AAV) vector comprising the nucleic acid of claim 1.

3. The vector of claim 2, wherein the vector is a self-complementary recombinant AAV (scAAV) or a single-stranded vector (ssAAV).

4. The vector of claim 2 or 3 comprising a capsid of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAV rh.74, AAV rh.8, AAVrh.10, AAVB1 , myoAAV, AAVMYO, modified AAV9 (mAAV9), or AAV-SLB101 .

5. The vector of claim 4 comprising a capsid of modified AAV9 vector (mAAV9) or AAV- SLB101.

6. The vector of claim 5, wherein the mAAV9 capsid comprises a capsid protein comprising: an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12.

7. The vector of claim 5, wherein the AAV-SLB101 capsid comprises a capsid protein comprising: an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13.

8. A recombinant adeno-associated virus (AAV) vector comprising: a capsid of a modified AAV9 (mAAV9) or an AAV-SLB101 ; and a nucleotide sequence encoding miDUX4.405.

9. The vector of claim 8, wherein the vector comprises a mAAV9 capsid protein comprising:an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 12; or the amino acid sequence of SEQ ID NO: 12.

10. The vector of claim 8, wherein the vector comprises an AAV-SLB101 capsid protein comprising: an amino acid sequence comprising at least or about 80% sequence identity to the amino acid sequence of SEQ ID NO: 13; or the amino acid sequence of SEQ ID NO: 13.11 . The vector of any one of claims 8-10, wherein the nucleotide sequence encoding miDUX4.405 comprises: a nucleotide sequence comprising at least or about 80% sequence identity to the nucleotide sequence of SEQ ID NO: 3, 6, 8, or 11 ; or the amino acid sequence of SEQ ID NO: 3, 6, 8, or 11 .

12. A composition comprising(a) the nucleic acid of claim 1 ; or(b) the vector of any one of claims 2-11 ; and a pharmaceutically acceptable carrier.

13. A method of inhibiting and / or interfering with expression of a double homeobox 4 (DUX4) gene in a cell comprising contacting the cell with(a) the nucleic acid of claim 1 ;(b) the vector of any one of claims 2-11 ; and / or(c) the composition of claim 12.

14. The method of claim 13, wherein the cell is in a human subject.

15. A method of treating a subject having a muscular dystrophy or a cancer or a subject at risk of having a muscular dystrophy or a cancer comprising administering to the subject an effective amount of(a) the nucleic acid of claim 1 ;(b) the vector of any one of claims 2-11 ; and / or(c) the composition of claim 12.

16. The method of claim 15, wherein the muscular dystrophy is facioscapulohumeral muscular dystrophy (FSHD).

17. The method of claim 15, wherein the cancer is a sarcoma, a B-cell lymphoma, or a DUX4-expressing cancer of the adrenal, bile duct, bladder, breast, cervix, colon, endometrium, esophagus, head / neck, liver, brain, lung, mesothelium, neural crest, ovary, pancreas, prostate, kidney, skin, soft tissue, stomach, testicles, or thymus.

18. The method of any one of claims 15-17, wherein the effective amount of the vector is a dose of about 1.0x1011vg / kg to about 1 .0x1015vg / kg.

19. The method of any one of claims 15-17, wherein the effective amount of the vector is a dose of about 1 .0x1012vg / kg to about 5.0x1014vg / kg.

20. The method of any one of claims 15-17, wherein the effective amount of the vector is a dose of about 1 .0x1013vg / kg to about 1 .0x1014vg / kg.21 . The method of any one of claims 15-17, wherein the effective amount of the vector is a dose of about 3.0x1013vg / kg or about 6.0x1013vg / kg.

22. Use of(a) the nucleic acid of claim 1 ;(b) the adeno-associated virus of any one of claims 2-11 ; and / or(c) the composition of claim 12 for the preparation of a medicament for inhibiting expression of a double homeobox 4 (DUX4) gene in a cell.

23. Use of(a) the nucleic acid of claim 1 ;(b) the vector of any one of claims 2-11 ; and / or(c) the composition of claim 12 for treating or ameliorating a muscular dystrophy or a cancer.

24. Use of(a) the nucleic acid of claim 1 ;(b) the vector of any one of claims 2-11 ; and / or(c) the composition of claim 12for the preparation of a medicament for treating or ameliorating a muscular dystrophy or a cancer.

25. The use of any one of claims 22-24, wherein the muscular dystrophy is facioscapulohumeral muscular dystrophy.

26. The use of any one of claims 22-24, wherein the cancer is a sarcoma, a B-cell lymphoma, or a DUX4-expressing cancer of the adrenal, bile duct, bladder, breast, cervix, colon, endometrium, esophagus, head / neck, liver, brain, lung, mesothelium, neural crest, ovary, pancreas, prostate, kidney, skin, soft tissue, stomach, testicles, or thymus.

27. The(a) nucleic acid of claim 1 ;(b) vector of any one of claims 2-11 ;(c) composition of claim 12;(d) method of any one of claims 13-21 ; or(f) use of any one of claims 22-26, wherein the nucleic acid, vector, composition, or medicament is formulated for intramuscular injection, oral administration, subcutaneous administration or injection, intradermal administration or injection, intraventricular delivery or injection, transdermal transport, injection into the blood stream, or for aerosol administration.

Images