HIV-1 immunogens and methods of use
HIV-1 immunogens with V1 region variations and reduced N-glycosylation sites, delivered via nanoparticles, address the challenge of eliciting broadly neutralizing antibodies in outbred animal models, achieving enhanced neutralization breadth and potency.
Patent Information
- Application Number
- PCT/US2025/024298
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-12
- Filing Date
- 2025-04-11
- Publication Date
- 2025-10-16
AI Technical Summary
Existing HIV-1 vaccine strategies struggle to consistently elicit broadly neutralizing antibodies (bNAbs) in outbred animal models due to the limitations of available unmutated common ancestor (UCA) inferences and the diversity of human immunoglobulin repertoires, making it challenging to design immunogens that stimulate a broad range of V3-glycan bNAbs.
Development of HIV-1 immunogens with specific variations in the V1 region, including alterations to reduce N-glycosylation sites, and their use in combination with nanoparticle delivery systems to enhance immune response induction.
The modified HIV-1 immunogens effectively induce V3-glycan bNAbs in non-human primates, demonstrating improved breadth and potency of neutralization against diverse HIV strains.
Smart Images
Figure US2025024298_16102025_PF_FP_ABST
Abstract
Description
Attorney Docket No.046483-6285-00WO HIV-1 IMMUNOGENS AND METHODS OF USE STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0001] This invention was made with government support under AI131251 and AI100148 and awarded by the National Institutes of Health. The government has certain rights in the invention. CROSS REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to U.S. Provisional Application No.63 / 633,562, filed April 12, 2024, which is hereby incorporated by reference herein in its entirety. REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0003] This application contains a Sequence Listing, which is submitted electronically via EFS-Web as an XML Document formatted sequence listing with a file name “046483-6285- 00WO Sequence Listing.xml” having a creation date of April 11, 2025, and having a size of 629,192 bytes. The sequence listing submitted via EFS-Web is part of the specification and is herein incorporated by reference in its entirety. BACKGROUND OF THE INVENTION
[0004] Developing an efficacious HIV-1 vaccine remains a global health priority, as widespread immunization would enable sustained epidemic control. A major goal of vaccine design is the elicitation of broadly neutralizing antibodies (bNAbs), which bind one of several conserved sites on the HIV-1 Envelope (Env) glycoprotein and prevent viral entry into host cells, thereby endowing protective immunity (Pegu et al., 2019, Cell Host Microbe 26, 336-346.e333).
[0005] The Env V3-glycan patch is one of the most frequently targeted bNAb sites in natural infection in humans and macaques alike (Roark et al., 2021, Science 371; Landais et al., 2016, PLoS Pathog 12, e1005369), making it an attractive vaccine target. This epitope comprises the N332 gp120 glycan and the 324GDIR327 peptide motif at the base of the V3 loop, which contributes to the coreceptor binding site (Kong et al., 2013, Nat Struct Mol Biol 20, 796-803; D. Sok et al., 2016, Immunity 45, 31-45). V3-glycan bNAbs are one of the most potent bNAbAttorney Docket No.046483-6285-00WO classes (Burton and Hangartner, 2016, Annu Rev Immunol 34, 635-659; Haynes et al., 2023, Nat Rev Immunol 23, 142-158), often achieving geometric mean titer IC50 <0.1 µg / mL against large panels of viruses, and representatives of the broadest lineages neutralize up to 65% of circulating strains (Burton and Hangartner, 2016, Annu Rev Immunol 34, 635-659; Haynes et al., 2023, Nat Rev Immunol 23, 142-158; M. Bonsignori et al., 2017, Sci Transl Med 9; Freund et al., 2017, Sci Transl Med 9; MacLeod et al., 2016, Immunity 44, 1215-1226). Unlike bNAbs targeting other Env epitopes such as the CD4 binding site and V2-apex, V3-glycan bNAbs are immunogenetically diverse, and exhibit varied angles of approach and less reliance on rare features such as extremely long CDRH3 loops. Thus, they likely arise from a less restricted pool of germline precursors and may be easier to consistently elicit by vaccination in human populations, which have heterogenous immunoglobulin repertoires. Additionally, compared to other bNAb classes, V3-glycan bNAbs tend to require less extensive somatic hypermutation to acquire neutralization breadth (Haynes et al., 2023, Nat Rev Immunol 23, 142-158; M. Bonsignori et al., 2017, Sci Transl Med 9; MacLeod et al., 2016, Immunity 44, 1215-1226) suggesting they could be more rapidly matured once primed. Thus, V3-glycan bNAbs represent a promising vaccine target, and as such there has been substantial effort in the field to design immunization regimens that elicit these types of responses.
[0006] Thus far, common strategies have been to use directed mutagenesis, structure- guided design, and / or library screens to engineer immunogens that engage the germline-encoded precursor of a known V3-glycan bNAb lineage – this has been dubbed the “germline-targeting” or “lineage-based” approach. However, this approach is limited by the paucity of high- confidence unmutated common ancestor (UCA) inferences available for V3-glycan bNAbs. High-quality UCA inferences require longitudinal deep B cell receptor (BCR) repertoire sequencing datasets from patients who develop V3-glycan bNAbs, which are only available for a few select lineages. Additionally, engineering an immunogen to maximize affinity for a given UCA does not guarantee cross-reactivity with other UCAs, which could be disadvantageous given the diversity of naïve immunoglobulin repertoires within the human population – an ideal immunogen would stimulate as many UCAs as possible. Nevertheless, significant advances have been made using the germline-targeting approach to design and iteratively assess immunogens engineered to bind precursors of human V3-glycan bNAb lineages, including BG18 (Steichen et al., 2019, Science 366; Steichen et al., 2024, Science 384, eadj8321; Z. Xie et al., 2024, ScienceAttorney Docket No.046483-6285-00WO 384, eadk0582), DH270 (Saunders et al., 2019, Science 366; Swanson et al., 2025, Sci Transl Med 17, eadr2218), and PGT12 (Steichen et al., 2016, Immunity 45, 483-496; Escolano et al., 2016, Cell 166, 1445-1458.e1412; Escolano et al., 2019, Nature 570, 468-473; Escolano et al., 2021, Sci Transl Med 13, eabk1533). In particular, sequential vaccination with select immunogens has successfully matured V3-glycan UCAs to breadth and potency in immunoglobulin knockin mouse models (Xie et al., 2024, Science 384, eadk0582; Saunders et al., 2019, Science 366; Escolano et al., 2016, Cell 166, 1445-1458.e1412), providing proof-of- principle that these types of lineages can be boosted in vivo. However, consistent V3-glycan bNAb elicitation remains to be achieved in an outbred animal model (Steichen et al., 2024, Science 384, eadj8321; Escolano et al., 2021, Sci Transl Med 13, eabk1533).
[0007] Thus, there remains a need in the art for an outbred animal model for HIV-1 and improved HIV-1 vaccines. The present invention addresses these needs. SUMMARY OF THE INVENTION
[0008] In one embodiment, the invention relates to an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82. In one embodiment, the at least 2 variations are in the V1 region.
[0009] In one embodiment, the V1 region comprises a sequence as set forth in SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:222.
[0010] In one embodiment, at least one variation decreases the level of N-glycosylation of at least one N-linked glycosylation site (NGS) or potential N-linked glycosylation site (PNGS) within SEQ ID NO:82.
[0011] In one embodiment, at least one variation decreases the level of N-glycosylation of N133, N137, N156, or a combination thereof.
[0012] In one embodiment, the HIV-1 immunogen comprises an amino acid sequence of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQAttorney Docket No.046483-6285-00WO ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80. In one embodiment, the HIV-1 immunogen comprises a variant of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprising at least 80% sequence identity to SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80 or SEQ ID NO:82. In one embodiment, the HIV-1 immunogen comprises a fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprising at least the V1 sequence of SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ IDAttorney Docket No.046483-6285-00WO NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:222. In one embodiment, the HIV-1 immunogen comprises a fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprising at least the V1 region of SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:222, wherein the fragment comprises at least 80% sequence identity to the corresponding fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80.
[0013] In one embodiment, the invention relates to a nucleic acid molecule encoding an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82. In one embodiment, the at least 2 variations are in the V1 region.
[0014] In one embodiment, the nucleic acid molecule comprises a variant of SEQ ID NO:81, wherein the variant encodes an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82. In one embodiment, the at least 2Attorney Docket No.046483-6285-00WO variations are in the sequence encoding the V1 region.
[0015] In one embodiment, the sequence encoding the V1 region comprises a sequence as set forth in SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245 or SEQ ID NO:246.
[0016] In one embodiment, the at least one variation decreases the level of N- glycosylation of at least one N-linked glycosylation site (NGS) or potential N-linked glycosylation site (PNGS) within SEQ ID NO:82. In one embodiment, the at least one variation decreases the level of N-glycosylation of N133, N137, N156 or a combination thereof.
[0017] In one embodiment, the nucleic acid molecule comprises SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40. In one embodiment, the nucleic acid molecule comprises a variant of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprising at least 80% sequence identity to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ IDAttorney Docket No.046483-6285-00WO NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:81. In one embodiment, the nucleic acid molecule comprises a fragment of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprising at least the sequence encoding the V1 region of SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245 or SEQ ID NO:246. In one embodiment, the nucleic acid molecule comprises a fragment of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprising at least the sequence encoding the V1 region of SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245 or SEQ ID NO:246, wherein the fragment comprises at least 80% sequence identity to the corresponding fragment of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ IDAttorney Docket No.046483-6285-00WO NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40.
[0018] In one embodiment, the nucleic acid molecule is an mRNA molecule. In one embodiment, the nucleic acid molecule is a nucleoside modified mRNA molecule.
[0019] In one embodiment, the invention relates to a composition comprising an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82. In one embodiment, the composition comprises a nanoparticle. In one embodiment, the nanoparticle comprises an mi3 nanoparticle. In one embodiment, the composition is an HIV-1 vaccine. In one embodiment, the composition is an HIV-1 boosting vaccine.
[0020] In one embodiment, the invention relates to a composition comprising a nucleic acid molecule encoding an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82. In one embodiment, the composition comprises a nanoparticle. In one embodiment, the nanoparticle comprises a lipid nanoparticle (LNP). In one embodiment, the composition is an HIV-1 vaccine. In one embodiment, the composition is an HIV-1 boosting vaccine.
[0021] In one embodiment, the invention relates to a method of inducing an immune response against HIV-1 in a subject comprising administering to the subject an effective amount an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82, a nucleic acid molecule encoding the same, or a composition comprising an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82 or a nucleic acid molecule encoding the same.
[0022] In one embodiment, the composition is administered by intravenous, intradermal, subcutaneous, inhalation, intranasal, or intramuscular delivery. In one embodiment, the method comprises a single administration of an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82, aAttorney Docket No.046483-6285-00WO nucleic acid molecule encoding the same, or a composition comprising an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82 or a nucleic acid molecule encoding the same.
[0023] In one embodiment, the method comprises at least one administration of the HIV- 1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82, a nucleic acid molecule encoding the same, or a composition comprising an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82, or composition comprising a nucleic acid molecule encoding the same as a priming vaccine and a second administration of a second immunogenic agent as a boosting vaccine. In one embodiment, the priming immunogen comprises SEQ ID NO:42, SEQ ID NO: 45 or SEQ ID NO:46, or a fragment or variant thereof. In one embodiment, the priming vaccine comprises a nanoparticle comprising an HIV-1 immunogen comprising a sequence as set forth in SEQ ID NO:42, SEQ ID NO: 45 or SEQ ID NO:46, or a fragment or variant thereof. In one embodiment, the priming vaccine comprises a nucleic acid molecule comprising SEQ ID NO:2, SEQ ID NO: 5 or SEQ ID NO:6, or a fragment or variant thereof. In one embodiment, the priming vaccine comprises an mRNA molecule comprising a ribonucleotide sequence corresponding to SEQ ID NO:2, SEQ ID NO: 5 or SEQ ID NO:6, or a fragment or variant thereof. In one embodiment, the priming vaccine comprises a nanoparticle comprising an mRNA molecule comprising a ribonucleotide sequence corresponding to SEQ ID NO:2, SEQ ID NO: 5 or SEQ ID NO:6, or a fragment or variant thereof.
[0024] In one embodiment, the method comprises administration of a first immunogenic agent as a priming agent and administration of the HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82, a nucleic acid molecule encoding the same, or a composition comprising an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82, or a composition comprising a nucleic acid molecule encoding the same as a boosting vaccine. In one embodiment, the boosting immunogen comprises SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQAttorney Docket No.046483-6285-00WO ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80, or a fragment or variant thereof. In one embodiment, the boosting vaccine comprises a nanoparticle comprising an HIV-1 immunogen comprising a sequence as set forth in SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80, or a fragment or variant thereof. In one embodiment, the boosting vaccine comprises a nucleic acid molecule comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40, or a fragment or variant thereof. In one embodiment, the boosting vaccine comprises an mRNA molecule comprising a ribonucleotide sequence corresponding to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40, or a fragment or variant thereof. In one embodiment, the boosting vaccine comprises a nanoparticleAttorney Docket No.046483-6285-00WO comprising an mRNA molecule comprising a ribonucleotide sequence corresponding to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40, or a fragment or variant thereof.
[0025] In one embodiment, the method comprises at least one administration of the immunogen of the HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82, a nucleic acid molecule encoding the same, or a composition comprising an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82, or a composition comprising a nucleic acid molecule encoding the same as a priming vaccine and a second administration of the HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82, a nucleic acid molecule encoding the same, or a composition comprising an HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:82, or a composition comprising a nucleic acid molecule encoding the same as a boosting vaccine.
[0026] In one embodiment, the invention relates to a method for identifying immunogens that will be efficient for eliciting bNAbs, the method comprising: a) immunizing multiple non-human primates with an immunogen or vaccine against HIV-1; b) infecting multiple non-human primates with a simian-human immunodeficiency virus (SHIV) comprising a modified HIV-1 envelope; c) isolating and characterizing monoclonal bNAbs from the multiple infected non- human animals; d) sequencing the isolated bNAbs; e) using the sequencing data to identify common routes of antibody-EnvAttorney Docket No.046483-6285-00WO coevolution; and f) generating immunogens based on the antibody-Env coevolution dataset capable of stimulating diverse bNAbs.
[0027] In one embodiment, at least one immunogen generated in step e) serves as a candidate for vaccine formulation.
[0028] In one embodiment, at least one immunogen generated in step e) serves as an evolving immunogen for re-infection of at least one non-human primate and re-iteration of steps c) through f).
[0029] In one embodiment, the non-human primate is a rhesus macaque.
[0030] In one embodiment, the modified HIV-1 Env comprises an S375Y mutation.
[0031] In one embodiment, the modified HIV-1 Env comprises an amino acid sequence of SEQ ID NO:42, SEQ ID NO: 45 or SEQ ID NO:46 or a fragment or variant thereof. In one embodiment, the variant of SEQ ID NO:42, SEQ ID NO: 45 or SEQ ID NO:46 lacks potential N-linked glycosylation sites (PNGS) at positions 230, 241, and 344.
[0032] In one embodiment, the invention relates to an immunogenic composition comprising at least one immunogen generated by the method for identifying immunogens that will be efficient for eliciting bNAbs.
[0033] In one embodiment, the invention relates to a nucleic acid molecule encoding an HIV-1 binding molecule, wherein the nucleic acid molecule comprises: a) a sequence encoding a heavy chain comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, SEQ ID NO:111, and SEQ ID NO:113; b) a sequence encoding a light chain comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:110, SEQ ID NO:112, or SEQ ID NO:114; or c) a combination of a sequence encoding a heavy chain comprising a nucleotide sequence of SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQAttorney Docket No.046483-6285-00WO ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, SEQ ID NO:111, and SEQ ID NO:113 and a sequence encoding a light chain comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:110, SEQ ID NO:112, or SEQ ID NO:114. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] The following detailed description of embodiments of the invention will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
[0035] Figure 1A through Figure 1I depict representative data demonstrating that the SHIV.5MUT rapidly and consistently induces V3-glycan bNAbs. Figure1A depicts a representative study design. Macaques were immunized with 100 µg of protein nanoparticles adjuvanted with 750U SMNP (delivered either as a single bolus or via an escalating dose regimen over the course of two weeks) or 100 µg of mRNA-LNPs (delivered as a single bolus) at eight-week intervals. All animals were then infected with SHIV.5MUT or SHIV.BG505.N332. Figure 1B depicts a representative amino acid alignment of the BG505 versus SHIV.5MUT Env V1 regions. Differences are highlighted, and potential N-linked glycan sites (PNGS) sites are boxed. Figure 1C depicts representative data demonstrating longitudinal plasma neutralization of SHIV.5MUT, represented as log(1 / ID50). Thin lines represent values from individual animals, and thick lines represent the group mean. Figure 1D depicts representative data demonstrating plasma neutralization of the indicated viruses at the timepoint of greatest breadth within 48 weeks of infection is shown for each animal, represented as reciprocal ID50. Figure 1E depicts representative mapping of the plasma neutralizing response against HIV-1 Q23 mutants lacking key V3-glycan epitope residues, with titers expressed as log(1 / ID50). Figure 1F depicts representative data demonstrating neutralization profiles of monoclonal antibodies representing each of the twelve V3-glycan bNAb lineages isolated from SHIV.5MUT-infected macaques. Titers are expressed as IC50 values in µg / mL. Figure 1G depicts representative dataAttorney Docket No.046483-6285-00WO demonstrating neutralization breadth and potency of AM12-352 mAb against a 119-strain global virus panel, with the dendrogram illustrating the phylogenetic relatedness of tested Envs. Figure 1H depicts representative data demonstrating neutralization activity of the twelve bNAbs against a panel of Q23 mutant viruses lacking key V3-glycan epitope residues. Titers are expressed as IC50 values in µg / mL. Figure 1I depict representative data demonstrating immunogenetic characteristics of the twelve V3-glycan bNAbs. Paired, two-tailed parametric t-test. SMNP, saponin / MPLA adjuvant; LNP, lipid nanoparticle; PNGS, potential N-linked glycosylation site; WPI, weeks post-infection; RM, rhesus macaque.
[0036] Figure 2A through Figure 2F depict representative data demonstrating that SHIV.5MUT-induced V3-glycan bNAbs are structurally diverse and resemble human bNAbs. Figure 2A depicts representative CryoEM structures of six SHIV.5MUT-induced V3-glycan bNAbs in complex with 5MUT-3fill SOSIP Env trimer. The heavy chain of each bNAb is shown in a darker shade, and the light chain is shown in a lighter shade. The N332gp120glycan is modeled as cyan spheres and the conserved GDIR peptide motif is in red. Figure 2B depicts the representative potential interactions between the bNAbs and the GDIR motif (red) and N332gp120 glycan (cyan). Figure 2C depicts a representative overlay of the CDRH3 loops of PGT128 and AM12-352. Figure 2D depicts the representative heavy chain amino acid alignment of the AM12-352 lineage UCA with mature bNAbs representing each of the three sub-lineages. Differences from the UCA are highlighted. Figure 2E depicts representative data demonstrating that the indicated antibodies were produced with and without their respective CDRH2 insertions. Neutralization activity against a panel of viruses is shown, with titers expressed as IC50 values in µg / mL. Figure 2F depicts representative potential interactions between the CDRH2 insertions of AM12-352, AM12-340, and AM12-347 with the N301gp120glycan.
[0037] Figure 3A through Figure 3E depict representative data demonstrating that inference of SHIV.5MUT-induced V3-glycan bNAb UCAs suggests similar antibodies may be elicitable in humans. Figure 3A depicts a representative amino acid alignment of UCA, mature bNAb, and closest human VH / VL allele for each heavy chain and light chain. Somatically mutated residues in the mature bNAb sequences are color-coded by estimated mutation probability, as determined by ARMADiLLO. Contact residues (defined by <4Å) of the mature bNAb are indicated with blue circles. Figure 3B depicts representative kinetics of bNAb lineage expansion, quantified as number of next-generation sequences from bulk IgG+ B cells at eachAttorney Docket No.046483-6285-00WO timepoint belonging to the indicated bNAb lineage. Circles indicate sequences were obtained from PBMCs, while triangles indicate sequences were obtained from lymph nodes. Figure 3C depicts the representative number of contact residues encoded by the UCA (grey) versus number encoded by somatic mutants for the indicated bNAbs. The somatically mutated contact residues are color-coded as in Figure 3A. Figure 3D depicts the representative percent identity at the amino acid level between each UCA V gene and the closest human VH / VL allele. Figure 3E depicts the representative number of contact residues conserved in the closest human VH and VL alleles (grey) versus number not conserved (yellow) for the indicated bNAbs. HC, heavy chain; LC, light chain; NGS, next-generation sequencing; PBMC, peripheral blood mononuclear cell; LN, lymph node; UCA, unmutated common ancestor; AA, amino acid.
[0038] Figure 4A through Figure 4F depict representative data demonstrating that V1 Env selection precedes V3 selection in SHIV.5MUT-infected macaques. Fraction of viral sequences that are divergent from SHIV.5MUT in the V1 (Figure 4A) or V3 (Figure 4D) regions of Env are plotted over time. Thin lines indicate data from individual animals, and thick lines represent group averages. Figure 4B depicts the frequency of V1 variants appearing in at least 4 macaques between 8-12 weeks post-infection. “n” indicates the number of macaques in which the indicated V1 variant was identified in this time frame, and the corresponding V1 sequence is indicated to the left (aligned to 5MUT). Each dot represents the frequency of that V1 variant occurring in a given animal, stratified by bNAb status (red = bNAb). Figure 4C depicts representative data demonstrating neutralization of representative common V1 variant viruses by V3-glycan bNAbs, represented as log(IC50). Figure 4E depicts a representative LOGO plot from animal V635, showing diversity in Env V1 (left) and V3 (right) regions over the course of infection. Figure 4F depicts representative mass spectroscopy-based site-specific glycan analysis of MD39-stabilized 5MUT and BG505.N332 SOSIP trimers. Paired, two-tailed parametric t-test (Figure 4C).
[0039] Figure 5A through Figure 5C depict data demonstrating that SHIV.5MUT elicits V3-glycan bNAbs via a two-step process. Figure 5A depicts a representative schematic of the model of SHIV.5MUT-mediated V3-glycan bNAb elicitation. Figure 5B depicts representative data demonstrating plasma neutralization of the indicated V1 variant viruses at week 12 post- infection, with titers represented as log(1 / ID50). Figure 5C depicts representative data demonstrating neutralization activity of two V1-directed antibodies, represented as IC50 inAttorney Docket No.046483-6285-00WO µg / mL. Paired, two-tailed parametric t-test (Figure 5B).
[0040] Figure 6A and Figure 6B depict data demonstrating that priming immunogens based on Env-antibody coevolution bind to multiple human and macaque UCAs. Figure 6A depicts representative data demonstrating binding of the indicated antibodies to cell-surface expressed Envs. mRNA encoding the indicated Envs was transfected into 293F cells and binding was queried by flow cytometry. Binding is quantified as fold-change in mean fluorescence intensity over mock-transfected cells, and data points two-fold or greater are colored. Figure 6B depicts representative data demonstrating the average V1 length (top) and average number of PNGSs (bottom) in V1 over time. Thin lines indicate data from individual animals, and thick lines represent group averages. UCA, unmutated common ancestor; MFI, mean fluorescence intensity; PNGS, potential N-linked glycosylation site.
[0041] Figure 7A through Figure 7D depict data demonstrating that RC1 and 11MUTB mRNA immunization induces robust autologous neutralizing responses. Figure 7A depicts a representative amino acid alignment of the mRNA immunogens used in this study. Figure 7B depicts representative data demonstrating plasma neutralization of the indicated virus after immunization, represented as log(1 / ID50) (left, center) or reciprocal ID50(right). Figure 7C depicts representative data demonstrating antigenic profiling of SHIV.5MUT and SHIV.BG505.N332 was assessed by testing neutralization of a panel of conformation-sensitive and broadly neutralizing antibodies (bNAb). Figure 7D depicts representative data demonstrating longitudinal viral load in SHIV.5MUT-infected macaques, represented as vRNA copies / mL (left). Circles indicate animals that were CD8-depleted 2-3 days prior to infection, and triangles indicate animals that were not. Average viral load between weeks 12-48 post-infection is shown (right), quantified as log(mean viral load). Average autologous neutralization titer, represented as mean(log(IC50)), is plotted (right). Parametric one-way ANOVA with Tukey’s correction for multiple comparisons (Figure 7B). Parametric unpaired two-tailed t-test (Figure 7D). WPI, weeks post-infection.
[0042] Figure 8A and Figure 8B depict exemplary experimental data demonstrating isolation of candidate bNAbs from SHIV.5MUT-infected macaques. Figure 8A depicts the representative gating strategy for the fluorescence-activated cell sorting used to isolate Env- binding B cells. Sorted Live CD3-CD8a-CD14-CD16-CD20+IgG+Env++B cells. Figure 8B depicts data demonstrating that monoclonal antibodies were synthesized and screened forAttorney Docket No.046483-6285-00WO neutralization activity, expressed as IC50 in µg / mL. Env probes that were used to isolate each B cell are listed. Within each animal, antibody names are color-coded by lineage.
[0043] Figure 9A and Figure 9B depict exemplary experimental data demonstrating bNAb lineage. Figure 9A depicts representative data demonstrating the carriage of an N301 PNGS or a N332 / N334 PNGS in 131 HIV-1 strains, comprising the 119-virus global panel plus 12 additional viruses. Figure 8B depicts representative data demonstrating neutralization mapping of representative members of each sub-lineage from the AM12-352 V3-glycan bNAb lineage. Neutralization activity against a panel of Q23 and CAP256SU mutant viruses lacking key residues in the V3-glycan epitope is shown, with titers expressed as IC50in µg / mL.
[0044] Figure 10 depicts exemplary experimental data demonstrating that SHIV.5MUT exhibits remarkable V1 and V3 selection in vivo, unlike SHIV.BG505.N332. Hamming distance from the infecting SHIV.5MUT or SHIV.BG505.N332 was assessed over time across Env using a sliding window of 10 amino acids. Hamming distance area under the curve (top) reflects the magnitude of difference in selection between SHIV.5MUT and SHIV.BG505.N332, while significance (bottom) indicates the statistical significance at each window.
[0045] Figure 11 depicts exemplary experimental data demonstrating the glycosylation of N133 and N137 in 5MUT. Mass spectroscopy-based site-specific glycan analysis of MD39- stabilized BG505.N332, BG505.N332.N136P, 5MUT, 5MUT.P136N, del4, del8, and 5MUT- 3fill SOSIP proteins.
[0046] Figure 12A and Figure 12B depict exemplary experimental data demonstrating that early intermediate antibodies in the AM12-340 and AJ09-80 lineages bind priming immunogens. Figure 12A depicts a representative amino acid alignment of inferred ancestors in the AJ09-80 and AM12-340 lineages. Figure 12B depicts the representative heavy and light chain sequences selected for synthesis and artificially paired. AJ09-80 intermediate heavy chains were paired with intermediate light chains from a similar developmental stage. AM12-340 intermediate heavy chains were paired with the AM12-340-UCA light chain. Binding to a panel of mRNA-encoded immunogens expressed on the surface of 293F cells was assessed by flow cytometry. Binding is quantified as fold-change in mean fluorescence intensity over mock- transfected cells, and data points meeting an arbitrary cutoff of two-fold or greater are colored.
[0047] Figure 13 depicts a representative alignment of V1 regions from BG505 variants.Attorney Docket No.046483-6285-00WO DETAILED DESCRIPTION
[0048] An outbred animal model has been developed that can be used to repeatably induce broadly neutralizing antibodies (bNAbs) against HIV-1 immunogens. The animal model enabled consistent V3-glycan bNAb elicitation in outbred animals, enabling detailed analysis of Env-antibody coevolution that can serve as a blueprint for vaccine design.
[0049] This disclosure also provides immunogens that facilitate V3-glycan bNAb elicitation. Definitions
[0050] As used in this document, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used here.
[0051] The term “and / or” means any one of the items, any combination of the items, or all of the items with which this term is associated.
[0052] The compositions of the present invention can comprise, consist essentially of, or consist of the claimed ingredients. The words “comprising” (and any form of comprising, such as “comprise” and “comprises”),“having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
[0053] The term “treating” or “treatment” refers to administration of a compound or agent to a subject who has a disorder or is at risk of developing the disorder with the purpose to cure, alleviate, relieve, remedy, delay the onset of, prevent, or ameliorate the disorder, the symptom of the disorder, the disease state secondary to the disorder, or the predisposition toward the disorder.
[0054] The term “about” generally refers to plus or minus 10% of the indicated number. For example, “about 10%” may indicate a range of 9% to 11%, and “about 1” may mean from 0.9- 1.1. Other meanings of “about” may be apparent from the context, such as rounding off, so, for example, “about 1” may also mean from 0.5 to 1.4.
[0055] “Potential N-linked Glycosylation site” refers to an amino acid sequence on the surface of a polypeptide, such as a protein, which accommodates the attachment of an N-glycan.Attorney Docket No.046483-6285-00WO A potential N-linked glycosylation site is triplet sequence of NXS / T in which N is asparagine, X is any residues except proline, S / T means serine or threonine. An N-glycan is a polysaccharide or oligosaccharide. Glycan may also be used to refer to the carbohydrate portion of a glycoconjugate, such as a glycoprotein, glycolipid, or a proteoglycan.
[0056] “Immunogenic polypeptide” refers to a protein or a portion thereof that is capable of inducing an immune response in a mammal, such as a mammal infected or at risk of infection with a pathogen. Administration of an immunogenic polypeptide derived from a pathogen of interest that inducing an immune response. Administration of an immunogenic polypeptide can lead to protective immunity against a pathogen of interest. In some examples, an immunogenic polypeptide is an antigen that is resurfaced to focus immunogenicity to a target epitope. An “immunogenic gpl20 polypeptide” is gpl20 molecule, a resurfaced gpl20 molecule, or a portion thereof capable of inducing an immune response in a mammal, such as a mammal with or without an HIV-1 infection. Administration of an immunogenic gpl20 polypeptide that induces an immune response can lead to protective immunity against HIV-1. “Immune response” refers to a response of a cell of the immune system, such as a B cell, T cell, or monocyte, to a stimulus. In one embodiment, the response is specific for a particular antigen (an “antigen-specific response”). In one embodiment, an immune response is a T cell response, such as a CD4+ response or a CD8+ response. In another embodiment, the response is a B cell response and results in the production of specific antibodies.
[0057] “Isolated” refers to an “isolated” biological component (such as a protein, for example, a disclosed antigen or nucleic acid encoding such an antigen) has been substantially separated or purified away from other biological components in which the component naturally occurs, such as other chromosomal and extrachromosomal DNA, RNA, and proteins. Proteins, peptides, and nucleic acids that have been “isolated” include proteins purified by standard purification methods. The term also embraces proteins or peptides prepared by recombinant expression in a host cell as well as chemically synthesized proteins, peptides, and nucleic acid molecules. Isolated (or purified) does not require absolute purity, and can include protein, peptide, or nucleic acid molecules that are at least 50% isolated, such as at least 75%, 80%, 90%, 95%, 98%, 99%, or even 99.9% isolated.
[0058] As used herein, the term “effective amount” in the context of the administration of a therapy to a subject refers to the amount of a therapy that achieves a desired prophylactic orAttorney Docket No.046483-6285-00WO therapeutic effect.
[0059] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (for example, rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA produced by that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and non-coding strand, used as the template for transcription, of a gene or cDNA can be referred to as encoding the protein or other product of that gene or cDNA. Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns. In some examples, a nucleic acid encodes a disclosed antigen. “Recombinant nucleic acid” refers to a nucleic acid having nucleotide sequences that are not naturally joined together. This includes nucleic acid vectors comprising an amplified or assembled nucleic acid which can be used to transform a suitable host cell. A host cell that comprises the recombinant nucleic acid is referred to as a “recombinant host cell.” The gene is then expressed in the recombinant host cell to produce, such as a “recombinant polypeptide.” A recombinant nucleic acid may serve a non-coding function (such as a promoter, origin of replication, ribosome-binding site, etc.) as well.
[0060] “Sequence identity” refers to the percentage of residues in the polynucleotide or polypeptide sequence variant that are identical to the non-variant sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. In some embodiments, polynucleotide and polypeptide variants have at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% polynucleotide or polypeptide sequence identity with a polynucleotide or polypeptide described herein.
[0061] The terms “specific binding,” “selective binding,” “selectively binds,” and “specifically binds,” refer to antibody binding to an epitope on a predetermined antigen but not to other antigens. Typically, the antibody binds with an equilibrium dissociation constant (KD) ofAttorney Docket No.046483-6285-00WO less than 106M, such as less than 107M, 108M, 109M or 1010M or even lower.
[0062] The terms “prevent,” “preventing,” “prevention,” “prophylactic treatment” and the like refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition.
[0063] The term “subject” refers to a human and a non-human animal. Examples of a non-human animal include all vertebrates, e.g., mammals, such as non-human mammals, non- human primates (particularly higher primates), dog, rodent (e.g. , mouse or rat), guinea pig, cat, and rabbit, and non-mammals, such as birds, amphibians, reptiles, etc. In one embodiment, the subject is a human. In another embodiment, the subject is an experimental, non-human animal or animal suitable as a disease model.
[0064] Variant sequences include those which have been modified from a parental sequence by having at least one substitution, insertion, deletion or modification of a nucleotide or amino acid residue.
[0065] Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
[0066] As used herein, the term “treat,” “treating,” and “treatment” refer to therapeutic or preventative measures described herein. The methods of “treatment” employ administration of an antibody to a subject having a disease or disorder, or predisposed to having such a disease or disorder, in order to prevent, cure, delay, reduce the severity of, or ameliorate one or more symptoms of the disease or disorder or recurring disease or disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment.
[0067] As disclosed herein, a number of ranges of values are provided. It is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither, or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both ofAttorney Docket No.046483-6285-00WO those included limits are also included in the invention. Description
[0068] gpl20 is a subunit of the Envelope (Env) protein from human immunodeficiency virus (HIV-1). The mature gpl20 wild-type polypeptides have about 500 amino acids in the primary sequence. The gpl20 is heavily N-glycosylated giving rise to an apparent molecular weight of 120 kD. The polypeptide comprises five conserved regions (C1-C5) and five regions of higher variability (V1-V5). Immunogenic Compositions
[0069] The present invention provides a composition that induces an immune response in a subject against HIV-1. In one embodiment, the invention comprises an HIV-1 immunogen or a nucleic acid molecule encoding an HIV-1 immunogen.
[0070] In some embodiments, the HIV-1 immunogen comprises a variant of SEQ ID NO:82, comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acid variations relative to SEQ ID NO:82. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 variations amino acid variations are within the V1 region. The V1 region comprises amino acids 131 to 157 (inclusively) relative to the reference sequence HXB2 or amino acids 131 to 149 (inclusively) relative to SEQ ID NO:82. In some embodiments, the V1 region of SEQ ID NO:82 comprises SEQ ID NO:201. In some embodiments, the HIV-1 immunogen comprises a variant of SEQ ID NO:82 comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acid variations in the V1 region relative to SEQ ID NO:201. Figure 13 depicts a representative alignment of V1 regions from BG505 variants. In some embodiments, the variant of SEQ ID NO:82 comprises a V1 region comprising a sequence of SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:222.
[0071] In one embodiment at least one variation decreases glycosylation of at least one N-linked glycosylation site (NGS) or potential N-linked glycosylation site (PNGS) within SEQAttorney Docket No.046483-6285-00WO ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within the V1 region. For example, in one embodiment, the variation in the V1 region decreases the level of N-glycosylation of N133, N137, N156 or a combination thereof.
[0072] In one embodiment at least one variation introduces at least one N-linked glycosylation site (NGS) or potential N-linked glycosylation site (PNGS) within SEQ ID NO:82. In one embodiment the variation introduces PNGS at position 230, 241, 344 or a combination thereof. In some embodiments, the immunogen includes variations which introduces 3 PNGS at positions 230, 241, and 344 (referred to herein as “3fill”).
[0073] In some embodiments, the variant of SEQ ID NO:82 comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:82. In some embodiments, the variant of SEQ ID NO:82 comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:82, and further comprises at least one variation in the V1 region. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within SEQ ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within the V1 region. For example, in one embodiment, the variation in the V1 region decreases the level of N-glycosylation of N133, N137, N156 or a combination thereof. In some embodiments, the variant of SEQ ID NO:82 comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:82, and further comprises a V1 region comprising a sequence of SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:222.
[0074] In some embodiments, the HIV-1 immunogen comprises a fragment of SEQ ID NO:82, comprising at least the V1 region, wherein the fragment of SEQ ID NO:82 further comprises at least one variation relative to SEQ ID NO:82. In some embodiments, the fragment of SEQ ID NO:82 comprises at least one variation within the V1 region of SEQ ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within SEQ ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS orAttorney Docket No.046483-6285-00WO PNGS within the V1 region. For example, in one embodiment, the variation in the V1 region decreases the level of N-glycosylation of N133, N137, N156 or a combination thereof.
[0075] In some embodiments, the HIV-1 immunogen may include one or more modifications in the Env V3 region of gpl20. In some embodiments, the protein constructs are stabilized with MD39 mutations (Steichen et al., 2016, Immunity 45, 483-496) and potential N- linked glycosylation sites (PNGS) are introduced at gp120 positions 230, 241, and 344 (“3fill”) to shield immunodominant off-target glycan hole (Escolano et al., 2021, Sci Transl Med 13, eabk1533; Klasse et al., 2018, PLoS Pathog 14, e1006913, Wrapp et al., 2023, J Virol 97, e0167322).
[0076] In some embodiments, the HIV-1 immunogen comprises sequence of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, or a fragment or variant thereof. In some embodiments, the variant of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ IDAttorney Docket No.046483-6285-00WO NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80. In some embodiments, the variant of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprises at least one variation relative to the parental sequence as set forth in SEQ ID NO:82.
[0077] In some embodiments, the fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprises at least 60%, 65%, 70%, 75%, 80%, 85%, 90% or more than 90% of the full length sequence of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80, or a variant thereof. In some embodiments, the fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ IDAttorney Docket No.046483-6285-00WO NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprises at least one variation of the parental sequence as set forth in SEQ ID NO:82. In some embodiments, the fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprises a V1 sequence of SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:222.
[0078] In one embodiment, the invention comprises a nucleic acid molecule encoding an HIV-1 immunogen. In some embodiments, the nucleic acid molecule is a DNA molecule. In some embodiments, the nucleic acid molecule is an RNA molecule. In some embodiments, the nucleic acid molecule is an mRNA molecule.
[0079] In some embodiments, the nucleic acid molecule encodes a variant of SEQ ID NO:82, comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acid variations relative to SEQ ID NO:82. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 variations amino acid variations relative to SEQ ID NO:82 are within the V1 region of SEQ ID NO:82, comprising amino acids 131 to 149 (inclusively) of SEQ ID NO:82 (CTNVTNNITDDMRGELKNC; SEQ ID NO:201). In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within SEQ ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within the V1 region. For example, in one embodiment, the variation in the V1 region decreases the level of N- glycosylation of N133, N137, N156 or a combination thereof. In some embodiments, the V1Attorney Docket No.046483-6285-00WO region comprises SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:222
[0080] In some embodiments, the nucleic acid molecule encodes a variant of SEQ ID NO:82 comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:82. In some embodiments, the nucleic acid molecule encodes a variant of SEQ ID NO:82 comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:82, and further comprises at least one variation in the V1 region. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within SEQ ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within the V1 region. For example, in one embodiment, the variation in the V1 region decrease the level of glycosylation of N133, N137, N156 or a combination thereof.
[0081] In some embodiments, the nucleic acid molecule encodes a HIV-1 immunogen comprising a fragment of SEQ ID NO:82, comprising at least the V1 region, wherein the fragment of SEQ ID NO:82 further comprises at least one variation SEQ ID NO:82. In some embodiments, the fragment of SEQ ID NO:82 comprises at least one variation within the V1 region of SEQ ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within SEQ ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within the V1 region. For example, in one embodiment, the variation in the V1 region decreases the level of N-glycosylation of N133, N137, N156 or a combination thereof.
[0082] In some embodiments, the HIV-1 immunogen may include one or more modifications in the Env V3 region of gpl20. In some embodiments, the nucleic acid molecule encodes a protein construct stabilized with MD39 mutations and having potential N-linked glycosylation sites (PNGS) introduced at gp120 positions 230, 241, and 344 (“3fill”) to shield immunodominant off-target epitopes. In some embodiments, the membrane-bound mRNA immunogens are further engineered to have a HLA-DR signal peptide, a flexible (GGGGS)2linker in place of the furin cleavage site, two helix-breaking prolines (Wrapp et al., 2023, J VirolAttorney Docket No.046483-6285-00WO 97, e0167322), and a truncated SIVmac cytoplasmic tail with an endocytosis knockout mutation.
[0083] In some embodiments, the nucleic acid molecule encodes an HIV-1 immunogen comprising a sequence of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80, or a fragment or variant thereof. In some embodiments, the variant of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80. In some embodiments, the variant of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ IDAttorney Docket No.046483-6285-00WO NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprises at least one variation relative to the parental sequence as set forth in SEQ ID NO:82.
[0084] In some embodiments, the nucleic acid molecule encodes a fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80, wherein the fragment comprises at least 60%, 65%, 70%, 75%, 80%, 85%, 90% or more than 90% of the full length sequence of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80, or a variant thereof. In some embodiments, the nucleic acid molecule encodes a fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprising at least one variation of the parental sequence as set forth in SEQ ID NO:82. In some embodiments, the fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52,Attorney Docket No.046483-6285-00WO SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprises at least the V1 region of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80.
[0085] In some embodiments, the nucleic acid molecule encodes a variant of SEQ ID NO:82, comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acid variations relative to SEQ ID NO:82. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 variations amino acid variations relative to SEQ ID NO:82 are within the V1 region of SEQ ID NO:82, comprising amino acids 131 to 149 (inclusively) of SEQ ID NO:82 (CTNVTNNITDDMRGELKNC; SEQ ID NO:201). In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within SEQ ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within the V1 region. For example, in one embodiment, the variation in the V1 region decreases the level of N- glycosylation of N133, N137, N156 or a combination thereof.
[0086] In some embodiments, the nucleic acid molecule comprises a variant of SEQ ID NO:81 comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:81. In some embodiments, the nucleic acid molecule encodes a variant of SEQ ID NO:81 comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:81, and further encodes a V1 region comprising a sequence of SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ IDAttorney Docket No.046483-6285-00WO NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:222. In some embodiments, the nucleic acid molecule comprises a variant of SEQ ID NO:81 comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:81. In some embodiments, the nucleic acid molecule encodes a variant of SEQ ID NO:81 comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:81, and further comprises a V1 coding sequence of SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245 or SEQ ID NO:246. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within the V1 region. For example, in one embodiment, the variation in the V1 region decreases the level of N-glycosylation of N133, N137, N156 or a combination thereof.
[0087] In some embodiments, the nucleic acid molecule comprises a fragment of SEQ ID NO:81, comprising at least the sequence encoding the V1 region, wherein the fragment of SEQ ID NO:81 further encodes at least one variation with respect to SEQ ID NO:82. In some embodiments, the fragment of SEQ ID NO:81 encodes at least one variation within the V1 region of SEQ ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within SEQ ID NO:82. In one embodiment the variation decreases glycosylation of at least one NGS or PNGS within the V1 region. For example, in one embodiment, the variation in the V1 region decreases the level of N-glycosylation of N133, N137, N156, or a combination thereof.
[0088] In some embodiments, the nucleic acid molecule comprises a sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24,Attorney Docket No.046483-6285-00WO SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40, or a fragment or variant thereof. In some embodiments, the variant of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more than 99% identity to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40. In some embodiments, the variant of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprises at least one variation with respect to SEQ ID NO:81. In some embodiments, the variant of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22,Attorney Docket No.046483-6285-00WO SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprises at least the sequence encoding the V1 sequence of SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245 or SEQ ID NO:246. In some embodiments, the fragment of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprises at least 60%, 65%, 70%, 75%, 80%, 85%, 90% or more than 90% of the full length sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40, or a variant thereof. In some embodiments, the fragment of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ IDAttorney Docket No.046483-6285-00WO NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprises at least the sequence encoding the V1 sequence of SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245 or SEQ ID NO:246. Table 1: Description of SHIV Constructs* Nucleic Acid Amino acid Name Alias Strain Stabilization GL bnAb Sequence Sequence Targeting Target SEQ ID NO: 1 SEQ ID NO: pUC-ccTEV-RC1.3Fill.PP- RC1 BG505 MD39, SOS, RC1 V3- 41 A101 DS, IP, PP glycan SEQ ID NO: 2 SEQ ID NO: pUC-ccTEV- 5Mut BG505 MD39, SOS, 5Mut V3- 42 BG505.5Mut.MD39.3Fill- DS, IP, PP glycan A101 SEQ ID NO: 3 SEQ ID NO: bg505.md39.n332.3fill BG505.N332. BG505 MD39, SOS, V3- 43 3Fill DS, IP, PP glycan SEQ ID NO: 4 SEQ ID NO: pUC-ccTEV- BG505 MD39, SOS, 4del V3- 44 BG505.MD39.3Fill-A101 DS, IP, PP glycan SEQ ID NO: 5 SEQ ID NO: pUC-ccTEV- 4del BG505 MD39, SOS, 4del V3- 45 BG505.5Mut.d135-138- DS, IP, PP glycan A101 SEQ ID NO: 6 SEQ ID NO: pUC-ccTEV- 8del BG505 MD39, SOS, 8del V3- 46 BG505.5Mut.d132-139- DS, IP, PP glycan A101 SEQ ID NO: 7 SEQ ID NO: pUC-ccTEV- 8del-E BG505 MD39, SOS, 8del V3- 47 BG505.5Mut.d132- DS, IP, PP glycan 139.R143E-A101 SEQ ID NO: 8 SEQ ID NO: pUC-ccTEV- 8del-G BG505 MD39, SOS, 8del V3- 48 BG505.5Mut.d132- DS, IP, PP glycan 139.R143G-A101 SEQ ID NO: 9 SEQ ID NO: pUC-ccTEV- SK BG505 MD39, SOS, 5Mut V3- 49 BG505.5Mut.SK-A101 DS, IP, PP glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV- 5Mut.N133.1 BG505 MD39, SOS, 5Mut.N133 V3- 10 50 5Mut.N133.137KO-A101 37KO DS, IP, PP +137KO glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV- 5Mut.N133K BG505 MD39, SOS, 5Mut.N133 V3- 11 51 5Mut.N133KO-A101 O DS, IP, PP KO glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV- 5Mut.N137K BG505 MD39, SOS, 5Mut.N137 V3- 12 52 5Mut.N137KO-A101 O DS, IP, PP KO glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV- Alt4del BG505 MD39, SOS, Alt.4del V3- 13 53 BG505.MD39.3Fill.d134- DS, IP, PP glycan 137-A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV- 3del BG505 MD39, SOS, 3del V3- 14 54 BG505.MD39.3Fill.d137- DS, IP, PP glycan 139-A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV-5Mut.R327K- 5MutGDIK BG505 MD39, SOS, 5Mut.R327 V3- 15 55 A101 DS, IP, PP K glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV-BG505.d132- 8delGDIK BG505 MD39, SOS, 8del.R327K V3- 16 56 139.R327K-A101 DS, IP, PP glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV-BG505.d135- 4delGDIK BG505 MD39, SOS, 4del.R327K V3- 17 57 138.R327K-A101 DS, IP, PP glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV-BG505.d135- 4del.GNIK BG505 MD39, SOS, 4del V3 V3- 18 58 138.GNIK-A101 DS, IP, PP Variant glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV-BG505.d132- 8del.GNIK BG505 MD39, SOS, 8del V3 V3- 19 59 139.GNIK-A101 DS, IP, PP Variant glycanAttorney Docket No.046483-6285-00WO SEQ ID NO: SEQ ID NO: 5Mut.GNIK 5MutGNIK BG505 MD39, SOS, 5Mut V3 V3- 20 60 DS, IP, PP variant glycan SEQ ID NO: SEQ ID NO: 5Mut.GNIR 5MutGNIR BG505 MD39, SOS, 5Mut V3 V3- 21 61 DS, IP, PP variant glycan SEQ ID NO: SEQ ID NO: BG505.d132-139.GNIR 8delGNIR BG505 MD39, SOS, 8del V3 V3- 22 62 DS, IP, PP Variant glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV-BG505.d135- 4del.GNIR BG505 MD39, SOS, 4del V3 V3- 23 63 138.GNIR-A101 DS, IP, PP Variant glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV-BG505.d135- 4del.330Y BG505 MD39, SOS, 4del V3 V3- 24 64 138.H330Y-A101 DS, IP, PP Variant glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV-BG505.d132- 8del.330Y BG505 MD39, SOS, 8del V3 V3- 25 65 139.H330Y-A101 DS, IP, PP Variant glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV-5Mut.H330Y- 5Mut.330Y BG505 MD39, SOS, 5Mut V3 V3- 26 66 A101 DS, IP, PP Variant glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV- 5Mut.136S BG505 MD39, SOS, 5Mut V1 V3- 27 67 BG505.5Mut.MD39.3Fill.P DS, IP, PP Variant glycan 136S-A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV- 5Mut.C3V4.S BG505 MD39, SOS, 5Mut V3- 28 68 BG505.5Mut.MD39.3Fill.C hift DS, IP, PP glycan 3V4shift-A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV- 5Mut.136S.C BG505 MD39, SOS, 5Mut.P136S V3- 29 69 BG505.5Mut.MD39.3Fill.P 3V4.Shift DS, IP, PP glycan 136S.C3V4shift-A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV- 231965.c1 231965.c mRNA5 V2-apex 30 70 231965.c1.mRNA5.TK - 1 A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV- THRO.18 THRO.1 mRNA5 V2-apex 31 71 THRO.18.mRNA5.TK- 8 A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV- TRO.11 TRO.11 mRNA5 V3- 32 72 TRO.11.TK.mRNA5-A101 glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV-JR- JRFL JRFL mRNA5 V3- 33 73 FL.RnS.TK.mRNA5-A101 glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV- YU2 YU2 mRNA5 V3- 34 74 YU2.TK.mRNA5-A101 glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV- TRJO.58 TRJO.58 mRNA5 V3- 35 75 TRJO.58.TK.mRNA5- glycan A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV- DJ263.8 DJ263.8 mRNA5 V3- 36 76 DJ263.8.TK.mRNA5-A101 glycan SEQ ID NO: SEQ ID NO: pUC-ccTEV- 6101.1 6101.1 mRNA5 V3- 37 77 6101.1.TK.160fill.mRNA5- glycan A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV- CAAN5342.A CAAN53 mRNA5 V3- 38 78 CAAN5342.A2.TK.mRNA 2 42.A2 glycan 5-A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV- BG505 MD39, SOS, V3- 39 79 BG505.N332.MD39.noFill- DS, IP, PP glycan A101 SEQ ID NO: SEQ ID NO: pUC-ccTEV- 11MutB BG505 MD39, SOS, 11MutB V3- 40 80 11MutB.3Fill.PP-A101 DS, IP, PP glycan SEQ ID NO: SEQ ID pUC-ccTEV- BG505.C3V4. BG505 195 NO:196 BG505.N332.C3V4shift- Shift A101 SEQ ID NO: SEQ ID pUC-ccTEV-5Mut.d135- 4del.C3V4.Sh BG505 197 NO:198 138.C3V4shift-A101 ift *Expression for all constructs - HLADR.SP, SIVmacCT, Y712I Table 2. Parental Constructs SEQ ID NO DescriptionAttorney Docket No.046483-6285-00WO SEQ ID NO: 81 (DNA) pUC-ccTEV-BG505.3Fill.mRNA5-A101 SEQ ID NO: 82 (amino acid) BG505.3Fill.mRNA5 translation SEQ ID NO: 289 (plasmid) pUC-ccTEV-BG505.3Fill.mRNA5-A101 Table 3: V1 sequences Name V1 amino acid sequence SEQ ID NO: V1 nucleotide sequence SEQ ID NO: pUC-ccTEV- CTNYAPNLLSNMRGEL 199 tgcaccaactacgcccccaacctgctgtccaacatgcg 246 RC1.3Fill.PP-A101 KQC cggcgagctgaagcagtgc pUC-ccTEV- CTNYTPNLTNDMRGEL 200 tgcaccaactacacccccaacctgaccaacgacatgcg 223 BG505.5Mut.MD39.3Fill KNC cggcgagctgaagaactgc -A101 bg505.md39.n332.3fill CTNVTNNITDDMRGEL 201 tgcaccaacgtgaccaacaacatcaccgacgacatgcg 224 KNC cggcgagctgaagaactgc pUC-ccTEV- CTNVTNNITDDMRGEL 201 tgcaccaacgtgaccaacaacatcaccgacgacatgcg 224 BG505.MD39.3Fill- KNC cggcgagctgaagaactgc A101 pUC-ccTEV- CTNYTNDMRGELKNC 202 tgcaccaactacaccaacgacatgcgcggcgagctga 225 BG505.5Mut.d135-138- agaactgc A101 pUC-ccTEV- CNDMRGELKNC 203 tgcaacgacatgcgcggcgagctgaagaactgc 226 BG505.5Mut.d132-139- A101 pUC-ccTEV- CNDMEGELKNC 204 tgcaacgacatggagggcgagctgaagaactgc 227 BG505.5Mut.d132- 139.R143E-A101 pUC-ccTEV- CNDMGGELKNC 205 tgcaacgacatgggcggcgagctgaagaactgc 228 BG505.5Mut.d132- 139.R143G-A101 pUC-ccTEV- CTNYTSNLTNDMKGEL 206 tgcaccaactacacctccaacctgaccaacgacatgaa 229 BG505.5Mut.SK-A101 KNC gggcgagctgaagaactgc pUC-ccTEV- CTQYTPQLTNDMRGEL 207 tgcacccagtacaccccccagctgaccaacgacatgcg 230 5Mut.N133.137KO-A101 KNC cggcgagctgaagaactgc pUC-ccTEV- CTQYTPNLTNDMRGEL 208 tgcacccagtacacccccaacctgaccaacgacatgcg 231 5Mut.N133KO-A101 KNC cggcgagctgaagaactgc pUC-ccTEV- CTNYTPQLTNDMRGEL 209 tgcaccaactacaccccccagctgaccaacgacatgcg 232 5Mut.N137KO-A101 KNC cggcgagctgaagaactgc pUC-ccTEV- CTNLTNDMRGELKNC 210 tgcaccaacctgaccaacgacatgcgcggcgagctga 233 BG505.MD39.3Fill.d134 agaactgc -137-A101 pUC-ccTEV- CTNYTPNDMRGELKNC 211 tgcaccaactacacccccaacgacatgcgcggcgagc 234 BG505.MD39.3Fill.d137 tgaagaactgc -139-A101 pUC-ccTEV- CTNYTPNLTNDMRGEL 200 tgcaccaactacacccccaacctgaccaacgacatgcg 223 5Mut.R327K-A101 KNC cggcgagctgaagaactgc pUC-ccTEV- CNDMRGELKNC 203 tgcaacgacatgcgcggcgagctgaagaactgc 226 BG505.d132-139.R327K- A101 pUC-ccTEV- CTNYTNDMRGELKNC 202 tgcaccaactacaccaacgacatgcgcggcgagctga 225 BG505.d135-138.R327K- agaactgc A101 pUC-ccTEV- CTNYTNDMRGELKNC 202 tgcaccaactacaccaacgacatgcgcggcgagctga 225 BG505.d135-138.GNIK- agaactgc A101 pUC-ccTEV- CNDMRGELKNC 203 tgcaacgacatgcgcggcgagctgaagaactgc 226 BG505.d132-139.GNIK- A101 5Mut.GNIK CTNYTPNLTNDMRGEL 200 tgcaccaactacacccccaacctgaccaacgacatgcg 223 KNC cggcgagctgaagaactgcAttorney Docket No.046483-6285-00WO 5Mut.GNIR CTNYTPNLTNDMRGEL 200 tgcaccaactacacccccaacctgaccaacgacatgcg 223 KNC cggcgagctgaagaactgc BG505.d132-139.GNIR CNDMRGELKNC 203 tgcaacgacatgcgcggcgagctgaagaactgc 226 pUC-ccTEV- CTNYTNDMRGELKNC 202 tgcaccaactacaccaacgacatgcgcggcgagctga 225 BG505.d135-138.GNIR- agaactgc A101 pUC-ccTEV- CTNYTNDMRGELKNC 202 tgcaccaactacaccaacgacatgcgcggcgagctga 225 BG505.d135- agaactgc 138.H330Y-A101 pUC-ccTEV- CNDMRGELKNC 203 tgcaacgacatgcgcggcgagctgaagaactgc 226 BG505.d132- 139.H330Y-A101 pUC-ccTEV- CTNYTPNLTNDMRGEL 200 tgcaccaactacacccccaacctgaccaacgacatgcg 223 5Mut.H330Y-A101 KNC cggcgagctgaagaactgc pUC-ccTEV- CTNYTSNLTNDMRGEL 212 tgcaccaactacacctccaacctgaccaacgacatgcg 235 BG505.5Mut.MD39.3Fill KNC cggcgagctgaagaactgc .P136S-A101 pUC-ccTEV- CTNYTPNLTNDMRGEL 200 tgcaccaactacacccccaacctgaccaacgacatgcg 223 BG505.5Mut.MD39.3Fill KNC cggcgagctgaagaactgc .C3V4shift-A101 pUC-ccTEV- CTNYTSNLTNDMRGEL 212 tgcaccaactacacctccaacctgaccaacgacatgcg 235 BG505.5Mut.MD39.3Fill KNC cggcgagctgaagaactgc .P136S.C3V4shift-A101 pUC-ccTEV- CSDLDNSNKGNATNTT 213 tgctccgacctggacaactccaacaagggcaacgcca 236 231965.c1.mRNA5.TK - VASEAGMNTTVAPEAG ccaacaccaccgtggcctccgaggccggcatgaacac A101 MKNC caccgtggcccccgaggccggcatgaagaactgc pUC-ccTEV- CTDYNNTATNTTSSATT 214 tgcaccgactacaacaacaccgccaccaacaccacctc 237 THRO.18.mRNA5.TK- TASSANKTAKEEEVMK ctccgccaccaccaccgcctcctccgccaacaagacc A101 NC gccaaggaggaggaggtgatgaagaactgc pUC-ccTEV- CTDNITNTNTNSSKNSS 215 tgcaccgacaacatcaccaacaccaacaccaactcctc 238 TRO.11.TK.mRNA5- THSYNNSLEGEMKNC caagaactcctccacccactcctacaacaactccctgga A101 gggcgagatgaagaactgc pUC-ccTEV-JR- CTDVNATNTTNDSEGT 216 tgcaccgacgtgaacgccaccaacaccaccaacgact 239 FL.RnS.TK.mRNA5- MERGEIKNC ccgagggcaccatggagcgcggcgagatcaagaact A101 gc pUC-ccTEV- CTDLRNATNTTSSSWET 217 tgcaccgacctgcgcaacgccaccaacaccacctcctc 240 YU2.TK.mRNA5-A101 MEKGEIKNC ctcctgggagaccatggagaagggcgagatcaagaac tgc pUC-ccTEV- CTDWTNGTDWNTTNSN 218 tgcaccgactggaccaacggcaccgactggaacacca 241 TRJO.58.TK.mRNA5- NTTISKEETIEGGEMKN ccaactccaacaacaccaccatctccaaggaggagac A101 C catcgagggcggcgagatgaagaactgc pUC-ccTEV- CHNVNSSNSSTSNSSNS 219 tgccacaacgtgaactcctccaactcctccacctccaact 242 DJ263.8.TK.mRNA5- STPINRTIDSDMQEEIKN cctccaactcctccacccccatcaaccgcaccatcgact A101 C ccgacatgcaggaggagatcaagaactgc pUC-ccTEV- CTNATYTNSDSKNSTSN 220 tgcaccaacgccacctacaccaactccgactccaagaa 243 6101.1.TK.160fill.mRNA SSLEDSGEGKMNC ctccacctccaactcctccctggaggactccggcgagg 5-A101 gcaagatgaactgc pUC-ccTEV- CSDVNTTSVNTTASSME 221 tgctccgacgtgaacaccacctccgtgaacaccaccgc 244 CAAN5342.A2.TK.mRN GGEIKNC ctcctccatggagggcggcgagatcaagaactgc A5-A101 pUC-ccTEV- CTNVTNNITDDMRGEL 201 tgcaccaacgtgaccaacaacatcaccgacgacatgcg 224 BG505.N332.MD39.noFi KNC cggcgagctgaagaactgc ll-A101 pUC-ccTEV- CTNYAPNLLSNMRGEL 222 tgcaccaactacgcccccaacctgctgtccaacatgcg 245 11MutB.3Fill.PP-A101 KNC cggcgagctgaagaactgc pUC-ccTEV- CTNVTNNITDDMRGEL 201 tgcaccaacgtgaccaacaacatcaccgacgacatgcg 224 BG505.N332.C3V4shift- KNC cggcgagctgaagaactgc A101 pUC-ccTEV-5Mut.d135- CTNYTNDMRGELKNC 202 tgcaccaactacaccaacgacatgcgcggcgagctga 225 138.C3V4shift-A101 agaactgc
[0089] The nucleic acid sequences coding for the HIV-1 immunogen of the invention can be obtained using recombinant methods known in the art, such as, for example by screening libraries from cells expressing the gene, by deriving the gene from a vector known to include theAttorney Docket No.046483-6285-00WO same, or by isolating directly from cells and tissues containing the same, using standard techniques. Alternatively, the gene of interest can be produced synthetically.
[0090] This disclosure also includes vectors containing a coding sequence for the disclosed immunogen, host cells containing the vectors, and methods of making substantially pure immunogen comprising the steps of introducing the coding sequence for the immunogen into a host cell, and cultivating the host cell under appropriate conditions such that the immunogen is produced and secreted. The immunogen so produced maybe harvested in conventional ways. Therefore, the present invention also relates to methods of expressing the immunogen and biological equivalents disclosed herein, assays employing these gene products, and recombinant host cells which comprise DNA constructs which express these receptor proteins.
[0091] Nucleic acid molecules encoding the immunogens may be recombinantly expressed by molecular cloning the nucleic acid encoding the immunogens into an expression vector (such as pcDNA3.neo, pcDNA3.1, pCR2.1, pBlueBacHis2 or pLITMUS28) containing a suitable promoter and other appropriate transcription regulatory elements, and transferred into prokaryotic or eukaryotic host cells to produce the immunogens. Techniques for such manipulations can be found described in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, are well known and readily available to the artisan of ordinary skill in the art. Therefore, another aspect of the present invention includes host cells that have been engineered to contain and / or express proteins from DNA sequences encoding the immunogens. Such recombinant host cells can be cultured under suitable conditions to produce the disclosed immunogens or a biologically equivalent form. Recombinant host cells may be prokaryotic or eukaryotic, including but not limited to, bacteria such as E. coli, fungal cells such as yeast, mammalian cells including, but not limited to, cell lines of human, bovine, porcine, monkey and rodent origin, and insect cells including but not limited to Drosophila and silkworm derived cell lines.
[0092] A variety of mammalian expression vectors may be used to express recombinant immunogens in mammalian cells. Expression vectors are defined herein as DNA sequences that are required for the transcription of cloned DNA and the translation of their mRNAs in an appropriate host. Such vectors can be used to express eukaryotic DNA in a variety of hosts such as bacteria, blue-green algae, plant cells, insect cells, and animal cells. Specifically designedAttorney Docket No.046483-6285-00WO vectors allow the shuttling of DNA between hosts such as bacteria- yeast or bacteria- animal cells. An appropriately constructed expression vector should contain: an origin of replication for autonomous replication in host cells, selectable markers, a limited number of useful restriction enzyme sites, a potential for high copy number, and active promoters. A promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis. A strong promoter is one which causes mRNAs to be initiated at high frequency.
[0093] Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, specifically designed plasmids or viruses. Commercially available mammalian expression vectors which may be suitable for immunogen expression, include but are not limited to, pIRES-hyg (Clontech), pIRES-puro (Clontech), pcDNA3.neo (Invitrogen), pcDNA3.1 (Invitrogen), pCI-neo (Promega), pLITMUS28, pLITMUS29, pLITMUS38 and pLITMUS39 (New England Bioloabs), pcDNAI, pcDNAIamp (Invitrogen), pcDNA3 (Invitrogen), pMClneo (Stratagene), pXTl (Stratagene), pSG5 (Stratagene), EBO-pSV2-neo (ATCC 37593) pBPV-l(8- 2) (ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198), pSV2-dhfr (ATCC 37146), pUCTag (ATCC 37460), and 1ZD35 (ATCC 37565).
[0094] Also, a variety of bacterial expression vectors may be used to express the disclosed immunogens in bacterial cells. Commercially available bacterial expression vectors that may be suitable for immunogen expression include, but are not limited to pCR2.1 (Invitrogen), pETl la (Novagen), lambda gtl 1 (Invitrogen), and pKK223-3 (Pharmacia). In addition, a variety of fungal cell expression vectors may be used to express the immunogens in fungal cells. Commercially available fungal cell expression vectors which may be suitable for recombinant immunogen expression include but are not limited to pYES2 (In vitro gen) and Pichia expression vector (Invitrogen).
[0095] Also, a variety of insect cell expression vectors may be used to express a recombinant receptor in insect cells. Commercially available insect cell expression vectors which may be suitable for recombinant expression of the immunogens include, but are not limited to, pBlueBacIII and pBlueBacHis2 (Invitrogen), and pAcG2T (Pharmingen).
[0096] The nucleic acid molecules can be cloned into a number of types of vectors. For example, the nucleic acid can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, a PCR-generated linear DNA sequence, and aAttorney Docket No.046483-6285-00WO cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, sequencing vectors and vectors optimized for in vitro transcription.
[0097] The expression vector may be introduced into host cells via any one of a number of techniques including but not limited to transformation, transfection, protoplast fusion, and electroporation. Transformation is meant to encompass a genetic change to the target cell resulting from incorporation of DNA. Transfection is meant to include any method known in the art for introducing the immunogens into the test cells. For example, transfection includes calcium phosphate or calcium chloride mediated transfection, lipofection, electroporation, as well as infection with, for example, a viral vector such as a recombinant retroviral vector containing the nucleotide sequence which encodes the immunogens, and combinations thereof. The expression vector-containing cells are individually analyzed to determine whether they produce the immunogens. Identification of immunogen expressing cells may be done by several means, including but not limited to immunological reactivity with specific bNAbs, labeled ligand binding and the presence of host cell-associated activity with respect to the immunogens.
[0098] Also within the scope of this invention is a host cell that contains the above- described nucleic acid. Examples include bacterial cells (e.g., E. coli cells), insect cells (e.g., using baculovirus expression vectors), yeast cells, or mammalian cells. To produce a polypeptide of this invention, one can culture a host cell in a medium under conditions permitting expression of the polypeptide encoded by a nucleic acid of this invention, and purify the polypeptide from the cultured cell or the medium of the cell. Alternatively, the nucleic acid of this invention can be transcribed and translated in vitro, e.g., using T7 promoter regulatory sequences and T7 polymerase.
[0099] Exemplary vectors containing a coding sequence for the disclosed immunogen include vectors having a sequence as set forth in SEQ ID NO:247 to SEQ ID NO:288. Therefore, in some embodiments, the invention relates to nucleic acid molecules comprising SEQ ID NO:247 to 288 as well as host cells comprising SEQ ID NO: 247 to 288.
[0100] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, carbohydrates, peptides, cationic polymers, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).Attorney Docket No.046483-6285-00WO
[0101] In the case where a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for the introduction of the nucleic acids into a host cell (in vitro, ex vivo or in vivo). In another aspect, the nucleic acid may be associated with a lipid. The nucleic acid associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid. Lipid, lipid / RNA or lipid / expression vector associated compositions are not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles, or with a “collapsed” structure. They may also simply be interspersed in a solution, possibly forming aggregates that are not uniform in size or shape. Lipids are fatty substances which may be naturally occurring or synthetic lipids. For example, lipids include the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.
[0102] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, MO; dicetyl phosphate (“DCP”) can be obtained from K & K Laboratories (Plainview, NY); cholesterol (“Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20^C. Chloroform is used as it is more readily evaporated than methanol.
[0103] Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to a composition of the present invention, in order to confirm the presence of the mRNA sequence in the host cell, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Northern blotting and RT-PCR; “biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunogenic means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.Attorney Docket No.046483-6285-00WO In vitro transcribed RNA
[0104] In one embodiment, the composition of the invention comprises an in vitro transcribed (IVT) RNA molecule encoding the HIV-1 immunogen of the invention. In one embodiment, an IVT RNA can be introduced to a cell as a form of transient transfection. The RNA is produced by in vitro transcription using a plasmid DNA template generated synthetically. DNA of interest from any source can be directly converted by PCR into a template for in vitro mRNA synthesis using appropriate primers and RNA polymerase. The source of the DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence or any other appropriate source of DNA.
[0105] In one embodiment, the DNA to be used for PCR contains an open reading frame. The DNA can be from a naturally occurring DNA sequence from the genome of an organism. In one embodiment, the DNA is a full-length gene of interest of a portion of a gene. The gene can include some or all of the 5’ and / or 3’ untranslated regions (UTRs). The gene can include exons and introns. In one embodiment, the DNA to be used for PCR is a human gene. In another embodiment, the DNA to be used for PCR is a human gene including the 5’ and 3’ UTRs. In another embodiment, the DNA to be used for PCR is a gene from a pathogenic or commensal organism, including bacteria, viruses, parasites, and fungi. In another embodiment, the DNA to be used for PCR is from a pathogenic or commensal organism, including bacteria, viruses, parasites, and fungi, including the 5’ and 3’ UTRs. The DNA can alternatively be an artificial DNA sequence that is not normally expressed in a naturally occurring organism. An exemplary artificial DNA sequence is one that contains portions of genes that are ligated together to form an open reading frame that encodes a fusion protein. The portions of DNA that are ligated together can be from a single organism or from more than one organism.
[0106] Genes that can be used as sources of DNA for PCR include genes that encode polypeptides that induce or enhance an adaptive immune response in an organism. In some instances, the genes are useful for a short term treatment. In some instances, the genes have limited safety concerns regarding dosage of the expressed gene.
[0107] In various embodiments, a plasmid is used to generate a template for in vitro transcription of mRNA, which is used for transfection.
[0108] Chemical structures with the ability to promote stability and / or translationAttorney Docket No.046483-6285-00WO efficiency may also be used. In some embodiments, the RNA has 5’ and 3’ UTRs. In one embodiment, the 5’ UTR is between zero and 3000 nucleotides in length. The length of 5’ and 3’ UTR sequences to be added to the coding region can be altered by different methods, including, but not limited to, designing primers for PCR that anneal to different regions of the UTRs. Using this approach, one of ordinary skill in the art can modify the 5’ and 3’ UTR lengths required to achieve optimal translation efficiency following transfection of the transcribed RNA.
[0109] The 5’ and 3’ UTRs can be the naturally occurring, endogenous 5’ and 3’ UTRs for the gene of interest. Alternatively, UTR sequences that are not endogenous to the gene of interest can be added by incorporating the UTR sequences into the forward and reverse primers or by any other modifications of the template. The use of UTR sequences that are not endogenous to the gene of interest can be useful for modifying the stability and / or translation efficiency of the RNA. For example, it is known that AU-rich elements in 3’ UTR sequences can decrease the stability of mRNA. Therefore, 3’ UTRs can be selected or designed to increase the stability of the transcribed RNA based on properties of UTRs that are well known in the art.
[0110] In one embodiment, the 5’ UTR can contain the Kozak sequence of the endogenous gene. Alternatively, when a 5’ UTR that is not endogenous to the gene of interest is being added by PCR as described above, a consensus Kozak sequence can be redesigned by adding the 5’ UTR sequence. Kozak sequences can increase the efficiency of translation of some RNA transcripts, but does not appear to be required for all RNAs to enable efficient translation. The requirement for Kozak sequences for many mRNAs is known in the art. In other embodiments the 5’ UTR can be derived from an RNA virus whose RNA genome is stable in cells. In other embodiments various nucleotide analogues can be used in the 3’ or 5’ UTR to impede exonuclease degradation of the mRNA.
[0111] To enable synthesis of RNA from a DNA template, a promoter of transcription should be attached to the DNA template upstream of the sequence to be transcribed. When a sequence that functions as a promoter for an RNA polymerase is added to the 5’ end of the forward primer, the RNA polymerase promoter becomes incorporated into the PCR product upstream of the open reading frame that is to be transcribed. In one embodiment, the promoter is a T7 RNA polymerase promoter, as described elsewhere herein. Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for T7, T3 and SP6 promoters are known in the art.Attorney Docket No.046483-6285-00WO
[0112] In one embodiment, the mRNA has both a cap on the 5’ end and a 3’ poly(A) tail which determine ribosome binding, initiation of translation and stability of mRNA in the cell. On a circular DNA template, for instance, plasmid DNA, RNA polymerase produces a long concatameric product, which is not suitable for expression in eukaryotic cells. The transcription of plasmid DNA linearized at the end of the 3’ UTR results in normal sized mRNA, which is effective in eukaryotic transfection when it is polyadenylated after transcription.
[0113] On a linear DNA template, phage T7 RNA polymerase can extend the 3’ end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003)).
[0114] The conventional method of integration of polyA / T stretches into a DNA template is molecular cloning. However, polyA / T sequence integrated into plasmid DNA can cause plasmid instability, which can be ameliorated through the use of recombination incompetent bacterial cells for plasmid propagation.
[0115] Poly(A) tails of RNAs can be further extended following in vitro transcription with the use of a poly(A) polymerase, such as E. coli polyA polymerase (E-PAP) or yeast polyA polymerase. In one embodiment, increasing the length of a poly(A) tail from 100 nucleotides to between 300 and 400 nucleotides results in about a two-fold increase in the translation efficiency of the RNA. Additionally, the attachment of different chemical groups to the 3’ end can increase mRNA stability. Such attachment can contain modified / artificial nucleotides, aptamers and other compounds. For example, ATP analogs can be incorporated into the poly(A) tail using poly(A) polymerase. ATP analogs can further increase the stability of the RNA.
[0116] 5’ caps also provide stability to mRNA molecules. In one embodiment, RNAs produced by the methods to include a 5’ cap1 structure. Such cap1 structure can be generated using Vaccinia capping enzyme and 2’-O-methyltransferase enzymes (CellScript, Madison, WI). Alternatively, 5’ cap is provided using techniques known in the art and described herein (Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001); Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).
[0117] RNA can be introduced into target cells using any of a number of different methods, for instance, commercially available methods which include, but are not limited to, electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or the Gene Pulser II (BioRad, Denver, Colo.),Attorney Docket No.046483-6285-00WO Multiporator (Eppendort, Hamburg Germany), cationic liposome mediated transfection using lipofection, polymer encapsulation, peptide mediated transfection, or biolistic particle delivery systems such as “gene guns” (see, for example, Nishikawa, et al. Hum Gene Ther., 12(8):861-70 (2001)). In some embodiments RNA of the invention is introduced to a cell with a method comprising the use of TransIT®-mRNA transfection Kit (Mirus, Madison WI), which, in some instances, provides high efficiency, low toxicity, transfection. Nucleoside-modified RNA
[0118] In one embodiment, the composition of the present invention comprises a nucleoside-modified nucleic acid encoding an HIV-1 immunogen as described herein.
[0119] For example, in one embodiment, the composition comprises a nucleoside- modified RNA. In one embodiment, the composition comprises a nucleoside-modified mRNA. Nucleoside-modified mRNA have particular advantages over non-modified mRNA, including for example, increased stability, low or absent innate immunogenicity, and enhanced translation. Nucleoside-modified mRNA useful in the present invention is further described in U.S. Patent Nos.8,278,036, 8,691,966, and 8,835,108, each of which is incorporated by reference herein in its entirety.
[0120] In some embodiments, nucleoside-modified mRNA does not activate any pathophysiologic pathways, translates very efficiently and almost immediately following delivery, and serve as templates for continuous protein production in vivo lasting for several days to weeks (Karikó et al., 2008, Mol Ther 16:1833-1840; Karikó et al., 2012, Mol Ther 20:948-953). The amount of mRNA required to exert a physiological effect is small, making it applicable for human therapy. For example, as described herein, nucleoside-modified mRNA encoding an HIV-1 immunogen has demonstrated the ability to induce broadly neutralizing antibody production. For example, in some instances, antigen encoded by nucleoside-modified mRNA induces greater production of broadly neutralizing antibody production as compared to antigen encoded by non-modified mRNA.
[0121] In some instances, expressing a protein by delivering the encoding mRNA has many benefits over methods that use protein, plasmid DNA or viral vectors. During mRNA transfection, the coding sequence of the desired protein is the only substance delivered to cells, thus avoiding all the side effects associated with plasmid backbones, viral genes, and viralAttorney Docket No.046483-6285-00WO proteins. More importantly, unlike DNA- and viral-based vectors, the mRNA does not carry the risk of being incorporated into the genome and protein production starts immediately after mRNA delivery. For example, high levels of circulating proteins have been measured within 15 to 30 minutes of in vivo injection of the encoding mRNA. In some embodiments, using mRNA rather than the protein also has many advantages. Half-lives of proteins in the circulation or in tissues are often short, thus protein treatment would need frequent dosing, while mRNA provides a template for continuous protein production for several days to weeks. Purification of proteins is problematic and they can contain aggregates and other impurities that cause adverse effects (Kromminga and Schellekens, 2005, Ann NY Acad Sci 1050:257-265).
[0122] In some embodiments, the nucleoside-modified RNA comprises the naturally occurring modified-nucleoside pseudouridine. In some embodiments, inclusion of pseudouridine makes the mRNA more stable, non-immunogenic, and highly translatable (Karikó et al., 2008, Mol Ther 16:1833-1840; Anderson et al., 2010, Nucleic Acids Res 38:5884-5892; Anderson et al., 2011, Nucleic Acids Research 39:9329-9338; Karikó et al., 2011, Nucleic Acids Research 39:e142; Karikó et al., 2012, Mol Ther 20:948-953; Karikó et al., 2005, Immunity 23:165-175).
[0123] It has been demonstrated that the presence of modified nucleosides, including pseudouridines in RNA suppress their innate immunogenicity (Karikó et al., 2005, Immunity 23:165-175). Further, protein-encoding, in vitro-transcribed RNA containing pseudouridine can be translated more efficiently than RNA containing no or other modified nucleosides (Karikó et al., 2008, Mol Ther 16:1833-1840). Subsequently, it is shown that the presence of pseudouridine improves the stability of RNA (Anderson et al., 2011, Nucleic Acids Research 39:9329-9338) and abates both activation of PKR and inhibition of translation (Anderson et al., 2010, Nucleic Acids Res 38:5884-5892).
[0124] Similar effects as described for pseudouridine have also been observed for RNA containing 1-methyl-pseudouridine.
[0125] In some embodiments, the nucleoside-modified nucleic acid molecule is a purified nucleoside-modified nucleic acid molecule. For example, in some embodiments, the composition is purified to remove double-stranded contaminants. In some instances, a preparative high-performance liquid chromatography (HPLC) purification procedure is used to obtain pseudouridine-containing RNA that has superior translational potential and no innate immunogenicity (Karikó et al., 2011, Nucleic Acids Research 39:e142). Administering HPLC-Attorney Docket No.046483-6285-00WO purified, pseudouridine-containing RNA coding for erythropoietin into mice and macaques resulted in a significant increase of serum EPO levels (Karikó et al., 2012, Mol Ther 20:948- 953), thus confirming that pseudouridine-containing mRNA is suitable for in vivo protein therapy. In some embodiments, the nucleoside-modified nucleic acid molecule is purified using non-HPLC methods. In some instances, the nucleoside-modified nucleic acid molecule is purified using chromatography methods, including but not limited to HPLC and fast protein liquid chromatography (FPLC). An exemplary FPLC-based purification procedure is described in Weissman et al., 2013, Methods Mol Biol, 969: 43-54. Exemplary purification procedures are also described in U.S. Patent Application Publication No. US2016 / 0032316, which is hereby incorporated by reference in its entirety.
[0126] The present invention encompasses RNA, oligoribonucleotide, and polyribonucleotide molecules comprising pseudouridine or a modified nucleoside. In some embodiments, the composition comprises an isolated nucleic acid encoding an antigen, wherein the nucleic acid comprises a pseudouridine or a modified nucleoside. In some embodiments, the composition comprises a vector, comprising an isolated nucleic acid encoding an antigen, adjuvant, or combination thereof, wherein the nucleic acid comprises a pseudouridine or a modified nucleoside.
[0127] In one embodiment, the nucleoside-modified RNA of the invention is IVT RNA, as described elsewhere herein. For example, in some embodiments, the nucleoside-modified RNA is synthesized by T7 phage RNA polymerase. In another embodiment, the nucleoside- modified mRNA is synthesized by SP6 phage RNA polymerase. In another embodiment, the nucleoside-modified RNA is synthesized by T3 phage RNA polymerase.
[0128] In one embodiment, the modified nucleoside is m1acp3Ψ (1-methyl-3-(3-amino- 3-carboxypropyl) pseudouridine. In another embodiment, the modified nucleoside is m1Ψ (1- methylpseudouridine). In another embodiment, the modified nucleoside is Ψm (2’-O- methylpseudouridine). In another embodiment, the modified nucleoside is m5D (5- methyldihydrouridine). In another embodiment, the modified nucleoside is m3Ψ (3- methylpseudouridine). In another embodiment, the modified nucleoside is a pseudouridine moiety that is not further modified. In another embodiment, the modified nucleoside is a monophosphate, diphosphate, or triphosphate of any of the above pseudouridines. In another embodiment, the modified nucleoside is any other pseudouridine-like nucleoside known in theAttorney Docket No.046483-6285-00WO art.
[0129] In another embodiment, the nucleoside that is modified in the nucleoside- modified RNA the present invention is uridine (U). In another embodiment, the modified nucleoside is cytidine (C). In another embodiment, the modified nucleoside is adenosine (A). In another embodiment, the modified nucleoside is guanosine (G).
[0130] In another embodiment, the modified nucleoside of the present invention is m5C (5-methylcytidine). In another embodiment, the modified nucleoside is m5U (5-methyluridine). In another embodiment, the modified nucleoside is m6A (N6-methyladenosine). In another embodiment, the modified nucleoside is s2U (2-thiouridine). In another embodiment, the modified nucleoside is Ψ (pseudouridine). In another embodiment, the modified nucleoside is Um (2’-O-methyluridine).
[0131] In other embodiments, the modified nucleoside is m1A (1-methyladenosine); m2A (2-methyladenosine); Am (2’-O-methyladenosine); ms2m6A (2-methylthio-N6-methyladenosine); i6A (N6-isopentenyladenosine); ms2i6A (2-methylthio-N6isopentenyladenosine); io6A (N6-(cis- hydroxyisopentenyl)adenosine); ms2io6A (2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine); g6A (N6-glycinylcarbamoyladenosine); t6A (N6-threonylcarbamoyladenosine); ms2t6A (2- methylthio-N6-threonyl carbamoyladenosine); m6t6A (N6-methyl-N6- threonylcarbamoyladenosine); hn6A(N6-hydroxynorvalylcarbamoyladenosine); ms2hn6A (2- methylthio-N6-hydroxynorvalyl carbamoyladenosine); Ar(p) (2’-O-ribosyladenosine (phosphate)); I (inosine); m1I (1-methylinosine); m1Im (1,2’-O-dimethylinosine); m3C (3- methylcytidine); Cm (2’-O-methylcytidine); s2C (2-thiocytidine); ac4C (N4-acetylcytidine); f5C (5-formylcytidine); m5Cm (5,2’-O-dimethylcytidine); ac4Cm (N4-acetyl-2’-O-methylcytidine); k2C (lysidine); m1G (1-methylguanosine); m2G (N2-methylguanosine); m7G (7- methylguanosine); Gm (2’-O-methylguanosine); m22G (N2,N2-dimethylguanosine); m2Gm (N2,2’-O-dimethylguanosine); m22Gm (N2,N2,2’-O-trimethylguanosine); Gr(p) (2’-O- ribosylguanosine (phosphate)); yW (wybutosine); o2yW (peroxywybutosine); OHyW (hydroxywybutosine); OHyW* (undermodified hydroxywybutosine); imG (wyosine); mimG (methylwyosine); Q (queuosine); oQ (epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosyl-queuosine); preQ0(7-cyano-7-deazaguanosine); preQ1(7-aminomethyl-7- deazaguanosine); G+(archaeosine); D (dihydrouridine); m5Um (5,2’-O-dimethyluridine); s4U (4- thiouridine); m5s2U (5-methyl-2-thiouridine); s2Um (2-thio-2’-O-methyluridine); acp3U (3-(3-Attorney Docket No.046483-6285-00WO amino-3-carboxypropyl)uridine); ho5U (5-hydroxyuridine); mo5U (5-methoxyuridine); cmo5U (uridine 5-oxyacetic acid); mcmo5U (uridine 5-oxyacetic acid methyl ester); chm5U (5- (carboxyhydroxymethyl)uridine)); mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester); mcm5U (5-methoxycarbonylmethyluridine); mcm5Um (5-methoxycarbonylmethyl-2’-O- methyluridine); mcm5s2U (5-methoxycarbonylmethyl-2-thiouridine); nm5s2U (5-aminomethyl-2- thiouridine); mnm5U (5-methylaminomethyluridine); mnm5s2U (5-methylaminomethyl-2- thiouridine); mnm5se2U (5-methylaminomethyl-2-selenouridine); ncm5U (5- carbamoylmethyluridine); ncm5Um (5-carbamoylmethyl-2’-O-methyluridine); cmnm5U (5- carboxymethylaminomethyluridine); cmnm5Um (5-carboxymethylaminomethyl-2’-O- methyluridine); cmnm5s2U (5-carboxymethylaminomethyl-2-thiouridine); m62A (N6,N6- dimethyladenosine); Im (2’-O-methylinosine); m4C (N4-methylcytidine); m4Cm (N4,2’-O- dimethylcytidine); hm5C (5-hydroxymethylcytidine); m3U (3-methyluridine); cm5U (5- carboxymethyluridine); m6Am (N6,2’-O-dimethyladenosine); m62Am (N6,N6,O-2’- trimethyladenosine); m2,7G (N2,7-dimethylguanosine); m2,2,7G (N2,N2,7-trimethylguanosine); m3Um (3,2’-O-dimethyluridine); m5D (5-methyldihydrouridine); f5Cm (5-formyl-2’-O- methylcytidine); m1Gm (1,2’-O-dimethylguanosine); m1Am (1,2’-O-dimethyladenosine); τm5U (5-taurinomethyluridine); τm5s2U (5-taurinomethyl-2-thiouridine)); imG-14 (4- demethylwyosine); imG2 (isowyosine); or ac6A (N6-acetyladenosine).
[0132] In another embodiment, a nucleoside-modified RNA of the present invention comprises a combination of 2 or more of the above modifications. In another embodiment, the nucleoside-modified RNA comprises a combination of 3 or more of the above modifications. In another embodiment, the nucleoside-modified RNA comprises a combination of more than 3 of the above modifications.
[0133] In various embodiments, between 0.1% and 100% of the residues in the nucleoside-modified RNA of the present invention are modified (e.g., either by the presence of pseudouridine, 1-methyl-pseudouridine, 5-methyl-uridine or another modified nucleoside base). In one embodiment, the fraction of modified residues is 0.1%. In another embodiment, the fraction of modified residues is 0.2%. In another embodiment, the fraction is 0.3%. In another embodiment, the fraction is 0.4%. In another embodiment, the fraction is 0.5%. In another embodiment, the fraction is 0.6%. In another embodiment, the fraction is 0.7%. In another embodiment, the fraction is 0.8%. In another embodiment, the fraction is 0.9%. In anotherAttorney Docket No.046483-6285-00WO embodiment, the fraction is 1%. In another embodiment, the fraction is 1.5%. In another embodiment, the fraction is 2%. In another embodiment, the fraction is 2.5%. In another embodiment, the fraction is 3%. In another embodiment, the fraction is 4%. In another embodiment, the fraction is 5%. In another embodiment, the fraction is 6%. In another embodiment, the fraction is 7%. In another embodiment, the fraction is 8%. In another embodiment, the fraction is 9%. In another embodiment, the fraction is 10%. In another embodiment, the fraction is 12%. In another embodiment, the fraction is 14%. In another embodiment, the fraction is 16%. In another embodiment, the fraction is 18%. In another embodiment, the fraction is 20%. In another embodiment, the fraction is 25%. In another embodiment, the fraction is 30%. In another embodiment, the fraction is 35%. In another embodiment, the fraction is 40%. In another embodiment, the fraction is 45%. In another embodiment, the fraction is 50%. In another embodiment, the fraction is 55%. In another embodiment, the fraction is 60%. In another embodiment, the fraction is 65%. In another embodiment, the fraction is 70%. In another embodiment, the fraction is 75%. In another embodiment, the fraction is 80%. In another embodiment, the fraction is 85%. In another embodiment, the fraction is 90%. In another embodiment, the fraction is 91%. In another embodiment, the fraction is 92%. In another embodiment, the fraction is 93%. In another embodiment, the fraction is 94%. In another embodiment, the fraction is 95%. In another embodiment, the fraction is 96%. In another embodiment, the fraction is 97%. In another embodiment, the fraction is 98%. In another embodiment, the fraction is 99%. In another embodiment, the fraction is 100%.
[0134] In another embodiment, the fraction is less than 5%. In another embodiment, the fraction is less than 3%. In another embodiment, the fraction is less than 1%. In another embodiment, the fraction is less than 2%. In another embodiment, the fraction is less than 4%. In another embodiment, the fraction is less than 6%. In another embodiment, the fraction is less than 8%. In another embodiment, the fraction is less than 10%. In another embodiment, the fraction is less than 12%. In another embodiment, the fraction is less than 15%. In another embodiment, the fraction is less than 20%. In another embodiment, the fraction is less than 30%. In another embodiment, the fraction is less than 40%. In another embodiment, the fraction is less than 50%. In another embodiment, the fraction is less than 60%. In another embodiment, the fraction is less than 70%.Attorney Docket No.046483-6285-00WO
[0135] In another embodiment, 0.1% of the residues of a given nucleoside (i.e., uridine, cytidine, guanosine, or adenosine) are modified. In another embodiment, the fraction of modified residues is 0.2%. In another embodiment, the fraction is 0.3%. In another embodiment, the fraction is 0.4%. In another embodiment, the fraction is 0.5%. In another embodiment, the fraction is 0.6%. In another embodiment, the fraction is 0.7%. In another embodiment, the fraction is 0.8%. In another embodiment, the fraction is 0.9%. In another embodiment, the fraction is 1%. In another embodiment, the fraction is 1.5%. In another embodiment, the fraction is 2%. In another embodiment, the fraction is 2.5%. In another embodiment, the fraction is 3%. In another embodiment, the fraction is 4%. In another embodiment, the fraction is 5%. In another embodiment, the fraction is 6%. In another embodiment, the fraction is 7%. In another embodiment, the fraction is 8%. In another embodiment, the fraction is 9%. In another embodiment, the fraction is 10%. In another embodiment, the fraction is 12%. In another embodiment, the fraction is 14%. In another embodiment, the fraction is 16%. In another embodiment, the fraction is 18%. In another embodiment, the fraction is 20%. In another embodiment, the fraction is 25%. In another embodiment, the fraction is 30%. In another embodiment, the fraction is 35%. In another embodiment, the fraction is 40%. In another embodiment, the fraction is 45%. In another embodiment, the fraction is 50%. In another embodiment, the fraction is 55%. In another embodiment, the fraction is 60%. In another embodiment, the fraction is 65%. In another embodiment, the fraction is 70%. In another embodiment, the fraction is 75%. In another embodiment, the fraction is 80%. In another embodiment, the fraction is 85%. In another embodiment, the fraction is 90%. In another embodiment, the fraction is 91%. In another embodiment, the fraction is 92%. In another embodiment, the fraction is 93%. In another embodiment, the fraction is 94%. In another embodiment, the fraction is 95%. In another embodiment, the fraction is 96%. In another embodiment, the fraction is 97%. In another embodiment, the fraction is 98%. In another embodiment, the fraction is 99%. In another embodiment, the fraction is 100%. In another embodiment, the fraction of the given nucleotide that is modified is less than 8%. In another embodiment, the fraction is less than 10%. In another embodiment, the fraction is less than 5%. In another embodiment, the fraction is less than 3%. In another embodiment, the fraction is less than 1%. In another embodiment, the fraction is less than 2%. In another embodiment, the fraction is less than 4%. In another embodiment, the fraction is less than 6%. In anotherAttorney Docket No.046483-6285-00WO embodiment, the fraction is less than 12%. In another embodiment, the fraction is less than 15%. In another embodiment, the fraction is less than 20%. In another embodiment, the fraction is less than 30%. In another embodiment, the fraction is less than 40%. In another embodiment, the fraction is less than 50%. In another embodiment, the fraction is less than 60%. In another embodiment, the fraction is less than 70%.
[0136] In some embodiments, the composition comprises a purified preparation of single-stranded nucleoside modified RNA. For example, in some embodiments, the purified preparation of single-stranded nucleoside modified RNA is substantially free of double stranded RNA (dsRNA). In some embodiments, the purified preparation is at least 90%, or at least 91%, or at least 92%, or at least 93 % or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or at least 99.5%, or at least 99.9% single stranded nucleoside modified RNA, relative to all other nucleic acid molecules (DNA, dsRNA, etc.).
[0137] In another embodiment, a nucleoside-modified RNA of the present invention is translated in the cell more efficiently than an unmodified RNA molecule with the same sequence. In another embodiment, the nucleoside-modified RNA exhibits enhanced ability to be translated by a target cell. In another embodiment, translation is enhanced by a factor of 2-fold relative to its unmodified counterpart. In another embodiment, translation is enhanced by a 3- fold factor. In another embodiment, translation is enhanced by a 4-fold factor. In another embodiment, translation is enhanced by a 5-fold factor. In another embodiment, translation is enhanced by a 6-fold factor. In another embodiment, translation is enhanced by a 7-fold factor. In another embodiment, translation is enhanced by an 8-fold factor. In another embodiment, translation is enhanced by a 9-fold factor. In another embodiment, translation is enhanced by a 10-fold factor. In another embodiment, translation is enhanced by a 15-fold factor. In another embodiment, translation is enhanced by a 20-fold factor. In another embodiment, translation is enhanced by a 50-fold factor. In another embodiment, translation is enhanced by a 100-fold factor. In another embodiment, translation is enhanced by a 200-fold factor. In another embodiment, translation is enhanced by a 500-fold factor. In another embodiment, translation is enhanced by a 1000-fold factor. In another embodiment, translation is enhanced by a 2000-fold factor. In another embodiment, the factor is 10-1000-fold. In another embodiment, the factor is 10-100-fold. In another embodiment, the factor is 10-200-fold. In another embodiment, the factor is 10-300-fold. In another embodiment, the factor is 10-500-fold. In another embodiment, theAttorney Docket No.046483-6285-00WO factor is 20-1000-fold. In another embodiment, the factor is 30-1000-fold. In another embodiment, the factor is 50-1000-fold. In another embodiment, the factor is 100-1000-fold. In another embodiment, the factor is 200-1000-fold. In another embodiment, translation is enhanced by any other significant amount or range of amounts.
[0138] In another embodiment, the nucleoside-modified antigen-encoding RNA of the present invention induces a significantly more robust adaptive immune response as compared with an unmodified in vitro-synthesized RNA molecule of the same sequence. In another embodiment, the modified RNA molecule induces an adaptive immune response that is 2-fold greater than its unmodified counterpart. In another embodiment, the adaptive immune response is increased by a 3-fold factor. In another embodiment, the adaptive immune response is increased by a 4-fold factor. In another embodiment, the adaptive immune response is increased by a 5- fold factor. In another embodiment, the adaptive immune response is increased by a 6-fold factor. In another embodiment, the adaptive immune response is increased by a 7-fold factor. In another embodiment, the adaptive immune response is increased by an 8-fold factor. In another embodiment, the adaptive immune response is increased by a 9-fold factor. In another embodiment, the adaptive immune response is increased by a 10-fold factor. In another embodiment, the adaptive immune response is increased by a 15-fold factor. In another embodiment, the adaptive immune response is increased by a 20-fold factor. In another embodiment, the adaptive immune response is increased by a 50-fold factor. In another embodiment, the adaptive immune response is increased by a 100-fold factor. In another embodiment, the adaptive immune response is increased by a 200-fold factor. In another embodiment, the adaptive immune response is increased by a 500-fold factor. In another embodiment, the adaptive immune response is increased by a 1000-fold factor. In another embodiment, the adaptive immune response is increased by a 2000-fold factor. In another embodiment, the adaptive immune response is increased by another fold difference.
[0139] In another embodiment, “induces significantly more robust adaptive immune response” refers to a detectable increase in an adaptive immune response. In another embodiment, the term refers to a fold increase in the adaptive immune response (e.g., 1 of the fold increases enumerated above). In another embodiment, the term refers to an increase such that the nucleoside-modified RNA can be administered at a lower dose or frequency than an unmodified RNA molecule while still inducing a similarly effective adaptive immune response.Attorney Docket No.046483-6285-00WO In another embodiment, the increase is such that the nucleoside-modified RNA can be administered using a single dose to induce an effective adaptive immune response.
[0140] In another embodiment, the nucleoside-modified RNA of the present invention exhibits significantly less innate immunogenicity than an unmodified in vitro-synthesized RNA molecule of the same sequence. In another embodiment, the modified RNA molecule exhibits an innate immune response that is 2-fold less than its unmodified counterpart. In another embodiment, innate immunogenicity is reduced by a 3-fold factor. In another embodiment, innate immunogenicity is reduced by a 4-fold factor. In another embodiment, innate immunogenicity is reduced by a 5-fold factor. In another embodiment, innate immunogenicity is reduced by a 6-fold factor. In another embodiment, innate immunogenicity is reduced by a 7-fold factor. In another embodiment, innate immunogenicity is reduced by a 8-fold factor. In another embodiment, innate immunogenicity is reduced by a 9-fold factor. In another embodiment, innate immunogenicity is reduced by a 10-fold factor. In another embodiment, innate immunogenicity is reduced by a 15-fold factor. In another embodiment, innate immunogenicity is reduced by a 20-fold factor. In another embodiment, innate immunogenicity is reduced by a 50-fold factor. In another embodiment, innate immunogenicity is reduced by a 100-fold factor. In another embodiment, innate immunogenicity is reduced by a 200-fold factor. In another embodiment, innate immunogenicity is reduced by a 500-fold factor. In another embodiment, innate immunogenicity is reduced by a 1000-fold factor. In another embodiment, innate immunogenicity is reduced by a 2000-fold factor. In another embodiment, innate immunogenicity is reduced by another fold difference.
[0141] In another embodiment, “exhibits significantly less innate immunogenicity” refers to a detectable decrease in innate immunogenicity. In another embodiment, the term refers to a fold decrease in innate immunogenicity (e.g., 1 of the fold decreases enumerated above). In another embodiment, the term refers to a decrease such that an effective amount of the nucleoside-modified RNA can be administered without triggering a detectable innate immune response. In another embodiment, the term refers to a decrease such that the nucleoside-modified RNA can be repeatedly administered without eliciting an innate immune response sufficient to detectably reduce production of the protein encoded by the modified RNA. In another embodiment, the decrease is such that the nucleoside-modified RNA can be repeatedly administered without eliciting an innate immune response sufficient to eliminate detectableAttorney Docket No.046483-6285-00WO production of the protein encoded by the modified RNA. Lipid Nanoparticle
[0142] In one embodiment, delivery of nucleoside-modified RNA comprises any suitable delivery method, including exemplary RNA transfection methods described elsewhere herein. In some embodiments, delivery of a nucleoside-modified RNA to a subject comprises mixing the nucleoside-modified RNA with a transfection reagent prior to the step of contacting. In another embodiment, a method of present invention further comprises administering nucleoside-modified RNA together with the transfection reagent. In another embodiment, the transfection reagent is a cationic lipid reagent. In another embodiment, the transfection reagent is a cationic polymer reagent.
[0143] In another embodiment, the transfection reagent is a lipid-based transfection reagent. In another embodiment, the transfection reagent is a protein-based transfection reagent. In another embodiment, the transfection reagent is a carbohydrate-based transfection reagent. In another embodiment, the transfection reagent is a cationic lipid-based transfection reagent. In another embodiment, the transfection reagent is a cationic polymer-based transfection reagent. In another embodiment, the transfection reagent is a polyethyleneimine based transfection reagent. In another embodiment, the transfection reagent is calcium phosphate. In another embodiment, the transfection reagent is Lipofectin®, Lipofectamine®, or TransIT®. In another embodiment, the transfection reagent is any other transfection reagent known in the art.
[0144] In another embodiment, the transfection reagent forms a liposome. Liposomes, in another embodiment, increase intracellular stability, increase uptake efficiency and improve biological activity. In another embodiment, liposomes are hollow spherical vesicles composed of lipids arranged in a similar fashion as those lipids, which make up the cell membrane. They have, in another embodiment, an internal aqueous space for entrapping water-soluble compounds and range in size from 0.05 to several microns in diameter. In another embodiment, liposomes can deliver RNA to cells in a biologically active form.
[0145] In one embodiment, the composition comprises a lipid nanoparticle (LNP) and one or more nucleic acid molecules described herein. For example, in one embodiment, the composition comprises an LNP and one or more nucleoside-modified RNA molecules encoding an HIV-1 immunogen as described herein.Attorney Docket No.046483-6285-00WO
[0146] Exemplary LNPs and their manufacture are described in the art, for example in U.S. Patent Application Publication No. US20120276209, Semple et al., 2010, Nat Biotechnol., 28(2):172-176; Akinc et al., 2010, Mol Ther., 18(7): 1357-1364; Basha et al., 2011, Mol Ther, 19(12): 2186-2200; Leung et al., 2012, J Phys Chem C Nanomater Interfaces, 116(34): 18440- 18450; Lee et al., 2012, Int J Cancer., 131(5): E781-90; Belliveau et al., 2012, Mol Ther nucleic Acids, 1: e37; Jayaraman et al., 2012, Angew Chem Int Ed Engl., 51(34): 8529-8533; Mui et al., 2013, Mol Ther Nucleic Acids.2, e139; Maier et al., 2013, Mol Ther., 21(8): 1570-1578; and Tam et al., 2013, Nanomedicine, 9(5): 665-74, each of which are incorporated by reference in their entirety. Virus-like Particles and SAPN
[0147] In some embodiments, the immunogen polypeptides are multimerized on a virus- like particle (VLP) (e.g., retrovirus-like particle, HIV-like particle). Virus-like particles, or retrovirus-like particles, in the context of the present disclosure, are membrane-surrounded structures comprising viral envelope proteins embedded within the membrane of the host cell in which they are produced. In some embodiments, there are additional viral core proteins in the VLPs. These VLPs do not contain intact viral nucleic acid, and they are non-infectious. In some embodiments, there is sufficient envelope protein on the surface of the VLP so that when a VLP preparation is formulated into an immunogenic composition and administered to an animal or human, an immune response (cell-mediated or humoral) is raised. In some embodiments, the Env protein is truncated from the carboxy terminus as compared with the naturally occurring virus envelope protein. In the context of the present invention, a “truncated” envelope protein is one which contains less than a full-length cytoplasmic domain, which but retains surface antigenic determinants against which an immune response is generated, and it retains sufficient envelope sequence for proper precursor processing and membrane insertion.
[0148] In some embodiments, the SpyTag / SpyCatcher technology (Zakeri, B. et al. Proc Natl Acad Sci U S A 109, E690-697 (2012) is used for the assembly of HIV-1 immunogens into a mi3 VLP (Bruun et al., 2018, ACS Nano 12, 8855-8866; Gristick et al., 2023, Sci Immunol 8, eade6364) via an irreversible isopeptide bond formed by the interaction between the SpyTag peptide and the SpyCatcher polypeptide. The Spytag peptide can be included at the N-terminus, C-Terminus or internally within the HIV-1 immunogen. When SpyTagged HIV-1 immunogensAttorney Docket No.046483-6285-00WO are contacted with a SpyCatcher-mi3 nanocage scaffold, the interaction between the SpyTag and the SpyCatcher results in formation of a mi3 VLP presenting at least one HIV-1 immunogen. In one embodiment, the mi3 nanoparticle of the invention comprises at least 20 SpyTag labeled HIV-1 Env timer immunogens.
[0149] In some embodiments, the immunogens can be formulated as a protein complex comprising at least one immunogen polypeptide multimerized via covalent or non-covalent bonding / interaction (e.g., van der Waals interactions). For example, two or more immunogen polypeptides may be cross-linked by one or more cross-linkers. Crosslinkers are reagents having reactive ends to specific functional groups (e.g., primary amines or sulfhydryls) on proteins or other molecules. Crosslinkers are capable of joining two or more molecules by a covalent bond. Crosslinkers include but are not limited to amine-to-amine crosslinkers (e.g., disuccinimidyl suberate(DSS)), amine-to-sulfhydryl crosslinkers (e.g., N-g-maleimidobutyryl- oxysuccinimide ester (GMBS)), carboxyl-to-amine crosslinkers (e.g., dicyclohexylcarbodiimide (DCC)), sulfhydryl-to-carbohydrate crosslinkers (e.g., N-b- maleimidopropionic acid hydrazide (BMPH)), sulfhydryl-to-sulfhydryl crosslinkers (e.g., 1,4- bismaieimidobutane (BMB)), photoreactive crosslinkers (e.g. , N-5-azido-2- nitrobenzoyloxysuccinimide (ANB-NOS)), chemo selective ligation crosslinkers (e.g., NHS- PEG4-Azide).
[0150] In one embodiment, the immunogenic composition of the invention comprises an HIV-1 immunogen fusion molecule comprising an HIV-1 immunogen domain and an aggregation domain. In some embodiments, the HIV-1 immunogen fusion molecule forms a self- assembling nanoparticle. Self-assembling protein nanoparticles (SAPN) may be formed by the assembly of one or more polypeptide chains comprising at least one antigen and at least one protein oligomerization domain (e.g., ferritin). Without limitation, the SAPN of the invention may self-assemble into a tetrahedron, a cube, an octahedron, a dodecahedron, or an icosahedron. In one embodiment, the SAPN of the invention is generated by the aggregation of at least 20 HIV-1 immunogen fusion molecules. The SAPN of the invention may be used as an efficient means for presenting at least one HIV-1 immunogen. Assay System
[0151] In some embodiments, the invention relates to an assay system for identifying immunogens that will be efficient for eliciting bNAbs. In some embodiments, the assay systemAttorney Docket No.046483-6285-00WO comprises an outbred animal model for HIV.
[0152] In some embodiments, the assay system comprises (i) immunization of multiple outbred non-human primates with a vaccine against HIV, (ii) infection of the non-human primates with an “evolving immunogen” comprising a SHIV bearing a modified Env, wherein the SHIV functions to mature early vaccine-elicited response, (iii) isolating bNAbs from the infected animals; and (iv) sequencing the isolated bNAbs to identify common routes of Env- antibody coevolution.
[0153] Any HIV-1 Env can be incorporated into a SHIV as an “evolving antibody”. Methods of generating SHIV from any HIV-1 Env are described in Roark et al., 2021, Science 371; Li et al., 2021, J Virol 95, e00071-21; and Li et al., 2016, Proc Natl Acad Sci U S A 113, E3413-3422, each of which is incorporated herein in its entirety. In some embodiments, the evolving immunogen comprises a S375Y mutation to facilitate entry into CD4 cells.
[0154] In some embodiments, the evolving immunogen comprises an immunogen comprising SEQ ID NO:42, SEQ ID NO:45 or SEQ ID NO:46, or a fragment or variant thereof. In some embodiments, the evolving immunogen comprises a variant of SEQ ID NO:42, SEQ ID NO:45 or SEQ ID NO:46 lacking the potential N-linked glycosylation sites (PNGS) at gp120 positions 230, 241, and 344 (“3fill”), or a fragment or variant thereof. In some embodiments, the non-human primate is a rhesus macaque.
[0155] In some embodiments, the assay further comprises using the identified uncommon routes of Env-antibody coevolution as a molecular guide for vaccine design. Therefore, in some embodiments, the assay system allows for identification of HIV-1 immunogens that can function as priming immunogens, boosting immunogens, evolving immunogens, or any combination thereof. Accordingly, the invention also provides priming immunogens, boosting immunogens, evolving immunogens, or any combination thereof, developed using the assay system described.
[0156] In some embodiments, the assay system includes iterative rounds of infection and identification of common Env-antibody co-evolution where an immunogen identified as having a mutation in at least one common route of Env-antibody coevolution in one round is used as the “evolving immunogen” in a subsequent round of immunization / infection / analysis.
[0157] In some embodiments, the assay system is used to generate a mutational map of antibody-Env evolution which drives efficient bNAb generation. In some embodiments, the mutational map is then used for vaccine design by identifying mutations that, when incorporatedAttorney Docket No.046483-6285-00WO into immunogens, promote the formation of efficient bNAbs in immunized subjects. Binding Molecules
[0158] In some embodiments, the disclosure provides antigen binding molecules. In some embodiments, the antigen binding molecules target HIV-1 V3-glycan. In some embodiments, the antigen binding molecule comprises an anti-HIV-1 antibody. In some embodiments, the antigen binding molecule comprises an HIV-1 unmutated common ancestor (UCA) antibody.
[0159] As used herein, the terms “antibody” and “antibodies” include full-length antibodies, antigen-binding fragments of full-length antibodies, and molecules comprising antibody CDRs, VH regions, and / or VL regions. Examples of antibodies include, without limitation, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies comprising two heavy chain and two light chain molecules, an antibody light chain monomer, an antibody heavy chain monomer, an antibody light chain dimer, an antibody heavy chain dimer, an antibody light chain-antibody heavy chain pair, intrabodies, heteroconjugate antibodies, antibody-drug conjugates, single domain antibodies, monovalent antibodies, single-chain antibodies or single-chain Fvs (scFv), camelized antibodies, affibodies, Fab fragments, F(ab’)2fragments, disulfide-linked Fvs (sdFv), anti-idiotypic (anti-Id) antibodies (including, e.g., anti- anti-Id antibodies), and antigen-binding fragments of any of the above. In certain embodiments, antibodies described herein refer to polyclonal antibody populations. Antibodies can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, or IgY), any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1,or IgA2), or any subclass (e.g., IgG2a or IgG2b) of immunoglobulin molecule. In certain embodiments, antibodies described herein are IgG antibodies, or a class (e.g., human IgG1 or IgG4) or subclass thereof.
[0160] Exemplary nucleotide sequences encoding antigen binding molecules are provided in Table 4. Table 4: Antibody and UCA Sequences: Antibody Heavy Chain nucleotide Light Chain nucleotideAttorney Docket No.046483-6285-00WO AJ09-21 SEQ ID NO: 83 SEQ ID NO: 84 AJ09-83 SEQ ID NO: 85 SEQ ID NO: 86 AJ09-110 SEQ ID NO: 87 SEQ ID NO: 88 AM12-352 SEQ ID NO: 89 SEQ ID NO: 90 NN39-92 SEQ ID NO: 91 SEQ ID NO: 92 V634-136 SEQ ID NO: 93 SEQ ID NO: 94 V635-33 SEQ ID NO: 95 SEQ ID NO: 96 V645-158 SEQ ID NO: 97 SEQ ID NO: 98 AJ09-3-UCA SEQ ID NO: 99 SEQ ID NO: 100 AJ09-80-UCA SEQ ID NO: 101 SEQ ID NO: 102 AJ09-110-UCA SEQ ID NO: 103 SEQ ID NO: 104 AM12-340-UCA SEQ ID NO: 105 SEQ ID NO: 106 NN39-90-UCA SEQ ID NO: 107 SEQ ID NO: 108 V634-136-UCA SEQ ID NO: 109 SEQ ID NO: 110 V635-33-UCA SEQ ID NO: 111 SEQ ID NO: 112 V645-20-UCA SEQ ID NO: 113 SEQ ID NO: 114
[0161] In some embodiments, the nucleic acid molecule encoding the heavy chain of the antigen binding molecule comprises a sequence of SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, SEQ ID NO:111, or SEQ ID NO:113.
[0162] In some embodiments, the nucleic acid molecule encoding the light chain of the antigen binding molecule comprises a sequence of SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:110, SEQ ID NO:112, or SEQ ID NO:114.
[0163] In some embodiments, the antigen binding molecules of the invention are used to assay HIV-1 immunogen binding using methods commonly known to those of skill in the art, including, but not limited to, immunoassays, such as the enzyme linked immunosorbent assay (ELISA), immunoprecipitation, or Western blotting. Pharmaceutical Compositions
[0164] The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.Attorney Docket No.046483-6285-00WO
[0165] Although the description of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to subjects of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various subjects is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as non-human primates, cattle, pigs, horses, sheep, cats, and dogs.
[0166] Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for ophthalmic, oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, intravenous, intracerebroventricular, intradermal, intramuscular, or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunogenic-based formulations.
[0167] A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient, which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
[0168] The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w / w) active ingredient.
[0169] In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents.
[0170] Controlled- or sustained-release formulations of a pharmaceutical composition ofAttorney Docket No.046483-6285-00WO the invention may be made using conventional technology.
[0171] As used herein, “parenteral administration” of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intradermal, intrasternal injection, intratumoral, intravenous, intracerebroventricular and kidney dialytic infusion techniques.
[0172] Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e. powder or granular) form for reconstitution with a suitable vehicle (e.g. sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.
[0173] The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3-butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer’s solution, isotonicAttorney Docket No.046483-6285-00WO sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
[0174] A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity. Such a formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 0.5 to about 7 nanometers. In some embodiments, the formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 1 to about 6 nanometers. Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder or using a self-propelling solvent / powder-dispensing container such as a device comprising the active ingredient dissolved or suspended in a low-boiling propellant in a sealed container. In some embodiments, such powders comprise particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 nanometers and at least 95% of the particles by number have a diameter less than 7 nanometers. In some embodiments, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90% of the particles by number have a diameter less than 6 nanometers. In some embodiments, dry powder compositions include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.
[0175] Low boiling propellants generally include liquid propellants having a boiling point of below 65°F at atmospheric pressure. Generally the propellant may constitute 50 to 99.9% (w / w) of the composition, and the active ingredient may constitute 0.1 to 20% (w / w) of the composition. The propellant may further comprise additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (in some instances having a particle size of the same order as particles comprising the active ingredient).
[0176] Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared,Attorney Docket No.046483-6285-00WO packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (e.g., sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.
[0177] The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3-butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer’s solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations that are useful include those that comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer system. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt. Methods of Treatment or Prevention
[0178] The present invention provides methods of inducing an adaptive immune response against HIV-1 in a subject comprising administering an effective amount of a composition comprising an immunogen of the invention, or a nucleic acid molecule encoding an immunogen of the invention. The present invention provides methods of inducing broadly-neutralizing antibodies in the serum capable of recognizing a V3-glycan epitope.
[0179] In one embodiment, the method provides immunity in the subject to HIV-1 virusAttorney Docket No.046483-6285-00WO infection, or to a disease or disorder associated with HIV. The present invention thus provides a method of treating or preventing the infection, disease, or disorder associated with HIV-1 virus.
[0180] In one embodiment, the composition is administered to a subject having an infection, disease, or disorder associated with HIV. In one embodiment, the composition is administered to a subject at risk for developing the infection, disease, or disorder associated with HIV. For example, the composition may be administered to a subject who is at risk for being in contact with HIV. In one embodiment, the composition is administered to a subject who is in contact with or expected to be in contact with another person who has been diagnoses with HIV. In one embodiment, the composition is administered to a subject who has knowingly been exposed to HIV-1 through their occupation, or other contact.
[0181] In one embodiment, the method comprises administering a composition comprising one or more nucleoside-modified nucleic acid molecules encoding one or more HIV- 1 immunogens. In one embodiment, the method comprises administering a composition comprising a one or more nucleoside-modified nucleic acid molecules encoding at least one HIV-1 immunogen described herein.
[0182] In some embodiments, the method of the invention allows for sustained expression of the HIV-1 immunogen, described herein, for at least several days following administration. In some embodiments, the method of the invention allows for sustained expression of the HIV-1 immunogen, described herein, for at least 2 weeks following administration. In some embodiments, the method of the invention allows for sustained expression of the HIV-1 immunogen, described herein, for at least 1 month following administration. However, the method, in some embodiments, also provides for transient expression, as in some embodiments, the nucleic acid is not integrated into the subject genome.
[0183] In some embodiments, the method comprises administering nucleoside-modified RNA, which provides stable expression of the HIV-1 immunogen described herein. In some embodiments, administration of nucleoside-modified RNA results in little to no innate immune response, while inducing an effective adaptive immune response.
[0184] In some embodiments, the method provides sustained protection against HIV. For example, in some embodiments, the method provides sustained protection against HIV-1 for more than 2 weeks. In some embodiments, the method provides sustained protection against HIV-1 for 1 month or more. In some embodiments, the method provides sustained protectionAttorney Docket No.046483-6285-00WO against HIV-1 for 2 months or more. In some embodiments, the method provides sustained protection against HIV-1 for 3 months or more. In some embodiments, the method provides sustained protection against HIV-1 for 4 months or more. In some embodiments, the method provides sustained protection against HIV-1 for 5 months or more. In some embodiments, the method provides sustained protection against HIV-1 for 6 months or more. In some embodiments, the method provides sustained protection against HIV-1 for 1 year or more.
[0185] In one embodiment, a single immunization of the composition induces a sustained protection against HIV-1 for 1 month or more, 2 months or more, 3 months or more, 4 months or more, 5 months or more, 6 months or more, or 1 year or more.
[0186] Administration of the compositions of the invention in a method of treatment can be achieved in a number of different ways, using methods known in the art. In one embodiment, the method of the invention comprises systemic administration of the subject, including for example enteral or parenteral administration. In some embodiments, the method comprises intradermal delivery of the composition. In another embodiment, the method comprises intravenous delivery of the composition. In some embodiments, the method comprises intramuscular delivery of the composition. In one embodiment, the method comprises subcutaneous delivery of the composition. In one embodiment, the method comprises inhalation of the composition. In one embodiment, the method comprises intranasal delivery of the composition.
[0187] It will be appreciated that the composition of the invention may be administered to a subject either alone, or in conjunction with another agent.
[0188] The therapeutic and prophylactic methods of the invention thus encompass the use of pharmaceutical compositions encoding an HIV-1 antigen, adjuvant, or a combination thereof, described herein to practice the methods of the invention. The pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of from 1 ng / kg / day and 100 mg / kg / day. In one embodiment, the invention envisions administration of a dose, which results in a concentration of the compound of the present invention from 10 nM and 10 ^M in a mammal.
[0189] Typically, dosages which may be administered in a method of the invention to a mammal, such as a human, range in amount from 0.01 μg to about 50 mg per kilogram of body weight of the mammal, while the precise dosage administered will vary depending upon anyAttorney Docket No.046483-6285-00WO number of factors, including but not limited to, the type of mammal and type of disease state being treated, the age of the mammal and the route of administration. In some embodiments, the dosage of the compound will vary from about 0.1 μg to about 10 mg per kilogram of body weight of the mammal. In some embodiments, the dosage will vary from about 1 μg to about 1 mg per kilogram of body weight of the mammal.
[0190] The composition may be administered to a mammal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months, several years, or even less frequently, such as every 10-20 years, 15-30 years, or even less frequently, such as every 50-100 years. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the mammal, etc.
[0191] Single or multiple administrations of the compositions may be administered depending on the dosage and frequency as required and tolerated by the subject. In one embodiment, the dosage is administered once as a bolus, but in another embodiment can be applied periodically until a therapeutic result is achieved. Generally, the dose is sufficient to treat or ameliorate symptoms or signs of disease without producing unacceptable toxicity to the subject. Systemic or local administration can be utilized.
[0192] It may be advantageous to administer the immunogenic compositions disclosed herein with other agents such as proteins, peptides, antibodies, and other antiviral agents, such as anti-HIV agents. Examples of such anti-HIV therapeutic agents include nucleoside reverse transcriptase inhibitors, such as abacavir, AZT, didanosine, emtricitabine, lamivudine, stavudine, tenofovir, zalcitabine, zidovudine, and the like, non-nucleoside reverse transcriptase inhibitors, such as delavirdine, efavirenz, nevirapine, protease inhibitors such as amprenavir, atazanavir, indinavir, lopinavir, nelfinavir, fosamprenavir, ritonavir, saquinavir, tipranavir, and the like, and fusion protein inhibitors such as enfuvirtide and the like. In certain embodiments, immunogenic compositions are administered concurrently with other anti-HIV therapeutic agents. In some examples, the disclosed immunogens are administered with T-helper cells, such as exogenous T- helper cells. Exemplary methods for producing and administering T- helper cells can be found in International Patent Publication WO 03 / 020904, which is incorporated herein by reference. In certain embodiments, the immunogenic compositions are administered sequentially with otherAttorney Docket No.046483-6285-00WO anti-HIV therapeutic agents, such as before or after the other agent. One of ordinary skill in the art would know that sequential administration can mean immediately following or after an appropriate period of time, such as hours, days, weeks, months, or even years later.
[0193] The disclosed HIV-1 immunogens or nucleic acids encoding these immunogens can be used in a multistep immunization regime. In some examples, the regime includes administering to a subject a therapeutically effective amount of a first immunogen or immunogenic fragments thereof as disclosed herein (the prime) and boosting the immunogenic response with one or more additional immunogens or immunogenic fragments thereof after an appropriate period of time. The method of eliciting such an immune reaction is what is known as “prime-boost.” In this method, the antibody response to the selected immunogenic surface is focused by giving the subject's immune system a chance to “see” the antigenic surface in multiple contexts. In other words, the use of multiple immunogens or immunogenic fragments thereof with an antigenic surface in common selects for antibodies that bind the immunogen's surface in common.
[0194] In some examples, the immunogens or nucleic acids encoding these immunogens are administered in “prime-boost” immunization regimes. For example, in one embodiment, an immunogen or nucleic acids encoding an immunogen can are administered to a subject as a priming vaccine, a boosting vaccine, or a combination thereof.
[0195] In one embodiment, an HIV-1 immunogen, a nucleic acid molecule encoding an immunogen, a composition comprising an HIV-1 immunogen, or a composition comprising a nucleic acid molecule encoding an HIV-1 immunogen is administered as a priming immunogen or priming vaccine. In one embodiment, the priming immunogen comprises SEQ ID NO:42, SEQ ID NO: 45 or SEQ ID NO:46, or a fragment or variant thereof. In one embodiment, the priming vaccine comprises a nanoparticle comprising an HIV-1 immunogen comprising a sequence as set forth in SEQ ID NO:42, SEQ ID NO: 45 or SEQ ID NO:46, or a fragment or variant thereof. In one embodiment, the priming vaccine comprises a nucleic acid molecule comprising SEQ ID NO:2, SEQ ID NO: 5 or SEQ ID NO:6, or a fragment or variant thereof. In one embodiment, the priming vaccine comprises an mRNA molecule comprising a ribonucleotide sequence corresponding to SEQ ID NO:2, SEQ ID NO: 5 or SEQ ID NO:6, or a fragment or variant thereof. In one embodiment, the priming vaccine comprises a nanoparticle comprising an mRNA molecule comprising a ribonucleotide sequence corresponding to SEQ IDAttorney Docket No.046483-6285-00WO NO:2, SEQ ID NO: 5 or SEQ ID NO:6, or a fragment or variant thereof.
[0196] In one embodiment, an HIV-1 immunogen, a nucleic acid molecule encoding an immunogen, a composition comprising an HIV-1 immunogen, or a composition comprising a nucleic acid molecule encoding an HIV-1 immunogen is administered as a boosting immunogen or boosting vaccine.
[0197] In some embodiments, the boosting vaccine comprises an immunogen comprising SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80, or a fragment or variant thereof. In one embodiment, the boosting vaccine comprises a nanoparticle comprising an HIV-1 immunogen comprising a sequence as set forth in SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80, or a fragment or variant thereof.
[0198] In some embodiments, the boosting vaccine comprises a nucleic acid molecule encoding an immunogen SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQAttorney Docket No.046483-6285-00WO ID NO:79, or SEQ ID NO:80, or a fragment or variant thereof. In some embodiments, the boosting vaccine comprises a nucleic acid molecule comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40, or a fragment or variant thereof.
[0199] In one embodiment, the boosting vaccine comprises an mRNA molecule comprising a ribonucleotide sequence corresponding to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40, or a fragment or variant thereof. In one embodiment, the boosting vaccine comprises a nanoparticle comprising an mRNA molecule comprising a ribonucleotide sequence corresponding to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40, or a fragment or variant thereof.
[0200] One can also use cocktails containing the disclosed immunogenic agents, for example, the immunogen, the nucleic acid encoding the immunogen, or the composition described above, or a combination thereof can be administered in a cocktail with one or more additional agent.Attorney Docket No.046483-6285-00WO
[0201] The prime can be administered as a single dose or multiple doses, for example, two doses, three doses, four doses, five doses, six doses or more can be administered to a subject over days, weeks or months. The boost can be administered as a single dose or multiple doses, for example, two to six doses or more can be administered to a subject over a day, a week or months. Multiple boosts can also be given, such as one to five, or more. Different dosages can be used in a series of sequential inoculations. For example, a relatively large dose in a primary inoculation and then a boost with relatively smaller doses. The immune response against the selected antigenic surface can be generated by one or more inoculations of a subject with an immunogenic composition disclosed herein. EXPERIMENTAL EXAMPLES
[0202] The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
[0203] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the present invention and practice the claimed methods. The following working examples therefore are not to be construed as limiting in any way the remainder of the disclosure. Example 1: Consistent and Rapid Induction of Potent Broadly Neutralizing HIV-1 V3- Glycan Antibodies in Monkeys
[0204] A protective HIV-1 vaccine needs to consistently elicit high titer, broadly neutralizing plasma responses. A major roadblock thus far has been the lack of a tractable model of bNAb induction in outbred animals. Here, this gap was addressed by designing “evolving immunogen” SHIV.5MUT, which induces V3-glycan bNAbs in 64% of macaques and thus represents the first reproducible model of rapid and robust V3-glycan bNAb elicitation in non- human primates. Remarkably, common patterns of Env-antibody coevolution emerged across SHIV.5MUT-infected macaques, allowing us to deconvolute the mechanism of bNAb inductionAttorney Docket No.046483-6285-00WO and use it as a blueprint for vaccine design.
[0205] A main advantage of the SHIV model is that it enables the study of multiple animals infected with SHIVs bearing identical Envs, as opposed to human cohorts in which each individual was infected with a unique transmitted / founder virus. While studies of Env-antibody coevolution in humans who developed bNAbs have yielded important findings (Bonsignori et al., 2017, Sci Transl Med 9; Freund et al., 2017, Sci Transl Med 9; Liao et al., 2013, Nature 496, 469-476), the findings may be difficult to generalize. Here, data showed that SHIV.5MUT induced V3-glycan bNAbs via similar routes in 14 / 22 animals, starting with an early wave of antibodies directed to the subglycosylated and immunogenic V1 region of 5MUT that prompted the in vivo generation of common Env variants with shortened V1 loops. In turn, these variants likely primed V3-glycan bNAb precursors, and subsequent diversification in the Env V1 and V3 regions may have boosted them to breadth and potency by mimicking the natural diversity among circulating HIV-1 strains (Figure 5A). Given this shared bNAb developmental trajectory, it may be possible to mine the extensive Env-antibody coevolution dataset to reverse-engineer a vaccine that replicates the consistent V3-glycan bNAb elicitation observed in SHIV.5MUT infection. Indeed, priming immunogens capable of binding multiple diverse V3-glycan bNAb UCAs have already been designed. These immunogens can be used in a next iteration of sequential immunization trials (Figure 6A). Intriguingly, a similar pattern of V1-directed antibodies driving V1 deletions and precipitating V3-glycan bNAb development was observed in human subject DH270, confirming that this finding is applicable to humans (Bonsignori et al., 2017, Sci Transl Med 9). However, DH270 required more than four years to develop plasma breadth, whereas SHIV.5MUT-infected macaques took less than one year, a timescale more compatible with vaccine development and testing.
[0206] More broadly, the principle of rational glycan modification combined with Env- antibody coevolution may serve as a generalizable strategy for inducing bNAbs against HIV-1 and other persistent viruses. Indeed, the use of Envs lacking specific PNGS sequons as priming immunogens has shown promise at expanding putative precursors to multiple HIV-1 bNAb epitopes (Steichen et al., 2019, Science 366; Steichen et al., 2024, Science 384, eadj8321; Xie et al., 2024, Science 384, eadk0582; Saunders et al., 2019, Science 366; Swanson et al., 2025, Sci Transl Med 17, eadr2218; Steichen et al., 2016, Immunity 45, 483-496; Escolano et al., 2016, Cell 166, 1445-1458.e1412; Escolano et al., 2019, Nature 570, 468-473; Escolano et al., 2021,Attorney Docket No.046483-6285-00WO Sci Transl Med 13, eabk1533; Saunders et al., 2024, Cell 187, 79-94.e24), although optimal boosting regimens capable of guiding these responses to breadth and potency have not yet been identified. The present study teaches routes of Env escape upon infection with selectively glycan-deficient viruses such as SHIV.5MUT that can serve as a roadmap for vaccine design by delineating the identity and order of Env variants needed to induce bNAbs via sequential immunization. Supporting the wide applicability of this method, deletion of N-glycans adjacent to the CD4 binding site was recently shown to enhance elicitation of bNAbs to this epitope in a SHIV model (Morris et al.2025, in press). Similarly, immunization with an exposed, carrier- conjugated fusion peptide followed by SHIV infection resulted in the rapid maturation of vaccine-induced fusion peptide bNAbs in macaques (Wang et al., 2024, Cell 187, 7214- 7231.e7223). Moreover, this strategy may be translatable to other persistent viruses that have eluded antibody-mediated vaccine protection. For example, much like HIV-1 Env, sites of vulnerability on the prefusion HSV-1 glycoprotein B (gB) are heavily glycan-shielded and thus largely immunologically inert (Roark et al.2025, in press). Infecting with an HSV mutant deficient in glycans surrounding one such site and studying subsequent gB-antibody evolution may reveal variants capable of priming and boosting HSV neutralizing antibodies.
[0207] Furthermore, this model demonstrates that lineage-agnostic approaches to inducing V3-glycan bNAbs can be effective. Because there are no common immunogenetic criteria for defining “V3-glycan bNAb precursors,” the HIV-1 vaccine field has focused on eliciting antibodies that resemble the precursors of single lineages (Steichen et al., 2019, Science 366; Steichen et al., 2024, Science 384, eadj8321; Saunders et al., 2019, Science 366; Escolano et al., 2016, Cell 166, 1445-1458.e1412).
[0208] In this lineage-based approach, priming immunogens are designed by engineering stabilized Env trimers or derivatives to maximize binding to a given UCA. Thus, the dearth of high-quality, authentic UCA inferences has been a major roadblock. Additionally, due to the vast diversity in BCR sequence space, it is unlikely that an antibody exactly matching a given UCA will arise in another individual, let alone in an entire population. To circumvent this, proponents of lineage-based vaccine design have come up with somewhat arbitrary rules to define putative precursors based on shared immunogenetic features with a UCA, including gene usage and CDRH3 length, often yielding vanishingly small estimates of precursor frequency in the naïve repertoire (Steichen et al., 2024, Science 384, eadj8321; Swanson et al., 2023, PLoS Pathog 19,Attorney Docket No.046483-6285-00WO e1011401). However, while precursors resembling one specific lineage may be exceedingly rare, the fact that SHIV.5MUT rapidly induces bNAbs in 64% of macaques suggests that bona fide V3-glycan bNAb precursors are both more diverse and more abundant than previously appreciated (Figure 1D). Indeed, SHIV.5MUT elicited bNAbs with varied gene usage and CDRH3 lengths ranging from 14-25 amino acids, suggesting that current precursor definitions may be overly restrictive (Figure 1I). Additionally, lineage-agnostic approaches have the added benefit of potentially inducing different types of V3-glycan bNAbs within the same individual. Indeed, SHIV.5MUT infection induced at least 3 distinct V3-glycan bNAb lineages each in macaques AJ09 and V641, which target the epitope in different ways (Figure 1F and Figure 1H). This is desirable because it would theoretically afford protection against viral variants that are resistant to a particular subclass of V3-glycan bNAbs. Additionally, the number of authentic UCA inferences available for V3-glycan bNAbs was increased, which will facilitate vaccine design.
[0209] A key question is whether these results will be translatable in human clinical trials involving protein- and / or mRNA-based immunogens. In general, the confluence of immunogenetic (Figure 3A, Figure 3D, and Figure3E) and structural (Figure 2A and Figure 2C) similarities between human and macaque V3-glycan bNAbs suggests that responses akin to those induced by SHIV.5MUT should be achievable in humans (Wang et al., 2020, Elife 9). In addition, much like their human counterparts, SHIV.5MUT-induced V3-glycan bNAbs exhibit considerable diversity, suggesting they could be elicited in populations with heterogenous immunoglobulin repertoires. In contrast, vaccine programs targeting classes of HIV-1 bNAbs with restrictive genetic features, such as VRC01-class CD4 binding site bNAbs (that require permissive alleles of IGHV1-2 and rare short CDRL3 loops) and V2-apex bNAbs (that almost exclusively use D3-15 in macaques, for which there is no human homolog), may fall short of achieving maximal efficacy if some individuals lack compatible alleles. Thus, pending preclinical validation in mouse and macaque studies, the immunogens derived from the Env- antibody coevolution dataset will be valuable for clinical trials aimed at stimulating and maturing V3-glycan bNAbs. However, it remains unknown whether the potent plasma neutralization breadth observed in SHIV.5MUT-infected macaques will be readily recapitulated by vaccine schema. In particular, the selection and expansion of potent, on-target B cell responses in the germinal center may be a byproduct of the immune dysregulation inherent in SHIV infection,Attorney Docket No.046483-6285-00WO including Tfh cell depletion. It is plausible that in the context of limiting Tfh cell help, only the highest-affinity B cells can successfully compete for survival signals and thus are able to persist and mature unencumbered by the high levels of interclonal competition expected in healthy vaccinees. Regardless, SHIV.5MUT infection represents the first outbred animal model of rapid and consistent V3-glycan bNAb elicitation, enabling rigorous analysis of common routes of Env- antibody coevolution that can function as a guide for future vaccine design efforts.
[0210] A lineage-agnostic approach was developed to elicit V3-glycan bNAbs via infection with a simian-human immunodeficiency virus (SHIV), SHIV.5MUT, based on a V3- targeting Env trimer immunogen (Steichen et al., 2024, Science 384, eadj8321). SHIV infection is a valuable model as it faithfully recapitulates the molecular dynamics of bNAb induction observed in people living with HIV-1 (PLWH) and enables rigorous analysis of Env-antibody coevolution in multiple macaques infected with the same virus (Roark et al., 2021, Science 371; Li et al., 2016, Proc Natl Acad Sci U S A 113, E3413-3422; Wang et al., 2024, Cell 187, 7214- 7231.e7223). Here, 14 / 22 (64%) SHIV.5MUT-infected macaques develop potent V3-glycan bNAb responses within one year of infection, in contrast to 0 / 14 (0%) controls infected with the parental SHIV.BG505.N332 (p<0.0001, Fisher’s exact test). Twelve monoclonal bNAbs were isolated and characterized from eight animals that exhibit diverse structural and immunogenetic features yet show marked similarity to human V3-glycan bNAbs. Longitudinal SHIV Env and BCR repertoire sequencing revealed common routes of antibody-virus coevolution across animals, with the initial antibody response targeting a hypoglycosylated region of V1 and driving the selection of Env variants with shortened V1 loops, which in turn stimulate V3-glycan bNAb precursor B cells. This dataset was leveraged to infer twelve new macaque V3-glycan bNAb UCAs and design priming immunogens that bind these and several human-derived UCAs. Overall, SHIV.5MUT infection represents the first model of rapid, consistent V3-glycan bNAb elicitation in outbred animals, enabling detailed analysis of Env-antibody coevolution that can serve as a molecular blueprint for vaccine design. The results of the experiments are now described. Rapid induction of plasma breadth in SHIV.5MUT-infected macaques
[0211] The 5MUT Env was originally described as part of a series of BG505-basedAttorney Docket No.046483-6285-00WO immunogens designed to induce PGT121-like V3-glycan bNAbs (Steichen et al., 2016, Immunity 45, 483-496; Escolano et al., 2016, Cell 166, 1445-1458.e1412). It was previously reported that immunizing macaques and other wild-type animals with a series of soluble Env trimer immunogens presented on 60-mer protein nanoparticles, starting with glycan-modified Env trimer immunogens RC1 and 11MUTB followed by 5MUT and a cocktail of wildtype Envs, successfully induced cross-neutralizing antibodies, though they had weak potencies and largely failed to protect against infectious challenge (Steichen et al., 2016, Immunity 45, 483-496; Escolano et al., 2016, Cell 166, 1445-1458.e1412; Escolano et al., 2019, Nature 570, 468-473; Escolano et al., 2021, Sci Transl Med 13, eabk1533). Negative stain electron microscopy-based polyclonal epitope mapping (nsEMPEM) analysis of the serum antibodies suggested that initial responses were on-target but got progressively worse with subsequent boosting (Escolano et al., 2021, Sci Transl Med 13, eabk1533). Therefore, a SHIV bearing a 5MUT Env could act as an “evolving immunogen” to better mature early vaccine-elicited responses, and that analysis of the Env-antibody coevolution could inform the design of boosting immunogens.
[0212] To test this, macaques were immunized with protein (Group 1, n=8) or mRNA (Group 2, n=8) versions of RC1 and 11MUTB and then infected with SHIV.5MUT. A third group was infected with SHIV.5MUT without prior protein or mRNA immunization (Group 3, n=12) (Figure 1A). The protein and mRNA Env trimer constructs were stabilized with MD39 mutations (Steichen et al., 2016, Immunity 45, 483-496) and introduced potential N-linked glycosylation sites (PNGS) at positions 230gp120, 241gp120, and 344gp120(“3fill”) to shield an immunodominant off-target glycan hole (Escolano et al., 2021, Sci Transl Med 13, eabk1533; Klasse et al., 2018, PLoS Pathog 14, e1006913, Wrapp et al., 2023, J Virol 97, e0167322). The membrane-bound mRNA immunogens were further engineered to include an HLA-DR signal peptide, a flexible (GGGGS)2 linker in place of the furin cleavage site, two helix-breaking prolines (Wrapp et al., 2023, J Virol 97, e0167322), and a truncated SIVmac cytoplasmic tail with an endocytosis knockout mutation (Figure 7A). Both RC1-3fill and 11MUTB-3fill mRNA constructs were expressed on the surface of 293F cells in vitro and exhibited favorable antigenic profiles. The protein immunogens were multimerized on 60-mer mi3 nanoparticles (Bruun et al., 2018, ACS Nano 12, 8855-8866; Gristick et al., 2023, Sci Immunol 8, eade6364) and delivered with saponin / MPLA nanoparticle (SMNP) (Silva et al., 2021, Sci Immunol 6, eabf1152) adjuvant as either a bolus (n=4) or as an escalating dose regimen over the course of two weeksAttorney Docket No.046483-6285-00WO (n=4), that has been shown to promote robust, long-lived germinal center responses (Lee et al., 2022, Nature 609, 998-1004; Bhagchandani et al., 2024, Sci Immunol 9, eadl3755). The mRNA immunogens were encapsulated in lipid nanoparticles (LNP) and delivered as a bolus (n=8). All animals developed robust autologous neutralizing plasma responses within 8 weeks of the RC1 prime, although the mean titer was significantly higher in protein- versus mRNA-immunized animals (Figure 7B). Titers increased after boosting with 11MUTB, with the escalating dose subgroup reaching significantly higher titers than the protein bolus or mRNA groups (Figure 7B). There was no cross-neutralization of viruses bearing more native-like Envs including SHIV.5MUT and SHIV.BG505.N332, indicating successful immunofocusing to the V1V3 region of Env (Figure 7B).
[0213] Next, these vaccine-elicited responses were further matured toward breadth by infecting with “evolving immunogen” SHIV.5MUT. The 5MUT Env differs from the parental BG505 at four positions within the V1 loop of gp120 (V134Y, N136P, I138L, and D140N) (Steichen et al., 2016, Immunity 45, 483-496) (Figure 1B), and as such SHIV.5MUT was generated by introducing these substitutions into the previously-described SHIV.BG505.N332, which includes an S375Y mutation known to enable efficient entry into rhesus CD4 T cells (Li et al., 2016, Proc Natl Acad Sci U S A 113, E3413-3422). Using this strategy, a SHIV can be generated from any starting HIV-1 Env (Roark et al., 2021, Science 371; Li et al., 2021, J Virol 95, e00071-21; Li et al., 2016, Proc Natl Acad Sci U S A 113, E3413-3422).
[0214] To confirm that the 5MUT Env assembles on virions, SHIV.5MUT was antigenically profiled by assessing neutralization sensitivity to a panel of bNAbs and antibodies that recognize conformation-dependent epitopes. SHIV.BG505.N332 and SHIV.5MUT were potently neutralized by multiple bNAb classes including those targeting the V3-glycan, V2-apex, and CD4 binding sites, but were largely resistant to antibodies targeting regions exposed in open Env conformations such as CD4i, V2i, V2p, and linear V3 epitopes, confirming expression of intact, well-formed trimers on the virion surface (Figure 7C). Promisingly, SHIV.5MUT exhibited enhanced susceptibility to neutralization by V3-glycan bNAbs, suggesting that the mutations in 5MUT successfully increase accessibility of this epitope (Figure 7C).
[0215] To facilitate viral replication, most animals were treated with anti-CD8^ 2-3 days prior to intravenous inoculation with SHIV.5MUT. SHIV.5MUT productively infected all animals and generally exhibited the expected replication kinetics, with most macaques reachingAttorney Docket No.046483-6285-00WO peak viremia of 107-108vRNA copies / mL at two weeks post-infection and going on to establish stable setpoint viremia (Figure 7D). Five animals that died of accelerated AIDS within the first 20 weeks of infection and one that exhibited an abnormally low viral load were excluded from subsequent analyses.
[0216] The remaining 22 macaques were followed for one year and longitudinally screened plasma neutralization activity against SHIV.5MUT and a panel of 8 heterologous, tier-2 containing a PNGS at N332gp120. All animals developed potent autologous neutralizing responses within the first 12 weeks of infection (mean reciprocal ID50 = 625) that increased over time, plateaued by week 20 (mean reciprocal ID50= 2540), and persisted until at least week 48 (Figure 1C). Heterologous neutralization activity was observed in the plasma by week 24 in many animals that rapidly acquired breadth and potency over the next several weeks. Overall, 14 / 22 (64%) SHIV.5MUT-infected macaques developed robust bNAb responses within 48 weeks of infection, as defined by neutralization of at least 3 / 8 heterologous viruses with ID50titers >1:20 (Figure 1D). Five animals displayed particularly impressive breadth and potency, neutralizing all nine viruses in the panel and achieving ID50 titers >1:1000 (Figure 1D). All bNAb responses mapped to the V3-glycan epitope, as evidenced by substantial reduction or complete abrogation of neutralizing activity against mutant viruses lacking critical V3 residues including N332gp120and R327gp120 (Figure 1E). In stark contrast, 0 / 14 (0%) of SHIV.BG505.N332-infected macaques developed V3-glycan bNAbs within the same 48-week timeframe (p<0.0001, Fisher’s exact test) (Figure 1D). As the 5MUT Env differs from BG505 by only 4 amino acid substitutions in the V1 loop (Figure 1B), these mutations must endow SHIV.5MUT with its propensity to elicit V3- glycan bNAbs. Importantly, the frequency of bNAb elicitation in SHIV.5MUT-infected animals was roughly equivalent between groups, irrespective of prior vaccination, suggesting that SHIV.5MUT itself or a derivative thereof stimulated these bNAb lineages (Figure 1D). Together, these data demonstrate that SHIV.5MUT rapidly and consistently induces broad and potent V3- glycan-directed neutralizing responses in macaques, and thus represents the first reproducible model of V3-glycan bNAb elicitation in outbred animals. Diversity of SHIV.5MUT-elicited V3-glycan bNAbs
[0217] To decipher the various routes of V3-glycan bNAb maturation in these macaques, the monoclonal antibodies (mAbs) responsible for the observed plasma breadth were isolated andAttorney Docket No.046483-6285-00WO characterized. Fluorescence-activated cell sorting was used to isolate heterologous Env-binding IgG+memory B cells from peripheral blood mononuclear cells (PBMCs), in some cases sorting from samples collected after 48 weeks of infection to ensure maximal breadth (Figure 8A). Single Env-specific B cells were sorted into individual wells of a 96-well plate and antibody genes were amplified and sequenced. Representatives of expanded lineages were synthesized as recombinant IgGs and screened for neutralization activity against SHIV.5MUT and a panel of five heterologous viruses (Figure 8B). Antibodies that potently neutralized at least two heterologous viruses were selected for epitope mapping and further testing against a larger panel. In total, 227 mAbs were screened representing 102 distinct lineages from eight macaques, yielding twelve bona fide V3-glycan bNAb lineages (Figure 1F).
[0218] Neutralization profiles of representative mAbs from each of these showed similar plasma breadth to what was observed in the corresponding macaque, suggesting predominant bNAb species were successfully identified (Figure 1D and Figure 1F). To more comprehensively characterize the breadth of these bNAbs, neutralization was tested against a diverse, 119-virus panel containing representatives of all major HIV-1 clades. The breadth of SHIV.5MUT-elicited V3-glycan bNAbs is on par with prototypical human V3-glycan bNAbs including DH270.6, PCDN76-33A, and BF520.1 (Haynes et al., 2023, Nat Rev Immunol 23, 142-158; Bonsignori et al., 2017, Sci Transl Med 9; MacLeod et al., 2016, Immunity 44, 1215-1226; Simonich et al., 2016, Cell 166, 77-87). It is unsurprising that the best human V3-glycan bNAbs (PGT121, PGT128, and BG18) achieve even greater breadth and potency, as they were isolated after protracted chronic infection and evolved over the course of several years or decades, thus accruing substantial somatic hypermutation (Haynes et al., 2023, Nat Rev Immunol 23, 142-158; Freund et al., 2017, Sci Transl Med 9; Walker et al., 2011, Nature 477, 466-470). In contrast, the bNAbs reported here were isolated within 48 weeks of infection. Much like most human V3- glycan bNAbs, most SHIV.5MUT-elicited V3-glycan bNAbs strictly neutralized viruses containing an N332gp120glycan. Interestingly however, mAb AM12-352 was able to neutralize viruses naturally lacking this glycan, thereby widening its coverage to include many clade AE strains that are currently circulating in Asia (Figure 1G) (Hemelaar et al., 2011, Aids 25, 679- 689).
[0219] Next, the epitope of the SHIV.5MUT-elicited bNAbs was phenotypically mapped by assessing diminution of neutralization activity against a series of Q23 mutant viruses lackingAttorney Docket No.046483-6285-00WO critical residues in the V3-glycan epitope. Despite grossly targeting the same V3 region of Env, the twelve bNAb lineages exhibited preferential reliance on different residues within the epitope. Consistent with the heterologous neutralization profiles, all except AM12-352 exhibited a strict dependence on the N332gp120 glycan, which instead required the N301gp120 glycan (Figure 1H). This type of N301gp120-dependent bNAb may represent an even more promising vaccine target than canonical, N332gp120-targeting V3-glycan bNAbs, as the N301gp120glycan is more conserved across HIV-1 strains (Figure 9A). Additionally, as expected, representative mAbs from all lineages depended on D325gp120 or R327gp120 (which comprise the GDIR peptide motif) or downstream H330gp120, although the pattern of dependence varied across lineages. Interestingly, this diversity in the functional epitope was observed both between and within individual animals. For example, three distinct V3-glycan bNAb lineages each were isolated from macaques AJ09 and V641 that exhibited differential dependence on D325gp120, R327gp120, and H330gp120, perhaps indicating cooperative evolution. Encouragingly, these data showed intra-lineage heterogeneity in the functional epitope, isolating several additional members of the AM12-352 lineage that completely depended on the N332gp120, instead of the N301gp120, glycan (Figure 9B). To be protective, an immunization regimen would ideally accomplish something similar, as inducing various bNAb lineages or sub-lineages that target the same epitope in different ways could preclude infection by viral strains that have evolved to escape a given class of V3-glycan bNAbs.
[0220] Next, this study was aimed to understand how amenable these SHIV.5MUT- induced V3-glycan bNAbs might be to vaccine elicitation by querying their sequences. bNAbs often include rare immunogenetic features thought to impede their development including strict allelic requirements, very long CDRH3 loops, indels, and extensive somatic hypermutation. Promisingly, these bNAbs utilized diverse VH3- and VH4-family genes (Figure 1I), which comprise the most common VH alleles in both humans and macaques (Vázquez Bernat et al., 2021, Immunity 54, 355-366.e354; Ramesh et al., 2017, Front Immunol 8, 1407; Matsuda et al., 1998, J Exp Med 188, 2151-2162), and predominantly used JH5 and JH6 genes, which are known to contribute to CDRH3 length. Thus, there did not seem to be a strict requirement for certain immunoglobulin alleles, as is the case for macaque V2-apex bNAbs (which require D3-15) or human CD4 mimetic bNAbs (which require VH1-2 or VH1-46) (Sok wt al., 2018, Nat Immunol 19, 1179-1188; Haynes et al., 2023, Nat Rev Immunol 23, 142-158). The median CDRH3 length was 20 amino acids (range: 14-25) (Figure 1I), which is well-represented in the human andAttorney Docket No.046483-6285-00WO macaque repertoires (Briney et al., 2019, Nature 566, 393-397; Joyce et al., 2020, Sci Rep 10, 1120).
[0221] Additionally, most lineages did not include indels, except the AM12-352 and NN39-92 lineages that had insertions in CDRH2 (Figure 1I). The average frequency of VH somatic mutation was 8.0% at the nucleotide level (Figure 1I), lower than that of previously described V3-glycan bNAbs (Haynes et al., 2023, Nat Rev Immunol 23, 142-158), implying that once primed, these lineages may not require extensive boosting to achieve breadth and potency. Together, the immunogenetic diversity of the SHIV.5MUT-induced V3-glycan bNAbs and lack of apparent rare features suggests that such bNAb precursors may be more prevalent in the naïve B cell repertoire than previously appreciated, further supporting targeting of the V3-glycan epitope through vaccination. Structural characterization of macaque V3-glycan bNAbs
[0222] To understand how the SHIV.5MUT-elicited V3-glycan bNAbs interact with Env at a molecular level, Cryo-EM structures of antibody Fabs in complex with 5MUT-3fill SOSIP Env trimers were solved. As predicted by the phenotypic mapping (Figure 1F and Figure 9B), all bNAbs recognized the V3-glycan epitope, contacting residues in324GDIR327as well as the N332gp120 glycan (Figure 2A and Figure 2B). Consistent with their diverse immunogenetics, they displayed various angles of approach / binding poses and modes of epitope engagement.
[0223] Interestingly, despite the overall diversity, data showed structural and phylogenetic similarities between human and macaque V3-glycan bNAbs. For example, even though PGT128 (human) and AM12-352 (macaque) exhibit different angles of approach / binding poses (Figure 2A), their CDRH3 loops exhibit structural microhomology (Figure 2C). Additionally, the evolution of the AM12-352 lineage mirrors that of the PGT128 lineage – both split into sub-lineages defined by CDRH2 insertions that contribute to neutralization breadth (Doores et al., 2015, J Virol 89, 1105-1118). Multiple members of the AM12-352 lineage were isolated, which segregated / clustered into three clades characterized by three distinct insertions in CDRH2. Longitudinal deep BCR repertoire sequencing of peripheral IgG+B cells revealed that the sub-lineages split post-infection following three independent insertion events (Figure 2D). Representatives of each sub-lineage (AM12-352, AM12-340, and AM12-347 mAbs) demonstrated distinct neutralization profiles. AM12-352 was the only mAb that neutralizedAttorney Docket No.046483-6285-00WO viruses lacking the N332gp120-glycan, instead exhibiting a strong functional dependence on the N301gp120-glycan. Removing the CDRH2 insertions from all three mAbs severely diminished neutralization breadth and potency (Figure 2E). Fab-Env structures showed that these insertions interacted with the N301gp120 glycan (Figure 2F). This is reminiscent of the PGT128 lineage, in which a CDRH2 insertion increases contact with the N332gp120 glycan and enhances breadth against viruses containing this glycan, whereas lineage members without the insertion (e.g., PGT130) can better neutralize N334gp120-glycan-containing viruses (Doores et al., 2015, J Virol 89, 1105-1118).
[0224] Despite the fact that SHIV.5MUT-elicited V3-glycan bNAbs used diverse immunoglobulin genes, the data showed that the broadest bNAbs from two different macaques had nearly identical light chains, using IGKV2-ACL*01-S1235 and IGKJ1*01 (Figure 1I). Inference of V3-glycan bNAb UCAs
[0225] Next, this study was aimed to understand the elicitation and evolution of these SHIV.5MUT-induced V3-glycan bNAb lineages in more detail. A boon of this SHIV model is that it enables the rigorous longitudinal BCR analyses required to infer high-confidence UCAs, which are critical to identifying Env variants capable of priming these types of lineages via vaccination. First, an individualized immunoglobulin repertoire reference was constructed for each macaque by deep sequencing the BCRs of naïve IgM+IgD+peripheral B cells and assigning animal-specific germline alleles with IgDiscover (Corcoran et al., 2016, Nat Commun 7, 13642). In parallel, IgG+B cells were sorted and sequenced from draining lymph nodes (post- immunization, Groups 1-2) and PBMCs (post-infection, Groups 1-3) at multiple timepoints, using the SONAR analysis pipeline (Schramm et al., 2016, Front Immunol 7, 372) to trace the evolution of the bNAb lineages. BCR sequences from eight macaques were analyzed to infer twelve high-confidence V3-glycan bNAb UCAs (Figure 3A).
[0226] To determine when these lineages were initiated, the BCR sequencing dataset was queried to identify the earliest timepoint at which lineage member sequences were detected in each animal. These data did not show lineage members in the draining lymph node or PBMC compartments of vaccinated animals (Groups 1 and 2) prior to infection with SHIV.5MUT, suggesting that the protein and mRNA immunizations did not prime these bNAb lineages. In contrast, results showed early members within 12-24 weeks of infection in all groups (FigureAttorney Docket No.046483-6285-00WO 3B), indicating that SHIV.5MUT or a derivative thereof likely initiated all bNAb lineages. This timing is consistent with the development of plasma neutralization breadth, which typically began 20-32 weeks post-infection in animals that made bNAbs.
[0227] These lineages developed neutralization breadth and comparatively low rates of somatic mutation (Figure 1I). Further, these data showed that most structurally-identified contact residues were UCA-encoded rather than the product of somatic hypermutation (Figure 3A and Figure 3C). Next, the probability of occurrence of each somatic mutation was analyzed using the ARMADiLLO computational pipeline, which takes into account both the number of nucleotide substitutions required to make a nonsynonymous change as well as the predilection of activation- induced cytidine deaminase (AID) to target certain sequence motifs (Martin Beem et al., 2023, Nucleic Acids Res 51, W51-w56). Promisingly, of the non-UCA-encoded contact residues, many were predicted to be “probable” (>2%) mutations that may be relatively easy to replicate via vaccination (Figure 3A and Figure 3C).
[0228] Next, to assess clinical relevance to humans, human VH and VL alleles with high similarity to these macaque V3-glycan bNAbs were identified. Encouragingly, closely related human immunoglobulin genes were found for all bNAbs, with average identities of 89% (VH) and 90% (VL) at the amino acid level (Figure 3A and Figure 3D). Many of these were alleles of the same genes used by canonical human V3-glycan bNAbs: IGHV4-34 (used by PCDN-38A), IGHV4-59 (used by PGT121), and IGHV4-39 (used by PGT128) (Figure 3A) (Haynes et al., 2023, Nat Rev Immunol 23, 142-158 (2023). Additionally, more than 50% of combined VH and VL contact residues were conserved in the closest human allele (Figure 3E). Together, these results suggest that bNAbs akin to those described here should be readily elicitable in humans, and that their developmental trajectories to breadth and potency are relatively straightforward and may not necessitate extensive boosting regimens. As such, these new UCAs have great potential to serve as the foundation for the next generation of HIV-1 vaccine design efforts. Mechanism of consistent V3-glycan bNAb induction
[0229] Next, this study was aimed to decipher the mechanism of consistent V3-glycan bNAb elicitation in SHIV.5MUT-infected macaques and leverage it for vaccine design. To this end, SHIV Env evolution was longitudinally analyzed in vivo via single-genome sequencing of circulating plasma virion RNA (Salazar-Gonzalez et al., 2008, J Virol 82, 3952-3970; Keele etAttorney Docket No.046483-6285-00WO al., 2008, Proc Natl Acad Sci U S A 105, 7552-7557). To pinpoint Env variants that may be causally implicated in bNAb elicitation, Env sequencing data from macaques infected with SHIV.5MUT was compared versus the parental SHIV.BG505.N332, which show different propensities to induce V3-glycan bNAbs despite differing by only four residues in V1 (Figure 1B).
[0230] To assess differences in Env evolution, Hamming distance at each residue was analyzed over time using a ten amino acid sliding window. The greatest magnitude and most significant difference was strong, rapid selection within the V1 loop of Env in all SHIV.5MUT- but not SHIV.BG505.N332-infected macaques (Figure 10). This selection began as early as week 4 post-infection and progressed so quickly that by week 16, no unmutated SHIV.5MUT V1 sequences were detectable (Figure 4A). Given that data showed early lineage members by week 12-16 post-infection in most animals that developed bNAbs (Figure 3B), it was reasoned that the Env variants circulating shortly prior must have primed them. Therefore, the next experiments focused on V1 mutants present at weeks 8-12 post-infection. Remarkably, common patterns of escape emerged across all SHIV.5MUT-infected animals, with variants containing mutations at P136gp120, R143gp120, or V1 deletions dominating the early viral quasispecies (Figure 4B). The most common mutants in this timeframe were the P136S variant (observed in 20 / 22 macaques at frequencies of 1-89%) and the Δ135-138gp120 / Δ136-139gp120 (del4) variants, both of which gave rise to the same shortened V1 amino acid sequence (present in 19 / 22 animals at frequencies of 7- 62%) (Figure 4B). Other shared deletion mutants included Δ137-139 (del3) and Δ132-139 (del8) (Figure 4B). To narrow down which of these common V1 variants likely primed the bNAb lineages, SHIVs bearing representative Envs were generated, including SHIV.5MUT.del4 (“SHIV.del4”), SHIV.5MUT.del8 (“SHIV.del8”), SHIV.5MUT.P136T, and SHIV.5MUT.R143G. Experiments were then used to test the ability of these bNAbs to neutralize these viruses, expecting the best priming Env candidates to better expose the V3-glycan epitope and thus exhibit enhanced neutralization sensitivity. Promisingly, SHIV.del4 and SHIV.del8 were neutralized with significantly greater potency than the parental SHIV.5MUT, whereas the P136T variant was more resistant to neutralization and the R143G variant showed no change (Figure 4C). Consistent with the hypothesis that these or other early V1 variants initiated the bNAb lineages, these data showed subsequent selection in the V3-glycan epitope starting at week 16 post-infection in the SHIV.5MUT-infected animals that went on to develop plasma breadth,Attorney Docket No.046483-6285-00WO likely reflecting pressure exerted by burgeoning bNAb lineage members (Figure 4D). Neither the V1 nor the V3 selection went to fixation, indicating persistent antibody-mediated pressure (Figure 4E). Indeed, the continued V3 evolution likely contributed to bNAb maturation, as the residues sampled in the escape variants are frequently used by other M-group viruses, thereby “teaching” the bNAbs to accommodate relevant heterogeneity in the epitope and enabling them to neutralize diverse HIV-1 strains (Figure 4E). In contrast, SHIV.BG505.N332-infected macaques showed minimal V1 and V3 selection throughout the first 48 weeks of infection (Figure 4A, Figure 4B, and Figure 4D).
[0231] To understand the basis of the different V1 selection phenotypes observed in SHIV.5MUT- versus SHIV.BG505.N332-infected macaques, the next studies focused on the four distinguishing residues in V1 (Figure 1B). BG505 contains potential N-linked glycosylation sites (PNGSs) within the V1 loop at N133gp120 and N137gp120 (Struwe et al., 2018, Cell Rep 24, 1958- 1966.e1955; Derking et al., 2021, Cell Rep 35, 108933), comprising part of the glycan shield thought to dampen the immunogenicity of HIV-1 Env (McCoy et al., 2016, Cell Rep 16, 2327- 2338; Klasse et al., 2018, PLoS Pathog 14, e1006913). While 5MUT retains both these PNGS sequons, they are adjacent to a proline introduced at position gp120136 (Figure 1B). Given that a proline residue immediately before or after a PNGS sequon reduces N-glycan occupancy (Steichen et al., 2024, Science 384, eadj8321; Mellquist et al., 1998, Biochemistry 37, 6833- 6837; Bañó-Polo et al., 2011, Protein Sci 20, 179-186), it was hypothesized that the N133gp120and / or N137gp120PNGS in 5MUT may be suboptimally glycosylated. Glycan analysis by mass spectrometry confirmed that the N133gp120 PNGS in 5MUT shows a reduced level of glycosylation (Figure 4F and Figure 11). Reduced V1 glycosylation could enhance 5MUT immunogenicity as compared to the parental BG505, inducing a targeted humoral response that may account for the V1 selection. Indeed, most of the shared V1 variants between macaques eliminated the P136gp120 residue by point mutation or deletion (Figure 4B), ostensibly restoring V1 glycosylation and escaping the early plasma neutralizing response.
[0232] Given that V1 selection preceded bNAb lineage initiation and subsequent V3 selection in SHIV.5MUT-infected animals, it was hypothesized that bNAb elicitation may occur via a two-step process. Specifically, a model was proposed whereby an initial wave of V1- directed antibodies exert selective pressure on the V1-glycan-deficient 5MUT Env, prompting escape mutants that shorten the V1 loop and expose the underlying V3-glycan epitope, which inAttorney Docket No.046483-6285-00WO turn prime V3-glycan bNAb precursor B cells (Figure 5A). To test this model, the initial plasma response were mapped against early V1 variant viruses SHIV.del4, SHIV.del8, and SHIV.5MUT.P136T. Consistently, data showed a significant reduction in neutralization activity against these variants compared to the parental SHIV.5MUT, confirming that a substantial portion of the early neutralizing response is V1-directed (Figure 5B). Next, the antibodies responsible for driving the generation of these V1 escape variants in vivo were isolated by sorting single 5MUT++del4- or 5MUT++BG505- IgG+B cells from PBMCs, amplifying their antibody genes, and synthesizing representative mAbs. In total, two V1-specific lineages were identified from different macaques that recapitulated the early plasma phenotype, potently neutralizing SHIV.5MUT but not the V1 escape variants (Figure 5C). To better understand the interaction of these V1-directed mAbs with Env, a single-particle Cryo-EM structure of NN39-25 Fab in complex with 5MUT-3fill Env was solved.
[0233] Having shown that induction of V1-directed antibodies like NN39-25 likely led to the selection of V1 variants in vivo, this study next aimed to characterize the variant Envs themselves. These experiments focused on the del4 and del8 variants because SHIVs bearing these Envs exhibited enhanced neutralization sensitivity to V3-glycan bNAbs (Figure 4C), suggesting they may provide increased epitope accessibility and thus enable UCA binding. Additionally, the V1 loop directly overlies the V3-glycan epitope in pre-fusion Env, lending credence to the hypothesis that shortening V1 may increase epitope exposure.
[0234] Together, these data support a model in which a hypo-glycosylated SHIV.5MUT induces an early wave of V1-directed antibodies that drive the acquisition of Env V1 deletions. Such variants, typified by del4 and del8, expose the underlying V3-glycan epitope and likely prime bNAb precursors. Env-antibody coevolution informs lineage-agnostic immunogen design
[0235] Next, the robust antibody-Env coevolution dataset was leveraged to design priming immunogens capable of stimulating diverse V3-glycan bNAb UCAs in an epitope- rather than lineage-based manner. Based on the sequencing (Figure 4B) and functional (Figure 4C) data, del4 and del8 were selected as the best candidate immunogens and generated an mRNA-encoded version of each, employing the same stabilization strategy as above (Figure 7). For comparison, additionally mRNA constructs encoding other V1 variants (del3 andAttorney Docket No.046483-6285-00WO 5MUT.P136S.R143K) were generated as well as controls (5MUT and BG505.N332). These immunogens were expressed on the surface of 293F cells and binding to a panel of human and macaque V3-glycan bNAb UCAs was assessed (Figure 3A). All constructs expressed high levels of intact trimers on the cell surface, as evidenced by robust binding of bNAbs PGT145 and PGDM1400, which recognize quaternary epitopes (Figure 6A). As expected, given their full- length, glycosylated V1 loops, neither BG505.N332 nor 5MUT.P136S.R143K exhibited detectable binding (>2-fold over background) to any UCA tested, and V1-glycan-deficient 5MUT showed only low-level binding to 3 / 11 UCAs. In contrast, immunogens with shorter V1 loops and fewer glycans (del3, del4, and del8) were able to bind 5 or 6 UCAs each, and did so much more robustly than 5MUT. Interestingly, in some cases the UCA binding pattern was complementary, with del4 and del8 together hitting 7 / 11 UCAs (Figure 6A). Together, these data suggest that the priming immunogens have the potential to bind and stimulate multiple, diverse V3-glycan bNAb precursors and thus represent promising candidates to carry forward into the next iteration of vaccine trials.
[0236] There were three UCAs that did not exhibit detectable binding to any of these immunogens, including AM12-340-UCA and AJ09-80-UCA. To better understand what may have primed these lineages in vivo, intermediate mAbs from various stages of lineage maturation were produced by artificially pairing heavy and light chains inferred from the longitudinal BCR repertoire sequencing dataset (Figure 12A). These studies detected binding to early inferred ancestor (IA) mAbs from both lineages: AJ09-80-IA1 bound del3 and AM12-340-IA2 bound 5MUT, and binding increased as more mature lineage members were tested (Figure 12B). Despite undetectable binding to AM12-340-UCA and AJ09-80-UCA in vitro, it is possible that del3 and 5MUT stimulated these lineages in vivo. The binding threshold for BCR activation in a germinal center remains poorly understood and given the avidity effects afforded by the follicular dendritic cell network, it is possible that the limit of detection of this flow-based assay was too low to capture physiologically relevant low-level binding. Additionally, given the minimal Env diversity in the circulating quasispecies around the time these lineages were initiated (week 8-12), representatives of most major variants were able to be synthesized and tested, and as such there remain few other plausible priming Envs. However, the possibility that these experiments failed to synthesize the correct variants, or that the few mutations in regions of Env other than V1 are functionally important to priming cannot be excluded.Attorney Docket No.046483-6285-00WO
[0237] Despite evidence that del3, del4, and del8 likely primed most V3-glycan bNAb lineages in this study, their presence alone was not sufficient to guarantee bNAb elicitation. Indeed, the del4 variant appeared in 19 / 22 animals between weeks 8-12 (Figure 4B), yet not all of them went on to make bNAbs. One explanation is that the frequency of bNAb precursor B cells is prohibitively low, and that several macaques did not make bNAbs because they did not have B cells expressing the “correct” BCR in their naïve repertoire. While this has been postulated for certain subclasses of bNAbs that resemble a single human-derived UCA (Steichen et al., 2024, Science 384, eadj8321), it is likely not the case here, as del3, del4, and del8 recognized immunogenetically and structurally diverse BCRs (Figure 6A). Another possibility is that all macaques had the potential to make bNAbs, but antigen drive was too low in the subset that failed to do so. Consistent with this hypothesis, the non-bNAbers had a significantly lower setpoint viral load over the course of infection (Figure 7D) and correspondingly low autologous plasma neutralization titers (Figure 7D), suggesting the relative dearth of antigen may have hampered the generation of an immune response robust enough to produce bNAbs. Relatedly, it is possible that the V1 variant Envs primed bona fide bNAb precursors even in the non-bNAbers, but subsequent Env evolution was not conducive to boosting these responses toward breadth. Indeed, data showed V3 selection in several non-bNAbers, although it was delayed (consistent with lower antigen load) and transient (perhaps indicating inappropriate boosting) (Figure 4D).
[0238] To gain insight into how Env evolution promoted the acquisition of breadth after priming in the bNAbers and to inform the rational design of vaccine boosting strategies, the next experiments focused on the longitudinal single-genome sequencing dataset (Figure 10). While early Env evolution was quite conserved among all SHIV.5MUT-infected macaques, late Env evolution was more varied and certain patterns emerged that stratified by bNAb status. For example, in addition to the expected selection within the V3-glycan epitope (Figure 4D), bNAbers also showed a progressive lengthening of the V1 loop during bNAb maturation, which was accompanied by an increase in number V1 PNGS sequons (Figure 6B). These escape variants were likely the result of pressure exerted by the bNAb lineages themselves and thus represent a valuable roadmap of how to boost V3-glycan bNAbs to breadth once primed. In particular, these results imply that booster immunogens should gradually elongate V1, to better reflect the variety of V1 lengths in currently-circulating viruses, and incorporate diversity into the V3-glycan epitope. Additionally, the absence of these boosting variants in vivo may haveAttorney Docket No.046483-6285-00WO precluded bNAb development in the non-bNAbers that displayed hints of on-target priming (Figure 4D and Figure 6B). Overall, this analysis of concurrent V3-glycan bNAb development and Env evolution in SHIV.5MUT-infected macaques has yielded a detailed molecular blueprint for bNAb elicitation that may be translatable to human vaccine trials. Example 2: Sequences pUC-ccTEV-RC1.3Fill.PP-A101–SEQ ID NO:1 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacgcccccaacctgctgtccaacatgcgcggcgagctgaagcagtgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacttcggcgacatcatcggcgacatccgcatggcccact gcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggc ggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcaggg ctccaactccaccggctccaacgactccatcgtgctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccag ggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgc gcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcg gctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgca ggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcag ctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaa ctcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggag gagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaa gatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctccccccc ctcctacttccagtaataa pUC-ccTEV-BG505.5Mut.MD39.3Fill-A101-SEQ ID NO:2 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacacccccaacctgaccaacgacatgcgcggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggccca ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccgg cggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagg gctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcca gggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatg cgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggc ggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgc aggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagca gctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgga actcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgga ggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatca agatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccc cctcctacttccagtaataaAttorney Docket No.046483-6285-00WO pUC-ccTEV-BG505.N332.MD39.3Fill-A101–SEQ ID NO:3 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaacgtgaccaacaacatcaccgacgacatgcgcggcgagctgaagaactgc tccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaac aactccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgcc ggcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacc cagctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgca gatcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggccc actgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccg gcggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcag ggctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcc agggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacat gcgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcgg cggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtg caggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagc agctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgg aactcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgg aggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatc aagatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctccccc ccctcctacttccagtaataa pUC-ccTEV-BG505.MD39.3Fill-A101–SEQ ID NO:4 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaacgtgaccaacaacatcaccgacgacatgcgcggcgagctgaagaactgc tccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaac aactccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgcc ggcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacc cagctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgca gatcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggccc actgcaccgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccg gcggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcag ggctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcc agggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacat gcgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcgg cggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtg caggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagc agctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgg aactcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgg aggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatc aagatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctccccc ccctcctacttccagtaataa pUC-ccTEV-5Mut.d135-138-A101–SEQ ID NO:5 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacaccaacgacatgcgcggcgagctgaagaactgctccttcaacatga ccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaag gagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcc tgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctga acggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcaccAttorney Docket No.046483-6285-00WO cgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggcccactgcaacgtgtc caaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctgg aggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactcca ccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatcc gctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactg gcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcg gcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaa cctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcc cgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctgg tccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccag aaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatca tgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttcc agtaataa pUC-ccTEV-5Mut.d132-139-A101–SEQ ID NO:6 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaacgacatgcgcggcgagctgaagaactgctccttcaacatgaccaccgagctgc gcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaaggagtaccgcctg atcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcctgaagtgcaaga acaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctgaacggctccctgg ccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacccgccccaacaac aacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggcccactgcaacgtgtccaaggccacctg gaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctggaggtgaccaccc actccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactccaccggctccaacg actccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatccgctgcgtgtccaa catcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactggcgctccgagctg tacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcggcggcggctccgc cgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaacctgctgtccggca tcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcccgcgtgctggccgt ggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctggtccaaccgcaacct gtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccagaaccagcaggaga agaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatcatgatcgtgggcggc ctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttccagtaataa pUC-ccTEV-5Mut.d132-139.R143E-A101–SEQ ID NO:7 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaacgacatggagggcgagctgaagaactgctccttcaacatgaccaccgagctgc gcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaaggagtaccgcctg atcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcctgaagtgcaaga acaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctgaacggctccctgg ccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacccgccccaacaac aacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggcccactgcaacgtgtccaaggccacctg gaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctggaggtgaccaccc actccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactccaccggctccaacg actccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatccgctgcgtgtccaa catcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactggcgctccgagctg tacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcggcggcggctccgc cgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaacctgctgtccggca tcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcccgcgtgctggccgt ggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctggtccaaccgcaacct gtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccagaaccagcaggagaAttorney Docket No.046483-6285-00WO agaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatcatgatcgtgggcggc ctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttccagtaataa pUC-ccTEV-5Mut.d132-139.R143G-A101–SEQ ID NO:8 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaacgacatgggcggcgagctgaagaactgctccttcaacatgaccaccgagctgc gcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaaggagtaccgcctg atcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcctgaagtgcaaga acaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctgaacggctccctgg ccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacccgccccaacaac aacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggcccactgcaacgtgtccaaggccacctg gaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctggaggtgaccaccc actccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactccaccggctccaacg actccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatccgctgcgtgtccaa catcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactggcgctccgagctg tacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcggcggcggctccgc cgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaacctgctgtccggca tcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcccgcgtgctggccgt ggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctggtccaaccgcaacct gtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccagaaccagcaggaga agaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatcatgatcgtgggcggc ctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttccagtaataa pUC-ccTEV-5Mut.SK-A101–SEQ ID NO:9 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacacctccaacctgaccaacgacatgaagggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggccca ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccgg cggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagg gctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcca gggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatg cgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggc ggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgc aggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagca gctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgga actcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgga ggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatca agatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccc cctcctacttccagtaataa pUC-ccTEV-5Mut.N133.137KO-A101–SEQ ID NO:10 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcacccagtacaccccccagctgaccaacgacatgcgcggcgagctgaagaactgc tccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaac aactccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgcc ggcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccAttorney Docket No.046483-6285-00WO cagctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgca gatcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggccc actgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccg gcggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcag ggctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcc agggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacat gcgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcgg cggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtg caggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagc agctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgg aactcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgg aggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatc aagatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctccccc ccctcctacttccagtaataa pUC-ccTEV-5Mut.N133KO-A101–SEQ ID NO:11 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcacccagtacacccccaacctgaccaacgacatgcgcggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggccca ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccgg cggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagg gctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcca gggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatg cgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggc ggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgc aggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagca gctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgga actcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgga ggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatca agatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccc cctcctacttccagtaataa pUC-ccTEV-5Mut.N137KO-A101–SEQ ID NO:12 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacaccccccagctgaccaacgacatgcgcggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggccca ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccgg cggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagg gctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcca gggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatg cgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggc ggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgc aggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcaAttorney Docket No.046483-6285-00WO gctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgga actcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgga ggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatca agatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccc cctcctacttccagtaataa pUC-ccTEV-BG505.MD39.3Fill.d134-137-A101–SEQ ID NO:13 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaacctgaccaacgacatgcgcggcgagctgaagaactgctccttcaacatga ccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaag gagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcc tgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctga acggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacc cgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggcccactgcaacgtgtc caaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctgg aggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactcca ccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatcc gctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactg gcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcg gcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaa cctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcc cgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctgg tccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccag aaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatca tgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttcc agtaataa pUC-ccTEV-BG505.MD39.3Fill.d137-139-A101–SEQ ID NO:14 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacacccccaacgacatgcgcggcgagctgaagaactgctccttcaacat gaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaaca aggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccat cctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgct gaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgca cccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggcccactgcaacgtg tccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacct ggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactc caccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgat ccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaac tggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggc ggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgca acctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggc ccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctg gtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtccca gaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatc atgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttc cagtaataa pUC-ccTEV-5Mut.R327K-A101–SEQ ID NO:15 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggaccAttorney Docket No.046483-6285-00WO agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacacccccaacctgaccaacgacatgcgcggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatcaagcaggccca ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccgg cggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagg gctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcca gggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatg cgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggc ggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgc aggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagca gctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgga actcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgga ggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatca agatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccc cctcctacttccagtaataa pUC-ccTEV-BG505.d132-139.R327K-A101SEQ ID NO:16 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaacgacatgcgcggcgagctgaagaactgctccttcaacatgaccaccgagctgc gcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaaggagtaccgcctg atcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcctgaagtgcaaga acaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctgaacggctccctgg ccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacccgccccaacaac aacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatcaagcaggcccactgcaacgtgtccaaggccacctg gaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctggaggtgaccaccc actccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactccaccggctccaacg actccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatccgctgcgtgtccaa catcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactggcgctccgagctg tacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcggcggcggctccgc cgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaacctgctgtccggca tcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcccgcgtgctggccgt ggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctggtccaaccgcaacct gtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccagaaccagcaggaga agaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatcatgatcgtgggcggc ctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttccagtaataa pUC-ccTEV-BG505.d135-138.R327K-A101–SEQ ID NO:17 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacaccaacgacatgcgcggcgagctgaagaactgctccttcaacatga ccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaag gagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcc tgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctga acggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacc cgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatcaagcaggcccactgcaacgtgtc caaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctgg aggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactcca ccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatcc gctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactg gcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcgAttorney Docket No.046483-6285-00WO gcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaa cctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcc cgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctgg tccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccag aaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatca tgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttcc agtaataa pUC-ccTEV-BG505.d135-138.GNIK-A101–SEQ ID NO:18 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacaccaacgacatgcgcggcgagctgaagaactgctccttcaacatga ccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaag gagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcc tgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctga acggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacc cgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcaacatcaagcaggcccactgcaacgtgtc caaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctgg aggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactcca ccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatcc gctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactg gcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcg gcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaa cctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcc cgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctgg tccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccag aaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatca tgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttcc agtaataa pUC-ccTEV-BG505.d132-139.GNIK-A101–SEQ ID NO:19 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaacgacatgcgcggcgagctgaagaactgctccttcaacatgaccaccgagctgc gcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaaggagtaccgcctg atcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcctgaagtgcaaga acaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctgaacggctccctgg ccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacccgccccaacaac aacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcaacatcaagcaggcccactgcaacgtgtccaaggccacctg gaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctggaggtgaccaccc actccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactccaccggctccaacg actccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatccgctgcgtgtccaa catcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactggcgctccgagctg tacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcggcggcggctccgc cgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaacctgctgtccggca tcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcccgcgtgctggccgt ggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctggtccaaccgcaacct gtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccagaaccagcaggaga agaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatcatgatcgtgggcggc ctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttccagtaataa pUC-ccTEV-5Mut.GNIK-A101–SEQ ID NO:20 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccgaAttorney Docket No.046483-6285-00WO ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacacccccaacctgaccaacgacatgcgcggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcaacatcaagcaggccca ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccgg cggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagg gctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcca gggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatg cgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggc ggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgc aggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagca gctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgga actcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgga ggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatca agatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccc cctcctacttccagtaataa pUC-ccTEV-5Mut.GNIR-A101–SEQ ID NO:21 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacacccccaacctgaccaacgacatgcgcggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcaacatccggcaggccca ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccgg cggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagg gctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcca gggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatg cgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggc ggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgc aggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagca gctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgga actcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgga ggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatca agatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccc cctcctacttccagtaataa pUC-ccTEV-BG505.d132-139.GNIR-A101–SEQ ID NO:22 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaacgacatgcgcggcgagctgaagaactgctccttcaacatgaccaccgagctgc gcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaaggagtaccgcctg atcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcctgaagtgcaaga acaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctgaacggctccctgg ccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacccgccccaacaac aacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcaacatccggcaggcccactgcaacgtgtccaaggccacctg gaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctggaggtgaccaccc actccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactccaccggctccaacg actccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatccgctgcgtgtccaaAttorney Docket No.046483-6285-00WO catcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactggcgctccgagctg tacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcggcggcggctccgc cgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaacctgctgtccggca tcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcccgcgtgctggccgt ggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctggtccaaccgcaacct gtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccagaaccagcaggaga agaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatcatgatcgtgggcggc ctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttccagtaataa pUC-ccTEV-BG505.d135-138.GNIR-A101-SEQ ID NO:23 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacaccaacgacatgcgcggcgagctgaagaactgctccttcaacatga ccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaag gagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcc tgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctga acggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacc cgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcaacatccggcaggcccactgcaacgtgtc caaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctgg aggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactcca ccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatcc gctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactg gcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcg gcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaa cctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcc cgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctgg tccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccag aaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatca tgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttcc agtaataa pUC-ccTEV-BG505.d135-138.H330Y-A101–SEQ ID NO:24 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacaccaacgacatgcgcggcgagctgaagaactgctccttcaacatga ccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaag gagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcc tgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctga acggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacc cgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccggcaggcctactgcaacgtgtcc aaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctgga ggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactccac cggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatccg ctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactgg cgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcgg cggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaac ctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggccc gcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctggt ccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccaga accagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatcat gatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttcc agtaataa pUC-ccTEV-BG505.d132-139.H330Y-A101–SEQ ID NO:25Attorney Docket No.046483-6285-00WO atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaacgacatgcgcggcgagctgaagaactgctccttcaacatgaccaccgagctgc gcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaacaactccaacaaggagtaccgcctg atcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccggcttcgccatcctgaagtgcaaga acaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccacccagctgctgctgaacggctccctgg ccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcagatcaactgcacccgccccaacaac aacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccggcaggcctactgcaacgtgtccaaggccacctgg aacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccggcggcgacctggaggtgaccaccca ctccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagggctccaactccaccggctccaacga ctccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatccagggcgtgatccgctgcgtgtccaac atcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatgcgcgacaactggcgctccgagctgt acaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggcggctccggcggcggcggctccgcc gtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgcaggcccgcaacctgctgtccggcat cgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagcagctgcaggcccgcgtgctggccgtg gagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctggaactcctcctggtccaaccgcaacctgt ccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctggaggagtcccagaaccagcaggagaag aacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatcaagatcttcatcatgatcgtgggcggcct gatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccccctcctacttccagtaataa pUC-ccTEV-5Mut.H330Y-A101-SEQ ID NO:26 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacacccccaacctgaccaacgacatgcgcggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccggcaggccta ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccgg cggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcagg gctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcca gggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatg cgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggc ggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgc aggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagca gctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgga actcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgga ggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatca agatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccc cctcctacttccagtaataa pUC-ccTEV-BG505.5Mut.MD39.3Fill.P136S-A101-SEQ ID NO:27 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacacctccaacctgaccaacgacatgcgcggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggccca ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcaacaacaccatcatccgcttcgcccagtcctccgg cggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggatctccaacacctccgtgcaggAttorney Docket No.046483-6285-00WO gctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatcca gggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacatg cgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcggc ggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtgc aggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagca gctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgga actcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgga ggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatca agatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctcccccc cctcctacttccagtaataa pUC-ccTEV-BG505.5Mut.MD39.3Fill.C3V4shift-A101-SEQ ID NO:28 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacacccccaacctgaccaacgacatgcgcggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggccca ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcgacaacaccaccatccgcttcgcccagtcctccg gcggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggaccaacaacaccgccgtgca gggctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatc cagggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacat gcgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcgg cggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtg caggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagc agctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgg aactcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgg aggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatc aagatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctccccc ccctcctacttccagtaataa pUC-ccTEV-BG505.5Mut.MD39.3Fill.P136S.C3V4shift-A101–SEQ ID NO:29 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggacgccgagaccaccctgttctgcgcctccgacgccaaggcctacgagaccgagaagcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatccacctggagaacgtgaccgaggagttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgcagtgcaccaactacacctccaacctgaccaacgacatgcgcggcgagctgaagaactgct ccttcaacatgaccaccgagctgcgcgacaagaagcagaaggtgtactccctgttctaccgcctggacgtggtgcagatcaacgagaaccagggcaaccgctccaaca actccaacaaggagtaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaaggtgtccttcgagcccatccccatccactactgcgcccccgccg gcttcgccatcctgaagtgcaagaacaagaccttcaacggcaccggcccctgccccaacgtgtccaccgtgcagtgcacccacggcatcaagcccgtggtgtccaccc agctgctgctgaacggctccctggccgaggaggaggtgatcatccgctccgagaacatcaccaacaacgccaagaacatcctggtgcagctgaacacccccgtgcag atcaactgcacccgccccaacaacaacaccgtgaagtccatccgcatcggccccggccaggccttctactacaccggcgacatcatcggcgacatccgccaggccca ctgcaacgtgtccaaggccacctggaacgagaccctgggcaacgtgtccaagcagctgcgcaagcacttcggcgacaacaccaccatccgcttcgcccagtcctccg gcggcgacctggaggtgaccacccactccttcaactgcggcggcgagttcttctactgcaacacctccggcctgttcaactccacctggaccaacaacaccgccgtgca gggctccaactccaccggctccaacgactccatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagcgcatcggccagtgcatgtacgccccccccatc cagggcgtgatccgctgcgtgtccaacatcaccggcctgatcctgacccgcgacggcggctccaccaactccaccaccgagaccttccgccccggcggcggcgacat gcgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccctgggcgtggcccccacccgctgcaagcgccgcgtggtgggcggcggcgg cggctccggcggcggcggctccgccgtgggcatcggcgccgtgtccctgggcttcctgggcgccgccggctccaccatgggcgccgcctccatgaccctgaccgtg caggcccgcaacctgctgtccggcatcgtgcagcagcagtccaacctgctgcgcgcccccgagccccagcagcacctgctgaagccccccgtgtggggcatcaagc agctgcaggcccgcgtgctggccgtggagcactacctgcgcgaccagcagctgctgggcatctggggctgctccggcaagctgatctgctgcaccaacgtgccctgg aactcctcctggtccaaccgcaacctgtccgagatctgggacaacatgacctggctgcagtgggacaaggagatctccaactacacccagatcatctacggcctgctgg aggagtcccagaaccagcaggagaagaacgagcaggacctgctggccctggacaagtgggcctccctgtggaactggttcgacatctccaactggctgtggtacatc aagatcttcatcatgatcgtgggcggcctgatcggcctgcgcatcgtgttcgccgtgctgtccgtgatccaccgcgtgcgccagggcatccgccccgtgttctcctccccc ccctcctacttccagtaataaAttorney Docket No.046483-6285-00WO pUC-231965.c1.mRNA5.TK_-A101–SEQ ID NO:30 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggaggcctccaccaccctgttctgcgcctccgacgccaaggcctacgaggccgaggcccacaacatctgggccacccacgcctgcgtgcccaccga ccccaacccccaggagatcgagctgaagaacgtgaccgagaacttcaacatgtggaagaacgacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgcagccctgcgtgaagctgacccccctgtgcgtgaccctgaactgctccgacctggacaactccaacaagggcaacgccaccaacaccaccgtggcctcc gaggccggcatgaacaccaccgtggcccccgaggccggcatgaagaactgctccttcaacatcaccaccgaggtgaaggacaagaagaagctggtgtacgccctgtt ctacaagctggacgtggtgcagctggacggcaacaccaactcctaccgcctgatcaactgcaacacctccgcctgcacccaggcctgccccaagatcaccttcgagcc catccccatccactactgcgcccccgccggcttcgccatcctgaagtgcaacaacaagatgttcaacggcaccggcccctgcaacaacgtgtccaccgtgcagtgcacc cacggcatcaagcccgtggtgtccacccagctgctgctgaacggctccctggccgaggagggcgtgatcatccgctccgagaacctgaccgacaacaccaagaccat catcgtgcagctgaacgagtccgtgatcatcaactgcacccgccccaacaacatgacccgccagggcgtgcacatcggccccggccaggccctgttcaccctgaacc gcgtgatcggcaacatccgcctgccctactgcaacatctcccgcaaggactggaacaagaccctgcagcaggtggccgagaagctgggcaacctgtacaacaagacc aagatcatcttcgagccctcctccggcggcgaccccgagatcaccacccactccttcaactgcggcggcgagttcttctactgctccacctccaagctgttcaacgagac ctgggacctgaacaacacctacaacgcctccatcgagaacaacaccatcatcaccctgccctgccgcatcaagcagatcatcaacatgtggcagggcgtgggcaagtg catgtacgccccccccatcgagggcctgatcaagtgcacctccaacatcaccggcctgctgctgacccgcgacggcggccgggacaactcctcctccaacgagacctt ccgccccggcggcggcgacatgcgcgacaactggcgctccgagctgtacaagtacaaggtggtgaagatcgagcccatcggcctggcccccaccaagtgcaagcg ccgcgtggtggagggcggcggcggctccggcggcggcggctccgccatcggcctgggcgccatgttcctgggcttcctgggcgccgccggctccaccatgggcgc cgcctccaacaccctgaccgtgcaggcccgccagctgctgtccggcatcgtgcagcagcagaacaacctgccccgcgcccccgaggcccagcagcacctgctgcag ccccccgtgtggggcatcaagcagctgcaggcccgcgtgctggccgtggagcggtacctggaggtgcagcagctgctgggcatctggggctgctccggcaagctga tctgctgcaccaccgtgccctggaacacctcctggtccaaccgcacccaggagatctgggacaacatgacctggatggagtgggagcgcgagatcggcaactacacc ggcctgatctactccctgatcgaggagtcccagttccagcaggagatcaacgaggtggacctgctggagctggacaagtgggcctccctgtggaactggttctccatca ccaactggctgtggtacatccgcctgttcatcatgatcgtgggcggcctgatcggcctgcgcatcatcttcgccgtgctgtccatcgtgaaccgcgtgcgccagggcatcc gccccgtgttctcctcccccccctcctacttccagtaataa pUC-THRO.18.mRNA5.TK-A101–SEQ ID NO:31 atggccatctccggcgtgcccgtgctgggcttcttcatcatcgccgtgctgatgtccgcccaggagtcctgggccaacctgtgggtgaccgtgtactacggcgtgc ccgtgtggaaggaggccaccaccaccctgttctgcgcctccgacgccaaggcctacgacaccgaggtgcacaacgtgtgggccacccacgcctgcgtgcccaccga ccccgacccccaggaggtggtgctggagaacgtgaccgagaacttcaacatgtggaagaacaacatggtggagcagatgcacgaggacatcatctccctgtgggacc agtccctgaagccctgcgtgaagctgacccccctgtgcgtgaccctgaactgcaccgactacaacaacaccgccaccaacaccacctcctccgccaccaccaccgcct cctccgccaacaagaccgccaaggaggaggaggtgatgaagaactgctccttcaacatcaccaccaacgtgcgcgacaaggtgaagcgcgagtacgccctgttctac aacctggacgtggtgaagatcgaggagggcgagacctcctaccgcctggtgtcctgcaacacctccgtgtgcacccaggcctgccccaagatcaccttcgagcccatc cccatccactactgcgcccccgccggcttcgccatcctgaagtgcaacaacaagaccttcaacggcaccggcccctgcaccaacgtgtccaccgtgcagtgcacccac ggcatcaagcccgtggtgtccacccagctgctgctgaacggctccctggccgaggagggcgaggtggtgatccgctccgccaacttcaccaacaacgccaagaccat catcgtgcagctgaacaagtccgtggccatcaactgcacccgccccaacaa...
Claims
Attorney Docket No.046483-6285-00WO CLAIMS What is claimed is:
1. An HIV-1 immunogen comprising an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:
82.
2. The HIV-1 immunogen of claim 1, wherein the at least 2 variations are in the V1 region.
3. The HIV-1 immunogen of claim 1 or 2, wherein the V1 region comprises a sequence as set forth in SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:
222.
4. The HIV-1 immunogen of claim 1, wherein at least one variation decreases the level of N-glycosylation of at least one N-linked glycosylation site (NGS) or potential N-linked glycosylation site (PNGS) within SEQ ID NO:
82.
5. The HIV-1 immunogen of claim 1, wherein at least one variation decreases the level of N-glycosylation of N133, N137, N156, or a combination thereof.
6. The HIV-1 immunogen of claim 1, wherein the HIV-1 immunogen comprises an amino acid sequence selected from: a) an immunogen comprising SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71,Attorney Docket No.046483-6285-00WO SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80; b) a variant of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprising at least 80% sequence identity to SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80 or SEQ ID NO:82; c) a fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprising at least the V1 sequence of SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:222; orAttorney Docket No.046483-6285-00WO d) a fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80 comprising at least the V1 region of SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, or SEQ ID NO:222, wherein the fragment comprises at least 80% sequence identity to the corresponding fragment of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:
80.
7. A nucleic acid molecule encoding an HIV-1 immunogen of claim 1.
8. The nucleic acid molecule of claim 7, comprising a variant of SEQ ID NO:81, wherein the variant encodes an amino acid sequence comprising at least 2 variations from the parental sequence as set forth in SEQ ID NO:
82.
9. The nucleic acid molecule of claim 8, wherein the at least 2 variations are in the sequence encoding the V1 region.Attorney Docket No.046483-6285-00WO 10. The nucleic acid molecule of claim 8 or 9, wherein the sequence encoding the V1 region comprises a sequence as set forth in SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245 or SEQ ID NO:
246.
11. The nucleic acid molecule of claim 7, wherein at least one variation decreases the level of N-glycosylation of at least one N-linked glycosylation site (NGS) or potential N-linked glycosylation site (PNGS) within SEQ ID NO:
82.
12. The nucleic acid molecule of claim 11, wherein at least one variation decreases the level of N-glycosylation of N133, N137, N156 or a combination thereof.
13. The nucleic acid molecule of claim 7 comprising a sequence selected from: a) a nucleotide sequence comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40; b) a variant of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprising at least 80% sequence identity to SEQ ID NO:1, SEQAttorney Docket No.046483-6285-00WO ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:81; c) a fragment of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprising at least the sequence encoding the V1 region of SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245 or SEQ ID NO:246; or d) a fragment of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:40 comprising at least the sequence encoding the V1 region of SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:237, SEQ IDAttorney Docket No.046483-6285-00WO NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245 or SEQ ID NO:246, wherein the fragment comprises at least 80% sequence identity to the corresponding fragment of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39 or SEQ ID NO:
40.
14. The nucleic acid molecule of claim 7, wherein the nucleic acid molecule is an mRNA molecule.
15. The nucleic acid molecule of claim 14, wherein the nucleic acid molecule is a nucleoside modified mRNA molecule.
16. A composition comprising the immunogen of any one of claims 1-6 or the nucleic acid molecule of any one of claims 7-15.
17. The composition of claim 16, comprising a nanoparticle comprising the immunogen of any one of claims 1-6 or the nucleic acid molecule of any one of claims 7-15.
18. The composition of claim 17, wherein the nanoparticle comprises a lipid nanoparticle (LNP) or a mi3 nanoparticle.
19. The composition of any one of claims 16-18, wherein the composition is an HIV- 1 vaccine.
20. The composition of any one of claims 16-19, wherein the composition is a boosting HIV-1 vaccine.
21. A method of inducing an immune response against HIV-1 in a subject comprisingAttorney Docket No.046483-6285-00WO administering to the subject an effective amount of the immunogen of any one of claims 1-6, the nucleic acid molecule of any one of claims 7-15, or the composition of any one of claims 16-20.
22. The method of claim 21, wherein the composition is administered by a delivery route selected from the group consisting of intravenous, intradermal, subcutaneous, inhalation, intranasal, and intramuscular.
23. The method of claim 21, wherein the method comprises a single administration of the composition.
24. The method of claim 21, wherein the method comprises at least one administration of the immunogen of any one of claims 1-6, the nucleic acid molecule of any one of claims 7-15, or the composition of any one of claims 16-20 as a priming vaccine and a second administration of a second immunogenic agent as a boosting vaccine.
25. The method of claim 21, wherein the method comprises administration of a first immunogenic agent as a priming agent and administration of the immunogen of any one of claims 1-6, the nucleic acid molecule of any one of claims 7-15, or the composition of any one of claims 16-20 as a boosting vaccine.
26. The method of claim 21, wherein the method comprises at least one administration of the immunogen of any one of claims 1-6, the nucleic acid molecule of any one of claims 7-15, or the composition of any one of claims 16-20 as a priming vaccine and a second administration of the immunogen of any one of claims 1-6, the nucleic acid molecule of any one of claims 7-15, or the composition of any one of claims 16-20 as a boosting vaccine.
27. The method of any one of claims 24-26, wherein the priming immunogen comprises SEQ ID NO:42, SEQ ID NO: 45 or SEQ ID NO:46, or a fragment or variant thereof.
28. The method of any one of claims 24-26, wherein the boosting immunogen comprises SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQAttorney Docket No.046483-6285-00WO ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, or SEQ ID NO:80, or a fragment or variant thereof.
29. A method for identifying immunogens that will be efficient for eliciting bNAbs, the method comprising: a) immunizing multiple non-human primates with an immunogen or vaccine against HIV-1; b) infecting multiple non-human primates with a simian-human immunodeficiency virus (SHIV) comprising a modified HIV-1 envelope; c) isolating and characterizing monoclonal bNAbs from the multiple infected non- human animals; d) sequencing the isolated bNAbs; e) using the sequencing data to identify common routes of antibody-Env coevolution; and f) generating immunogens based on the antibody-Env coevolution dataset capable of stimulating diverse bNAbs.
30. The method of claim 29, wherein at least one immunogen generated in step e) serves as a candidate for vaccine formulation.
31. The method of claim 29, wherein at least one immunogen generated in step e) serves as an evolving immunogen for re-infection of at least one non-human primate and re- iteration of steps c) through f).
32. The assay of claim 29, wherein the non-human primate is a rhesus macaque.
33. The assay of claim 29, wherein the modified HIV-1 Env comprises an S375Y mutation.Attorney Docket No.046483-6285-00WO 34. The assay of claim 29, wherein the modified HIV-1 Env comprises an amino acid sequence of SEQ ID NO:42, SEQ ID NO: 45 or SEQ ID NO:46 or a fragment or variant thereof.
35. The assay of claim 34, wherein the variant of SEQ ID NO:42, SEQ ID NO: 45 or SEQ ID NO:46 lacks potential N-linked glycosylation sites (PNGS) at positions 230, 241, and 344.
36. An immunogenic composition comprising at least one immunogen generated by the method of claim 29.
37. A nucleic acid molecule encoding an HIV-1 binding molecule comprising: a) a sequence encoding a heavy chain comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, SEQ ID NO:111, and SEQ ID NO:113; b) a sequence encoding a light chain comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:110, SEQ ID NO:112, or SEQ ID NO:114; c) a combination of a sequence encoding a heavy chain comprising a nucleotide sequence of SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, SEQ ID NO:111, and SEQ ID NO:113 and a sequence encoding a light chain comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:110, SEQ ID NO:112, or SEQ ID NO:114.
Citation Information
Patent Citations
Modified immunogenic proteins
US20230190914A1
Rapid elicitation of broadly neutralizing bovine antibodies to HIV env
US20240109956A1