Inhibitor of viral entry

By targeting SLC3A2 with HAT inhibitors, the viral entry process is blocked, offering a therapeutic solution for SARS-CoV-2 infections, especially in vulnerable populations.

WO2025219517A1PCT designated stage Publication Date: 2025-10-23UNIVERSITY OF GENEVA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/060641
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-19
Filing Date
2025-04-17
Publication Date
2025-10-23

AI Technical Summary

Technical Problem

Current treatments for SARS-CoV-2 infections, particularly in immunocompromised individuals and those with co-morbidities, are largely symptomatic, and there is a need for improved prophylactics and therapeutics to address viral entry mechanisms beyond ACE2.

Method used

Identifying SLC3A2 as a host dependency factor for viral entry and using HAT inhibitors, such as CD98 inhibitors, to block viral entry into host cells.

Benefits of technology

HAT inhibitors effectively reduce viral entry and replication, providing a potential therapeutic approach for preventing or treating SARS-CoV-2 infections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025060641_23102025_PF_FP_ABST
    Figure EP2025060641_23102025_PF_FP_ABST
Patent Text Reader

Abstract

The disclosure concerns preventing or treating a viral infection in an individual, comprising administering a HAT inhibitor to the individual. The disclosure further concerns a HAT inhibitor for use in the method of the disclosure, and use of a HAT inhibitor in the manufacture of a medicament for preventing or treating a viral infection in an individual. In addition, the disclosure concerns a related method of screening for a treatment for a viral infection.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] INHIBITOR OF VIRAL ENTRY

[0002] FIELD OF THE DISCLOSURE

[0003] The disclosure concerns preventing or treating a viral infection in an individual, comprising administering a HAT inhibitor to the individual. The disclosure further concerns a HAT inhibitor for use in the method of the disclosure, and use of a HAT inhibitor in the manufacture of a medicament for preventing or treating a viral infection in an individual. In addition, the disclosure concerns a related method of screening for a treatment for a viral infection.

[0004] BACKGROUND

[0005] Numerous viruses are capable of harming the health of humans and / or animals. One virus of particular recent interest is SARS-CoV-2, which entered the human population as a novel SARS Coronavirus (SARS-CoV-2) presumably after a zoonotic transfer from an animal source. The virus quickly spread globally, infected more than 750 million people and has so far been responsible for almost 7 million deaths. SARS-CoV-2 replicates in the upper and occasionally lower respiratory tract of humans. While infection may remain asymptomatic, symptomatic infections can vary widely. Clinical signs of COVID-19 range from cold-like symptoms to acute respiratory distress syndrome and respiratory failure.

[0006] SARS-CoV-2 virions attach to heparan sulfates on the cell surface and rely primarily on angiotensin converting enzyme 2 (ACE2) to enter the host cell. The entry process requires proteolytic activation of the SARS-CoV-2 spike (S). Entry either occurs at the cell surface (when the serine protease TMPRSS2 is expressed by the host cell) or by endosomal uptake (in which case endosomal cathepsins are responsible for the cleavage of SARS-CoV-2 S protein). Expression of hACE2 suffices to make mice susceptible to SARS-CoV-2, but ACE2 independent entry has also been shown for example in H522 cells. Furthermore, S protein mutations leading to enhanced viral entry do not necessarily augment ACE2 binding. This points to additional host dependency factors permitting or supporting the entry process of SARS-CoV-2.

[0007] While vaccines against SARS-CoV-2 are now available and may reduce the likelihood of severe symptoms developing, some individuals remain badly affected by SARS-CoV-2 infection. This is particularly the case in immunocompromised individuals, and those with co-morbidities. Treatment is largely symptomatic. Improved prophylactics against SARS-CoV-2 infection, and effective therapeutics for COVID-19 are therefore required.

[0008] SUMMARY OF THE DISCLOSURE

[0009] The present inventors have sought to identify additional host dependency factors permitting or supporting the entry process of SARS-CoV-2, with a view to targeting these for the purpose of prevention or treatment of viral infections. In particular, the inventors have identified host plasma membrane proteins in the vicinity of attached viral spike proteins and assessed their effects on viral entry. Among these, SLC3 A2 (the heavy subunit of CD98, a heterodimeric amino acid transporter (HAT)) was shown to have an important effect on viral entry, with SLC3 A2 knockout reducing the ability of SARS-CoV- 2 S pseudotyped virus-like particles (VLP) to infect host cells to a level comparable with ACE2 knockout. Furthermore, a chemical inhibitor of CD98 was shown to reduce entry of SARS-CoV-2 to host cells. The inventors have therefore demonstrated that SLC3 A2 is an entry factor in virus infection, and thereby identified SLC3 A2 and HATs such as CD98 as drug targets for antiviral therapy.

[0010] Accordingly, the disclosure provides:

[0011] - a method of preventing or treating a viral infection in an individual, comprising administering a heterodimeric amino acid transporter (HAT)inhibitor to the individual;

[0012] - a heterodimeric amino acid transporter (HAT) inhibitor for use in the method of the disclosure;

[0013] - use of a heterodimeric amino acid transporter (HAT) inhibitor in the manufacture of a medicament for preventing or treating a viral infection in an individual; and

[0014] - a method of screening for a treatment for a viral infection, comprising: (a) contacting a heterodimeric amino acid transporter (HAT) with a compound to be screened; and (b) determining whether the compound affects the activity of the heterodimeric amino acid transporter (HAT). DESCRIPTION OF THE FIGURES

[0015] Figure 1: A) Summary of CSPL technique generated with BioRender.com. B) Cell lysates with 40ug of proteins were separated by SDS-PAGE and analysed by western blot depicting the expression of ACE2 in different cell lines (A549, A549 A2, A549T2, A549 A2T2, H522 and Calu3 WT). Both short and long exposures have been shown to visualize the ACE2 bands in the different cell lines. Beta-actin was used as a loading control. C) Representative SDS-PAGE of insect cell expresses Wuhan-spike HRP. Purified protein containing fractions were loaded onto an SDS-polyacrylamide gel and stained with Coomassie Blue.

[0016] Figure 2: Cell surface proximity ligation. A) Pulldown of biotinylated host cell proteins on A549 A2T2 cells with streptavidin post cell surface proximity ligation. Streptavidin-HRP was used to probe biotinylated proteins. B) Venn diagram indicating number of proteins found in the three mass spectrometry experiments and their overlap in A549 A2T2 cells. C) Half of the hits found at least in two out of three experiments were grouped into the GO cluster for viral entry into host cells and virus receptor activity. Black circle indicates the hand-picked candidates.

[0017] Figure 3: List of proteins present in mass spectrometry experiments.

[0018] Figure 4: String network of the 55 proteins found in mass spectrometry in the three independent experiments in A549 A2T2 cells, according to gene ontology classification and sorted from lowest to highest false discovery rate (FDR).

[0019] Figure 5: Total cell lysates were separated by SDS-PAGE and analyzed by western blot to confirm knockouts of target proteins in A549 A2T2 cells. ACE2 knockout in A549 A2T2 cells was done as a positive control. Equal loading was verified by probing for betaactin. The asterisk refers to the single-cell knockout clones that were used for the experiments for each gRNA and for each target.

[0020] Figure 6: Absolute luciferase values after infection of Calu3 control (Cas9 empty) or ACE2 KO cells 96h post infection. VLPs were pseudotyped with SARS-CoV-2 S (A) or VSV-G (B) and diluted to achieve a comparable absolute infection efficacy. Each dot represents a technical replicate in one biological experiment.

[0021] Figure 7: SARS-CoV-2 S and VSV-G pseudotyped VLP entry into A549 A2T2 KO cells. A) SARS-CoV-2 pseudotyped VLP entry in A549 A2T2 cells transduced with lentiviral CRISPR / Cas9 guide RNAs (2 per target). ACE2 is used as a positive control. The results are shown in relative light units to mock, Cas9 empty. The results of the 2 guide RNAs are pooled together. One-way ANOVA with Brown-Forsythe and Welch test was done. B) VSV-G pseudotyped VLP entry in A549 A2T2 cells transduced with lentiviral CRISPR / Cas9 guide RNAs (2 per target). ACE2 is used as a positive control. The results are shown in relative light units to mock, Cas9 empty. The results of the 2 guide RNAs are pooled together. One-way ANOVA with Brown -Forsythe and Welch test was done. C) Z- score analysis depicting the effect of the knockout of 5 out of 10 candidates on SARS-CoV-

[0022] 2 S pseudotyped VLP entry. The dotted lines at -3 and +3 are thresholds that correspond to

[0023] 3 times the standard deviation. D) Z-score showing the effect of the knockout of 5 out of 10 protein candidates on VSV-G pseudotyped VLP entry. The dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation.

[0024] Figure 8: A) SARS-CoV-2 S pseudotyped VLP entry in A549 A2T2 knockout cells (Fig S3). The asterisk represents the knockout of the target proteins using a 2ndgRNA. The results are shown in relative light units to mock, Cas9 empty. One-way ANOVA with Brown-Forsythe and Welch test was done. B) VSV-G VLP entry in A549 A2T2 cells knockout for the candidates. The asterisk indicates knockout using a 2ndgRNA. The results are shown in relative light units to mock, Cas9 empty. One-way ANOVA with Brown- Forsythe and Welch test was done. C) Z-score analysis showing the excluded candidate proteins and the absence of any effect on SARS-CoV-2 S pseudotyped VLP entry. The dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation. The asterisk represents knockout of A549 A2T2 cells using a 2ndgRNA. D) Z-score depicting the absence of any effect of the excluded proteins on VSV-G pseudotyped VLP entry. The dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation. The asterisk represents knockout of target proteins in A549 A2T2 cells with a 2ndgRNA.

[0025] Figure 9: A) Total cell lysates were separated by SDS-PAGE and analyzed by western blot to verify the knockout of target proteins in Calu3 cells. ACE2 knockouts were performed as a positive control. Equal loading was verified by probing for beta-actin. B) Quantification of target proteins as shown in (A) in Calu3 cells post knockout using lentiviral gRNAs. The knockouts with 2 gRNAs have been pooled together. The black circle indicates the knockout using gRNAl and the black squares indicate the knockouts made using gRNA2. One-Way ANOVA statistical test was performed to compare the Calu3 control cells with the knockouts of the target proteins.

[0026] Figure 10: SARS-CoV-2 S and VSV-G pseudotyped VLP entry into Calu3 KO cells. A) SARS-CoV-2 pseudotyped VLP entry in Calu3 cells transduced with lentiviral CRISPR / Cas9 guide RNAs (2 per target). ACE2 is used as a positive control. The results are shown in relative light units to mock, Cas9 empty. The results of the 2 guide RNAs are pooled together. One-way ANOVA with Brown-Forsythe and Welch test was done. B) VSV-G pseudotyped VLP entry in Calu3 cells transduced with lentiviral CRISPR / Cas9 guide RNAs (2 per target). ACE2 is used as a positive control. The results are shown in relative light units to mock, Cas9 empty. The results of the 2 guide RNAs are pooled together. One-way ANOVA with Brown-Forsythe and Welch test was done. C) Z-score analysis depicting the effect of the knockout of the proteins on SARS-CoV-2 S pseudotyped VLP entry. The dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation. D) Z-score showing the effect of the knockout of the proteins on VSV- G pseudotyped VLP entry. Dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation.

[0027] Figure 11: A) SARS-CoV-2 pseudotyped VLP entry is indicated in relative light units to Ctrl in A549 cells transduced with lentiviral cDNAs of target proteins. One-way ANOVA with Brown-Forsythe and Welch test was done. B) VSV-G pseudotyped VLP entry in A549 cells overexpressed with cDNAs of target proteins is depicted in relative light units to mock, Ctrl. One-way ANOVA with Brown-Forsythe and Welch test was done. C) Z-score analysis of the SARS-CoV-2 S pseudotyped VLP entry into A549 cells overexpressed with respective cDNAs. Dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation. D) Z-score of VSV-G pseudotyped VLP entry in A549 cells overexpressed with target proteins by lentiviral transduction. Dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation.

[0028] Figure 12: SARS-CoV-2 S and VSV-G pseudotyped entry into A549 A2 OE cells. A) SARS-CoV-2 pseudotyped VLP entry is indicated in relative light units to Ctrl in A549 A2 cells transduced with lentiviral cDNAs of target proteins. One-way ANOVA with Brown-Forsythe and Welch test was done. B) VSV-G pseudotyped VLP entry in A549 A2 cells overexpressed with cDNAs of target proteins is depicted in relative light units to mock, Ctrl. One-way ANOVA with Brown -Forsythe and Welch test was done. C) Z-score analysis of the SARS-CoV-2 S pseudotyped VLP entry into A549 A2 cells overexpressed with respective cDNAs. Dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation. D) Z-score of VSV-G pseudotyped VLP entry in A549 A2 cells overexpressed with target proteins by lentiviral transduction. Dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation.

[0029] Figure 13: SARS-CoV-2 S and VSV-G pseudotyped entry into Calu3 cells. A) SARS-CoV-2 pseudotyped VLP entry is indicated in relative light units to Ctrl in Calu3 cells transduced with lentiviral cDNAs of target proteins. One-way ANOVA with Brown- Forsythe and Welch test was done. B) VSV-G pseudotyped VLP entry in Calu3 cells overexpressed with cDNAs of target proteins is depicted in relative light units to mock, Ctrl. One-way ANOVA with Brown -Forsythe and Welch test was done. C) Z-score analysis of the SARS-CoV-2 S entry into Calu3 cells overexpressed with respective cDNAs. Dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation. D) Z- score of VSV-G entry in Calu3 cells overexpressed with target proteins by lentiviral transduction. Dotted lines at -3 and +3 are thresholds that correspond to 3 times the standard deviation.

[0030] Figure 14: A) Total cell lysates were separated by SDS-PAGE and analyzed by western blot to check for over expression of target proteins in A549 cells. Over expression of ACE2 in A549 cells was done as a positive control B) Total cell lysates were separated by SDS-PAGE and analyzed by western blot to check for over expression of target proteins in A549 A2 cells. C) Total cell lysates were separated by SDS-PAGE and analyzed by western blot to check for over expression of target proteins in Calu3 cells.

[0031] Figure 15: SARS-CoV-2 regulates the expression of some of the target proteins. A) Cell lysates were separated by SDS-PAGE and analyzed by western blot depicting the expression of target proteins and SARS-CoV-2 N, 24 hpost infection with Wuhan B.l and Omicron BA. l at MOI 1. A representative blot of three independent experiments is shown. Equal loading was confirmed by probing for beta actin. B) Quantification of three independent infection experiments as shown in (A). Each symbol refers to an independent experiment depicting infection with Wuhan B.L One-way ANOVA statistical test was performed. C) Quantification of three independent infection experiments as shown in (A). Each symbol refers to an independent experiment depicting infection with Omicron BA.1. One-way ANOVA statistical test was performed. D) Further quantification of three independent infection experiments as shown in (A) for CE2, ATP1B1, SLC3A2, ADAMIO, EGFR, PLNXB2 across (i) to (vi), respectively. Statistical significance was determined with a one-way ANOVA test.

[0032] Figure 16: IC50 concentrations according to literature for GI254023X, KYT 0353 and Ouabain are indicated.

[0033] Figure 17: A) Intracellular ATP levels were measured after 2h+ 24 h of Camostat mesylate treatment in Calu3 cells, three technical repeats from one experiment and the highest non-toxic concentration are shown. B) Intracellular ATP levels were measured after 2h+ 24 h of KYT 0353 treatment in Calu3 cells, three technical repeats from one experiment and the highest non-toxic concentration are shown. C) Intracellular ATP levels were measured after 4h+ 24 h of GI254023X treatment in Calu3 cells, three technical repeats from one experiment and the highest non-toxic concentration are shown. D) Intracellular ATP levels were measured after 2h+ 24 h of Ouabain treatment in Calu3 cells, three technical repeats from one experiment and the highest non-toxic concentration are shown. Paired t- test was performed as a statistical test.

[0034] Figure 18: Reduction in SARS-CoV-2 replication post-treatment with chemical inhibitors of TMPRSS2, SLC3A2, ADAMIO and ATP1B1. A) Treatment of Calu3 cells with H2O or Camostat mesylate, TMPRSS2 inhibitor, for 2hand infection with Omicron BA.1 for 24 h. RT-qPCR was performed after RNA extraction from cell lysates to assess for subgenomic E gene. Each dot represents a biological replicate indicated as fold induction to the average of the housekeeping genes, RNaseP, 18S and GAPDH. Paired t-test was performed to analyze the statistical significance between the Mock and chemical inhibition. B) Treatment of Calu3 cells with DMSO and KYT 0353, SLC3A2 inhibitor, for 2h. These cells were then infected with Omicron BA.1 for 24 hand a RT-qPCR was done to assess for subgenomic E gene from cell lysates. Each dot represents a biological replicate shown as fold change to the average of RNaseP, 18S and GAPDH. A paired T-test was performed to analyze the statistical significance between the Mock and chemical inhibition. C) Treatment of Calu3 cells with DMSO and GI254023X, ADAMIO inhibitor, for 4h. These cells were then infected with Omicron BA.1 for 24 hand a RT-qPCR was done to assess for subgenomic E gene from cell lysates. Each dot represents a biological replicate shown as fold change to the average of RNaseP, 18S and GAPDH. A paired T-test was performed to analyze the statistical significance between the Mock and chemical inhibition. D) Treatment of Calu3 cells with H20 and Ouabain, ATP IB 1 inhibitor, for 2h. These cells were then infected with Omicron BA.1 for 24 hand a RT-qPCR was done to assess for subgenomic E gene from cell lysates. Each dot represents a biological replicate shown as fold change to the average of the housekeeping genes, RNaseP, 18S and GAPDH. Paired t-test was performed to analyze the statistical significance between the Mock and chemical inhibition. E) SARS-CoV-2 replication post-treatment with chemical inhibitors of ADAMIO, SLC3A2, TMPRSS2 and ATP1B1 (i) Treatment of Calu3 cells with KYT0353 (100 pM) for 2 h or GI254023X (100 pM) for 4 h. Post incubation with inhibitor, cells were washed and infected with MOI 1 of Omicron BA. l. RT-qPCR was performed after RNA extraction from cell lysates collected 24 h post infection to assess for subgenomic E gene. Each dot represents a biological replicate indicated as relative expression to the average of the housekeeping genes, RNaseP, 18 S and GAPDH. Ordinary one-way ANOVA was performed as a statistical test, (ii) Treatment of Calu3 cells with KYT0353 at a concentration of 500 pM for 2 h. The cells were washed to remove the compound and infected with Omicron BA.1 at a MOI of 1. After removal of the virus inoculum, cells were washed and replaced with growth medium containing KYT0353 (500 pM). RT-qPCR was done to assess subgenomic E gene from cell lysates 2 h +24 h post incubation. Each dot represents a biological replicate shown as relative expression to the average of RNaseP, 18 S and GAPDH. A paired T-test was performed to analyze the statistical significance ebetween the Mock and chemical inhibition, (iii) Treatment of Calu3 cells with Camostat mesylate (100 pM) and Ouabain (10 nM) for 2 h. Post incubation, the chemical compounds were removed, cells were washed and infected with MOI 1 of Omicron BA.l. RT- qPCR was performed after RNA extraction from cell lysates collected 2 h +24 h post incubation to assess for subgenomic E gene. Each dot represents a biological replicate indicated as relative expression to the average of the housekeeping genes, RNaseP, 18 S and GAPDH. Ordinary one-way ANOVA was performed as a statistical test.

[0035] Figure 19: CD98 complex. CD98 is a heterodimer that comprises CD98hc (also known as SLC3A2 or 4F2hc) and LAT1 (also known as SLC7A5). Together, the two subunits form a functional LAT1 transporter.

[0036] DETAILED DESCRIPTION It is to be understood that different applications of the disclosed methods and products may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the disclosure only, and is not intended to be limiting.

[0037] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

[0038] General definitions

[0039] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which this disclosure belongs.

[0040] As used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a virus” includes “viruses”, reference to “an inhibitor” includes two or more such inhibitors, and the like.

[0041] In general, the term “comprising” is intended to mean including but not limited to. For example, a method “comprising administering a CD98 inhibitor to the individual” contains a step of administering said inhibitor to the individual, but may also contain additional steps or involve administration of one or more additional substances.

[0042] In some aspects of the disclosure, the word “comprising” is replaced with the phrase “consisting of’. The term “consisting of’ is intended to be limiting. For example, a method “consisting of administering a CD98 inhibitor to the individual” contains a step of administering said inhibitor to the individual, and does not contain any additional steps or involve administration of any additional substances.

[0043] The terms “protein” and “polypeptide” are used interchangeably herein, and are intended to refer to a polymeric chain of amino acids of any length.

[0044] Preventing or treating a viral infection

[0045] As set out above, the present inventors have shown that SLC3 A2 (the heavy subunit of CD98,a heterodimeric amino acid transporter (HAT)) is important for viral entry, and that chemical inhibition of CD98 reduces entry of virus to host cells. In other words, the present inventors have identified thereby identified HATs including CD98 (or its heavy subunit SLC3 A2) as drug targets for antiviral therapy.

[0046] Accordingly, the disclosure provides a method of preventing or treating a viral infection in an individual, comprising administering a HAT inhibitor to the individual. The disclosure further provides a HAT inhibitor for use in a method of preventing or treating a viral infection in an individual, the method comprising administering the HAT inhibitor to the individual. The disclosure also provides use of a HAT inhibitor for the manufacture of a medicament for preventing or treating a viral infection in an individual.

[0047] HAT inhibitor

[0048] The heterodimeric amino acid transporters (HATs) are a family of amino acid transporters that each comprise a glycosylated heavy chain transporter known as SLC3 A2, 4F2hc or CD98hc. In addition to SLC3 A2, each HAT comprises a non-glycosylated light chain transporter. There are six non-glycosylated light chain transporters capable of forming a HAT together with SLC3A2: LAT1 (also known as SLC7A5 or 4F21c), LAT2 (also known as SLC7A8), y+LATl (also known as SLC7A7), y+LAT2 (also known as SLC7A6), Asc-1 (also known as SLC7A10), and xCT ((also known as SLC7A11).

[0049] In a HAT, one of these non-glycosylated light chain transporters is linked to SLC3 A2 by a disulfide bridge. Together, the non-glycosylated light chain transporter and SLC3 A2 form a functional amino acid transported. SLC3 A2 is required for the stability of the transporter at the plasma membrane. The non-glycosylated light chain transporter facilitates amino acid transport across the membrane. Substrate selectivity is conferred by the non-glycosylated light chain transporter.

[0050] As set out above, the present disclosure concerns use of a HAT inhibitor for preventing or treating viral infection in an individual. The HAT inhibitor may be defined as any compound that reduces or eliminates a function of a HAT, or reduces or eliminates expression of a HAT.

[0051] The HAT may be any known HAT. For example, the HAT may be a HAT that comprises or consists of SLC7A5 and SLC3 A2. The HAT may be a HAT that comprises or consists of SLC7A8 and SLC3A2. HATs that comprise SLC7A5 or SLC7A8 and SLC3A2are so-called system L (or leucine preferring) HATs. The HAT may be a system L HAT. The HAT may be a HAT that comprises or consists of SLC7A7 and SLC3A2. The HAT may be a HAT that comprises or consists of SLC7A6 and SLC3A2. HATs that comprise SLC7A7 or SLC7A6 and SC3A2 are so-called system y+L HATs. The HAT may be a system y+L HAT.

[0052] The HAT may be a HAT that comprises or consists of SLC7A11 and SLC3 A2. HATs that comprise SLC7A11 and SC3A2 are so-called system xc’ HATs. The HAT may be a system xc’ HAT.

[0053] The HAT may be a HAT that comprises or consists of SLC7A10 and SLC3A2. HATs that comprise SLC7A10 and SC3A2 are so-called system ASC HATs. The HAT may be a system ASC HAT.

[0054] When the HAT inhibitor reduces or eliminates a function of the HAT, the HAT inhibitor may, for instance, reduce the amino acid transporter function of the HAT described above. Alternatively or additionally, the HAT inhibitor may reduce any other known function of the HAT. The HAT inhibitor may, for example, eliminate the amino acid transporter function described above. Alternatively or additionally, the HAT inhibitor may eliminate any known function of the HAT. In any case, the comparator for the reduction in function may be a HAT that has not been contacted with the HAT inhibitor. In other words, the HAT inhibitor may reduce a function of the HAT relative to a HAT that has not been contacted with the HAT inhibitor. “Elimination” in this context means that a function of the HAT is completely obliterated.

[0055] When the HAT inhibitor reduces or eliminates expression of the HAT, the HAT inhibitor may, for instance, reduce or eliminate expression of the HAT on the cell surface. “Elimination” in this context means that expression of the HAT is completely obliterated. Expression of one or both subunits may be reduced. For instance, the HAT inhibitor may reduce or eliminate expression of SLC3 A2. The HAT inhibitor may, for example, reduce or eliminate expression of SLC3 A2 on the cell surface. “Elimination” in this context means that expression of SLC3 A2 is completely obliterated. The HAT inhibitor may, for instance, reduce or eliminate expression of the non-glycosylated light chain transporter (i.e. of SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11). The HAT inhibitor may, for example, reduce or eliminate expression of the non-glycosylated light chain transporter (i.e. of SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) on the cell surface. “Elimination” in this context means that expression of the non-glycosylated light chain transporter is completely obliterated. The HAT inhibitor may, for instance, reduce or eliminate expression of SLC3 A2 and the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11). The HAT inhibitor may, for example, reduce or eliminate expression of SLC3 A2 and the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) on the cell surface. “Elimination” in this context means that expression of SLC3 A2 and the non-glycosylated light chain transporter are completely obliterated. In any case, expression may be reduced relative to expression in a cell that has not be contacted with the HAT inhibitor.

[0056] To reduce or eliminate a function of the HAT, the CD98 inhibitor may target one or both of the subunits of the HAT. For instance, the HAT inhibitor may bind to one or both of the subunits of HAT, affect a function of one or both subunits, or reduce or eliminate expression of one or both subunits of HAT. The HAT inhibitor may, for example, target (e.g. bind to and / or affect a function of and / or reduce or eliminate expression of) SLC3 A2. The HAT inhibitor may, for example, target (e.g. bind to and / or affect a function of and / or reduce or eliminate expression of) the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11). The HAT inhibitor may, for example, target (e.g. bind to and / or affect a function of and / or reduce or eliminate expression of) SLC3A2 and the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11).

[0057] An inhibitor that targets (e.g. binds to and / or affects a function of and / or reduces or eliminate expression of) SLC3 A2 may be referred to as a SLC3 A2 inhibitor. In one preferred aspect of the disclosure, the HAT inhibitor is a SLC3 A2 inhibitor.

[0058] When the HAT inhibitor is a SLC3 A2 inhibitor, the affected function of SLC3 A2 may, for example, be the ability to form a complex with a non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11). Therefore, the SLC3 A2 inhibitor may, for instance, reduce or eliminate the ability of SLC3A2 to form a complex with a non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11). When the HAT inhibitor is a SLC3A2 inhibitor, the affected function of SLC3 A2 may, for example, be the ability to participate in a functional amino acid transporter, such as a HAT. Therefore, the SLC3 A2 inhibitor may, for instance, reduce or eliminate the ability of SLC3 A2 to participate in a functional amino acid transporter, such as a HAT. In either case, the comparator for the reduction or elimination in function may be SLC3 A2 that has not been contacted with the SLC3 A2 inhibitor. In other words, the SLC3 A2 inhibitor may reduce or eliminate a function of SLC3 A2 relative to SLC3 A2 that has not been contacted with the SLC3 A2 inhibitor.

[0059] When the HAT inhibitor is a SLC3 A2 inhibitor, the SLC3 A2 inhibitor may reduce or eliminate expression of SLC3 A2. “Elimination” in this context means that expression of SLC3A2 is completely obliterated. The SLC3 A2 inhibitor may reduce or eliminate expression of SLC3 A2 at the mRNA level, for instance. Preferably, the SLC3 A2 inhibitor reduces or eliminates expression of SLC3 A2 protein. More preferably, the SLC3 A2 inhibitor reduces or eliminates surface expression of SLC3 A2 protein. In any case, expression may be reduced relative to expression in a cell that has not be contacted with the SLC3A2 inhibitor.

[0060] An inhibitor that targets (e.g. binds to and / or affects a function of and / or reduces or eliminate expression of a non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) may be referred to as a non-glycosylated light chain transporter inhibitor. The HAT inhibitor may, for instance, be a non-glycosylated light chain transporter inhibitor. For example, the HAT inhibitor may be a SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 and / or SLC7A11 inhibitor.

[0061] When the HAT inhibitor is a non-glycosylated light chain transporter inhibitor, the affected function of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) may, for example, be the ability to form a complex with SLC3 A2. Therefore, the non-glycosylated light chain transporter inhibitor may, for instance, reduce or eliminate the ability of the non-glycosylated light chain (i.e._SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) to form a complex with SLC3 A2. When the HAT inhibitor is a non-glycosylated light chain transporter inhibitor, the affected function of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) may, for example, be the ability to transport amino acids. Therefore, the non-glycosylated light chain transporter inhibitor may, for instance, reduce or eliminate the ability of a non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7Al l) to transport amino acids. When the HAT inhibitor is a non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) inhibitor, the affected function of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) may, for example, be the ability to participate in a functional amino acid transporter. Therefore, the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) inhibitor may, for instance, reduce or eliminate the ability of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7Al l) to participate in a functional amino acid transporter. In any case, the comparator for the reduction or elimination in function may be the relevant non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) that has not been contacted with the inhibitor. In other words, the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) inhibitor may reduce or eliminate a function of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) relative to the non- glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) that has not been contacted with the inhibitor.

[0062] When the HAT inhibitor is a non-glycosylated light chain transporter inhibitor, the non-glycosylated light chain transporter inhibitor may reduce or eliminate expression of a non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11). “Elimination” in this context means that expression of the non- glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) is completely obliterated. The non-glycosylated light chain transporter inhibitor may reduce or eliminate expression of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) at the mRNA level, for instance. Preferably, the non-glycosylated light chain transporter inhibitor reduces or eliminates expression of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) protein. More preferably, the non-glycosylated light chain transporter inhibitor reduces or eliminates surface expression of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) protein. In any case, expression may be reduced relative to expression in a cell that has not be contacted with the inhibitor. An inhibitor that targets (e.g. binds to and / or affects a function of and / or reduces or eliminate expression of) SLC3 A2 and a non-glycosylated light chain transporter may be referred to as a SLC3 A2 / non-glycosylated light chain transporter inhibitor. The HAT inhibitor may, for instance, be a SLC3 A2 / non-glycosylated light chain transporter inhibitor. For instance, the HAT inhibitor maybe a SLC3A2 / SLC7A5 inhibitor, a SLC3A2 / SLC7A8 inhibitor, a SLC3A2 / SLC7A7 inhibitor, a SLC3A2 / SLC7A6 inhibitor, a SLC3A2 / SLC7A10 inhibitor or a SLC3A2 / SLC7A1 linhibitor.

[0063] When the HAT inhibitor is a SLC3 A2 / non-glycosylated light chain transporter inhibitor (i.e. a SLC3A2 / SLC7A5 inhibitor, a SLC3A2 / SLC7A8 inhibitor, a SLC3A2 / SLC7A7 inhibitor, a SLC3A2 / SLC7A6 inhibitor, a SLC3A2 / SLC7A10 inhibitor or a SLC3A2 / SLC7A1 linhibitor), the affected function of SLC3 A2 may, for example, be the ability to form a complex with the non-glycosylated light chain transporter. When the HAT inhibitor is a SLC3 A2 / non-glycosylated light chain transporter inhibitor, the affected function of the non-glycosylated light chain transporter may, for example, be the ability to form a complex with SLC3 A2. Therefore, the SLC3 A2 / non-glycosylated light chain transporter inhibitor may, for instance, reduce or eliminate the ability of SLC3 A2 to form a complex with a non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11). The SLC3A2 / non-glycosylated light chain transporter inhibitor may, for instance, reduce or eliminate the ability of a non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) to form a complex with SLC3 A2. When the HAT inhibitor is a SLC3 A2 / non-glycosylated light chain transporter inhibitor, the affected function of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) may, for example, be the ability to transport amino acids. Therefore, the SLC3 A2 / non-glycosylated light chain transporter inhibitor may, for instance, reduce or eliminate the ability of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) to transport amino acids. When the HAT inhibitor is a SLC3 A2 / non-glycosylated light chain transporter inhibitor, the affected function of SLC3 A2 may, for example, be the ability to participate in a functional amino acid transporter. Therefore, the SLC3 A2 / non-glycosylated light chain transporter inhibitor may, for instance, reduce or eliminate the ability of SLC3 A2 to participate in a functional amino acid transporter. When the HAT inhibitor is a SLC3 A2 / non-glycosylated light chain transporter inhibitor, the affected function of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) may, for example, be the ability to participate in a functional amino transporter. Therefore, the SLC3 A2 / non-glycosylated light chain transporter inhibitor may, for instance, reduce or eliminate the ability of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) to participate in a functional amino acid transporter. In any case, the comparator for the reduction or elimination in SLC3A2 function may be SLC3 A2 that has not been contacted with the SLC3 A2 / non-glycosylated light chain transporter inhibitor. In other words, the SLC3 A2 / non-glycosylated light chain transporter inhibitor may reduce or eliminate a function of SLC3 A2 relative to SLC3 A2 that has not been contacted with the SLC3 A2 / non-glycosylated light chain transporter inhibitor. The comparator for the reduction or elimination in non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) function may be non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) that has not been contacted with the SLC3A2 / non- glycosylated light chain transporter inhibitor. In other words, the SLC3 A2 / non- glycosylated light chain transporter inhibitor may reduce or eliminate a function of the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) relative to a non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) that has not been contacted with the SLC3 A2 / non-glycosylated light chain transporter inhibitor.

[0064] When the HAT inhibitor is a SLC3 A2 / non-glycosylated light chain transporter inhibitor, the SLC3A2 / non-glycosylated light chain transporter inhibitor may reduce or eliminate expression of SLC3 A2 and / or the SLC3 A2 / non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11). “Elimination” in this context means that expression of SLC3 A2 and / or the SLC3 A2 / non- glycosylated light chain transporter is completely obliterated. The SLC3 A2 / non- glycosylated light chain transporter inhibitor may reduce or eliminate expression of SLC3 A2 and / or the SLC3 A2 / non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A1 l)at the mRNA level, for instance. Preferably, the SLC3 A2 / non-glycosylated light chain transporter inhibitor reduces or eliminates expression of SLC3 A2 and / or the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) protein. More preferably, the SLC3 A2 / non-glycosylated light chain transporter inhibitor reduces or eliminates surface expression of SLC3 A2 and / or the non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11) protein. In any case, expression may be reduced relative to expression in a cell that has not be contacted with the SLC3 A2 / non-glycosylated light chain transporter inhibitor.

[0065] The HAT inhibitor (such as the SLC3 A2 inhibitor, non-glycosylated light chain transporter inhibitor, or SLC3 A2 / non-glycosylated light chain transporter inhibitor) may take any form. In one aspect of the disclosure, the HAT inhibitor (such as the SLC3 A2 inhibitor, non-glycosylated light chain transporter inhibitor, or SLC3 A2 / non-glycosylated light chain transporter inhibitor) comprises a small molecule. In one aspect of the disclosure, the HAT inhibitor (such as the SLC3 A2 inhibitor, non-glycosylated light chain transporter inhibitor, or SLC3 A2 / non-glycosylated light chain transporter inhibitor) comprises an antibody or an antigen binding fragment thereof. In one aspect of the disclosure, the HAT inhibitor (such as the SLC3 A2 inhibitor, non-glycosylated light chain transporter inhibitor, or SLC3 A2 / non-glycosylated light chain transporter inhibitor) comprises a nucleic acid silencing molecule. Small molecules, antibodies and nucleic acid silencing molecules that inhibit HATs are discussed below.

[0066] Irrespective of its mechanism of inhibiting HAT, the HAT inhibitor (such as the SLC3 A2 inhibitor, non-glycosylated light chain transporter inhibitor, or SLC3 A2 / non- glycosylated light chain transporter inhibitor) preferably reduces or eliminates entry of the virus that causes the viral infection to a cell of the individual. Reduction of viral entry may, for example, be relative to viral entry to a cell that has not been contacted with the inhibitor. “Elimination” in this context means that viral entry to the cell is completely obliterated. The cell, may, for example, be a cell of the respiratory system. For instance, the cell may be a cell of the upper respiratory tract. For instance, the cell may be a cell of the nose, nostrils, nasal cavity, mouth, throat (pharynx), or (larynx). The cell may be a component of the upper respiratory epithelium, such as a ciliated cell, a goblet cell, or a basal cell. The cell may, for example, be a cell of the lower respiratory tract. For instance, the cell may be a cell of the trachea, bronchi, bronchioles or lungs. A cell of the lungs may, for example, be a cell of the alveolar duct, alveolar sac or alveolus. The lower respiratory tract cell may, for example be a cell of the lower respiratory epithelium, such as a ciliated cell, a club cell or a basal cell. The lower respiratory tract cell may, for example, be a mesenchymal cell, such as a mesenchymal cell forming the lining of the lungs.

[0067] CD98 inhibitor

[0068] The HAT inhibitor may, for example, be a CD98 inhibitor.

[0069] In the context of the present application, CD98 may be defined as a heterodimer that comprises CD98hc (also known as SLC3A2 or 4F2hc) and SLC7A5 (also known as LAT1 or 4F21c). Together, the two subunits form a functional amino acid transporter which preferentially transports branched-chain (valine, leucine, isoleucine) and aromatic (tryptophan, tyrosine, phenylalanine) amino acids. The heterodimer is a HAT. A schematic of CD98 in accordance with the present application is shown in Figure 19. Studies have previously shown that SLC7A5 is the sole transport competent subunit of the heterodimer, able to mediate antiport of amino acids with the same properties of the heterodimer, while SLC3 A2 does not exhibit any intrinsic transport function.

[0070] The CD98 inhibitor may be defined as any compound that reduces or eliminates a function of the CD98 heterodimer, or reduces or eliminates expression of the CD98 heterodimer.

[0071] When the CD98 inhibitor reduces or eliminates a function of the CD98 heterodimer, the CD98 inhibitor may, for instance, reduce the LAT1 transporter function described above. Alternatively or additionally, the CD98 inhibitor may reduce any other known function of the CD98 heterodimer. The CD98 inhibitor may, for example, eliminate the LAT1 transporter function described above. Alternatively or additionally, the CD98 inhibitor may eliminate any known function of the CD98 heterodimer. In any case, the comparator for the reduction in function may be a CD98 heterodimer that has not been contacted with the CD98 inhibitor. In other words, the CD98 inhibitor may reduce a function of the CD98 heterodimer relative to a CD98 heterodimer that has not been contacted with the CD98 inhibitor. “Elimination” in this context means that a function of the CD98 heterodimer is completely obliterated.

[0072] When the CD98 inhibitor reduces or eliminates expression of the CD98 heterodimer, the CD98 inhibitor may, for instance, reduce or eliminate expression of the CD98 heterodimer on the cell surface. “Elimination” in this context means that expression of the CD98 heterodimer is completely obliterated. Expression of one or both subunits may be reduced. For instance, the CD98 inhibitor may reduce or eliminate expression of SLC3 A2. The CD98 inhibitor may, for example, reduce or eliminate expression of SLC3 A2 on the cell surface. “Elimination” in this context means that expression of SLC3 A2 is completely obliterated. The CD98 inhibitor may, for instance, reduce or eliminate expression of SLC7A5. The CD98 inhibitor may, for example, reduce or eliminate expression of SLC7A5 on the cell surface. “Elimination” in this context means that expression of SLC7A5 is completely obliterated. The CD98 inhibitor may, for instance, reduce or eliminate expression of SLC3A2 and SLC7A5. The CD98 inhibitor may, for example, reduce or eliminate expression of SLC3 A2 and SLC7A5 on the cell surface. “Elimination” in this context means that expression of SLC3 A2 and SLC7A5 are completely obliterated. In any case, expression may be reduced relative to expression in a cell that has not be contacted with the CD98 inhibitor.

[0073] To reduce or eliminate a function of the CD98 heterodimer, the CD98 inhibitor may target one or both of the subunits of CD98. For instance, the CD98 inhibitor may bind to one or both of the subunits of CD98, affect a function of one or both subunits, or reduce or eliminate expression of one or both subunits of CD98. The CD98 inhibitor may, for example, target (e.g. bind to and / or affect a function of and / or reduce or eliminate expression of) SLC3 A2. The CD98 inhibitor may, for example, target (e.g. bind to and / or affect a function of and / or reduce or eliminate expression of) SLC7A5. The CD98 inhibitor may, for example, target (e.g. bind to and / or affect a function of and / or reduce or eliminate expression of) SLC3A2 and SLC7A5.

[0074] An inhibitor that targets (e.g. binds to and / or affects a function of and / or reduces or eliminate expression of) SLC3 A2 may be referred to as a SLC3 A2 inhibitor. In one preferred aspect of the disclosure, the CD98 inhibitor is a SLC3A2 inhibitor.

[0075] When the CD98 inhibitor is a SLC3 A2 inhibitor, the affected function of SLC3A2 may, for example, be the ability to form a complex with SLC7A5. Therefore, the SLC3A2 inhibitor may, for instance, reduce or eliminate the ability of SLC3A2 to form a complex with SLC7A5. When the CD98 inhibitor is a SLC3A2 inhibitor, the affected function of SLC3A2 may, for example, be the ability to participate in a functional LAT1 transporter. Therefore, the SLC3 A2 inhibitor may, for instance, reduce or eliminate the ability of SLC3A2 to participate in a functional LAT1 transporter. In either case, the comparator for the reduction or elimination in function may be SLC3 A2 that has not been contacted with the SLC3 A2 inhibitor. In other words, the SLC3 A2 inhibitor may reduce or eliminate a function of SLC3 A2 relative to SLC3 A2 that has not been contacted with the SLC3 A2 inhibitor.

[0076] When the CD98 inhibitor is a SLC3 A2 inhibitor, the SLC3 A2 inhibitor may reduce or eliminate expression of SLC3 A2. “Elimination” in this context means that expression of SLC3A2 is completely obliterated. The SLC3 A2 inhibitor may reduce or eliminate expression of SLC3 A2 at the mRNA level, for instance. Preferably, the SLC3 A2 inhibitor reduces or eliminates expression of SLC3 A2 protein. More preferably, the SLC3 A2 inhibitor reduces or eliminates surface expression of SLC3 A2 protein. In any case, expression may be reduced relative to expression in a cell that has not be contacted with the SLC3A2 inhibitor.

[0077] An inhibitor that targets (e.g. binds to and / or affects a function of and / or reduces or eliminate expression of) SLC7A5 may be referred to as a SLC7A5 inhibitor. The CD98 inhibitor may, for instance, be a SLC7A5 inhibitor.

[0078] When the CD98 inhibitor is a SLC7A5 inhibitor, the affected function of SLC7A5 may, for example, be the ability to form a complex with SLC3 A2. Therefore, the SLC7A5 inhibitor may, for instance, reduce or eliminate the ability of SLC7A5 to form a complex with SLC3 A2. When the CD98 inhibitor is a SLC7A5 inhibitor, the affected function of SLC7A5 may, for example, be the ability to antiport amino acids. Therefore, the SLC7A5 inhibitor may, for instance, reduce or eliminate the ability of SLC7A5 to antiport amino acids. When the CD98 inhibitor is a SLC7A5 inhibitor, the affected function of SLC7A5 may, for example, be the ability to participate in a functional LAT1 transporter. Therefore, the SLC7A5 inhibitor may, for instance, reduce or eliminate the ability of SLC7A5 to participate in a functional LAT1 transporter. In any case, the comparator for the reduction or elimination in function may be SLC7A5 that has not been contacted with the SLC7A5 inhibitor. In other words, the SLC7A5 inhibitor may reduce or eliminate a function of SLC7A5 relative to SLC7A5 that has not been contacted with the SLC7A5 inhibitor.

[0079] When the CD98 inhibitor is a SLC7A5 inhibitor, the SLC7A5 inhibitor may reduce or eliminate expression of SLC7A5. “Elimination” in this context means that expression of SLC7A5 is completely obliterated. The SLC7A5 inhibitor may reduce or eliminate expression of SLC7A5 at the mRNA level, for instance. Preferably, the SLC7A5 inhibitor reduces or eliminates expression of SLC7A5 protein. More preferably, the SLC7A5 inhibitor reduces or eliminates surface expression of SLC7A5 protein. In any case, expression may be reduced relative to expression in a cell that has not be contacted with the SLC7A5 inhibitor.

[0080] An inhibitor that targets (e.g. binds to and / or affects a function of and / or reduces or eliminate expression of) SLC3 A2 and SLC7A5 may be referred to as a SLC3 A2 / SLC7A5 inhibitor. The CD98 inhibitor may, for instance, be a SLC3 A2 / SLC7A5 inhibitor.

[0081] When the CD98 inhibitor is a SLC3 A2 / SLC7A5 inhibitor, the affected function of SLC3A2 may, for example, be the ability to form a complex with SLC7A5. When the CD98 inhibitor is a SLC3 A2 / SLC7A5 inhibitor, the affected function of SLC7A5 may, for example, be the ability to form a complex with SLC3 A2. Therefore, the SLC3 A2 / SLC7A5 inhibitor may, for instance, reduce or eliminate the ability of SLC3 A2 to form a complex with SLC7A5. The SLC3A2 / SLC7A5 inhibitor may, for instance, reduce or eliminate the ability of SLC7A5 to form a complex with SLC3 A2. When the CD98 inhibitor is a SLC3 A2 / SLC7A5 inhibitor, the affected function of SLC7A5 may, for example, be the ability to antiport amino acids. Therefore, the SLC3 A2 / SLC7A5 inhibitor may, for instance, reduce or eliminate the ability of SLC7A5 to antiport amino acids. When the CD98 inhibitor is a SLC3 A2 / SLC7A5 inhibitor, the affected function of SLC3 A2 may, for example, be the ability to participate in a functional LAT1 transporter. Therefore, the SLC3 A2 / SLC7A5 inhibitor may, for instance, reduce or eliminate the ability of SLC3 A2 to participate in a functional LAT1 transporter. When the CD98 inhibitor is a SLC3 A2 / SLC7A5 inhibitor, the affected function of SLC7A5 may, for example, be the ability to participate in a functional LAT1 transporter. Therefore, the SLC3A2 / SLC7A5 inhibitor may, for instance, reduce or eliminate the ability of SLC7A5 to participate in a functional LAT1 transporter. In any case, the comparator for the reduction or elimination in SLC3 A2 function may be SLC3 A2 that has not been contacted with the SLC3 A2 / SLC7A5 inhibitor. In other words, the SLC3 A2 / SLC7A5 inhibitor may reduce or eliminate a function of SLC3 A2 relative to SLC3 A2 that has not been contacted with the SLC3A2 / SLC7A5 inhibitor. The comparator for the reduction or elimination in SLC7A5 function may be SLC7A5 that has not been contacted with the SLC3 A2 / SLC7A5 inhibitor. In other words, the SLC3 A2 / SLC7A5 inhibitor may reduce or eliminate a function of SLC7A5 relative to SLC7A5 that has not been contacted with the SLC3A2 / SLC7A5 inhibitor. When the CD98 inhibitor is a SLC3 A2 / SLC7A5 inhibitor, the SLC3 A2 / SLC7A5 inhibitor may reduce or eliminate expression of SLC3A2 and / or SLC7A5. “Elimination” in this context means that expression of SLC3 A2 and / or SLC7A5 is completely obliterated. The SLC3 A2 / SLC7A5 inhibitor may reduce or eliminate expression of SLC3 A2 and / or SLC7A5 at the mRNA level, for instance. Preferably, the SLC3 A2 / SLC7A5 inhibitor reduces or eliminates expression of SLC3 A2 and / or SLC7A5 protein. More preferably, the SLC3 A2 / SLC7A5 inhibitor reduces or eliminates surface expression of SLC3 A2 and / or SLC7A5 protein. In any case, expression may be reduced relative to expression in a cell that has not be contacted with the SLC3 A2 / SLC7A5 inhibitor.

[0082] The CD98 inhibitor (such as the SLC3 A2 inhibitor, SLC7A5 inhibitor, or SLC3 A2 / SLC7A5 inhibitor) may take any form. In one aspect of the disclosure, the CD98 inhibitor (such as the SLC3 A2 inhibitor, SLC7A5 inhibitor, or SLC3 A2 / SLC7A5 inhibitor) comprises a small molecule. In one aspect of the disclosure, the CD98 inhibitor (such as the SLC3 A2 inhibitor, SLC7A5 inhibitor, or SLC3 A2 / SLC7A5 inhibitor) comprises an antibody or an antigen binding fragment thereof. In one aspect of the disclosure, the CD98 inhibitor (such as the SLC3 A2 inhibitor, SLC7A5 inhibitor, or SLC3 A2 / SLC7A5 inhibitor) comprises a nucleic acid silencing molecule. Small molecules, antibodies and nucleic acid silencing molecules that inhibit CD98 are discussed below.

[0083] Irrespective of its mechanism of inhibiting CD98, the CD98 inhibitor (such as the SLC3A2 inhibitor, SLC7A5 inhibitor, or SLC3A2 / SLC7A5 inhibitor) preferably reduces or eliminates entry of the virus that causes the viral infection to a cell of the individual. Reduction of viral entry may, for example, be relative to viral entry to a cell that has not been contacted with the inhibitor. “Elimination” in this context means that viral entry to the cell is completely obliterated. The cell, may, for example, be a cell of the respiratory system. For instance, the cell may be a cell of the upper respiratory tract. For instance, the cell may be a cell of the nose, nostrils, nasal cavity, mouth, throat (pharynx), or (larynx). The cell may be a component of the upper respiratory epithelium, such as a ciliated cell, a goblet cell, or a basal cell. The cell may, for example, be a cell of the lower respiratory tract. For instance, the cell may be a cell of the trachea, bronchi, bronchioles or lungs. A cell of the lungs may, for example, be a cell of the alveolar duct, alveolar sac or alveolus. The lower respiratory tract cell may, for example be a cell of the lower respiratory epithelium, such as a ciliated cell, a club cell or a basal cell. The lower respiratory tract cell may, for example, be a mesenchymal cell, such as a mesenchymal cell forming the lining of the lungs.

[0084] Small molecule

[0085] As set out above, the HAT inhibitor or CD98 inhibitor (such as the SLC3 A2 inhibitor, SLC7A5 inhibitor, or SLC3A2 / SLC7A5 inhibitor) may comprise a small molecule. The HAT inhibitor or CD98 inhibitor (such as the SLC3 A2 inhibitor, SLC7A5 inhibitor, or SLC3 A2 / SLC7A5 inhibitor) may consist of a small molecule.

[0086] The term “small molecule” has an accepted definition in the art, and is used to refer to an organic compound that has a molecular weight of up to 1000 daltons and a size in the order of 1 nm, and that is capable of regulating a biological process. Small molecules that inhibit HATs are known in the art.

[0087] The small molecule may, for example, comprise JPH203 (otherwise known as KYT 0353). JPH203 has already been used in the client to treat solid tumours (UMIN000016546; Okano I. First-in-human phase I study ofJPH203, an L-type amino acid transporter 1 inhibitor, in patients with advanced solid tumors. Invest New Drugs. 2020 Oct;38(5): 1495-1506). The small molecule may, for example, comprise a derivative of JPH203, such as JG336. JG336 is described in Zaugg J et al. Small molecule inhibitors provide insights into the relevance ofLATl andLAT2 in materno-foetal amino acid transport. J Cell Mol Med. 2020 Nov;24(21): 12681-12693.

[0088] The small molecule may, for example, comprise JX009, which is a LAT1 and LAT2 inhibitor. JX009 is described in Zaugg J et al. Small molecule inhibitors provide insights into the relevance ofLATl andLAT2 in materno-foetal amino acid transport. J Cell Mol Med. 2020 Nov;24(21 ): 12681 - 12693.

[0089] The small molecule may, for example, comprise BCH (2-aminobicyclo (2,2,1)- heptane-2-carboxylic acid). BCH is described in Shennan & Thomson (2008). Inhibition of system L (LATl / CD98hc) reduces the growth of cultured human breast cancer cells. Oncology Reports, 20, 885-889.

[0090] The small molecule may, for example, comprise melphalan ((2S)-2-amino-3-{4- [bis(2-chloroethyl)amino]phenyl (propanoic acid). Melphalan is known in the art as a chemotherapy medication used to treat cancers such as multiple myeloma, malignant lymphoma, lymphoblastic and myeloblastic leukemia, childhood neuroblastoma, ovarian cancer, mammary adenocarcinoma and uveal melanoma. Melphalan has been shown to reduce the expression of CD98.

[0091] The small molecule may, for example, comprise KMH-233. KMH-233 is described in Huttunen et al. L-Type amino acid transporter 1 (latl)-mediated targeted delivery of perforin inhibitors. Int. J. Pharm. 498, 205-216.

[0092] The small molecule may, for example, comprise 3-iodo-L-tyrosine. 3-iodo-L- tyrosine is described in Geier et al. Structure-based ligand discovery for the Large-neutral Amino Acid Transporter 1, LAT-1. Proc Natl Acad Sci U S A 110, 5480-5485.

[0093] The small molecule may, for example, comprise a meta-substituted phenylalanine derivative. Meta-substituted phenylalanine derivatives are described in Augustyn et al. LAT-1 activity of meta-substituted phenylalanine and tyrosine analogs. Bioorg Med Chem Lett 26, 2616-2621.

[0094] The small molecule may, for example, comprise JX-075. The small molecule may, for example, comprise JX-078. The small molecule may, for example, comprise JX- 11913. JX-075, JX-078 and JX-119 are bicyclic meta-tyrosine derivatives which are described in Yan et al. Mechanism of substrate transport and inhibition of the human LATl-4F2hc amino acid transporter . Cell Discov 7, 16 (2021).

[0095] The small molecule may, for example, comprise DTE. The small molecule may, for example, comprise C407. DTE and C407 are described in Napolitano et al. Potent inhibitors of human LAT1 (SLC7A5) transporter based on dithiazole and dithiazine compounds for development of anticancer drugs, Biochemical Pharmacology, Volume 143, 2017, Pages 39-52, ISSN 0006-2952.

[0096] In a preferred aspect of the disclosure the CD98 inhibitor comprises JPH203. For instance, the CD98 inhibitor may consist of JPH203.

[0097] Each of JPH203, JX009, JG336, BCH, Melphalan. KMH-23310, 3-iodo-L-tyrosine, a meta-substituted phenylalanine derivative, JX-075, JX-078, JX-11913, DTE or C40714 are known in the art to inhibit CD98.

[0098] Antibodies and antigen-binding fragments As set out above, the HAT inhibitor or CD98 inhibitor (such as the SLC3 A2 inhibitor, SLC7A5 inhibitor, or SLC3A2 / SLC7A5 inhibitor) may comprise an antibody or an antigen binding fragment thereof. The HAT inhibitor or CD98 inhibitor (such as the SLC3A2 inhibitor, SLC7A5 inhibitor, or SLC3A2 / SLC7A5 inhibitor) may consist of an antibody or an antigen binding fragment thereof.

[0099] The antibody may, for example, be an anti-HAT antibody. That is, the antibody may be specific for one or more HAT. In other words, the antibody may selectively bind to one or more HATs. In the context of the present disclosure, an antibody that is specific for or selectively binds to one or more HATs may have greater affinity for one or more HATs than for any other antigen. An antigen-binding fragment of an anti-HAT antibody is also specific for, or selectively binds to, the one or more HATs.

[0100] An antibody that selectively binds to one or more HATs may selectively bind to any part of the one or more HATs. An antibody that selectively binds to one or more HATs may, for example, selectively bind to SLC3A2. An antibody that selectively binds to one or more HATs may, for example, selectively bind to one or more non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11). An antibody that selectively binds to one or more HATs may, for example, selectively bind to a complex comprising SLC3 A2 and a non-glycosylated light chain transporter (i.e. SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11). An antibody that selectively binds to one or more may, for example, selectively bind to a complex consisting of SLC3 A2 and SLC7A5, to a complex consisting of SLC3 A2 and SLC7A8, to a complex consisting of SLC3 A2 and SLC7A7, to a complex consisting of SLC3A2 and SLC7A6, to a complex consisting of SLC3A2 and SLC7A10, and / or a complex consisting of SLC3A2 and SLC7A11.

[0101] The anti-HAT antibody may, for example, be an anti-SLC3 A2 antibody. That is, the antibody may be specific for SLC3 A2. In other words, the antibody may selectively bind to SLC3 A2. In the context of the present disclosure, an antibody that is specific for or selectively binds to SLC3A2 may have greater affinity for SLC3 A2 than for any other antigen. An antigen-binding fragment of an anti-SLC3 A2 antibody is also specific for, or selectively binds to, SLC3 A2.

[0102] The anti-HAT antibody may, for example, be an anti-SLC7A5 antibody. That is, the antibody may be specific for SLC7A5. In other words, the antibody may selectively bind to SLC7A5. In the context of the present disclosure, an antibody that is specific for or selectively binds to SLC7A5 may have greater affinity for SLC7A5 than for any other antigen. An antigen-binding fragment of an anti-SLC7A5 antibody is also specific for, or selectively binds to, SLC7A5.

[0103] The anti-HAT antibody may, for example, be an anti-SLC7A8 antibody. That is, the antibody may be specific for SLC7A8. In other words, the antibody may selectively bind to SLC7A8. In the context of the present disclosure, an antibody that is specific for or selectively binds to SLC7A8 may have greater affinity for SLC7A8 than for any other antigen. An antigen-binding fragment of an anti-SLC7A8 antibody is also specific for, or selectively binds to, SLC7A8.

[0104] The anti-HAT antibody may, for example, be an anti-SLC7A7 antibody. That is, the antibody may be specific for SLC7A7. In other words, the antibody may selectively bind to SLC7A7. In the context of the present disclosure, an antibody that is specific for or selectively binds to SLC7A7 may have greater affinity for SLC7A7 than for any other antigen. An antigen-binding fragment of an anti-SLC7A7 antibody is also specific for, or selectively binds to, SLC7A7.

[0105] The anti-HAT antibody may, for example, be an anti-SLC7A6 antibody. That is, the antibody may be specific for SLC7A6. In other words, the antibody may selectively bind to SLC7A6. In the context of the present disclosure, an antibody that is specific for or selectively binds to SLC7A6 may have greater affinity for SLC7A6 than for any other antigen. An antigen-binding fragment of an anti-SLC7A6 antibody is also specific for, or selectively binds to, SLC7A6.

[0106] The anti-HAT antibody may, for example, be an anti-SLC7A10 antibody. That is, the antibody may be specific for SLC7A10. In other words, the antibody may selectively bind to SLC7A10. In the context of the present disclosure, an antibody that is specific for or selectively binds to SLC7A10 may have greater affinity for SLC7A10 than for any other antigen. An antigen-binding fragment of an anti-SLC7A10 antibody is also specific for, or selectively binds to, SLC7A10.

[0107] The anti-HAT antibody may, for example, be an anti-SLC7Al 1 antibody. That is, the antibody may be specific for SLC7A11. In other words, the antibody may selectively bind to SLC7A11. In the context of the present disclosure, an antibody that is specific for or selectively binds to SLC7A11 may have greater affinity for SLC7A11 than for any other antigen. An antigen-binding fragment of an anti-SLC7Al 1 antibody is also specific for, or selectively binds to, SLC7A11.

[0108] The antibody may, for example, be an anti-CD98 antibody. That is, the antibody may be specific for CD98. In other words, the antibody may selectively bind to CD98. In the context of the present disclosure, an antibody that is specific for or selectively binds to CD98 may have greater affinity for CD98 than for any other antigen. An antigen-binding fragment of an anti-CD98 antibody is also specific for, or selectively binds to, CD98.

[0109] An antibody that selectively binds to CD98 may selectively bind to any part of CD98. An antibody that selectively binds to CD98 may, for example, selectively bind to SLC3 A2. An antibody that selectively binds to CD98 may, for example, selectively bind to SLC7A5. An antibody that selectively binds to CD98 may, for example, selectively bind to a complex comprising SLC3A2 and SLC7A5. An antibody that selectively binds to CD98 may, for example, selectively bind to a complex consisting of SLC3 A2 and SLC7A5.

[0110] The anti-CD98 antibody may, for example, be an anti-SLC3 A2 antibody. That is, the antibody may be specific for SLC3 A2. In other words, the antibody may selectively bind to SLC3A2. In the context of the present disclosure, an antibody that is specific for or selectively binds to SLC3A2 may have greater affinity for SLC3 A2 than for any other antigen. An antigen-binding fragment of an anti-SLC3 A2 antibody is also specific for, or selectively binds to, SLC3 A2.

[0111] The anti-CD98 antibody may, for example, be an anti-SLC7A5 antibody. That is, the antibody may be specific for SLC7A5. In other words, the antibody may selectively bind to SLC7A5. In the context of the present disclosure, an antibody that is specific for or selectively binds to SLC7A5 may have greater affinity for SLC7A5 than for any other antigen. An antigen-binding fragment of an anti-SLC7A5 antibody is also specific for, or selectively binds to, SLC7A5.

[0112] In any case, the antibody may, for example, be a monoclonal antibody. The antibody may, for example, be an IgG, IgM, IgA, IgD, or IgE. The IgG may, for example, be an IgGl, IgG2, IgG3 or an IgG4.

[0113] The antibody may, for example, be a HAT blocking antibody. The antibody may, for example, be a CD98 blocking antibody. The antibody may, for example, be a SLC3 A2 blocking antibody. The antibody may, for example, be a SLC7A5 blocking antibody. The HAT blocking antibody may, for example, be a CD98 blocking antibody. The HAT blocking antibody may, for example, be a SLC3 A2 blocking antibody. The HAT blocking antibody may, for example, be a SLC7A5 blocking antibody. The HAT blocking antibody may, for example, be a SLC7A8 blocking antibody. The HAT blocking antibody may, for example, be a SLC7A7 blocking antibody. The HAT blocking antibody may, for example, be a SLC7A6 blocking antibody. The HAT blocking antibody may, for example, be a SLC7A10 blocking antibody. The HAT blocking antibody may, for example, be a SLC7A11 blocking antibody. The CD98 blocking antibody may, for example, be a SLC3 A2 blocking antibody. The CD98 blocking antibody may, for example, be a SLC7A5 blocking antibody.

[0114] In the context of the present disclosure, a blocking antibody may be defined as an antibody that, when bound to its target, (i) directly interferes with the function of its target and / or (ii) prevents other antibodies from binding to the target. Thus, a blocking antibody may, when bound to its target, directly interfere with the function of the target. A blocking antibody may, when bound to its target, prevent other antibodies from binding to the target. A blocking antibody may, when bound to its target, directly interfere with the function of the target and prevent other antibodies from binding to the target. A blocking antibody that directly interferes with the function of its target may, for example, inhibit the function of the target. A blocking antibody may, for example, inhibit the target’s normal receptorligand interactions. For instance, the blocking antibody may be an antagonist of the target.

[0115] A HAT blocking antibody may therefore be defined as an antibody that (i) directly interferes with the function of a HAT when it is bound to the HAT, and / or (ii) prevents other antibodies from binding to a HAT when it is bound to the HAT. A CD98 blocking antibody may therefore be defined as an antibody that (i) directly interferes with the function of CD98 when it is bound to CD98, and / or (ii) prevents other antibodies from binding to CD98 when it is bound to CD98. A SLC3A2 blocking antibody may therefore be defined as an antibody that (i) directly interferes with the function of SLC3 A2 when it is bound to SLC3 A2, and / or (ii) prevents other antibodies from binding to SLC3 A2 when it is bound to SLC3 A2. A SLC7A5 blocking antibody may therefore be defined as an antibody that (i) directly interferes with the function of SLC7A5 when it is bound to SLC7A5, and / or (ii) prevents other antibodies from binding to SLC7A5 when it is bound to SLC7A5. Antibodies that block HATs, CD98, SLC3 A2, SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 and / or SLC7A11 are known in the art. CD98 blocking antibodies include R8H283, HBJ 127, IGN523, MEM 108, BK19.9, 4F2, BU53, BU89, AHN-18.1 and AHN-18. The CD98 blocking antibody may therefore be R8H283, HBJ 127, IGN523, MEM 108, BK19.9, 4F2, BU53, BU89, AHN-18.1 or AHN-18. The CD98 inhibitor may be R8H283, HBJ 127, IGN523, MEM 108, BK19.9, 4F2, BU53, BU89, AHN-18.1 or AHN-18.

[0116] R8H283 (Osaka University Otsuka Pharmaceutical Co., Ltd) is described at https: / / www.otsuka.co.jp / en / company / newsreleases / 2022 / 20220415 l.html; in Kana Hasegawa et al. Selective targeting of multiple myeloma cells with a monoclonal antibody recognizing the ubiquitous protein CD98 heavy chain. Sci. Transl. Med. 14, eaax7706 (2022). DOI:10.1126 / scitranslmed.aax7706; and in WO 2017 / 026497.

[0117] HBJ 127 is described in Mori K et al. The functional interaction between CD98 and CD 147 in regulation of virus-induced cell fusion and osteoclast formation. Med Microbiol Immunol 193, 155-162 (2004). https: / / doi.org / 10.1007 / s00430-003-0191-0.

[0118] IGN523, a humanized monoclonal antibody, is described in Hayes G M et al. Antitumor activity of an anti-CD98 antibody. Int J Cancer. 2015 Aug 1 ; 137(3):710-20. IGN523 has already been used in the clinic (NCT02040506).

[0119] MEM 108 (a CD98 blocking antibody) is described in Kim Mi-Yeon and Cho Jae Youl. Molecular association of CD98, CD29, and CD 147 critically mediates monocytic U937 cell adhesion. Korean J Physiol Pharmacol. 2016 Sep; 20(5): 515-523.

[0120] BK19.9 is an IgGl. 4F2 is an IgG2a. BU53 is an IgG2a. BU89 is an IgGl. AHN- 18.1. AHN- 18 is an IgGl . BK19.9, 4F2, BU53, BU89, AHN-18.1 and AHN-18 are described in Cho J Y et al. The functional interactions between CD98, f 1-integrins, and CD147 in the induction of U937 homotypic aggregation. Blood (2001) 98 (2): 374-382.

[0121] SLC3A2 blocking antibodies include UM7F8, KHK2898 and 3G9. The CD98 blocking antibody or SLC3 A2 blocking antibody may therefore be UM7F8, KHK2898 or 3G9. The CD98 inhibitor or SLC3A2 inhibitor may be UM7F8, KHK2898 or 3G9.

[0122] UM7F8 is described in L A Diaz et al. Monocyte-dependent regulation of T lymphocyte activation through CD98. International Immunology, Volume 9, Issue 9, Sep 1997, Pages 1221-1231, https: / / doi.Org / 10.1093 / intimm / 9.9.1221. KHK2898 is described in is described in Hayes G M et al. Antitumor activity of an anti-CD98 antibody. Int J Cancer. 2015 Aug l;137(3):710-20. KHK2898 has already been used in the clinic. (NCT01516645).

[0123] 3G9 is described in Wang S et al. SLC3A2, antigen of mAb 3G9, promotes migration and invasion by upregulating of mucins in gastric cancer. Oncotarget. 2017 Jul 25;8(51):88586-88598. doi: 10.18632 / oncotarget.19529. PMID: 29179459; PMCID: PMC5687629.

[0124] An antigen-binding fragment of an antibody may be defined as any fragment of the antibody that is specific for, or selectively binds to, the same antigen as the antibody. The antigen-binding fragment may, for example, comprise or consist of a single chain variable fragment (scFv). The antigen-binding fragment may, for example, comprise or consist of a scFv-Fc. The antigen-binding fragment may, for example, comprise or consist of a singledomain antibody, such as a camelid antibody, an artificial VHH fragment or an IgNAR.

[0125] Nucleic acid silencing molecule

[0126] The HAT inhibitor or CD98 inhibitor (such as the SLC3 A2 inhibitor, SLC7A5 inhibitor, or SLC3 A2 / SLC7A5 inhibitor) may comprise a nucleic acid silencing molecule. The HAT inhibitor or CD98 inhibitor (such as the SLC3 A2 inhibitor, SLC7A5 inhibitor, or SLC3 A2 / SLC7A5 inhibitor) may consist of a nucleic acid silencing molecule.

[0127] In the context of the disclosure, a silencing molecule may be defined as a molecule that reduces or eliminates (i.e. knocks down) expression of a target gene. A silencing molecule may, for example, reduce the amount of the mRNA product of target gene. A silencing molecule may, for example, eliminate the mRNA product of target gene. A silencing molecule may, for example, reduce the amount of the protein product of target gene. A silencing molecule may, for example, eliminate the protein product of target gene. In the present disclosure, the target gene encodes a component of a HAT. For instance, the target gene may encode SLC3 A2. The target gene may encode SLC7A5, SLC7A8, SLC7A7, SLC7A6, SLC7A10 or SLC7A11. Preferably, the target gene encodes a component of CD98, such as SLC3A2 or SLC7A5.

[0128] In the context of the disclosure, a nucleic acid silencing molecule may be defined as a silencing molecule that comprises or consists of one or more nucleic acids. The nucleic acid silencing molecule of the disclosure may comprise RNA. The nucleic acid silencing

[0129] The nucleic acid silencing molecule of the disclosure may comprise DNA. The nucleic acid silencing molecule of the disclosure may comprise DNA and RNA. The nucleic acid silencing molecule of the disclosure may consist of RNA. The nucleic acid silencing molecule of the disclosure may consist of DNA. The nucleic acid silencing molecule of the disclosure may consist of DNA and RNA.

[0130] The nucleic acid silencing molecule may reduce or eliminate (i.e. knock down) expression of the target gene by any mechanism known in the art. The nucleic acid silencing molecule may, for example, bind to a mRNA molecule encoded by the target gene to block its translation into protein. The nucleic acid silencing molecule may, for example, bind to a mRNA molecule encoded by the target gene to induce degradation (such as enzymatic degradation) of the mRNA. The nucleic acid silencing molecule may, for example, bind to DNA encoding the target gene to induce methylation of the DNA and / or its associated histones.

[0131] For example, the nucleic acid silencing molecule may comprise or consist of an antisense oligonucleotide (AON). The nucleic acid silencing molecule may comprise or consist of a small interfering RNA (siRNA). The nucleic acid silencing molecule may comprise or consist of a short hairpin RNA (shRNA). The nucleic acid silencing molecule may comprise or consist of a microRNA (miRNA). Preferably, the nucleic acid silencing molecule comprises or consists of an antisense oligonucleotide (AON) or a small interfering RNA (siRNA).

[0132] The nucleic acid silencing molecule may be about 10 to about 15000 nucleotides in length, such as about 100 to about 14000, about 200 to about 13000, about 300 to about 12000, about 400 to about 11000, about 400 to about 10000, about 500 to about 9000, about 600 to about 8000, about 700 to about 7000, about 800 to about 6000, about 900 to about 5000, about 1000 to about 4000, or about 2000 to 3000 in length. Preferably, the nucleic acid silencing molecule is less than 100 (such as less than 95, less than 90, less than 85, less than 80, less than 75, less than 70, less than 65, less than 60, less than 55, less than 50, less than 45, less than 40, less than 35, less than 30, less than 25, less than 20, less than 15, or less than 10) nucleotides in length. The nucleic acid silencing molecule may, for example be about 10 to about 50 nucleotides in length. For example, the nucleic acid silencing molecule may be about 10 to about 40, about 10 to about 30, about 10 to about 20, about 20 to about 50, about 20 to about 40, about 20 to about 30, about 30 to about 50, or about 30 to about 40 nucleotides in length. Preferably, the nucleic acid molecule is about 10 to about 30 (such as about 10 to about 20, or about 20 to about 30) nucleotides in length. The nucleic acid molecule may, for example, be about 10, about 11, about 12, about 13, about 14, about 14, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29 or about 30 nucleotides in length. The nucleic acid molecule may preferably be about 16 or about 20 nucleic acids in length. Typical lengths of antisense oligonucleotides (AONs), small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs) and microRNAs (miRNAs) are well-known in the art.

[0133] The nucleic acid silencing molecule may, for example, comprise one or more 2'-O- methoxyethylribose (MOE) modified nucleotides or consist of 2'-O-methoxyethylribose (MOE) modified nucleotides. The nucleic acid silencing molecule may, for example, comprise one or more 2’-O-methyl (20Me) modified nucleotides or consist of 2’-O-methyl (20Me) modified nucleotides. The nucleic acid silencing molecule may, for example, comprise one or more locked nucleic acid (LNA) modified nucleotides or consist of locked nucleic acid (LNA) modified nucleotides. The nucleic acid silencing molecule may, for example, comprise one or more nucleotide phosphorothioates or consist of nucleotide phosphorothioates. MOE modified nucleotides, 20Me modified nucleotides, LNA modified nucleotides and nucleotide phosphorothioates are described in the art.

[0134] The nucleic acid silencing molecule may be capable of binding to the target gene or to the RNA encoded by the target gene. The nucleic acid silencing molecule may be capable of binding to part of the target gene or to part of the RNA encoded by the target gene. Binding may, for example, be effected by hybridisation.

[0135] Viral infection

[0136] Administration of the CD98 inhibitor to the individual prevents or treats a viral infection in the individual. A viral infection is an infection caused by a virus. In a viral infection, the causative virus replicates in one or more cells of the individual. In some aspects of the disclosure, the infection may cause clinical signs, i.e. signs of disease. In other aspects of the disclosure, the infection may not cause clinical signs. In other words, the infection may be subclinical or asymptomatic.

[0137] The virus that causes the viral infection may be any type of virus. The virus may, for example, be an RNA virus. The virus may, for example, be a DNA virus. The virus may, for example, be a reverse transcribing virus. The genome of the virus may be singlestranded. The single strand may, for example, be positive sense. The single strand may, for example, be negative sense. The genome of the virus may, for example, be doublestranded. The virus may, for example, be an enveloped virus. The virus may, for example, be a non-enveloped virus. The virus may, for example, be an RNA virus in one of the following families: Coronaviridae, Reoviridae, Picomaviridae, Caliciviridae, Togaviridae, Arenaviridae, Flaviviridae, Orthomyxoviridae, Paramyxoviridae, Bunyaviridae, Rhabdoviridae, Astroviridae, Bomaviridae, Hepeviridae. The virus may, for example, be a DNA virus in one of the following families: Adenoviridae, Papovaviridae, Parvoviridae, Herpesviridae, Poxviridae, Anelloviridae, Pleolipoviridae. The virus may, for example, be a reverse transcribing virus in one of the following families: Retroviridae, Caulimoviridae, Hepadnaviridae.

[0138] In a preferred aspect of the disclosure, the virus that causes the viral infection is a member of the Coronaviridae family. The virus may, for example, be a coronavirus. As set out in the Example, the present inventors have demonstrated that CD98 or SLC3 A2 facilitates coronaviral entry to cells, and that inhibition of CD98 or SLC3 A2 reduces coronaviral entry. Inhibitors of CD98 or SLC3 A2 may therefore be used to prevent or treat coronavirus infections. The coronavirus may, for example, be a human coronavirus. A human coronavirus may be defined as a coronavirus that infects humans. Human coronaviruses include SARS-CoV-2 (the causative agent of COVID-19), SARS-CoV-1 (the causative agent of SARS), MERS-CoV (the causative agent of MERS), NL63, OC43, HKU1 and 229E. NL63, OC43, HKU1 and 229E are collectively known as common cold coronaviruses (CCCs), as they cause around 20% of common colds. The virus that causes the viral infection may preferably be SARS-CoV-2. The virus that causes the viral infection may be SARS-CoV-1. The virus that causes the viral infection may be a common cold coronavirus. The common cold coronavirus may, for example, be NL63, OC43, HKU1 or 229E. CD98 or SLC3 A2 may also have a role in entry of other types of virus to cells. Inhibition of CD98 or SLC3 A2 may therefore reduce entry of other types of virus, and be used to treat viral infections that are not caused by a coronavirus. Accordingly, the virus that causes the viral infection may belong to a family other than the Coronaviridae family. The virus may, for example, be a virus that is not a coronavirus. The virus may, for example, be any virus for which CD98 or SLC3 A2 has a role in viral entry. There is evidence that CD98 or SCL3 A2 has a role in viral entry for MNV-1 (murine norovirus-1), VACV (vaccinia virus), HCV (hepatitis C virus), AD37 (adenovirus type 37), Chikungunya virus, HCMV (human cytomegalovirus), NDV (Newcastle Disease virus), HIV (human immunodeficiency virus) and HSV-1 (herpes simplex virus 1). Accordingly, the virus may, for example, be a norovirus, (e.g. MNV-1 or a human norovirus), a poxvirus (e.g. VACV), a hepacivirus (e.g. hepatitis C virus), an adenovirus (e.g. AD37), an alphavirus (e.g. Chikungunya virus), a cytomegalovirus (e.g. HCMV), an avulavirus (e.g. NDV), a lentivirus (e.g. HIV) or an alphaherpesvirus (e.g. HSV-1).

[0139] Preventing or treating

[0140] Administration of the CD98 inhibitor to the individual prevents or treats a viral infection in the individual.

[0141] Prevention of a viral infection may, for example, refer to the effect of administering the CD98 inhibitor (e.g. SLC3 A2 inhibitor) to the individual prior to replication of the causative virus in one or more cells of the individual. Replication of the causative virus may, for example, be signaled by shedding or excretion of the virus by the individual. Accordingly, prevention of a viral infection may, for example, refer to the effect of administering the CD98 inhibitor (e.g. SLC3 A2 inhibitor) to the individual prior shedding or excretion of the causative virus by the individual. Prevention of a viral infection may, for example, refer to the effect of administering the CD98 inhibitor (e.g. SLC3 A2 inhibitor) to the individual prior to the onset of one or more clinical signs of the viral infection.

[0142] Prevention of a viral infection may, for example, refer to preventing replication of the causative virus in one or more cells of the individual. For instance, replication of the causative virus in one or more cells of the individual may be prevented following exposure of the individual to the virus. Prevention of a viral infection may, for example, refer to preventing the onset of one or more clinical signs of the viral infection in the individual. For instance, the onset of one or more clinical signs of the viral infection may be prevented following exposure of the individual to the virus. In this way, clinical disease may be avoided. The viral infection may be rendered subclinical or asymptomatic instead.

[0143] Prevention of a viral infection may, for example, refer to delaying the onset of one or more clinical signs of the viral infection in the individual. For instance, the onset of one or more clinical signs of the viral infection may be delayed following exposure of the individual to the virus. The delay may, for example, be for one or more days, such as two or more, three or more, four or more, five or more, six or more, seven or more, 10 or more, 14 or more or 21 or more days.

[0144] Prevention of a viral infection may, for example, refer to minimising the onset of one or more clinical signs of the viral infection in the individual. For instance, the onset of one or more clinical signs of the viral infection may be minimised following exposure of the individual to the virus. Minimising the onset of a clinical sign may refer to reducing the severity of the clinical sign from the point that it first becomes apparent in the individual.

[0145] Treatment of a viral infection may, for example, refer to the effect of administering the CD98 inhibitor (e.g. SLC3 A2 inhibitor) to the individual after replication of the causative virus in one or more cells of the individual has begun. Replication of the causative virus may, for example, be signaled by shedding or excretion of the virus by the individual. Accordingly, treatment of a viral infection may, for example, refer to the effect of administering the CD98 inhibitor (e.g. SLC3 A2 inhibitor) to the individual after shedding or excretion of the causative virus by the individual has begun. Treatment of a viral infection may, for example, refer to the effect of administering the CD98 inhibitor (e.g. SLC3 A2 inhibitor) to the individual after the onset of one or more clinical signs of the viral infection.

[0146] Treatment of a viral infection may, for example, refer to reducing the severity of one or more clinical signs of the viral infection. Treatment of a viral infection may, for example, refer to reducing the severity of all clinical signs of the viral infection. The severity of a clinical sign may, for example, be reduced compared to the severity of the clinical sign in the individual before the CD98 inhibitor (e.g. SLC3 A2 inhibitor) is administered. The severity of a clinical sign may, for example, be reduced compared to the expected severity of the clinical sign in the individual should the CD98 inhibitor (e.g.

[0147] SLC3 A2 inhibitor) not be administered. The severity of a clinical sign may, for example, be reduced compared to the average severity of the clinical sign in infected individuals not administered with the CD98 inhibitor (e.g. SLC3 A2 inhibitor).

[0148] Treatment of a viral infection may, for example, refer to reducing the duration of one or more clinical signs of the viral infection. Treatment of a viral infection may, for example, refer to reducing the duration of all clinical signs of the viral infection. The duration of a clinical sign may, for example, be reduced compared to the expected duration of the clinical sign in the individual should the CD98 inhibitor (e.g. SLC3 A2 inhibitor) not be administered. The duration of a clinical sign may, for example, be reduced compared to the average duration of the clinical sign in infected individuals not administered with the CD98 inhibitor (e.g. SLC3 A2 inhibitor).

[0149] Treatment of a viral infection may, for example, refer to abolishing one or more clinical signs of the viral infection. Treatment of a viral infection may, for example, refer to abolishing all clinical signs of the viral infection.

[0150] Treatment of a viral infection may, for example, refer to stopping the progression of one or more clinical signs of the viral infection. Treatment of a viral infection may, for example, refer to stopping the progression of all clinical signs of the viral infection. Stopping the progression of a clinical sign may, for example, refer to preventing the clinical sign from becoming more severe. Stopping the progression of a clinical sign may, for example, refer to preventing the onset of one or more sequelae of the clinical sign.

[0151] Individual

[0152] The individual to which the CD98 inhibitor (e.g. SLC3 A2 inhibitor) is administered may be an individual of any species capable of contracting a viral infection. Preferably, the individual is a mammal. More preferably, the individual is a human. However, the individual may, for example, be a non-human animal such as a non-human mammal or a bird. The non-human mammal may, for example, be a companion animal such as a dog, cat, horse, rabbit or guinea pig. The non-human mammal may, for example, be a farm animal such as a cow, sheep, pig or goat.

[0153] The individual may, for instance, be an adult. The individual may, for instance, be a juvenile. When the individual is human, for example, the juvenile may be an infant (or baby) or a child.

[0154] Administration

[0155] The CD98 inhibitor (e.g. SLC3 A2 inhibitor) may be administered by any route. Suitable routes include, but are not limited to, the intravenous, intrathecal, intracerebral ventricular, intramuscular, intraperitoneal, subcutaneous, intradermal, transdermal and oral / buccal routes.

[0156] The CD98 inhibitor (e.g. SLC3 A2 inhibitor) may be prepared together with a physiologically acceptable carrier or diluent. Typically, such compositions are prepared as liquid suspensions of inhibitor. The inhibitor may be mixed with an excipient which is pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, of the like and combinations thereof. In addition, if desired, the pharmaceutical compositions may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, and / or pH buffering agents.

[0157] The CD98 inhibitor (e.g. SLC3 A2 inhibitor) may be administered in a manner compatible with the dosage formulation and in such amount will be therapeutically effective. The quantity to be administered depends on the subject to be treated, and the viral infection to be treated. Precise amounts of inhibitor required to be administered may depend on the judgement of the practitioner and may be peculiar to each subject.

[0158] The CD98 inhibitor (e.g. SLC3 A2 inhibitor) may be administered in combination with one or more other compositions suitable for preventing or treating the viral infection. For example, the CD98 inhibitor (e.g. SLC3A2 inhibitor) may be administered in combination with (a) a vaccine against the virus that causes the viral infection, (b) an antiviral drug, and / or (c) one or more supportive therapies. The CD98 inhibitor (e.g.

[0159] SLC3 A2 inhibitor) may be administered in combination with: (a); (b); (c); (a) and (b); (a) and (c); (b) and (c); or (a); (b) and (c).

[0160] Screening method The disclosure provides a method of screening for a treatment for a viral infection. The method comprises (a) contacting a HAT with a compound to be screened; and (b) determining whether the compound affects the activity of the HAT. The HAT may, for example, be CD98. The HAT may, for example, comprise SLC3A2. A compound that is found to affect the activity of the HAT may be capable of preventing or treating a viral infection. For instance, a compound that is found to inhibit the HAT (e.g. to by inhibiting SLC3 A2 and / or CD98) may be capable of preventing or treating a viral infection. As set out above, the Examples of the present application show that inhibition of SLC3 A2 and / or CD98 (e.g. using KYT 0353) reduces viral entry and thus may be used to treat viral infection.

[0161] The activity of the HAT that is determined in step (b) may preferably be the ability of the HAT to facilitate viral entry to a cell. Thus, step (b) may comprise determining whether the compound affects entry of the virus that causes the viral infection to a cell. Assays for viral entry are known in the art and considered in the present Examples. For example, one or more cells may be contacted with virus for a period of time. The virus may then be removed by washing the cells. The cell may be lysed to expose virus that has entered the cell. Virus that has entered the cell may be quantified, for example using qPCR or Western blot.

[0162] The cell may, for example, be a host cell. The cell may, for example, be a mammalian cell. The cell may, for example, be a human cell. The cell may, for example, be a host cell line. The cell may, for example, be a mammalian cell line. The cell may, for example, be a human cell line.

[0163] The activity of the HAT that is determined in step (b) may, for instance, be the ability to transport amino acids. Thus, step (b) may comprise determining whether the compound affects the ability of the HAT to transport amino acids. Methods for determining transporting ability are known in the art. FURTHER ASPECTS

[0164] 1. A method of preventing or treating a viral infection in an individual, comprising administering a heterodimeric amino acid transporter (HAT) inhibitor to the individual.

[0165] 2. The method of aspect 1, wherein the HAT inhibitor is a CD98 inhibitor, optionally a SLC3A2 inhibitor.

[0166] 3. The method of aspect 1 or 2, wherein the HAT inhibitor reduces or eliminates entry of the virus that causes the viral infection to a cell of the individual, optionally wherein the cell is a cell of the respiratory system.

[0167] 4. The method of any one of the preceding aspects, wherein the HAT inhibitor comprises a small molecule.

[0168] 5. The method of aspect 4, wherein the small molecule comprises JPH203, JX009, JG336, BCH, Melphalan. KMH-23310, 3-iodo-L-tyrosine, a meta-substituted phenylalanine derivative, JX-075, JX-078, JX-11913, DTE or C40714.

[0169] 6. The method of any one of the preceding aspects, wherein the HAT inhibitor comprises an antibody or an antigen binding fragment thereof.

[0170] 7. The method of aspect 6, wherein the antibody is a CD98 blocking antibody, optionally a SLC3 A2 blocking antibody.

[0171] 8. The method of aspect 7, wherein:

[0172] (a) the CD98 blocking antibody is R8H283, HBJ 127, IGN523, MEM 108, BK19.9, 4F2,

[0173] BU53, BU89, AHN-18.1 or AHN-18; or

[0174] (b) the SLC3A2 blocking antibody is UM7F8, KHK2898 or 3G9. 9. The method of any one of the preceding aspects, wherein the HAT inhibitor comprises a nucleic acid silencing molecule.

[0175] 10. The method of any one of the preceding aspects, wherein the virus that causes the viral infection is (a) a coronavirus, or (b) a norovirus, a poxvirus, a hepacivirus, an adenovirus, an alphavirus, a cytomegalovirus , an avulavirus, a lentivirus or an alphaherpesvirus.

[0176] 11. The method of aspect 10, wherein the coronavirus is:

[0177] (a) SARS-CoV-2;

[0178] (b) a common cold coronavirus, optionally NL63, OC43, HKU1, 229E;

[0179] (c) SARS-CoV-1; or

[0180] (d) MERS-CoV.

[0181] 12. A HAT inhibitor for use in the method of any one of the preceding aspects.

[0182] 13. Use of a HAT inhibitor in the manufacture of a medicament for preventing or treating a viral infection in an individual, optionally wherein the HAT inhibitor is a CD98 inhibitor or a SLC3 A2 inhibitor.

[0183] 14. A method of screening for a treatment for a viral infection, comprising:

[0184] (a) contacting a HAT with a compound to be screened; and

[0185] (b) determining whether the compound affects the activity of the HAT; optionally wherein the HAT is CD98 or comprises SLC3 A2.

[0186] 15. The method of aspect 14, wherein step (b) comprises determining whether the compound affects entry of the virus that causes the viral infection to a cell. EXAMPLES

[0187] The following Examples illustrate the invention.

[0188] Introduction

[0189] At the end of 2019 a novel SARS Coronavirus (SARS-CoV-2) entered the human population, presumably after a zoonotic transfer from a yet to be identified animal source. The virus quickly spread globally, infected more than 750 million people and is responsible for at almost 7 million deaths (WHO, https: / / covidl9.who.int, Dec 2023). SARS-CoV-2 replicates in the upper and occasionally lower respiratory tract of humans. Infections can remain asymptomatic; symptomatic infections manifest in a wide range: from cold-like symptoms to acute respiratory distress syndrome and respiratory failure.

[0190] SARS-CoV-2 virions attach to heparan sulfates on the cell surface and rely primarily on angiotensin converting enzyme 2 (ACE2) to enter the host cell. The entry process requires proteolytic activation of the SARS-CoV-2 spike (S) and either occurs at the cell surface, when the serine protease TMPRSS2 is expressed by the host cell or by endosomal uptake. In the latter case endosomal cathepsins are responsible for the cleavage of SARS-CoV-2 S protein, initiating fusion of viral and endosomal membrane.

[0191] In vivo, expression of hACE2 suffices to make mice susceptible to SARS-CoV-2. Additional entry factors such as neuropilin 1 have bene identified, which support ACE2 dependent entry. However, ACE2 independent entry has been shown, e.g., in H522 cells. Here ACE2 knockout did not affect the entry process, suggesting that additional proteins could substitute the default receptor. Along these lines, S protein mutations found in variants of concern, which lead to enhanced viral entry, do not augment ACE2 binding. This points to additional host dependency factors permitting or supporting the entry process of SARS-CoV-2.

[0192] To identify such host factors, cell surface proximity ligation (CSPL) was used in the present Example to identify host plasma membrane proteins in the vicinity of attached viral spike proteins. Hits were validated with subsequent gain of function and loss of function approaches using VLP entry assays. Using chemical inhibitors of a subset of entry factors in virus infection assays we ultimately demonstrate that these host surface proteins could serve as future drug targets in antiviral therapy.

[0193] Results

[0194] The inventors previously applied cell surface proximity ligation (CSPL) to biotinlabel host plasma membrane protein in the vicinity of attached trimeric viral ligands (Mazel-Sanchez, B. et al. Influenza A virus exploits transferrin receptor recycling to enter host cells. Proc Natl Acad Sci U S A 120, e2214936120 (2023)). Coupled to mass spectrometry this strategy successfully identified TfRl as a host entry factor for influenza A viruses.

[0195] In the present Example, the inventors performed CSPL on A549 cells overexpressing ACE2 and TMPRSS2 (A549 A2T2 (Fig.1 A and B)). A stabilized trimeric SARS-CoV-2 S protein fused C-terminally to HRP was used as molecular bait. These proteins were produced in insect cell culture using a baculovirus expression system (Fig. 1C). When incubating A549 A2T2 cells with this bait and applying its substrate biotin phenol, biotin ligation to numerous host proteins was achieved, which were pulled down with streptavidin beads and analysed by mass spectrometry (Fig.2A).

[0196] Data from three independent CSPL / MS experiments were filtered against the cell surface proteome atlas (Bausch-Fluck, D. et al. A mass spectrometric-derived cell surface protein atlas. PLoS One 10, e0121314 (2015)) and cross-referenced with the CRAPome library (Mellacheruvu, D. et al. The CRAPome: a contaminant repository for affinity purification-mass spectrometry data. Nat Methods 10, 730-736 (2013)) for contaminants frequently found in pulldown-MS experiments. Pulldown data from cells incubated with trimeric HRP only was used as a comparator. Hits that were found in at least two out of three experiments were also considered (n=55) (Fig.2B and Fig.3). Among these were known host entry factors of SARS-CoV-2, such as neuropilin 1 (NRP1). The bona fide host entry receptor for SARS-CoV-2, ACE2, was only found enriched in one out of three experiments. Encouragingly, from the short list of 55 proteins about half were grouped into the GO cluster viral entry into host cells (GO: 0046718, red), virus life cycle (GO: 0019058, green) and virus receptor activity (G0:0001618, blue) Fig 2C) with false discovery rates of 7.08 x 10'19, 1.02 x 10'17and 5.32xl0'18, respectively. In contrast proteins that did not fulfill the bioinformatics selection criteria grouped into virus receptor activity (G0:0001618) with an FDR of 0.0067, the other two biological processes were not associated with this group of proteins (Fig. 4). The inventors continued with a hand-picked selection of ten candidates indicated by a black circle in Fig 2C (five assigned to GO: 0046718 and or G0:0001618, and five without such assignment).

[0197] All ten proteins with at least two gRNAs were next depleted using CRISPR / Cas9 and subsequent single cell cloning in A549 A2T2 cells. Successful knockouts were confirmed by western blot (WB) and whenever possible two clones were selected, one from each gRNA approach (Fig. 5, selected clones are marked with an asterisk). As positive control, ACE2 knockout A549 cells (based on A549 A2T2) were used. To assess the functional consequences of genetic depletion of surface proteins on SARS-CoV-2 entry, knockout and control cells were infected with SARS-CoV-2 S pseudotyped replication incompetent HIV based VLP encoding a Gaussia luciferase reporter. To assess specificity, VSV G pseudotyped VLP were used in parallel. Since the two VLP differ only in the surface protein, distinct effects of knockout are most probably related to early steps of viral replication (attachment, entry, fusion). The infectious dose was harmonized between SARS-CoV-2 S and VSV G pseudotyped VLP, as measured by the absolute luciferase activity. It was also ensure that both VLP dilutions resulted in comparable absolute light units in the luciferase assay (Fig.6). Genetic depletion of five out of ten proteins resulted in robust reduction of SARS-CoV-2 S pseudotyped VLP entry (Fig. 7A and Z-score in 7C). Amongst these, knockout of three target genes (ATP IB 1, ADAMI 0 and SLC3A2) resulted in comparable loss of infection as knockout of ACE2 (Fig. 2A), suggesting an important effect on VLP entry. In contrast, none of the ten clones had a significant effect on the entry of VSV G pseudotyped VLP (Fig. 7B and Z-score in 7D). Of note, those of the 10 candidates (Fig. 3) for which knockout results (Fig. 5) and entry assay (Fig. 8) gave inconsistent results (e.g. when two gRNA resulted in robust knockout but only one in a functional reduction of entry) were excluded.

[0198] To assess the function of the remaining five proteins in a less artificial overexpression cell system, Calu3 cells were used. Calu3 cells express both ACE2 and the serine protease TMPRSS2. Since these cells divide poorly in cell culture, a bulk knockout approach was applied using lentiviral expressed CRISPR / Cas9 followed by puromycin selection. Knockout efficacy was confirmed by WB. Only those cell populations with at least 50% reduction in protein levels in the bulk population were used for functional assays (Fig. 9, A) WB and B) quantification). Knockout of all candidates except ATP IB 1 resulted in significantly reduced entry of SARS-CoV-2 S pseudotyped VLP in Calu3 cells (Fig. 10), while VSV G pseudotyped VLP entry was not significantly affected. Notably, the knockout of EGFR, which only reduced the entry into A549 A2T2 cells by about 50% (with a rather weak Z score) had a much stronger effect in Calu3 cells, potentially in consequence of the generally lower levels of endogenously expressed ACE2 (Fig. IB), which could make entry less efficient in Calu3 cells. Overall, a large overlap of candidate knockouts that affected SARS-CoV-2 VLP entry in the two different cell lines (A549 A2T2 and Calu3) as found.

[0199] To determine whether increasing the endogenous levels of the identified entry factor candidates in host cells would positively affect VLP entry, it was decided to use parental A549 cells and A549 cells solely overexpressing ACE2 (A549 A2) since A549 A2T2 are already highly infectable (Fig. IB). Additionally, the candidate cDNAs were overexpressed in Calu3 cells. However, in contrast to the clear affects achieved by knockout approaches, overexpression of the respective cDNAs by lentiviral transduction into either A549, A549-ACE2 or Calu3 cells did not enhance VLP infection, potentially due to sufficient endogenous amounts of entry factors (Fig. 11-13). Overexpression of entry factors was confirmed by specific WB (Fig. 14).

[0200] Some viruses downregulate their own entry receptors in infected host cells to avoid reinfection of the same cell during the exit process. It was reasoned that a downregulation of proviral entry factors could prevent SARS-CoV-2 reinfection of the same cell. Protein levels for the factors described here were analyzed by WB 24 h post infection. Both entry factors that supported SARS-CoV-2 S pseudotyped VLP entry in Calu3 cells, ADAMIO and SLC3A2, were downregulated during SARS-CoV-2 infection. Importantly, this downregulation was specific since to alternative host surface proteins (PLXNB2 and ATP1B1) remained unaffected by virus infection. As previously described ACE2 was upregulated in infected patients (Fig. 15).

[0201] While multiple vaccine platforms were successfully implemented and saved millions of lives in the Covid- 19 pandemic, successful antiviral therapy options are still limited. ADAMIO was recently identified as an alternative protease cleaving SARS-CoV- 2 S. For the here-identified most potent host entry factors ADAMIO, ATP1B1 and SLC3 A2 (identified in A549 A2T2) small molecule inhibitors are commercially available (Fig. 16). The TMPRSS2 inhibitor Camostat was included as a positive control. Using a Cell titer gio viability assay, the highest non-toxic concentration when applying on Calu3 cells was determined (Fig. 17 A-D). Cells were pretreated for 2 or 4h with 100 pM of Camostat, lOOpM or 500pM of KYT 0353 (LAT1-SLC3A2 inhibitor also known as JPH203), lOOpM of GI254023X (ADAMI 0 inhibitor) or lOOpM of ouabain (ATP IB 1 inhibitor). Subsequently cells were infected with MOI 1 of SARS-CoV-2 Omicron BA.1. Viral RNA copies of subgenomic E RNA were determined by qRT-PCR (Fig. 18A-E). Especially treatment with KYT 0353 at lOOpM and 500pM reduced the viral charge robustly, performing comparably to the TMPRSS2 inhibitor Camostat (Fig. 18A, B and E). In contrast chemical inhibition of ADAM10 or ATP1B1 had little or no effect, respectively (Fig. 18C, D and E).

[0202] In summary, the data show that CSPL-identified host surface proteins can serve as novel antiviral drug targets for the inhibition of SARS-CoV-2 entry.

[0203] Discussion

[0204] Over the past three years, several host factors have been described, which enhance SARS-CoV-2 entry. Amongst these are ADAM10 and ADAM17, MMP2 and MMP9 and TMPRSS13. None of these replaces ACE2 as main receptor for virion entry. Instead, these host factors promote cleavage of SARS-CoV-2 S (ADAMI 7) or act through a yet unknown but ACE2 dependent entry mechanism. TMEM106B in contrast was recently shown to allow ACE2 independent entry into cells, suggesting that SARS-CoV-2 is more flexible in its entry mechanism than initially thought.

[0205] The present Example describes the identification of five host entry factors of SARS-CoV-2: ATP1B1, SLC3A2, ADAM10, PLXNB2 and EGFR using an unbiased approach via cell surface proximity ligation. The data hence confirm independently the role of ADAM 10 in virus entry.

[0206] Importantly three of the remaining four factors were already implicated in the entry of other human viruses. SLC3 A2 was described to support entry of another positive strand RNA virus, HCV, without affecting other steps of virus replication. ATP IB 1 interacts with influenza A and B virus M2 protein, which is essential for acidification of the virion during entry. Knockout of the ATP1B1 gene in MDCK cells reduced replication of influenza A viruses, suggesting this host factor is required for virus entry. It was further proposed to act positively on cell to cell spread of HCMV by an unknown mechanism. Conversely, ATP IB 1 induction was shown to upregulate innate antiviral responses via TRAF3 and TR.AF6.

[0207] EGFR was proposed as a proviral entry factor or entry receptor of a number of human viruses: influenza A viruses29,30, HBV31, HCV32, HEV33, HPV34, ZiV35or TGEV36. Only for plexin B2 has no known direct implication in the entry process or the replication of other viruses. It should be pointed out, that in the hands of the inventors plexin B2 did not play a significant role in entry of SARS-CoV-2 into Calu3 cells.

[0208] This suggests that diverse viruses evolved convergent entry strategies relying of overlapping host surface proteins to overcome the host plasma membrane. In consequence some of these proteins might be excellent targets for broad-spectrum antiviral therapies.

[0209] The inventors previously used CSPL to identify host proteins involved in influenza A virus entry. The data in the present Example show that this technique could have broader implications for other viruses to identify host entry factors or potentially host restriction factors of entry. It was also noticed that CSPL was substantially more reproducible using SARS-CoV-2 S as compared to the previously used influenza virus HA. Potentially this is a consequence of a more selective protein receptor use by SARS-CoV-2 to enter cells, while IAV tends to show rather promiscuous receptor use. The protein environment at the point of entry may therefore be more defined for SARS-CoV-2 than for IAV.

[0210] Curiously, it was found that SARS-CoV-2 infection diminishes the levels of some proviral entry factors found here, e.g. SLC3A2 and ADAMIO, while increasing the levels of the bona fide entry receptor ACE2. In contrast plexin B2 levels remained stable during infection. This might suggest that the virus selectively targets a certain group of cell surface proteins. The mechanisms leading to these reduced protein levels need to be addressed in future studies, but they could be linked to virus induced shutoff by nspl . This reduction of host surface proteins enhancing viral entry may be beneficial for the virus when exiting infected cells to avoid reinfection.

[0211] The data might also contribute to the ongoing search for host factors contributing to enhanced or reduced susceptibility of human patients. Expression levels and sequence variations in the here-identified entry supporting factors might explain why some patients are more sensitive to SARS-CoV-2 infection. Direct antivirals against SARS-CoV-2 approved for clinical use include ritonavir- boosted nirmatrelvir (Paxlovid), remdesivir and molnupiravir. Host directed therapies aim mostly at a dampened inflammatory response to limit immune pathology. Currently there are no antiviral strategies approved that target host dependency factors, but few are in clinical trials.

[0212] Knockout of SLC3A2 resulted in comparable reduction of VLP entry as ACE2 knockout. Importantly chemical targeting of SLC3 A2 diminished replication of recent SARS-CoV-2 strain to similar extent as that of the TMPRSS2 inhibitor Camostat. In complex with LAT1 SLC3A2 forms a well characterized heterodimeric transporter at the plasma membrane for large neutral amino acids. It remains to be elucidated if the inhibition of SARS-CoV-2 entry via chemical blocking of SLC3 A2 relies on the presence of LAT1 or occurs in an independent fashion.

[0213] In conclusion, the data suggest that targeting of SLC3 A2 provides a new avenue of host directed antiviral therapy against SARS-CoV-2, either alone or in combination with other antivirals. These therapies are urgently needed to complement the successful vaccine approaches in place.

[0214] Materials and Methods

[0215] Cell lines

[0216] HEK293T (human embryonic kidney, ATCC) were cultured in DMEM (Dulbecco’s modified eagle medium, Gibco 10566016) A549 (adenocarcinomic human alveolar basal epithelial cells, ATCC), A549 A2 and A459 A2T2 cell lines and all derived cell lines including the knockout and over expression cell lines, were grown in DMEM / F12 + GlutaMAX (Dulbecco’s Modified Eagle Medium / Nutrient Mixture F-12, Gibco #10565018). For the A549 and A549 A2 over expression cell lines, the culture medium was supplemented with 2 pg / ml of puromycin and 6 pg / ml of blasticidin. Calu3 (lung epithelial adenocarcinoma cells, ATCC) and Calu3 derived knockout and over expression cell lines were grown in MEM + GlutaMAX (Gibco #41090-28) + lx MEM non-essential amino acids 100X (Gibco #11140-035) + 10 mM HEPES (Gibco #15630-056) + ImM sodium pyruvate (Gibco #11360-039). Cell culture media were supplemented with 10 % (v / v) heat-inactivated foetal bovine serum (Gibco #10270-106. Lot: 2307592) and pen- strep antibiotics (100 U / ml penicillin and 0.1 mg / ml streptomycin, Sigma-Aldrich #P0781). For Calu3 knockout and over expression cell lines, the growth medium was supplemented with either puromycin at 4ug / ml or with blasticidin at 2 pg / ml. All cells were maintained in low passage at 37 °C with 5 % CO2 and 90 % humidity, absence of mycoplasma was routinely confirmed by PCR.

[0217] SDS- PAGE and Western Blot

[0218] For western blot analysis, the cells were lysed in protein lysis buffer (tris Hcl 1 M pH 6.8, glycerol, SDS 20 %, H2O and DTT), sonicated 10X (30 secs on and 30 secs off) at 4°C and boiled at 95°C for 5 min. The samples were separated on a 7% SDS-PAGE gel and the transfer was performed to nitrocellulose filter membranes 0.45uM at 120V for 2 h. The membranes were blocked by 5 % skim milk, blotted with primary antibodies followed by incubation with horseradish peroxidase HRP conjugated secondary antibodies and visualised using enhanced chemiluminescent reagent (#K12049-D50) from Advansta.

[0219] Plasmids pLVX-IRES-Puro was purchased from Clontech (#632183). pSpCas9(BB)-2A- GFP (PX458) was a gift from Feng Zhang (Addgene #48138) and pMD2.G and psPAX2 were a gift from Didier Trono (Addgene #12259 and #12260).

[0220] Oligonucleotides for gRNA cloning and PCR primers

[0221] All oligonucleotides were purchased from Microsynth (France). Guide RNAs were designed using CRISPick and cloned into LentiCRISPR v2 (Addgene #52961) for Calu3 cells and into pSpCas9 (BB)-2A-GFP for A549 A2T2 cells (Addgene #48138). Two gRNAs were chosen to target each gene hence the nomenclature gRNAl and gRNA2. PCR primers used for cloning to make over expression plasmids are indicated below.

[0222] Antibodies Mouse monoclonal against actin antibody (#ab49900), rabbit monoclonal against

[0223] AdamlO antibody (#abl24695, epr5622) and rabbit monoclonal against ACE2 antibody (#ab272500, epr24705-45) were purchased from Abeam. Mouse monoclonal anti-FLAG HRP antibody (#A8592), goat polyclonal anti-rabbit IgG HRP antibody (#A8275) and goat polyclonal anti-mouse IgG HRP antibody (#A5278) were purchased from Sigma-Aldrich. The streptavidin-HRP (#S-911 ) was purchased from Thermofisher. Rabbit polyclonal against ITGB4 (#21738-1-AP), mouse monoclonal against ALCAM (#67768-l-Ig), rabbit polyclonal against PLXNB2 (#10602-l-AP), rabbit polyclonal against SLC3A2 (#15193- 1-A), mouse monoclonal EGFR (#66455-1 -Ig), mouse monoclonal EPHA2 (#66736-l-Ig), rabbit polyclonal ITGAV (#27096- 1-AP) and rabbit polyclonal anti-goat IgG HRP antibody (#SA00001-4) were purchased from Proteintech. Rabbit polyclonal anti -ATP IB 1 antibody (#HAP012911) was purchased from Atlas antibodies. Goat polyclonal against NECTIN2 antibody (#AF2229) was purchased from R&D Systems. Mouse monoclonal against CD44 antibody (#156-3C11) was purchased from Cell Signaling Technology. Inhibitors

[0224] TMPRSS2 specific inhibitor Camostat mesylate (#SML0057) were purchased from Sigma-Aldrich. Ouabain (#1076) an ATPase inhibitor, KYT 0353 (#5026) an inhibitor of LAT1 / SLC3A2 were purchased from Tocris. GI254023X targeting ADAM10 (#SML0789) were purchased from Sigma-Aldrich.

[0225] Cell Titer Gio cell viability assay

[0226] Calu3 cells were seeded in 96-well plates, at sub confluent levels, the cells were washed IX with PBS and the different chemical inhibitors were added to the cells in medium with 2 % fetal bovine serum (FBS). 24 h post incubation, the medium was removed from Calu3 cells and washed once with PBS. lOOul of medium with 2% FBS and lOOul of Cell Titer Gio reagent was added to each well. The cells were lysed by agitation at 450 rpm for 5 min using an orbital shaker. After 10 min incubation of the plate at room temperature, 180 pl of the mix was transferred to a luminometer-compatible, 96-well white plate. The luminescence signal was recorded on GloMax luminometer with preset Cell titer Gio protocol.

[0227] Recombinant proteins

[0228] Trimeric Spike was previously described. Based on this sequence (GenBank accession no. MN908947.3 for the original sequence), we added the coding sequence for HRP on the 3’ end of the T4foldon, connected via a GSGSG-linker and followed by a HislO-tag. A trimerized HRP control was designed with the same T4foldon and HislO tag. The recombinant proteins were expressed and purified at the Protein core facility (CMU, University of Geneva) using the baculovirus (Sf9 insect cells) expression system. Baculovirus were generated using a modified pFastBac vector encoding C-terminally tagged i) Wuhan Spike, ii) no protein. The proteins had a C-terminal tag composed of fused Wuhan Spike - HRP and a 10-histidine tag. The media containing the proteins was centrifuged at 4000 x g for 15 min at 4°C and filtered using 0.22 pm filters. The media was concentrated and adjusted to lOmM imidazole and applied on to a 5 ml His-trap FF column (Cytiva). 100ml of PBS supplemented with IM NaCl and lOmM Imidazole was used to wash the column and the column was eluted with 15ml of elution buffer (1 x PBS, 200 mM NaCl, 450 mM imidazole). Proteins eluted were concentrated to 1ml using AMICON 30 MWCO concentrators and loaded on a Size Exclusion Chromatography Superdex 200 10 / 300 column equilibrated in PBS at 4 °C. Pure protein fractions were pooled, concentrated and flash frozen in liquid nitrogen.

[0229] Cell surface proximity ligation assay

[0230] A549, A549 A2, A549 A2T2 and Calu3 cells were grown in 6-well format and incubated with 100 pg of recombinant Spike-HRP or HRP alone for 60 min . Biotin phenol and H2O2 were added for 10 min to allow proximity ligation of biotin. Cells were quenched and lysed with lysis buffer (0.4 % SDS, 500mM NaCl, 5 mM EDTA, 50 mM Tris-HCl pH 7.5, 1 % Triton-XlOO, 1 mM DTT, protease inhibitor). Biotinylated proteins were precipitated with streptavidin-agarose beads (Thermofisher #11205D) and prepared for mass spectrometry by on bead trypsin digest.

[0231] Mass spectrometry

[0232] On bead trypsin digestion was done to digest the proteins and peptides were analysed by nanoLC-MSMS using an easynLClOOO (Thermo Fisher) coupled to a Qexactive Plus mass spectrometer (Thermo Fisher). Data were analysed with Scaffold (Proteome Software) with 1 % of protein FDR with a 0.1 % of peptide FDR. Cell surface protein atlas was used to cross reference the proteins. For identification of host surface proteins enriched in the proximity of the Wuhan spike-HRP, the following cutoffs were applied: 1) 2-fold enrichment of Wuhan spike HRP over control HRP, 2) atleast 2 unique peptide per protein, 3) proteins present in less than 200 experiments out of 716 streptavidin dependent pulldowns in the CRAPome database.

[0233] Generation of a KO cell line using CRISPR / Cas9 with lentiviral transduction for Calu3 Subconfluent HEK293T cells in 6-well plates were transfected at a ratio of 1 :3 :4 with the following plasmids pMD2.G (vesicular stomatitis virus G protein (VSV G)), psPAX2 (HIV gag-pol) were a gift from Didier Trono (Addgene plasmid # 12259 and #12260) and lentiCRISPRv2, a gift from Feng Zhang (Addgene plasmid # 52961)44containing the specific gRNA (see above) with 2 pg / pl of Trans-IT LT1 (Minis). After 24 h, HEK293T medium was replaced with target cell medium. Calu3 cells were seeded in 6- well plates at a density of 50 %. The HEK293T supernatants containing lentiviruses to knockout the target protein was harvested 48h post transfection with a syringe and was passed through a sterile filter of 0.45um and complemented with polybrene at 8 pg / ml. The supernatant-polybrene mix was added to Calu3 cells after washing the cells IX with PBS. The supernatant containing lentiviruses were removed from Calu3 cells after 4 h and replaced with respective growth medium. At 48 h post transduction, Calu3 cells were split and selected with puromycin at 4 pg / ml. The knockout efficiency was assessed using western blot.

[0234] Generation of a KO cell line using CRISPR / Cas9 for A549 A2T2

[0235] Subconfluent levels of A549 A2T2 in 6-well plates were transfected with 2 pg of the target protein knockout plasmids (vector backbone pSpCas9(BB)-2A-GFP from Addgene #48138)45using FuGENE HD transfection reagent (Promega #E2311). 4 h post transfection, the medium was removed from A549 A2T2 cells and replaced with growth medium. 48 h post transfection, green fluorescent protein (GFP)-positive cells were sorted using Beckman Coulter MoFlo Astrios individually into 96-well plates. The efficiency of knockout was verified by western blotting. The cell lines transfected with an empty plasmid pSpCas9(BB)-2A-GFP are indicated as Cas9 empty.

[0236] Generation of overexpressing cell lines with lentiviral transduction systems

[0237] HEK293T cells in 6-well plates, at sub confluency, were transfected at a ratio of 1:3:4 with the following plasmids pMD2.G (vesicular stomatitis virus G protein (VSV G)), psPAX2 (HIV gag-pol) and over expression plasmids using 2 pl / pg of Trans-IT LT1 (Minis). 24 h post transfection, 293T medium was replaced with target cell medium. Target cells (A549, A549 A2 and Calu3) were seeded in 6-well plates. The HEK293T supernatants containing lentiviruses were harvested 48h post transfection with a syringe and were passed through a 0.45 pm sterile filter. These lentiviruses were complemented with 8 pg / ml of polybrene. Target cells were washed IX with PBS following transduction with 2 ml of lentivirus-polybrene mix. 4h after transduction, lentiviruses were removed from target cells and replaced with respective growth medium. 48 h post transduction, target cells were split and selected using puromycin at 2 pg / ml for A549 and A549 A2, 4 pg / ml for Calu3 and blasticidin at 6 pg / ml for A549 and A549 A2 and 2 pg / ml for Calu3. The efficiency of over expression was verified by western blot. SARS-CoV-2 Virus-Like Particles (VLP) production

[0238] To generate replication incompetent, luciferase expressing VLP, subconfluent 100 mm dish 293T cells were transfected with: 10 pg of psPAX, 5 pg of pCGl SARS-CoV-2 Spike46or 2.5 pg of pMD2.G and 15 pg of CD510B Glue (vector backbone pCDH-CMV- MCS-EFl-Puro from Sanbio, Netherlands #CD510B-l) kindly provided by Fabien Abdul, University of Geneva, using Trans 1T-LT1 transfection reagent (Mirus) according to manufacturer’s instructions. The supernatant containing SARS-CoV-2 Spike and VSV G pseudotyped VLP were harvested 48 h and 72h post transfection, respectively. The supernatants were cleared from cell debris by centrifugation (2000 x g, 10 min, 4°C) and were passed through a 0.45 pm filter attached to a syringe to remove cell debris. Aliquots were stored at -80 °C. VLP stocks were titered on target cells to achieve comparable infection rates within the linear range of the luciferase assay.

[0239] Titration of SARS-CoV-2 and VSV G VLPs on Cas9 empty and ACE2KO cells

[0240] Subconfluent Calu3 Cas9 empty, Calu3 ACE2KO and Calu3 ACE2*KO in 96-well plates were transduced with different volumes of the both SARS-CoV-2 and VSV G VLPs. 6 h post transfection, the VLPs were removed from the cells, washed 2X with 300ul of PBS per well and replaced with appropriate growth medium. The supernatant was collected every 24 h until 96 h, washed 2X with PBS and replaced with growth medium. After the harvest, the supernatants were centrifuged at 1500 x g for 7 min. 5 pl of the supernatant was then mixed with 50 pl of coelenterazine (Biosynth #EC175526) on white plates and the luciferase activity was measured using the Dual Gio protocol on the Glomax 96-well microplate luminometer.

[0241] Infection with SARS-CoV-2 VLP

[0242] Calu3, A549, A549 A2 and A549 A2T2 were seeded to achieve subconfluency in 96-well plates pre-coated with poly-L-lysine. The cells were washed once with PBS and infected with 100 pl of SARS-CoV-2 Spike or VSV G pseudotyped VLP per well. 6 h post-infection, the VLP were removed, the cells were washed twice with PBS and lOOul of fresh medium (MEM + GlutaMAX (Gibco #41090-28) + lx MEM non-essential amino acids 100X (Gibco #11140-035) + lOmM HEPES (Gibco #315630-056) + ImM sodium pyruvate (Gibco #11360-039) + 10 % (v / v) heat-inactivated foetal bovine serum (Gibco #10270-106. Lot: 2307592) + pen-strep antibiotics (100 U / ml penicillin and 0.1 mg / ml streptomycin, Sigma- Aldrich #P0781)) was added to each well. 96 h post-infection, the supernatants were collected and subjected to centrifugation. The Gaussia luciferase activity was measured by adding 5 pL of the supernatant with 50 pL of coelenterazine (Biosynth #EC175526) on white plates using the Glomax 96-well microplate luminometer Promega. DualGlo protocol in the Glomax software was used for the measurement which was at a rate of 1 s per well.

[0243] SARS-CoV-2 virus production

[0244] Calu3 cells were grown in 100 mm dish at sub-confluency. The cells were infected with an MOI of 0.01 of Omicron and Wuhan (kindly provided by Prof. Isabella Eckerle) viruses for 1 h at 37 °C in MEM + GlutaMAX (Gibco #41090-28) + lx MEM non- essential amino acids 100X (Gibco #11140-035) + lOmM HEPES (Gibco #15630-056) + 1 mM sodium pyruvate (Gibco #311360-039) + pen-strep antibiotics (100 U / ml penicillin and 0.1 mg / ml streptomycin, Sigma-Aldrich #P0781) + 2% (v / v) heat-inactivated foetal bovine serum (Gibco #10270-106. Lot: 2307592). The inoculum was removed after 1 h and fresh medium was added. The viral supernatants were recovered 48 h and 96 h postinfection for Omicron and Wuhan, respectively. The supernatants were centrifuged at 450 x g for 5 min and stored at -70 °C.

[0245] Plaque assay to determine viral titers

[0246] Vero E6 TMPRSS2 cells were grown to form a monolayer in 24-well plates. The cells were infected with 200 pl of serially diluted viruses. Viruses were diluted in serum free DMEM medium (Gibco #10566016). 1 h post infection, the inoculum was removed and 2.4 % Avicel overlay (Dupont) was added to the cells. Cells were incubated for 96h for both viruses at 37 °C. The overlay was removed, then cells were fixed in 4 % formaldehyde and the cell monolayer was stained with a solution of crystal violet. Plaques were counted and multiplied with the dilution and volume factor to determine viral titers (pfu / ml).

[0247] SARS-CoV-2 infection after pre-treatment with chemical inhibitors Calu3 cells at subconfluency in 24-well plates were incubated with the different chemical inhibitors at different time points (specified in the table below). At the end of the incubation with the chemical inhibitors, the cells were infected with Wuhan

[0248] (B.l : EPI ISL 414019) and Omicron (BA.l : EPI ISL 7605546) SARS-CoV-2 viruses at a MOI of 1. After 45 min of incubation with the viruses, the inoculum was removed, the cells were washed IX with PBS and was replaced by respective growth medium with 2 % FBS + 1 % P / S. 24 h post infection, the cells were washed IX with PBS and lysed in TRK lysis buffer (OmegaBiotek #R6834) for RT qPCR analysis. Samples were inactivated for 10 min at 70°C and exported from the BSL3 laboratory.

[0249] Reverse Transcription quantitative PCR

[0250] For extraction of total RNA from cells, EZNA total RNA kit I (OmegaBiotek #R6834) was used according to manufacturers’ instructions. Either probe based or SYBR green based assays were used to detect the different RNAs. The probe-based assay was used to detect subgenomic E (sgE) and RNaseP. For quantitative RT-PCR, a 25 pl reaction with 5ul of RNA was done with the Superscript III 1-step reverse transcriptase- PCR system (Invitrogen) with the Platinum Taq DNA polymerase according to the manufacturers’ protocol. Probes contained a 5’ YY-520 reporter dye and MGB 3’ quencher for subgenomic E (sgE) and 5’ FAM-520 reporter dye and MGB 3’ quencher for RNase P (Hs04930436, #4331182), both purchased from Microsynth. To determine the early virus replication, a quantitative RT-PCR targeting the subgenomic RNA encoding the envelope (sgE) was performed. The RT-PCR was performed using a thermocycling protocol with reverse transcription for 15 min at 50 °C and a denaturation step for 2 min at 95 °C to restore Taq DNA polymerase activity, followed by PCR amplification by 45 cycles of 95 °C for 15 s and 60 °C for 30 s. Fluorescence signal was detected after the elongation step of each cycle. RT-PCR was done with the following primers and probe: nCoV sgE Fwd: 5’-CCAACCAACTTTCGATCTCTTGT-3’, nCoV sgE Rev: 5’- CGTACCTGTCTCTTCCGAAACG-3’ and nCoV sgE prb: 5’YY / TCTCTAAACGAACTTATGTACTC / 3’MGB - Q530. 18S and GAPDH were detected using SYBR green system. RT was performed with lOOng of RNA samples for all conditions. The qPCR was performed using lul of cDNA mixed with lOul of 2X KAPA SYBR FAST qPCR Master Mix-universal (KAPA Biosystems, USA). 0.5ul of each of the forward and reverse primers (lOum) were added to the mix to make a final volume of 20ul with RNase, DNase water. qPCR was performed following a thermocycling protocol of an initial denaturation step at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 30 s and annealing / extension at 60 °C for 60 s. The following primers were used 18S Fwd: GTAACCCGTTGAACCCCATT, 18S Rev: CCATCCAATCGGTAGTAGCG, GAPDH Fwd: GCAAATTTCCATGGCACCGT and GAPDH Rev:

[0251] GCCCCACTTGATTTTGGAGG. The mean fold change in subgenomic E (sgE) gene expression was calculated by delta-delta ct method and by using average expression of 3 housekeeping genes, RNaseP, 18S and GAPDH.

[0252] Statistics

[0253] Statistical analysis was performed using GraphPad Prism 9. Statistical tests applied are indicated in each respective figure legend.

Claims

CLAIMS1. A heterodimeric amino acid transporter (HAT) inhibitor for use in a method of preventing or treating a viral infection in an individual, comprising administering the HAT inhibitor to the individual.

2. The HAT inhibitor for use according to claim 1, wherein the HAT inhibitor is a CD98 inhibitor, optionally a SLC3A2 inhibitor.

3. The HAT inhibitor for use according to claim 1 or 2, wherein the HAT inhibitor reduces or eliminates entry of the virus that causes the viral infection to a cell of the individual, optionally wherein the cell is a cell of the respiratory system.

4. The HAT inhibitor for use according to any one of the preceding claims, wherein the HAT inhibitor comprises a small molecule.

5. The HAT inhibitor for use according to claim 4, wherein the small molecule comprises JPH203, JX009, JG336, BCH, Melphalan. KMH-23310, 3-iodo-L-tyrosine, a meta-substituted phenylalanine derivative, JX-075, JX-078, JX-11913, DTE or C40714.

6. The HAT inhibitor for use according to any one of the preceding claims, wherein the HAT inhibitor comprises an antibody or an antigen binding fragment thereof.

7. The HAT inhibitor for use according to claim 6, wherein the antibody is a CD98 blocking antibody, optionally a SLC3 A2 blocking antibody.

8. The HAT inhibitor for use according to claim 7, wherein:(a) the CD98 blocking antibody is R8H283, HBJ 127, IGN523, MEM 108, BK19.9, 4F2,BU53, BU89, AHN-18.1 or AHN-18; or(b) the SLC3A2 blocking antibody is UM7F8, KHK2898 or 3G9.

9. The HAT inhibitor for use according to any one of the preceding claims, wherein the HAT inhibitor comprises a nucleic acid silencing molecule.

10. The HAT inhibitor for use according to any one of the preceding claims, wherein the virus that causes the viral infection is (a) a coronavirus, or (b) a norovirus, a poxvirus, a hepacivirus, an adenovirus, an alphavirus, a cytomegalovirus , an avulavirus, a lentivirus or an alphaherpesvirus.

11. The HAT inhibitor for use according to claim 10, wherein the coronavirus is:(a) SARS-CoV-2;(b) a common cold coronavirus, optionally NL63, OC43, HKU1, 229E;(c) SARS-CoV-1; or(d) MERS-CoV.

12. A method of screening for a treatment for a viral infection, comprising:(a) contacting a HAT with a compound to be screened; and(b) determining whether the compound affects the activity of the HAT; optionally wherein the HAT is CD98 or comprises SLC3 A2.

13. The method of claim 12, wherein step (b) comprises determining whether the compound affects entry of the virus that causes the viral infection to a cell.

Citation Information

Patent Citations

  • antibody

    WO2017026497A1

  • Use of tmprss2 inhibitors for the treatment of lung viral infections

    WO2021228762A1