Ribosomal RNA fragment methylation pattern indicative for lung cancer

Abstract

The present invention relates to a method for diagnosing lung cancer in a patient by determining the methylation status of a ribosomal RNA (rRNA) fragment.

Description

[0001] Our Ref.: 505-100 PCT RIBOSOMAL RNA FRAGMENT METHYLATION PATTERN INDICATIVE FOR LUNG CANCER The present invention relates to a method for diagnosing lung cancer in a patient bydetermining the methylation status of a ribosomal RNA (rRNA) fragment. BACKGROUND OF THE INVENTION Cancer is the uncontrolled growth of abnormal cells anywhere in a body. The abnormal cells are termed cancer cells, malignant cells, or tumor cells. Cancer cells can proliferate uncontrollably and form a mass of cancer cells. The most common types of cancer in males are lung cancer, prostate cancer, colorectal cancer, and stomach cancer. In females, the most common types are breast cancer, colorectal cancer, lung cancer, and cervical cancer. Lung cancer or bronchogenic carcinoma refers to tumors originating in the lung parenchyma or within the bronchi. It is one of the leading causes of cancer-related deaths inEurope and in the United States. Since 1987, lung cancer has been responsible for more deathsin women than breast cancer. It is estimated that there are 225,000 new cases of lung cancer inthe United States annually, and approximately 160,000 die because of lung cancer.Small non-coding RNAs can be used due to their diversity and characteristic expressionfor the diagnosis of human diseases such as lung cancer. These RNAs can be chemicallymodified. In addition to the canonical RNA bases A, C, U, and G, there exist several hundreddifferent modified bases including many of functional relevance. 2’-O-Methylation (Nm) is acommon modification found on non-coding RNAs. Nm modifications in small non-codingRNAs are dynamic and their frequency at certain variable sites has been shown to be correlatedwith certain cancer types. However, there is still an unmet need for new biomarkers that are reliable and facilitatethe diagnosis of lung cancer. The present inventors have previously described a 22 nucleotide fragment of the 28Sribosomal RNA (rRNA) that is released into the blood of lung cancer patients. The 28S rRNAfragment has the following sequence from 5’ to 3’: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1). Specifically, the present inventors have shown that the determination of the expression level of this fragment in blood of patients allows lung cancer diagnosis (Sikosek et al, 2023). It has been found that the 28S rRNA fragment is Nm modified at two distinct sites (G7,and C19) (Taoka et al, 2018).The present inventors have now used direct RNA sequencing of 28S rRNA fragmentmodifications in plasma cell-free RNA (cfRNA) samples from a clinical lung cancer cohort tofurther explore the diagnostic potential of this fragment. Especially, the present inventors haveused direct RNA sequencing via the Oxford Nanopore Technology sequencing platform tomeasure the methylation status of the 28S rRNA fragment from plasma cfRNA samples froma lung cancer clinical cohort to explore the diagnostic value of biomarker RNA modification profiling. cfRNA was manually extracted from plasma collected in Streck cfRNA tubes from atotal of 43 patients (27 cancer, 16 control). Sequencing was performed via the Oxford NanoporeTechnology sequencing method and methylation status was inferred at the single molecule levelper patient with a deep learning model. The present inventors have found a significant increase of the 28S rRNA fragment witha GmCm methylation pattern in lung cancer patients compared to healthy controls having adiagnostic performance of 0.84 ROC AUC. These findings highlight the importance of directRNA sequencing to measure RNA modifications at individual sites within single molecules toreveal differences that may otherwise be obscured. In summary, the present inventors could show that the single molecule RNAmodification profiling of small RNA biomarkers have high diagnostic value and allow thedetection of lung cancer in a fast and reliable way.SUMMARY OF THE INVENTION In a first aspect, the present invention relates to a method for diagnosing lung cancer ina patient / determining whether a patient suffers from lung cancer comprising the steps of:(a) determining the methylation proportion of Gm4020Cm4032 in the 28S ribosomal RNA(rRNA) fragment in a blood sample obtained from a patient, and(b) comparing the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragmentin a blood sample obtained from a patient to a reference methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment.In a second aspect, the present invention relates to the use of Gm4020Cm4032methylation in the 28S ribosomal RNA (rRNA) fragment to diagnose lung cancer in a patient / determine whether the patient suffers from lung cancer. This summary of the invention does not necessarily describe all features of the present invention. Other embodiments will become apparent from a review of the ensuing detailed description. DETAILED DESCRIPTION OF THE INVENTION Definitions Before the present invention is described in detail below, it is to be understood that thisinvention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, alltechnical and scientific terms used herein have the same meanings as commonly understood byone of ordinary skill in the art. Preferably, the terms used herein are defined as described in “A multilingual glossary of biotechnological terms: (IUPAC Recommendations)”, Leuenberger, H.G.W, Nagel, B. and Kölbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland). Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank Accession Number sequence submissions etc.), whether supra or infra, is hereby incorporated by reference in its entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. In the event of a conflict between the definitions or teachings of such incorporated references and definitions or teachings recited in the present specification, the text of the present specification takes precedence. The term “comprise” or variations such as “comprises” or “comprising” according to the present invention means the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. The term “consisting essentially of” according to the present invention means the inclusion of a stated integer or group of integers, while excluding modifications or other integers which would materially affect or alter the stated integer. The term “consisting of” or variations such as “consists of” according to the present invention means the inclusion of a stated integer or group of integers and the exclusion of any other integer or group of integers. The terms “a” and “an” and “the” and similar reference used in the context of describingthe invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The term “nucleotide”, as used herein, refers to an organic molecule consisting of a nucleoside and a phosphate. In particular, a nucleotide is composed of three subunit molecules: a nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphates. The four nucleobases in DNA are guanine, adenine, cytosine and thymine; in RNA, uracil is used in place of thymine. The nucleotide serves as monomeric unit of nucleic acid polymers, such as deoxyribonucleotide acid (DNA) or ribonucleotide acid (RNA). Thus, the nucleotide is a molecular building-block of DNA and RNA. The term “nucleoside”, as used herein, refers to a glycosylamine that can be thought of as nucleotide without a phosphate group. A nucleoside consists simply of a nucleobase (alsotermed a nitrogenous base) and a five-carbon sugar (ribose or 2'-deoxyribose) whereas anucleotide is composed of a nucleobase, a five-carbon sugar, and one or more phosphate groups. In a nucleoside, the anomeric carbon is linked through a glycosidic bond to the N9 of a purine or the N1 of a pyrimindine. The terms “nucleotide sequence” or “polynucleotide” are interchangeably used herein and refer to single-stranded and double-stranded polymers of nucleotide monomers, including without limitation, 2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by internucleotide phosphodiester bond linkages, or internucleotide analogs, and associated counter ions, e.g., H+, NH4+, trialkylammonium, Mg2+, Na+, and the like. A nucleotide sequence or polynucleotide may be composed entirely of deoxyribonucleotides, entirely of ribonucleotides, or chimeric mixtures thereof and may include nucleotide analogs. The nucleotide monomer units may comprise any of the nucleotides described herein, including, but not limited to, nucleotides and / or nucleotide analogs. The term “RNA molecule”, as used herein, refers to a polymeric form of ribonucleotides of any length. Like DNA, RNA is assembled as a chain of nucleotides, but unlike DNA, RNA is found in nature as a single strand folded onto itself, rather than a paired double strand. The term “small RNA molecule”, as described herein, refers to a polymeric RNA molecule that is less than 200 ribonucleotides, preferably < 50 ribonucleotides, more preferably < 30 ribonucleotides, in length. Specifically, small RNA molecules have a length of between 10 and < 50 ribonucleotides. More specifically, small RNA molecules have a length of between 10 and < 30 ribonucleotides. Small RNA molecules are usually non-coding RNA molecules such as ribosomal RNA (rRNA) molecules. The term “methylated small non-coding RNA”, as used herein, refers to RNA which has been post-transcriptionally edited or modified by methylation. The methylation can occur at a base (e.g. methyl-6-adenine, pseudouridine) and / or ribose ring (2′-ortho-methylated nucleotide (2′-O-m)). The methylation of small non-coding RNA occurring at a base is preferably selected from the group consisting of 6-methyladenosine (m6A), 5-methylcytidine (m5C), 5-methyluridine (m5U), 3-methyluridine (m3U), 1-methyladenosine (m1A), and 1- methylguanosine (m1G), or is a combination thereof. The 2′-O-methylation of the backbone ribose is the most common and conserved type of small non-coding RNA modification. The methylation of small non-coding RNA occurring at a ribose ring is selected from the group consisting of 3′-end 2′-O-methyladenosine (Am), 2′-O- methyluridine (Um), 2′-O-methylguanosine (Gm), and 2′-O-methylcytidine (Cm), or is a combination thereof. The term “28S ribosomal RNA (rRNA)”, as used herein, refers to the 28S rRNAtranscript of RNA polymerase I and part of the ribosomes. There it performs catalytic functionsand is, therefore, also known as a ribozyme. The RNA polymerase I transcribes a 45S pre-rRNAtranscript, from which a 5.8S rRNA, 18S rRNA and a 28S rRNA transcript are produced by a 90S pre-ribosome. The 28S rRNA is a component of the large 60S ribosomal subunit, where it functions as a peptidyltransferase. This enables the N-terminal attack of the amino acid, which is bound to the tRNA at the A-site, on the C-terminal end of the peptide chain at the P-site. Thiscreates a new peptide bond. In contrast to messenger RNA (mRNA), 28S rRNA is a catalyticRNA and not a coding RNA. It, therefore, does not serve as a transcript for protein biosynthesis.Human 28S rRNA is typically about 5060 nucleotides long.The term “28S ribosomal RNA (rRNA) fragment”, as used herein, refers to a fragmentof the 28S rRNA. It is 22 nucleotides long. The 28S rRNA fragment belongs to the class ofsmall non-coding RNA molecules. The 28S rRNA fragment has the following (basic) sequence(irrespective of methylation) from 5’ to 3’: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1). The term “methylated 28S ribosomal RNA (rRNA) fragment”, as used herein, refers toa fragment of the 28S rRNA which is methylated. The 28S rRNA fragment having the following(basic) sequence (irrespective of methylation) from 5’ to 3’:GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) has two methylations sites, namely G(if methylated Gm, also designated as Gm4020) and C (if methylated Cm, also designated asCm4032). When denoted GmCm or Gm4020Cm4032, both methylation sites in the 28s rRNAfragment are methylated. That means that either one methylation site, i.e. 5’ GCCGCCGmGUGAAAUACCACUAC 3’ (SEQ ID NO: 11) or 5’GCCGCCGGUGAAAUACCACmUAC 3’ (SEQ ID NO: 12), or both methylation sites, i.e. 5’GCCGCCGmGUGAAAUACCACmUAC 3’ (SEQ ID NO: 13), in the 28s rRNA fragment aremethylated. The above methylation is specifically a 2’-ortho-methylation (also designated as2’-O-methylation). Thus, in case of a methylated 28s rRNA fragment, a 2′-O-methylguanosine(Gm, Gm4020) methylation and / or a 2′-O-methylcytidine (Cm, Cm4032) methylation ispresent. The present inventors have calculated / determined the methylation proportion ofGm4020Cm4032 (GmCm) in the 28S rRNA fragment in blood samples of patients. They havefound that a variation of the methylation proportion of Gm4020Cm4032 (GmCm) in the 28SrRNA fragment is indicative for the presence of lung cancer in said patients.The term “methylation proportion of Gm4020Cm4032 in the 28S ribosomal RNA(rRNA) fragment”, as used herein, refers to the methylation percentage of Gm4020Cm4032 inthe 28s rRNA fragment in a blood sample. The blood sample may be from a patient to be testedor from a control subject.Specifically, the methylation percentage / proportion of Gm4020Cm4032 in the 28S rRNAfragment ranges between 100% (i.e. fully methylated, or all detected RNA entities are fullymethylated) and 0% (i.e. not methylated, or all detected RNA entities are not methylated).More specifically, the methylation percentage / proportion of Gm4020Cm4032 in the 28S rRNAfragment is 0, 1, 2, 3, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%. The present inventors have further found that the 28S rRNA fragment extracted fromperipheral blood of a patient suffering from lung cancer has a methylation proportion ofGm4020Cm4032 which is higher than a reference methylation proportion of Gm4020Cm4032of the same rRNA fragment extracted from peripheral blood of control subjects being healthy, i.e. not suffering from lung cancer.Accordingly, the determination of the methylation proportion of Gm4020Cm4032 in the 28Sribosomal RNA (rRNA) fragment in a blood sample obtained from a patient and the comparison of the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment in a blood sample obtained from a patient to a reference methylation proportion of Gm4020Cm4032 in the 28SrRNA fragment calculated by measuring at least one reference blood sample from a healthysubject / subject known to not suffer from lung cancer,wherein the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment comparedto the reference methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment isincreased,indicates that the patient suffers from lung cancer and, thus, allows the diagnosis of lung cancerin said patient.The above-mentioned methylation proportion is specifically calculated by dividing the numberof Gm4020Cm4032 in the 28S rRNA fragment by the total number of the 28S rRNA fragment(GC, Gm4020C, GCm4032, and Gm4020Cm4032) in the blood sample.As aforementioned, the reference methylation proportion is the methylation proportion ofGm4020Cm4032 in the 28S rRNA fragment determined by measuring at least one referenceblood sample from a healthy subject / subject known to not suffer from lung cancer. For example,1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, ormore reference blood sample(s) from (a) healthy subject(s) / (a) subject(s) known to not sufferfrom lung cancer may be measured. Average values of a number of patients are preferred.The above-mentioned reference methylation proportion is specifically calculated by dividingthe number of Gm4020Cm4032 in the 28S rRNA fragment by the total number of the 28SrRNA fragment (GC, Gm4020C, GCm4032, and Gm4020Cm4032) in the at least one referenceblood sample. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300,400, 500, or more reference blood sample(s) from (a) healthy subject(s) / (a) subject(s) knownto not suffer from lung cancer may be measured. Average values of a number of patients are preferred. The present inventors have also found that the methylation proportion ofGm4020Cm4032 in the 28S rRNA fragment in case of lung cancer is ≥ 60%, preferablybetween 60 and 80%, e.g. 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,78, 79, or 80%, and / or that the methylation proportion of Gm4020Cm4032 in the 28S rRNAfragment in case of healthiness / no lung cancer is ≤ 55%, preferably between 40 and 55%, e.g.40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55%. The term “lung cancer”, as used herein, refers to a disease which consists of uncontrolledcell growth in tissues of the lung. This growth may lead to metastasis, which is the invasion ofadjacent tissue and infiltration beyond the lungs. The vast majority of primary lung cancers are carcinomas of the lung, derived from epithelial cells. Lung cancer is the most common cause of cancer-related death in men and women. The most common symptoms are shortness of breath, coughing (including coughing up blood), and weight loss. The term “early stage lung cancer”, as used herein, refers to lung cancer that is early in its growth. It has not grown deeply into nearby tissues. In addition, it has not spread to other parts of the body of a patient. No metastasis has been formed. Specifically, early stage cancer is cancer of stage I and / or II. Lung cancer can occur in stages I, II, III, or IV. Specifically, lung cancer can be staged as follows: Stage I means that the cancer is small. It has not grown deeply into nearby tissues. Ithasn’t spread to the lymph nodes or other distant organs. Stage I can also be designated as early lung cancer. Stage I can be divided into IA and IB.Stage IA means the cancer is 3 cm or smaller.Stage IB means the cancer is between 3 cm and 4 cm. It might also be growing into structuressuch as: the main airway of the lung (main bronchus) or the membrane covering the lung (visceral pleura). Stage II means that the cancer is still small. However, it has grown more deeply intonearby tissues and perhaps the lymph nodes, but not into other parts of the body. Stage II can be divided into stage IIA and IIB. Part of the affected lung might have collapsed. Stage IIA means that the cancer is between 4 cm and 5 cm in size but there are no cancer cells in any lymph nodes. Stage IIB means that the cancer is up to 5 cm in size and there are cancer cells in the lymph nodes close to the affected lung. Alternatively, it is between 5 cm and 7 cm but there are no cancer cells in any lymph nodes. Alternatively, the cancer is not in any lymph nodes but has spread into one or more of the following areas: the chest wall (ribs, muscle or skin), the nerve close to the lung (the phrenic nerve), or the layers that cover the heart (mediastinal pleura and parietal pericardium). Alternatively, the cancer is less than 7 cm but there is more than one tumor in the same lobe of the lung. Stage III can be divided into stage IIIA, IIIB and IIIC. It is sometimes called locallyadvanced lung cancer. In stage IIIA, the cancer is up to 5cm in size and has spread to the lymph nodes in the center of the chest on the same side as the tumor. Alternatively, the cancer it is between 5 cm and 7 cm and there is more than one tumor in the same lobe of the lung. Alternatively, the cancer hasspread into one or more of the following areas just outside the lung: the chest wall (ribs, muscle or skin), the nerve close to the lung (the phrenic nerve), the layers that cover the heart (mediastinal pleura and parietal pericardium), or lymph nodes in the lung or close to the lung. Alternatively, the cancer is larger than 7 cm. It hasn't spread into lymph nodes but has spread into one or more of the following areas: the muscle under the lung (diaphragm), the center area of the chest (mediastinum), the heart, a main blood vessel, the wind pipe (trachea), the nervethat goes to the voice box (larynx), the food pipe (oesophagus), a spinal bone, or the area wherethe wind pipe divides (the carina). Alternatively, the cancer is in more than one lobe of the same lung and there might also be cancer cells in lymph nodes close to the affected lung. Stage IIIB can also mean different things. The cancer is less than 5 cm and has spread into lymph nodes in one of these places: the opposite side of the chest from the affected lung, the neck, or above the collarbone. Alternatively, the cancer is between 5 cm to 7 cm and has spread into lymph nodes in the center of the chest. Alternatively, the cancer is any size, has spread into lymph nodes in the center of the chest, and has spread into one or more of the following areas: the chest wall, the muscle under the lung (diaphragm), or the layers that cover the heart (mediastinal pleura and parietal pericardium). Alternatively, the cancer has spread into thelymph nodes in the center of the chest. The lung tumor is more than 7 cm or it has spread intoa major structure in your chest such as: the heart, the wind pipe (trachea), the food pipe (oesophagus), or a main blood vessel. Stage IIIC means the cancer is between 5c m and 7 cm in size or has spread into one or more of the following: the nerve close to the lung (phrenic nerve) or the covering of the heart (parietal pericardium) and it has spread into lymph nodes: in the center of the chest on the opposite side from the affected lung or at the top of the lung on the same side or opposite side or above the collar bone. Alternatively, there is more than one tumor in a different lobe of the same lung. Alternatively, stage IIIC can mean the cancer is bigger than 7 cm or it has spread into one of the following: the muscle under the lung (the diaphragm), the center of the chest (mediastinum), the heart, a major blood vessel, the wind pipe (trachea), the nerve going to the voice box (the recurrent laryngeal nerve), the food pipe (oesophagus), a spinal bone, or the area where the windpipe divides (the carina) and it has spread into lymph nodes: in the center of the chest on the opposite side from the affected lung or at the top of the lung on the same side or opposite side or above the collar bone. Alternatively, there are tumors in more than one lobe of the lung. Stage IV means that the lung cancer has spread. It can be designated as advanced lungcancer. It is divided into stage IVA and IVB.Stage IVA can mean any of the following: there is cancer in both lungs, the cancer is in thecovering of the lung (the pleura) or the covering of the heart (pericardium), or there is fluid around the lungs or the heart that contains cancer cells. Alternatively, it can mean that there is a single area of cancer that has spread outside the chest to a lymph node or to an organ such as the liver or bone. Stage IVB means that the cancer has spread to several areas in one or more organs. The term “diagnosing lung cancer”, as used herein, means determining whether a patient shows signs of or suffers from lung cancer. The term “patient”, as used herein, refers to any subject for whom it is desired to knowwhether she or he suffers from lung cancer. In particular, the term “patient”, as used herein,refers to a subject suspected to be affected by lung cancer. The patient may be diagnosed to beaffected by lung cancer, i.e. diseased, or may be diagnosed to be not affected by lung cancer, i.e. healthy. Further, the term “patient”, as used herein, refers to a subject which is affected bylung cancer, i.e. diseased. The subject may be re-tested for lung cancer and may be diagnosedas still having lung cancer or as having no lung cancer anymore. It should be noted that a patient that is diagnosed as being healthy, i.e. not suffering from lungcancer, may possibly suffer from another disease or condition not tested / known.The patient may be any mammal, including both a human and another mammal, e.g. an animalsuch as a rabbit, mouse, rat, or monkey. A human patient is particularly preferred.The term “(control) subject”, as used herein, refers to a subject known to be not affectedby lung cancer (negative control), i.e. healthy.It should be noted that a (control) subject which is known to be healthy, i.e. not suffering from lung cancer, may possibly suffer from another disease or condition not tested / known. The (control) subject may be any mammal, including both a human and another mammal, e.g. an animal such as a rabbit, mouse, rat, or monkey. A human (control) subject is particularly preferred. The term “direct RNA sequencing”, as used herein, refers to a method of sequencing in which individual RNAs are sequenced directly without conversion to cDNA or other secondarymolecules or amplification therefore minimising biases and information loss (e.g. loss ofinformation regarding RNA modifications) inherent to other sequencing mythologies. One preferred form of direct RNA sequencing is nanopore sequencing, specifically Oxford Nanopore Technology sequencing. The term “nanopore sequencing”, as used herein, is a third generation approach used in the sequencing of biopolymers, specifically, polynucleotides in the form of DNA or RNA.Using nanopore sequencing, a single molecule of DNA or RNA can be sequenced without theneed for Polymerase Chain Reaction (PCR) amplification or chemical labelling of the sample. Nanopore sequencing has the potential to offer relatively low-cost genotyping, high mobility for testing, and rapid processing of samples. Nanopore sequencing is the only sequencing technology to enable real-time analysis in fully scalable formats. The principle of nanopore sequencing is as follows: The biological or solid-state membrane, where the nanopore is found, is surrounded by electrolyte solution. The membrane splits the solution into two chambers. A bias voltage is applied across the membrane inducing an electric field that drives charged particles, in this case the ions, into motion. This effect is known as electrophoresis. For high enough concentrations, the electrolyte solution is well distributed and all the voltage drop concentrates near and inside the nanopore. This meanscharged particles in the solution only feel a force from the electric field when they are near thepore region. This region is often referred as the capture region. Inside the capture region, ions have a directed motion that can be recorded as a steady ionic current by placing electrodes nearthe membrane. Imagine now a nano-sized polymer such as DNA or protein placed in one of thechambers. This molecule also has a net charge that feels a force from the electric field when itis found in the capture region. The molecule approaches this capture region aided by brownianmotion and any attraction it might have to the surface of the membrane. Once inside the nanopore, the molecule translocates through via a combination of electro-phoretic, electro- osmotic and sometimes thermo-phoretic forces. Inside the pore the molecule occupies a volume that partially restricts the flow of ions, observed as an ionic current drop. Based on various factors such as geometry, size and chemical composition, the change in magnitude of the ionic current and the duration of the translocation will vary. The magnitude of the electric current density across a nanopore surface depends on the nanopores dimensions and the composition of DNA or RNA that is occupying the nanopore. Sequencing was made possible because, passing through the channel of the nanopore, the samples cause characteristic changes in the density of the electric current flowing through the nanopore. The total charge flowing through a nanopore channel is equal to the surface integral of electric current density flux across the nanopore unit normal surfaces between times t1and t2. In other words, different molecules can be sensed and potentially identified based on the modulation in ionic current. A strand of DNA or RNA is made up of a sequence of different combinations of four nucleotide bases: A, T (or U for RNA), G and C. Each base that passes through the nanopore can be identified through the characteristic disruption it causes to the current in real-time. Not only the DNA or RNA sequence can be detected, but also DNA orRNA modifications can be quantified in this way. Two types of nanopore sequencing exist: biological and solid state nanopore sequencing. The term “biological nanopore sequencing”, as used herein, refers to the use of transmembrane proteins, called protein nanopores, in particular, formed by protein toxins, thatare embedded in lipid membranes so as to create size dependent porous surfaces - withnanometer scale "holes" distributed across the membranes. Sufficiently low translocation velocity can be attained through the incorporation of various proteins that facilitate the movement of DNA or RNA through the pores of the lipid membranes Alpha hemolysin, which is a nanopore from bacteria that causes lysis of red blood cells orMycobacterium smegamatis porin A (MspA) may be used for nanopore sequencing.The term “solid state nanopore sequencing”, as used herein, refers to a sequencingapproach which, unlike biological nanopore sequencing, does not incorporate proteins into itssystem. Instead, solid state nanopore technology uses various metal or metal alloy substrateswith nanometer sized pores that allow DNA or RNA to pass through. These substrates most often serve integral roles in the sequence recognition of nucleic acids as they translocate through the channels along the substrates. Nanopore sequencing platforms are offered, for example, by Oxford Nanopore Technologies Ltd. All Oxford Nanopore sequencing devices use flow cells which contain anarray of tiny holes - nanopores - embedded in an electro-resistant membrane. Each nanoporecorresponds to its own electrode connected to a channel and sensor chip, which measures the electric current that flows through the nanopore. When a molecule passes through a nanopore, the current is disrupted to produce a characteristic ‘squiggle’. The squiggle is then decoded using basecalling algorithms to determine the DNA or RNA sequence in real time.Specifically, a strand of DNA or RNA is made up of a sequence of different combinations offour nucleotide bases: A, T (or U for RNA), G and C. Each base that passes through the nanopore can be identified through the characteristic disruption it causes to the current in real- time. This makes nanopore sequencing unique, in that it is the only sequencing technology that enables direct, real-time analysis of DNA / RNA in fully scalable formats. Advantages of real- time sequencing include rapid access to time critical information (e.g. pathogen identification), the generation of early sample insights and more control over the sequencing experiment. Nanopore sequencing is limited only by the length of the DNA / RNA fragment presented to thepore and can, therefore, span entire repetitive regions, resolve structural variants, anddifferentiate between different isoforms. The ability to sequence native DNA and RNA without the requirement for amplification, eliminates PCR bias and allows for the identification of base modifications, such as methylation, alongside nucleotide sequence. Particularly, the nanopore sequencing system, e.g. the Oxford Nanopore sequencingsystem, uses, in addition to flow cells, which contain an array of tiny holes - nanopores -embedded in an electro-resistant membrane, two more elements: a nanopore adapter / motorprotein complex and a tether oligonucleotide. The nanopore adapter is required for attachingthe DNA or RNA molecule to be sequenced to the nanopore. In addition, the motor protein isrequired for directing the DNA or RNA molecule to be sequence through the nanopore in orderto allow sequencing. Specifically, the motor protein controls translocation of the RNA or DNA strand through the nanopore. Once the DNA or RNA has passed through, the motor protein detaches and the nanopore is ready to accept the next DNA or RNA molecule. The motor protein is often an enzyme. The tether oligonucleotide has the function of concentrating the RNA or DNA target which is to be sequenced at the membrane surface of a nanopore flow cell. An electrically resistant membrane is further used, which means that all current must pass through the nanopore to ensure a clean signal. The subsequent sequencing of the DNA or RNA molecule is possible as, when the DNA or RNA molecule passes through the nano-scale hole, the current changes / fluctuates. This signal can be detected and is converted to the nucleotide sequence by a basecalling. The nanopore sequencing platforms available, such as the Oxford Nanopore platform, are optimized for the sequencing of long nucleic acids. Technical limitations have prohibited the sequencing of shorter molecules under 100 nucleotides including miRNAs. Chemical modifications of small non-coding RNAs have been reported in disease and may serve as promising biomarkers. Thus, the provision of methods to enable direct sequencing of small non- coding RNAs on a nanopore sequencing platform such as the Oxford Nanopore platform for the simultaneous measurement of both RNA abundance and modification patterns are highly needed. The standard preparation of a direct RNA sequencing library for use on the Oxford Nanopore platform involves the ligation of a 3’adapter only. This however, prevents thesequencing of the 20-50 nucleotides at the 5’end of RNAs, constituting a small region ofsequence that is lost on long RNA inserts however a much greater proportion of sequence thatis lost from smaller RNA inserts, such that the sequencing of RNA under 50 nucleotides wouldbe prohibited. The present inventors managed the sequencing of the 28S rRNA fragment which is only22 nucleotide long using a structured dumbbell 5’adapter that is ligated to the 5’end of the 28SrRNA fragment and enables the extension of the direct RNA sequencing library so as to enableaccurate nanopore sequencing of the full-length small RNA insert. In addition, a specific3’adapter is used. The term “adapter”, as used herein, refers to a polynucleotide that can be ligated to the5’end of a target RNA / RNA molecule (i.e. “5’adapter”) or to the 3’end of a target RNA / RNAmolecule (i.e. “3’adapter”). The nucleotides of the 5’adapter and the 3’adapter may be standardor natural (i.e. adenosine, guanosine, cytidine, thymidine, and uridine) as well as non-standardnucleotides. Non-limiting examples of non-standard nucleotides include inosine, xanthosine, isoguanosine, isocytidine, diaminopyrimidine and deoxyuridine. The adapters may comprise modified or derivatized nucleotides. Non-limiting examples of modifications in the ribose or base moieties include the addition, or removal, of acetyl groups, amino groups, carboxyl groups, carboxymethyl groups, hydroxyl groups, methyl groups, phosphoryl groups and thiol groups. In particular, included are 2’-0-methyl and locked nucleic acids (LNA) nucleotides. Suitable examples of derivatized nucleotides include those with covalently attached dyes, such as fluorescent dyes or quenching dyes, or other molecules such as biotin, digoxygenin, or magnetic particles or microspheres. The adapters may also comprise synthetic nucleotide analogs such as morpholinos or peptide nucleic acids (PNA). Phosphodiester bonds or phosphothioate bonds may link the nucleotides or nucleotide analogs of the linkers. The term “5’adapter”, as used herein, refers to a polynucleotide which is capable of forming a stem-loop structure. It comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. The first stemsequence and the second stem sequence form the “double-stranded region” or “double-strandedstem” of the stem-loop adapter. The 5’adapter, as described herein, can be present as linear polynucleotide, e.g. after denaturation / when denatured. In this form, the 5’adapter is single-stranded. This primarystructure may be converted into a secondary structure. This structure is designated as stem-loopstructure. Thus, the 5’adapter can also have a stem-loop structure, e.g. after re-naturation / when re-natured. As used herein, the term “stem-loop structure” refers to a pattern that can occur in single-stranded RNA. The structure is also known as a “hairpin” or “hairpin loop”. It occurs when tworegions of the same strand, usually complementary in nucleotide sequence when read in opposite directions, base-pair to form a double helix that ends in an unpaired loop. As used herein, the term “loop” refers to the single-stranded region of the stem-loopstructure. In particular, the loop is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. In other words, the loop is located between the two reverse complementary strands of the stem. In the context of the present invention, the term “5’adapter” refers to a polynucleotidethat can be ligated to the 5’end of the 28S rRNA fragment. The term “3’adapter”, as used herein, refers to a combination of two single-strandedoligonucleotides, i.e. a top strand (also designated as first oligonucleotide) and a bottom strand(also designated as second oligonucleotide). Both strands / oligonucleotides comprise sectionswhich are reverse complementary to each other so that they can form a hybrid / double-strandedstructure. The two strands / oligonucleotides of the 3’adapter, as described herein, can be presentas linear oligonucleotides, e.g. after denaturation / when denatured. In this form, the 3’adapter issingle-stranded. However, this primary structure may be converted into a secondary structure.Specifically, the two strands / oligonucleotides of the 3’adapter, as described herein, are furthercapable of forming a hybrid (double-stranded) structure. Thus, the 3’adapter can also have a hybrid (double-stranded) structure, e.g. after re-naturation / when re-natured. In the context of the present invention, the term “3’adapter” refers to a polynucleotide that can be ligated to the 3’end of the 28S ribosomal RNA (rRNA) molecule. The 5’adapter and / or 3’adapter, as described herein, may comprise locked nucleic acids(LNAs). The term “locked nucleic acids (LNAs)”, as used herein, refers to modified nucleotides,specifically deoxynucleotides or ribonucleotides. In case of locked ribonucleotides, the 2’-Oand 4’-C atoms of the ribose are joined through a methylene bridge. This additional bridge limits the flexibility normally associated with the ring, essentially locking the structure into arigid conformation. These nucleic acid analogs are also referred to in some circles as“inaccessible ribonucleotides”. LNA nucleotides can be mixed with DNA or RNA residues inthe polynucleotide, in effect hybridizing with DNA or RNA according to Watson-Crick base- pairing rules. The inflexible nature of these molecules greatly enhances hybridization stability.Further, polynucleotides containing LNAs offer tremendous discriminatory power, allowingthese molecules to distinguish between exact match and mismatched complementary target sequences with very little difficulty. The direct RNA sequencing of the 28S rRNA fragment requires a ligation productcomprising the 28S rRNA fragment to which the 5’adapter and one oligonucleotide of the3’adapter are ligated.This requires first of all that the 5’adapter and one oligonucleotide of the 3’adapter areannealed to the 28S rRNA fragment. Before the 5’adapter and one oligonucleotide of the3’adapter are annealed to the 28S rRNA fragment, the 28S rRNA fragment is denatured. Inaddition, the 5’adapter and the 3’adapter are denatured and subsequently renatured. The term “annealing”, as used herein, refers to a process of heating and cooling twosingle-stranded polynucleotides with complementary sequences. Heat breaks all hydrogenbonds and cooling allows new bonds to form between the sequences. During this process, the5’adapter attaches to the 28S rRNA fragment and forms its characteristic stem-loop structure.The 3’adapter, with its two strands / oligonucleotides, forms, during this process, a hybrid / duplexstructure. In particular, the 5’adapter attaches to the 5’end of the 28S rRNA fragment and oneoligonucleotide of the 3’adapter attaches to the 3’end of the 28S rRNA fragment.In this respect, it should be noted that the denaturation / renaturation of the 5’adapter and3’adapter takes place separately and in the absence of the 28S rRNA fragment. The 5’adapterand the 3’adapter are then ligated to the 28S rRNA fragment using / with a double stranded RNAligase, thereby producing a ligation product. As used herein, the term “ligation product” refers to a hybrid molecule comprising the28S rRNA fragment to which a 5’adapter and a 3’adapter are ligated. In particular, the annealing of the 5’adapter with the 28S rRNA fragment generates a double- stranded hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the adapterand the 5’end of the 28S rRNA fragment. This is an efficient substrate for ligation by a double-stranded RNA ligase. In addition, the annealing of one oligonucleotide of the 3’adpater with the 28S rRNA fragment generates a double-stranded hybrid containing a nick of RNA-OH- 3’ / 5’-P-RNA between the 3’end of the 28S rRNA fragment and the 5’end of the oligonucleotideof the 3’adapter. This is also an efficient substrate for ligation by a double-stranded RNA ligase.Generally, any double stranded RNA ligase capable of ligating double stranded RNA nicks / RNA structures may be used for this purpose. In one preferred embodiment, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2) or a Kod1 ligase. In one more preferred embodiment, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2). The conditions of the ligation reaction are typically adjusted so that the ligase functions near itsoptimal activity level. A buffering agent may be used to adjust and maintain the pH at thedesired level. Representative examples of suitable buffers include, but are not limited to, MOPS, HEPES, TAPS, Bicine, Tricine, TES, PIPES, MES, sodium acetate and Tris buffer. Incidentally, it is the oligonucleotide which is designated as bottom strand / secondoligonucleotide herein, which allows 28S rRNA fragment binding of the 3’adapter.As used herein, the term “extension reaction” refers to an elongation reaction in whichthe oligonucleotide of the 3’adapter ligated to the 3’end of the 28S rRNA fragment is extended,in particular in 5’ to 3’ direction, to form an “extension reaction product” comprising a strandreverse complementary to the 28S rRNA fragment. The extension reaction is also referred to as“reverse transcription”. In some embodiments, the extension reaction is a reverse transcriptionreaction comprising a reverse transcriptase, whereby a DNA (in particular cDNA) copy of the ligation product is made. The term “reverse transcriptase”, as used herein, refers to any enzyme having reverse transcriptase activity. In particular, the term “reverse transcriptase”, as used herein, refers to an enzyme used to generate DNA (cDNA) from an RNA template in a process termed reverse transcription. During reverse transcription, a hybrid double strand of RNA and DNA is built up after presentation of a single-stranded RNA by linking complementary paired DNA building blocks (deoxyribonucleotides). For the process of reverse transcription, a RT primer is usuallyrequired. Herein, the reverse transcriptase (RT) uses the bottom strand / second oligonucleotideof the 3’adapter as a self-primer to extend. In one preferred embodiment, the reversetranscriptase (RT) is SuperScript III RT, Maxima H-RT or Tth polymerase.The term “sample multiplexing (also known as multiplex sequencing)”, as used herein, allows large numbers of libraries to be pooled and sequenced simultaneously during a single run on sequencing instruments. Sample multiplexing is useful when targeting specific genomic regions or working with smaller genomes. The term “barcoding”, as used herein, refers to a method of specimen identification using short, standardized segments of nucleotides such as deoxynucleotides or ribonucleotides. Every species has its own barcode, just as every person has their own fingerprint. These DNA can be compared to a reference library to provide an ID. Residues in two or more polynucleotides are said to “correspond” to each other if theresidues occupy an analogous position in the polynucleotide structures. It is well known in theart that analogous positions in two or more polynucleotides can be determined by aligning the polynucleotide sequences based on nucleic acid sequence or structural similarities. Such alignment tools are well known to the person skilled in the art and can be, for example, obtainedon the World Wide Web, for example, ClustalW or Align using standard settings, preferablyfor Align EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5. The term “blood sample”, as used herein, encompasses whole blood or a blood fraction. Preferably, the blood fraction is selected from the group consisting of a blood cell fraction,plasma, and serum. In particular the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. For example, the blood cell fraction encompasseserythrocytes, leukocytes, and / or thrombocytes.The whole blood sample may be collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA-tube, in a Na-citrate tube, Heparin-tube, or in a ACD-tube (Acid citrate dextrose). Alternatively,the whole blood sample may be collected in a blood collection tube containing cell-free nucleic acid stabilizing chemical agents, such as glutaraldehyde, formaldehyde, or similar (e.g. Streck cfRNA BCT tube, Streck cfDNA BCT tube), and others, or cellular crowding agents, such as polyethyleneglycol (PEG) (e.g. Norgen cfDNA / cfRNA preservation tube), and others. The whole blood sample may also be collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 µl for humans or less. For example, the whole blood may be extracted from the patient via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need betaken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs,are extracted from the dried blood spots into a supernatant which is then further analyzed. Embodiments of the invention The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous, unless clearly indicated to the contrary. The present inventors have previously described a 22 nucleotide fragment of the 28Sribosomal RNA (rRNA) that is released into the blood of lung cancer patients. The 28S rRNAfragment has the following sequence from 5’ to 3’: GCCGCCGGUGAAAUACCACUAC(SEQ ID NO: 1). Specifically, the present inventors have shown that the determination of theexpression level of this fragment in blood of patients allows lung cancer diagnosis (Sikosek etal, 2023).It has been found that the 28S rRNA fragment is Nm modified at two distinct sites (G7,and C19) (Taoka et al, 2018).The present inventors have now used direct RNA sequencing of 28S rRNA fragmentmodifications in plasma cfRNA samples from a clinical lung cancer cohort to further explorethe diagnostic potential of this fragment. Especially, the present inventors have used direct RNAsequencing via the Oxford Nanopore Technology sequencing platform to measure themethylation status of the 28S rRNA fragment from plasma cfRNA samples from a lung cancer clinical cohort to explore the diagnostic value of biomarker RNA modification profiling. cfRNA was manually extracted from plasma collected in Streck cfRNA tubes from a total of43 patients (27 cancer, 16 control). Sequencing was performed via the Oxford NanoporeTechnology sequencing method and methylation status was inferred at the single molecule levelper patient with a deep learning model. The present inventors have found a significant increase of the 28S rRNA fragment witha GmCm methylation pattern in lung cancer patients compared to healthy controls having adiagnostic performance of 0.84 ROC AUC. These findings highlight the importance of directRNA sequencing to measure RNA modifications at individual sites within single molecules toreveal differences that may otherwise be obscured. In summary, the present inventors could show that the single molecule RNAmodification profiling of small RNA biomarkers have high diagnostic value and allow thedetection of lung cancer in a fast and reliable way. Thus, in a first aspect, the present invention relates to a method for diagnosing lungcancer in a patient / determining whether a patient suffers from lung cancer comprising the steps of:(a) determining the methylation proportion of Gm4020Cm4032 in the 28S ribosomal RNA(rRNA) fragment in a blood sample obtained from a patient, and(b) comparing the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragmentin a blood sample obtained from a patient to a reference methylation proportion ofGm4020Cm4032 in the 28S rRNA fragment. The patient tested is suspected of suffering from lung cancer. The above comparison allows the diagnosis of lung cancer in the patient / the determination whether the patient suffersfrom lung cancer or not. Alternatively, the patient tested is affected by lung cancer. The patientmay be re-tested for lung cancer and may be diagnosed as still having lung cancer or as havingno lung cancer anymore.The 28S rRNA fragment having the following (basic) sequence (irrespective ofmethylation) from 5’ to 3’: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1) has twomethylations sites, namely G (if methylated Gm, also designated as Gm4020) and C (ifmethylated Cm, also designated as Cm4032). When denoted GmCm or Gm4020Cm4032, both methylation sites in the 28s rRNA fragment are methylated. That means that either one methylation site, i.e. 5’ GCCGCCGmGUGAAAUACCACUAC 3’ (SEQ ID NO: 11) or 5’ GCCGCCGGUGAAAUACCACmUAC 3’ (SEQ ID NO: 12), or both methylation sites, i.e.5’ GCCGCCGmGUGAAAUACCACmUAC 3’ (SEQ ID NO: 13), in the 28s rRNA fragment are methylated. The above methylation is specifically a 2’-ortho-methylation (also designated as 2’-O-methylation). Thus, in case of a methylated 28s rRNA fragment, a 2′-O-methylguanosine(Gm, Gm4020) methylation and / or a 2′-O-methylcytidine (Cm, Cm4032) methylation ispresent. The present inventors found that the methylation proportion of Gm4020Cm4032 in the28S ribosomal RNA (rRNA) fragment correlates with lung cancer. Thus, in the above method,the methylation proportion of Gm4020Cm4032 (GmCm) in the 28S ribosomal RNA (rRNA)fragment is determined for diagnostic purposes.The methylation proportion is specifically calculated by dividing the number ofGm4020Cm4032 in the 28S rRNA fragment by the total number of the 28S rRNA fragment(GC, Gm4020C, GCm4032, and Gm4020Cm4032) in the blood sample. In one embodiment, the reference methylation proportion is the methylation proportionof Gm4020Cm4032 in the 28S rRNA fragment determined by measuring at least one referenceblood sample from a healthy subject / subject known to not suffer from lung cancer. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300,400, 500, or more reference blood sample(s) from (a) healthy subject(s) / (a) subject(s) knownto not suffer from lung cancer may be measured. The reference methylation proportion is specifically calculated by dividing the numberof Gm4020Cm4032 in the 28S rRNA fragment by the total number of the 28S rRNA fragment(GC, Gm4020C, GCm4032, and Gm4020Cm4032) in the at least one reference blood sample. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300,400, 500, or more reference blood sample(s) from (a) healthy subject(s) / (a) subject(s) knownto not suffer from lung cancer may be measured. Especially, the reference methylation proportion of Gm4020Cm4032 in the 28S rRNAfragment is an average methylation proportion. It is determined by measuring the methylationproportion of Gm4020Cm4032 in the 28S rRNA fragment in blood samples of control subjectsknown to be healthy / known to not suffer from lung cancer and calculating the “average”proportion (e.g. mean, median or modal value) thereof. It is preferred that the reference bloodsample is from the same source (e.g. blood cells, serum, or plasma) than the blood sampleisolated from the patient to be tested. It is further preferred that the reference methylationproportion of Gm4020Cm4032 in the 28S rRNA fragment is obtained from control subjectsknown to be healthy / known to not suffer from lung cancer of the same gender (e.g. female ormale) and / or of a similar age / phase of life (e.g. adults or elderly) than the patient to be tested.Particularly, the reference methylation proportion of Gm4020Cm4032 in the 28S rRNAfragment represents an average value in a healthy population.In one preferred embodiment, an increase of the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment compared to the reference methylation proportionof Gm4020Cm4032 in the 28S rRNA fragment indicates that the patient suffers from lungcancer. Thus, it is particularly preferred that the method for diagnosing lung cancer in apatient / determining whether a patient suffers from lung cancer comprises the steps of:(a) determining the methylation proportion of Gm4020Cm4032 in the 28S ribosomal RNA(rRNA) fragment in a blood sample obtained from a patient,(b) comparing the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragmentin a blood sample obtained from a patient to a reference methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment, whereinthe reference methylation proportion is the methylation proportion of Gm4020Cm4032 in the28S rRNA fragment determined by measuring at least one reference blood sample from a healthy subject / subject known to not suffer from lung cancer, and an increase of the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment compared to the reference methylation proportion of Gm4020Cm4032 in the 28S rRNAfragment indicates that the patient suffers from lung cancer.Specifically, the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment compared to the reference methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment is increased by at least 5%, more specifically by at least 10%, even more specifically by at least 20%, still even more specifically by at least 30%, and most specifically by at least 40 or 50%, e.g. at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50%. The present inventors have found that the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment in case of lung cancer is ≥ 60%, preferably between 60 and 80%,e.g. 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80%, and / orthat the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment in case of healthiness / no lung cancer is ≤ 55%, preferably between 40 and 55%, e.g. 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55%. The results are summarized in Figures 4 and 5.The methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment may bedetermined by direct RNA sequencing, methylation-dependent PCR, mass spectrometry, or any other method designed to detect methylation, particularly 2’-ortho-methylation, in RNA molecules. Specifically, the methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment is determined by direct RNA sequencing. More specifically, the direct RNA sequencing is Oxford Nanopore Technology sequencing. The direct RNA sequencing is preferably carried out on a ligation product comprisingthe 28S rRNA fragment to which a 5’adapter and a 3’adapter is ligated. The 3’adapter used herein comprises a top strand and a bottom strand. The top strand ofthe 3’adapter can alternatively be designated as first oligonucleotide and the bottom strand of the 3’adapter can alternatively be designated as second oligonucleotide. In this respect, it should be noted that the top stand and the bottom strand of the 3’adapter are capable of forming a hybrid structure via reverse complementary sequences. In one embodiment, the ligation product is obtained by(i) mixing the 28S rRNA fragment in denatured form, the 5’adpater in renatured form andthe 3’adapter in renatured form with each other, thereby annealing the 5’adapter and the 3’adapter to the 28S rRNA fragment, and(ii) ligating the 5’adapter and the 3’adapter to the 28S rRNA fragment using / with a doublestranded RNA ligase, thereby obtaining the ligation product. The annealing of the 5’adapter and 3’adapter to the 28S rRNA fragment in step (i) requires that the 28S rRNA fragment is present in denatured form. In one preferredembodiment, the denatured 28S rRNA fragment is produced by heating the 28S rRNA fragmentat between 65°C and 75°C, e.g. 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or 75°C, preferably at 70°C, for between 1 to 3 minutes, e.g.1, 2, or 3, minutes, preferably for 2 minutes. It is preferred that the 28S rRNA fragment is immediately placed on ice after denaturation. For the denaturation step, the 28S rRNA fragment is preferably given to an aqueous solution, e.g. water, or to a buffer solution. The 28S rRNA fragment may, after its denaturation, treated with a Polynucleotide Kinase (PNK) which 5’phosphorylates RNA to enable ligation to the 3’ OH group at the 3’ end of the 5’ adapter. As to the 5’adapter, a denaturation and a renaturation step is required so that the adaptercan form a stem-loop structure which allows annealing to the 28S rRNA fragment. In addition,as to the 3’adapter, a denaturation and a renaturation step is required so that the adapter can form a hybrid structure which allows annealing to the 28S rRNA fragment. Annealing is a process of heating and cooling the 5’adapter and 3’adapter withcomplementary sequences. Heat breaks all hydrogen bonds and cooling allows new bonds toform between the sequences. During this process, the 5’adapter attaches to the denatured 28SrRNA fragment and forms its characteristic stem-loop structure and the 3’adapter attaches tothe denatured 28S rRNA fragment and forms its characteristic stem / hybrid structure. Inparticular, the 5’adapter attaches to the 5’end / 5’terminal sequence of the 28S rRNA fragmentand the bottom strand / second oligonucleotide of the 3’adapter attaches to the 3’end / 3’terminalsequence of the 28S rRNA fragment.It is preferred that the 5’adapter and the 3’adapter are denatured and renatured together,i.e. in a common reaction vessel. It is further preferred that the denaturation / renaturation of the5’adapter and 3’adapter takes place separately and in the absence of the 28S rRNA fragment.In one preferred embodiment, the renatured 5’adapter is produced by denaturing the 5’adapter at between 75°C and 85°C, e.g. 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85°C, preferably at 82°C, for between 1 to 3 minutes, e.g.1, 2, or 3 minutes, preferably for 2 minutes, and renaturing the 5’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s. In one additional or alternative preferred embodiment, the renatured 3’adapter is produced by denaturing the 3’adapter at between 75°C and 85°C, e.g. 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85°C, preferably at 82°C, for between 1 to 3 minutes, e.g.1, 2, or 3 minutes, preferably for 2 minutes, and renaturing the 3’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s. For the denaturation and renaturation step, the 5’adapter and the 3’adapter are preferablygiven to an aqueous buffer comprising 10 mM TRIS HCl pH 7.5, 50 mM NaCl. In other words,the denaturing and renaturing of the 5’adapter and the 3’adapter is preferably carried out in anaqueous buffer comprising 10 mM TRIS HCl pH 7.5, 50 mM NaCl.The annealing of the 5’adapter with the 28S rRNA fragment particularly generates adouble-stranded (DNA / RNA) hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the adapter and the 5’end of the 28S rRNA fragment. This is an efficient substrate forligation by a double stranded RNA ligase. In addition, the annealing of the bottom strand / secondoligonucleotide of the 3’adpater with the 28S rRNA fragment particularly generates a double- stranded (DNA / RNA) hybrid containing a nick of RNA-OH-3’ / 5’-P-RNA between the 3’end of the 28S rRNA fragment and the 5’end of the bottom strand / second oligonucleotide of the 3’adapter. This is a substrate for ligation by a double stranded RNA ligase. The ligation is usually carried out in a ligation buffer. An exemplarily ligation buffer is described in the experimental section of the present patent application. In one preferred embodiment, the ligation buffer comprises polyethylene glycol (PEG), e.g. PEG 8000 (50%),and / or adenosine triphosphate (ATP), e.g. 10 mM ATP. The present inventors have noted thatPEG had the effect on the ligation reaction such that it functions as molecular crowding agent and / or ATP had the effect on the ligation reaction such that increased concentrations facilitate the ligation reactions. In one preferred embodiment, the ligation is carried out between 36°C and 38°C, e.g. 36, 37, or 38°C, preferably at 37°C, for between 30 minutes and 1.5 hours, e.g.30, 35, 40, 45, 50, 55 minutes, 1, 1.25, or 1.5 hour(s), preferably for 1 hour, then at between 14°C and 18°C, e.g.14, 15, 16, 17, or 18°C, preferably at 16°C, for between 1.5 hours and 2.5 hours, e.g.1.5, 2, or 2.5 hours, preferably for 2 hours, and at 12°C overnight. The double stranded RNA ligase can be any ligase capable of ligating double stranded RNA nicks / RNA structures. Preferably, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2) or a Kod1 ligase. Due to the above process, a ligation product is obtained in step (ii). Optionally, it is possible to reverse transcribing the ligation product, thereby obtainingan RNA / cDNA duplex. In this case, an RNA / cDNA duplex and not a ligation product issubjected to direct RNA sequencing. Particularly, the reverse transcription of the ligation product is carried out by reversetranscribing the ligation product using a reverse transcriptase (RT). Usually, the reversetranscriptase (RT) uses a RT primer. However, in the present case, the reverse transcriptase (RT) uses the bottom strand / second oligonucleotide of the 3’adapter as a self-primer to extend.The reverse transcriptase (RT) may be a SuperScript III RT, Maxima H-RT or Tth polymerase.Specifically, said reverse transcribing is carried out at between 45°C and 60°C, e.g.45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60°C, preferably at 50°C, for between 40 and60 minutes, e.g. 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or60 minutes, preferably for 50 minutes, then at between 60°C and 80°C, e.g. 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80°C, preferably at 70°C, for between 8 and 15 minutes, e.g.8, 9, 10, 11, 12, 13, 14, or 15 minutes, preferably for 10 minutes, before finally cooling down to 4°C. The result of the reverse transcription reaction is the formation of RNA / cDNA duplex. In one more preferred embodiment, the 5’adapter comprises the following sequence from 5’ to 3’: rCrCrGrGrCrGrGrCrCrGrUrGrGrCrGrUrGrGrArGrUrGrUrUrArArUrUrArArUrGrUrGr CrUrUrUrGrCrCrArUrG (SEQ ID NO: 2), wherein “r” stands for ribonucleotide and the ribonucleotides in bold designate the ribonucleotide sequence reverse complementary to the 5’terminal sequence of the 28S rRNA fragment. In one another more preferred embodiment, the top strand of the double stranded 3’adapter comprises the following sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGNNNNNNNNNNCTTGCTCTTAGGTA GTAGGTTC (SEQ ID NO: 3), wherein “r” stands for ribonucleotide, “ / 5Phos / ” indicates thatthe 5’-terminal ribonucleotide is phosphorylated, “rArArArArArArArArArA” stands for apoly(A) segment, and NNNNNNNNNN is an optional barcode, andthe bottom strand of the double stranded 3’adapter comprises the following sequence from 5’to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCCTTTTTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 7), wherein NNNNNNNNNN is an optionalbarcode, “TTTTTTTTTT” stands for a poly(T) segment, + denotes that the proceeding base isLNA modified, and deoxynucleotides in bold designate the deoxynucleotide sequence reverse complementary to the 3’terminal sequence of the 28S rRNA fragment. In this respect, it should be noted that the optional barcode sequence is variable. Theoptional barcode sequence in the top strand / first oligonucleotide and the optional barcodesequence in the bottom strand / second oligonucleotide are reverse complementary to each other.In one even more preferred embodiment,(i) the top strand of the double stranded 3’adapter comprises the following sequence from5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGAAACAAACACCTTGCTCTTA GGTAGTAGGTTC (SEQ ID NO: 4) and the bottom strand of the double stranded 3’adapter comprises the following sequencefrom 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGGTGTTTGTTTCCTTTTTTTTT TGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 8), or(ii) the top strand of the double stranded 3’adapter comprises the following sequence from5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGCTCTTGTGGGCTTGCTCTTAG GTAGTAGGTTC (SEQ ID NO: 5), and the bottom strand of the double stranded 3’adapter comprises the following sequencefrom 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGCCCACAAGAGCCTTTTTTTTT TGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 9), or(iii) the top strand of the double stranded 3’adapter comprises the following sequence from5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGAGGGCCGATTCTTGCTCTTAG GTAGTAGGTTC (SEQ ID NO: 6), and the bottom strand of the double stranded 3’adapter comprises the following sequencefrom 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAATCGGCCCTCCTTTTTTTTT TGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 10), or(iv) the top strand of the double stranded 3’adapter comprises the following sequence from5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGGCAACTGTCTCTTGCTCTTAG GTAGTAGGTTC (SEQ ID NO: 14), andthe bottom strand of the double stranded 3’adapter comprises the following sequencefrom 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAGACAGTTGCCCTTTTTTTT TTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 17), or(v) the top strand of the double stranded 3’adapter comprises the following sequence from5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGTGTTTACCGACTTGCTCTTAG GTAGTAGGTTC (SEQ ID NO: 15), andthe bottom strand of the double stranded 3’adapter comprises the following sequencefrom 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGTCGGTAAACACCTTTTTTTT TTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 18), or(vi) the top strand of the double stranded 3’adapter comprises the following sequence from5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGGCCAGGATACCTTGCTCTTAG GTAGTAGGTTC (SEQ ID NO: 16), and the bottom strand of the double stranded 3’adapter comprises the following sequencefrom 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGGTATCCTGGCCCTTTTTTTT TTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 19).The present inventors use a direct RNA sequencing platform for sequencing the 28SrRNA fragment. Specifically, the direct RNA sequencing platform is a Nanopore sequencingplatform which is offered, for example, by Oxford Nanopore Technologies Ltd. All OxfordNanopore sequencing devices use flow cells which contain an array of tiny holes - nanopores -embedded in an electro-resistant membrane. Each nanopore corresponds to its own electrode connected to a channel and sensor chip, which measures the electric current that flows through the nanopore. When a molecule passes through a nanopore, the current is disrupted to produce a characteristic ‘squiggle’. The squiggle is then decoded using basecalling algorithms to determine the DNA or RNA sequence in real time.Specifically, a strand of DNA or RNA is made up of a sequence of different combinations offour nucleotide bases: A, T (or U for RNA), G and C. Each base that passes through the nanopore can be identified through the characteristic disruption it causes to the current in real- time. This makes nanopore sequencing unique, in that it is the only sequencing technology that enables direct, real-time analysis of DNA / RNA in fully scalable formats. Advantages of real- time sequencing include rapid access to time critical information (e.g. pathogen identification), the generation of early sample insights and more control over the sequencing experiment. Nanopore sequencing is limited only by the length of the DNA / RNA fragment presented to the pore and can therefore span entire repetitive regions, resolve structural variants, and differentiate between different isoforms. The ability to sequence native DNA and RNA without the requirement for amplification, eliminates PCR bias and allows for the identification of base modifications, such as methylation, alongside nucleotide sequence. As mentioned above, direct RNA sequencing requires flow cells. Flow cells contain anarray of tiny holes - nanopores - embedded in an electro-resistant membrane. The direct RNAsequencing reaction especially further requires / comprises the addition of a structure allowingdirect RNA sequencing.Specifically, the structure allowing direct RNA sequencing is composed of(i) a first element, and(ii) a second element.More specifically,(i) the first element is a 5’overhang sequence on a direct RNA sequencing compatiblemotor protein / adapter complex, and(ii) the second element is a tether oligonucleotide that concentrates the ligation product orthe RNA / cDNA duplex at the membrane surface of a flow cell.The 5’overhang sequence on a direct RNA sequencing compatible motor protein / adaptercomplex, thus, established the connection / contact of the 5’adapter / 3’adapter complex carryingthe 28S RNA fragment to be sequenced and the motor protein / adapter complex. Even more specifically,(i) the first element recognizes the reverse complementary 3’overhanging sequence of thetop strand of the double stranded 3’adapter as described above to which it anneals andis ligated to, to enable direct RNA sequencing, and(ii) the second element recognizes the reverse complementary 5’overhanging sequence ofthe bottom strand of the double stranded 3’adapter as described above to which itanneals and is ligated to, to enable direct RNA sequencing. The direct RNA sequencing system uses, in addition to flow cells including nanoporesand an electro-resistant membrane, a nanopore adapter / motor protein complex and a tetheroligonucleotide. The nanopore adapter is required for attaching the 28S rRNA fragment to besequenced, specifically the ligation product or the RNA / cDNA duplex, to the nanopore. In addition, the motor protein is required for directing the 28S rRNA fragment to be sequence through the nanopore in order to allow sequencing. Specifically, the motor protein controls translocation of the 28S rRNA fragment strand through the nanopore. The tether oligonucleotide has the function of concentrating the 28S rRNA fragment which is to be sequenced at the membrane surface of a nanopore flow cell. An electrically resistant membrane means that all current must pass through the nanopore to ensure a clean signal. The final sequencing of the 28S rRNA fragment is possible as, when the 28S rRNA fragment passes through the nano-scale hole, the current changes / fluctuates. This signal can be detected and is converted to a nucleotide sequence by basecalling algorithms. Especially, the added structure allows direct RNA sequencing of the 28S rRNA fragment via the Oxford Nanopore Technology (ONT) platform.By direct RNA sequencing, the methylation of Gm4020Cm4032 in the 28S ribosomalRNA (rRNA) fragment is detected and the methylation proportion of Gm4020Cm4032 in the28S ribosomal RNA (rRNA) fragment in a blood sample obtained from a patient is calculated. The detected methylation is a 2'-ortho-methylation.In the method of the present invention, a blood sample is used. Preferably, the bloodsample is a whole blood sample or a blood fraction. More preferably, the blood fraction is anacellular fraction of blood or a cellular fraction of blood. Even more preferably, the acellularfraction of blood is serum or plasma, specifically plasma.The blood cell fraction may encompass erythrocytes, leukocytes, and / or thrombocytes.The whole blood sample may be collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA- tube, in a Na-citrate tube, Heparin-tube, or in a ACD-tube (Acid citrate dextrose). Alternatively, the whole blood sample may be collected in a blood collection tube containing cell-free nucleic acid stabilizing chemical agents, such as glutaraldehyde, formaldehyde, or similar (e.g. Streck cfRNA BCT tube, Streck cfDNA BCT tube), and others, or cellular crowding agents, such as polyethyleneglycol (PEG) (e.g. Norgen cfDNA / cfRNA preservation tube), and others.The whole blood sample may also be collected by means of a bloodspot technique, e.g. using aMitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 µl for humans or less. For example, the whole blood may be extracted from the patient via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need betaken in handling or shipping. Once at the analysis site, the desired components are extractedfrom the dried blood spots into a supernatant which is then further analyzed. The present inventors found that the methylation of Gm4020Cm4032 in the 28Sribosomal RNA (rRNA) fragment correlates with lung cancer. Thus, in a second aspect, the present invention relates to the use of Gm4020Cm4032methylation in the 28S ribosomal RNA (rRNA) fragment to diagnose lung cancer in apatient / determine whether the patient suffers from lung cancer.As to preferred embodiments, it is referred to the first aspect, of the present invention.The present invention is summarized as follows:A method for diagnosing lung cancer in a patient / determining whether a patient suffersfrom lung cancer comprising the steps of:(a) determining the methylation proportion of Gm4020Cm4032 in the 28Sribosomal RNA (rRNA) fragment in a blood sample obtained from a patient, and(b) comparing the methylation proportion of Gm4020Cm4032 in the 28S rRNAfragment in a blood sample obtained from a patient to a reference methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment.The method of item 1, wherein the methylation proportion is calculated by dividing thenumber of Gm4020Cm4032 in the 28S rRNA fragment by the total number of the 28SrRNA fragment in the blood sample.The method of items 1 or 2, wherein the reference methylation proportion is themethylation proportion of Gm4020Cm4032 in the 28S rRNA fragment determined bymeasuring at least one reference blood sample from a healthy subject / subject known to not suffer from lung cancer.The method of item 3, wherein the reference methylation proportion is calculated bydividing the number of Gm4020Cm4032 in the 28S rRNA fragment by the total numberof the 28S rRNA fragment in the at least one reference blood sample.The method of items 3 or 4, wherein an increase of the methylation proportion ofGm4020Cm4032 in the 28S rRNA fragment compared to the reference methylationproportion of Gm4020Cm4032 in the 28S rRNA fragment indicates that the patientsuffers from lung cancer.The method of any one of items 1 to 5, wherein the 28S rRNA fragment has thefollowing (basic) sequence (irrespective of methylation) from 5’ to 3’: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1).The method of any one of items 1 to 6, wherein the methylation proportion ofGm4020Cm4032 in the 28S rRNA fragment is determined by direct RNA sequencing, preferably Oxford Nanopore Technology sequencing, methylation-dependent PCR, mass spectrometry, or any other method designed to detect methylation, preferably 2’- ortho-methylation, in RNA molecules.The method of item 7, wherein the direct RNA sequencing is carried out on a ligationproduct comprising the 28S rRNA fragment to which a 5’adapter and a 3’adapter is ligated.The method of item 8, wherein the 3’adapter comprises a top strand and a bottom strand.The method of items 8 or 9, wherein the ligation product is obtained by(i) mixing the 28S rRNA fragment in denatured form, the 5’adpater in renaturedform and the 3’adapter in renatured form with each other, thereby annealing the 5’adapter and the 3’adapter to the 28S rRNA fragment, and(ii) ligating the 5’adapter and the 3’adapter to the 28S rRNA fragment using / with adouble stranded RNA ligase, thereby obtaining the ligation product.The method of item 10, wherein the double stranded RNA ligase is a T4 RNA ligase 2(Rnl2) or a Kod1 ligase.The method of any one of items 8 to 11, wherein the 5’adapter comprises thefollowing sequence from 5’ to 3’: rCrCrGrGrCrGrGrCrCrGrUrGrGrCrGrUrGrGrArGrUrGrUrUrArArUrUrArArUrG rUrGrCrUrUrUrGrCrCrArUrG (SEQ ID NO: 2), wherein “r” stands for ribonucleotide and the ribonucleotides in bold designate the ribonucleotide sequence reversecomplementary to the 5’terminal sequence of the 28S rRNA fragment.The method of any one of items 9 to 12, whereinthe top strand of the double stranded 3’adapter comprises the following sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGNNNNNNNNNNCTTGCTCTTA GGTAGTAGGTTC (SEQ ID NO: 3), wherein “r” stands for ribonucleotide, “ / 5Phos / ” indicates that the 5’-terminal ribonucleotide is phosphorylated,“rArArArArArArArArArA” stands for a poly(A) segment, and NNNNNNNNNN is anoptional barcode, andthe bottom strand of the double stranded 3’adapter comprises the following sequencefrom 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCCTTTTTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 7), wherein NNNNNNNNNN is anoptional barcode, stands for a poly(T) segment, + denotes that theproceeding base is LNA modified, and deoxynucleotides in bold designate the deoxynucleotide sequence reverse complementary to the 3’terminal sequence of the 28S rRNA fragment.The method of item 13, wherein(i) the top strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGAAACAAACACCTTGCT CTTAGGTAGTAGGTTC (SEQ ID NO: 4) andthe bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGGTGTTTGTTTCCTTTT (ii) the top strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGCTCTTGTGGGCTTGCTC TTAGGTAGTAGGTTC (SEQ ID NO: 5), and the bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGCCCACAAGAGCCTTT TTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 9), or(iii) the top strand of the double stranded 3’adapter comprises the following sequencefrom 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGAGGGCCGATTCTTGCT CTTAGGTAGTAGGTTC (SEQ ID NO: 6), and the bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAATCGGCCCTCCTTTT (iv) the top strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGGCAACTGTCTCTTGCT CTTAGGTAGTAGGTTC (SEQ ID NO: 14), andthe bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAGACAGTTGCCCTTT (v) the top strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGTGTTTACCGACTTGCT CTTAGGTAGTAGGTTC (SEQ ID NO: 15), andthe bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGTCGGTAAACACCTTT (vi) the top strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGGCCAGGATACCTTGCT CTTAGGTAGTAGGTTC (SEQ ID NO: 16), and the bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGGTATCCTGGCCCTTTT 15. The method of any one of items 1 to 14, wherein the methylation is a 2'-ortho-methylation.16. The method of any one of items 1 to 15, wherein the blood sample is a whole bloodsample or a blood fraction.17. The method of item 16, wherein the blood fraction is an acellular fraction of blood or acellular fraction of blood.18. The method of item 17, wherein the acellular fraction of blood is serum or plasma,preferably plasma.19. Use of Gm4020Cm4032 methylation in the 28S ribosomal RNA (rRNA) fragment todiagnose lung cancer in a patient / determine whether the patient suffers from lung cancer. Various modifications and variations of the invention will be apparent to those skilled in the art without departing from the scope of invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art in the relevant fields are intended to be covered by the present invention. BRIEF DESCRIPTION OF THE FIGURES The following Figures are merely illustrative of the present invention and should not be construed to limit the scope of the invention as indicated by the appended claims in any way.Figure 1: Shows the principle of nanopore sequencing on the platform of OxfordNanopore Technologies (ONT). A MinION flow cell contains 512 channels with 4 nanopores in each channel, for a total of 2,048 nanopores used to sequence DNA or RNA. The wells areinserted into an electrically resistant polymer membrane supported by an array ofmicroscaffolds connected to a sensor chip. Each channel associates with a separate electrode in the sensor chip and is controlled and measured individually by the application-specific integration circuit (ASIC). Ionic current passes through the nanopore because a constant voltage is applied across the membrane, where the trans side is positively charged. Under the control of a motor protein, a double-stranded DNA (dsDNA) molecule (or an RNA–DNA hybrid duplex) is first unwound, then single-stranded DNA or RNA with negative charge is ratcheted through the nanopore, driven by the voltage. As nucleotides pass through the nanopore, a characteristic current change is measured and is used to determine the corresponding nucleotide type at ~450 bases per s (R9.4 nanopore). Figure 2: Shows a schematic diagram of 28S ribosomal RNA (rRNA) fragmentsequencing on the ONT platform. Ligation of both a structured 5’ adapter, and 3’ adapter in the1st step, enclose the 28S rRNA fragment in the adapter sequence and enable accurate sequencingand RNA methylation detection and quantification.Figure 3: Shows a schematic diagram of the ML pipeline for barcode demultiplexingand RNA modification quantification with Nano-smallRNAseq.Figure 4: Shows that Gm4020Cm4032 methylation in the 28S ribosomal RNA (rRNA)fragment is diagnostic for lung cancer. The methylation proportion of Gm4020Cm4032 in the28S ribosomal RNA (rRNA) fragment is significantly increased in plasma cfRNA samples fromlung cancer patients compared to healthy controls (p = 1.36e-4).Figure 5: Shows a diagnostic ROC curve based on the methylation proportion ofGm4020Cm4032 in the 28S ribosomal RNA (rRNA) fragment within plasma cfRNA samples(ROC AUC = 0.84). Figure 6: Shows a standard curve for GmCm proportion, diluted in a background ofGCm. In order to control for any data leak from flowcell batch effect and to explore thequantitative performance of this classifier, a multiplexed standard curve of synthetic 28S ribosomal RNA (rRNA) fragment (GmCm in GCm) was created and sequenced on a single flowcell. A strong and significant correlation between the predicted and ground truth GmCmmethylation fraction (Pearson r = 0.9971, p = 1.24e-05) was observed. The synthetic 28Sribosomal RNA (rRNA) fragment encompasses nucleotides 4014-4035 of the human 28S ribosomal RNA (rRNA). EXAMPLES The examples given below are for illustrative purposes only and do not limit the invention described above in any way. EXAMPLE 1: DETECTION OF SMALL RNA MODIFICATIONS IN CLINICAL SAMPLES AND USE AS CANCER DIAGNOSTIC Methods: Study participants:Small RNA sequencing was performed on the ONT platform to quantify the Nm methylationstatus of the 28S rRNA fragment in a clinical lung cancer cohort. Clinical samples used werestemming from patients enrolled in the study registered under number DRKS00032631.Patients characteristics are summarized in Table 1 below. Specifically, 43 patients with asmoking history of at least 20 pack-years, and who are either current or ex-smokers having quitwithin the last 15 years, were prospectively recruited. Participants donated 10 ml blood inStreck cfRNA tubes, from which 0.5 ml of plasma was used for RNA extraction and librarypreparation for targeted direct RNA sequencing.

[0002] Controls Cancers Patient Characteristic (n= 16) (n= 27) Pathologic stage, n (%)Ia 1 (3.8)Ib 1 (3.8)IIb 1 (3.8)IIIa 2 (7.7)IIIb 4 (15.4)IIIc 2 (7.7)IVa 6 (23.1)IVb 8 (30.8)no information 2 (7.7)Table 1: Patients characteristicsProcessing of clinical samples Upon blood collection, cfRNA Streck BCT tubes were inverted 10 times and kept in upright position up to 1hour before processed by following protocol: 1. To separate plasma, centrifuge the tube at 1800 x g for 15 min at room temperature.2. Transfer the upper plasma layer to a new conical 15 ml falcon tube.3. Centrifuge the plasma at 2800 x g for 15 min at room temperature.4. Aliquot the plasma with 0.5 ml each into 1,5ml Eppendorf tubes.5. Freeze the aliquots by placing them into -80°C immediately after aliquoting. Extraction of RNA For the extraction of RNA from aliquoted plasma, a Zymp Research quick-cfRNA Serum & Plasma kit was used, by a protocol as described by the vendor. Additional steps included: After last wash with RNA Wash buffer, an extra centrifugation step with empty column was done to ensure complete removal of wash buffer. Elution was done with 20 µl of nuclease free-water. Nanopore libraries preparation protocol: 1. RNA PNK pre-treatment.1.1.In a 0.2 ml PCR tube, prepare a maximum of 1 mg of total RNA and adjust the volume to 16 μl with Nuclease-free Water.1.2.Place the tube in a thermal cycler and incubate at 70°C for 2 min. Immediately place on ice. 1.3.In a new 0.2 ml PCR tube add 15.6 μl denatured RNA from the previous stepand the following reagents: Denatured RNA 15.6 μlT4 PNK Reaction Buffer (10X) 2 μlATP (100 mM) 2 μlT4 PNK (10 U / μl) 0.4 μlTotal 20 μl1.4.Place the tube(s) in a thermal cycler and incubate at 37°C for 30 min. Heat inactivate by incubating at 65°C for 20 minutes. Immediately place on ice. 2. Preparing 5’ and 3’ adapters for RNA ligation:2.1.Prepare the Annealing buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl). 2.2. Prepare the 3’ adapter by annealing 1.4 µM Oligo A and Oligo B in a 1:1 ratioin Annealing buffer. 2.3.Resuspend and dilute the 5’ adapter in Annealing buffer to result in a 2.5 μMworking concentration. 2.4.Place the 3’ adapter and the 5’ adapter in the thermal cycler and incubate at 82°C for 2 min followed by a ramp down 0.1°C / sec to 4°C. Store in -20°C.irst RNA Ligation:3.1.Mix by pipetting the following reagents together to make the RNA ligation master mix: 5’ adapter (2.5 μM) 2 μlPEG8000 (50%) 2 μl10x RNA ligation buffer 2 μlT4 Rnl2 (10 U / μl) 1 μlRNase Inhibitor 1 μlATP (100 mM) 2 μlTotal 10 μl3.2.If preparing more than one sample (for multiplexing), mix in different 0.2 ml PCR tubes 10 μl of the previous Master mix, 9 μl PNK treated RNA and 1 μlof the corresponding barcoded 3’ adapter (1.4 μM). Mix by pipetting.3.3.Place the tube(s) in a thermal cycler and incubate at 37°C for 60 min and the lid heated at 45°C, then at 16°C for 2 h and 12°C overnight. everse Transcription:Use the 20 μl of the previous adapter-ligated RNA to continue with the reversetranscription: Ligation product (previous step) 20 μlNuclease-free water 4 μl5x first-strand buffer 8 μldNTPs, 10mM 2 μlDTT, 0.1 M 4 μlSuperScript III (reverse transcriptase) (200 U / μl) 2 μlTotal 40 μlPlace the tube(s) in a thermal cycler and incubate at 50°C for 50 min, then at 70°C for10 minHeat inactivate the T4 Rnl2 at 80°C for 5 minutes and 4°C until the next step.beads clean-up with Agencourt RNAClean XPTransfer the product to a 1.5 ml Eppendorf DNA LoBind tube. If preparing morethan one sample for multiplexing, in this step, all the samples can be mixedhomogeneously in a 1.5 ml Eppendorf DNA LoBind tube.Resuspend the stock of beads by vortexing.Adjust the ratio beads: RNA to 2x (example: for 40 µl of reverse transcriptionreaction, add 80 µl of resuspended beads) and mix by pipetting.Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.Prepare 500 µl of fresh 70%.Spin down the sample and pellet on a magnet.Wait until the supernatant is transparent (approx. 7-10 min) and pipette it off.Keep the tube on magnet and add 400 µl of 70% ethanol without disturbing the pellet.Keep the magnetic rack on the bench, rotate the bead-containing tube by 180°.Wait for the beads to migrate and then rotate the tube back to the starting position.Wait for the beads to migrate back and remove the ethanol.Spin down and place the tubes back on the magnet. Pipette off any residual ethanol.Remove the tube from the magnetic rack and resuspend the pellet in 21 µl ofNuclease-free water.Incubate 5 minutes at room temperature.Pellet the beads on a magnet until eluate is clear and colorless.Pipette 20 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.ond RNA Ligation: RNA Adapters (RMX):d the next reagents in the following order:Clean cDNA 20 µl NEBNext Quick Ligation Reaction Buffer 8 µlRNA Adapter (RMX) 6 µlNuclease-free water 3 µlT4 DNA Ligase (2000 U / μl) 3 µlTotal 40µlcubate the reaction for 10 to 20 minutes at room temperature.nd beads clean-up with Agencourt RNAClean XPResuspend the stock of beads by vortexingAdjust the ratio beads:RNA to 0.4x (example: for 40 µl of ligation product, add 16µl of resuspended beads) and mix by pipetting. Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.Spin down the sample and pellet on a magnet.Wait until the supernatant is transparent (approx. 7-10 min) and pipette it offKeep the tube on magnet and add 150 µl of Wash Buffer (WSB) to the beads.Close the tube lid and resuspend by flicking the tube.Short spin and return the tube to the magnetic rack.Wait for the beads to migrate and pipette off the supernatant.. Repeat the previous step.. Remove the tube from the magnetic rack.. Resuspend the pellet in 23 µl of Elution Buffer (EB) by the gentle flicking the tube.. Incubate 10 minutes at room temperature.. Pellet the beads on a magnet until eluate is clear and colorless.. Pipette 20 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.ing and loading the SpotON flow cellPrior to loading the reverse-transcribed and adapted RNA, the flow cell needs to beprepared. Add 30 µl of Flash Teher (FLT) in a full aliquote of Flush Buffer (FB). Mix by vortexing and spin down. This solution is the priming mix.Open the MinION device lid and slide the flow cell under the clip. Press down firmlyon the flow cell to ensure correct thermal and electrical contact.Slide the flow cell priming port cover clockwise to open the priming port.After opening the priming port, set a P1000 pipette to 200 µl and insert the tip into thepriming port.Turn the wheel of the pipette until the dial shows 220-230 µl or until you see a smallvolume of buffer entering the pipette tip. Note: Viually check that there is continuous buffer from the priming port across the sensor array.Load 800 µl of the priming mix into the flow cell via the priming port, avoid theintroduction of air bubbles. Wait for five minutes. During this time, prepare the library for loading by following the next steps:reverse-transcribed and adapted RNA 20 µlNuclease-free water 17.5 µlRNA Running Buffer (RRB) 37.5 µlTotal 75 µl8.7. Complete the flow cell priming by gently lifting the SpotON sample port cover andloading 200 µl of the priming mix into the flow cell priming port (not the SpotONsample port), avoiding the introduction of air bubbles. 8.8. Mix the prepared library gently by pipetting up and down and directly add the 75 µl oflibrary to the Flow Cell vi the SpotON sample port in a dropwise fashion (not touchingthe port with the pipette tip). Ensure each drop flows into the port before adding the next.Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port,close the priming port and replace the MinION device lid. 9. Data analysis and bioinformatics: Following the flowchart detailed in Figure 3.9.1. Raw data in the fast5 format is 1st basecalled with Guppy Basecalling Software(Version 6.5.7+ca6d6a) provided by Oxford Nanopore and the Nova labrna_r9.4.1_70bps_sup model (Cruciani et al, 2023). 9.2. Reads with PHRED ≤ 7 are removed.9.3. Reads are mapped to the target library with Burrows-Wheeler Aligner (BWA) and onlyretained if they map to both target insert sequence and the 5’ adapter.9.4. Reads are segmented into a 5’ RNA portion (containing target small RNA) and a 3’DNA portion (containing 3’ adapter and barcode) using a dynamic programming point detection approach (Truong et al, 2020). 9.5. Both segments are normalized by Median Absolute Deviation (MAD).9.6. Both segments are scaled to a fixed length of 5000.9.7. Outliers (defined as + / - 3 standard deviations) are clipped.9.8. The processed data is passed to two different trained neural networks:9.8.1.An insert model trained with ground truth data for all possible modification classes of the target small RNA insert. 9.8.2.A barcode model trained with ground truth data for all possible barcodes. 9.9. The predictions are combined to calculate the number of target modification classes aredetected per barcode. Results:The principle of nanopore sequencing on the platform of Oxford Nanopore Technologies(ONT) is shown in Figure 1. A MinION flow cell contains 512 channels with 4 nanopores ineach channel, for a total of 2,048 nanopores used to sequence DNA or RNA. The wells are inserted into an electrically resistant polymer membrane supported by an array of microscaffolds connected to a sensor chip. Each channel associates with a separate electrode in the sensor chip and is controlled and measured individually by the application-specific integration circuit (ASIC). Ionic current passes through the nanopore because a constant voltage is applied across the membrane, where the trans side is positively charged. Under the control of a motor protein, a double-stranded DNA (dsDNA) molecule (or an RNA–DNA hybrid duplex) is first unwound, then single-stranded DNA or RNA with negative charge is ratcheted through the nanopore, driven by the voltage. As nucleotides pass through the nanopore, a characteristic current change is measured and is used to determine the corresponding nucleotide type at ~450 bases per s (R9.4 nanopore).It could be demonstrated with nanopore sequencing on the platform of Oxford NanoporeTechnologies (ONT) that Gm4020Cm4032 methylation in the 28S ribosomal RNA (rRNA)fragment is diagnostic for lung cancer. The methylation proportion of Gm4020Cm4032 in the28S ribosomal RNA (rRNA) fragment is significantly increased in plasma cfRNA samples fromlung cancer patients compared to healthy controls (p = 1.36e-4) (see Figure 4). The diagnosticROC curve based on the methylation proportion of Gm4020Cm4032 in the 28S ribosomal RNA(rRNA) fragment within plasma cfRNA samples (ROC AUC = 0.84) is shown in Figure 5.A standard curve for GmCm proportion, diluted in a background of GCm is further shown inFigure 6. In order to control for any data leak from flowcell batch effect and to explore thequantitative performance of this classifier, a multiplexed standard curve of synthetic 28S ribosomal RNA (rRNA) fragment (GmCm in GCm) was created and sequenced on a single flowcell. A strong and significant correlation between the predicted and ground truth GmCm methylation fraction (Pearson r = 0.9971, p = 1.24e-05) was observed. The synthetic 28S ribosomal RNA (rRNA) fragment encompasses nucleotides 4014-4035 of the human 28S ribosomal RNA (rRNA). Sequences Name Sequence 5’ to 3’first Oligo 5’- (A) / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGAAACAAACACCTT barcode_1 GCTCTTAGGTAGTAGGTTC (SEQ ID NO: 4) first Oligo 5'- (A) / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGCTCTTGTGGGCTT barcode_2 GCTCTTAGGTAGTAGGTTC (SEQ ID NO: 5) first Oligo 5'- (A) / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGAGGGCCGATTCTT barcode_3 GCTCTTAGGTAGTAGGTTC (SEQ ID NO: 6) first Oligo 5'- (A) / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGGCAACTGTCTCTT barcode_4 GCTCTTAGGTAGTAGGTTC (SEQ ID NO: 14) first Oligo 5'- (A) / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGTGTTTACCGACTTG barcode_5 CTCTTAGGTAGTAGGTTC (SEQ ID NO: 15) first Oligo 5'- (A) / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGGCCAGGATACCTT barcode_6 GCTCTTAGGTAGTAGGTTC (SEQ ID NO: 16) second Oligo 5’- (B) 28S GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGGTGTTTGTTTCCTTT rRNA TTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 8) fragment barcode_1 second Oligo 5'- (B) 28S GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGCCCACAAGAGCCTT rRNA TTTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 9) fragment barcode_2 second Oligo 5'- (B) 28S GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAATCGGCCCTCCTT rRNA TTTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 10) fragment barcode_3 second Oligo 5'- (B) 28S GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAGACAGTTGCCCTT rRNATTTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 17)fragment barcode_4 second Oligo 5'- (B) 28S GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGTCGGTAAACACCTT rRNATTTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 18) fragment barcode_5 second Oligo 5'- (B) 28S GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGGTATCCTGGCCCTT rRNA TTTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 19) fragment barcode_6 5’adapter 5’- 28S rRNA rCrCrGrGrCrGrGrCrCrGrUrGrGrCrGrUrGrGrArGrUrGrUrUrArArUrUr fragment ArArUrGrUrGrCrUrUrUrGrCrCrArUrG (SEQ ID NO: 2)Table 2: Oligo sequences for targeted Nano-smallRNAseq. Bold underlined sequence indicatesthe barcode. ONT compatible sequence to enable ligation to the ONT RMX adapter is in italic.Bold black are the overhang regions designed to capture the 28S rRNA fragment. r denotes thatthe proceeding nucleotide is RNA. A + denotes that the proceeding base is LNA modified.REFERENCES Cruciani S, Delgado-Tejedor A, Pryszcz LP, Medina R, Llovera L & Novoa EM (2023) Denovo basecalling of m6A modifications at single molecule and single nucleotide resolution.bioRxiv: 2023.11.13.566801 Sikosek T, Horos R, Trudzinski F, Jehn J, Frank M, Rajakumar T, Klotz LV, Mercaldo N,Kahraman M, Heuvelman M, et al (2023) Early Detection of Lung Cancer using small RNAs.J Thorac Oncol Taoka M, Nobe Y, Yamaki Y, Sato K, Ishikawa H, Izumikawa K, Yamauchi Y, Hirota K,Nakayama H, Takahashi N, et al (2018) Landscape of the complete RNA chemicalmodifications in the human 80S ribosome. Nucleic Acids Res 46: gky811Truong C, Oudre L & Vayatis N (2020) Selective review of offline change point detectionmethods. Signal Process 167: 107299

Claims

CLAIMS1. A method for diagnosing lung cancer in a patient / determining whether a patient suffersfrom lung cancer comprising the steps of: (a) determining the methylation proportion of Gm4020Cm4032 in the 28Sribosomal RNA (rRNA) fragment in a blood sample obtained from a patient, and (b) comparing the methylation proportion of Gm4020Cm4032 in the 28S rRNAfragment in a blood sample obtained from a patient to a reference methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment.

2. The method of claim 1, wherein the methylation proportion is calculated by dividing thenumber of Gm4020Cm4032 in the 28S rRNA fragment by the total number of the 28SrRNA fragment in the blood sample.

3. The method of claims 1 or 2, wherein the reference methylation proportion is themethylation proportion of Gm4020Cm4032 in the 28S rRNA fragment determined bymeasuring at least one reference blood sample from a healthy subject / subject known tonot suffer from lung cancer.

4. The method of claim 3, wherein the reference methylation proportion is calculated bydividing the number of Gm4020Cm4032 in the 28S rRNA fragment by the total numberof the 28S rRNA fragment in the at least one reference blood sample.

5. The method of claims 3 or 4, wherein an increase of the methylation proportion ofGm4020Cm4032 in the 28S rRNA fragment compared to the reference methylation proportion of Gm4020Cm4032 in the 28S rRNA fragment indicates that the patientsuffers from lung cancer.

6. The method of any one of claims 1 to 5, wherein the 28S rRNA fragment has thefollowing (basic) sequence (irrespective of methylation) from 5’ to 3’: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 1).

7. The method of any one of claims 1 to 6, wherein the methylation proportion ofGm4020Cm4032 in the 28S rRNA fragment is determined by direct RNA sequencing, preferably Oxford Nanopore Technology sequencing, methylation-dependent PCR, mass spectrometry, or any other method designed to detect methylation, preferably 2’- ortho-methylation, in RNA molecules.

8. The method of claim 7, wherein the direct RNA sequencing is carried out on a ligationproduct comprising the 28S rRNA fragment to which a 5’adapter and a 3’adapter is ligated.

9. The method of claim 8, wherein the 3’adapter comprises a top strand and a bottomstrand.

10. The method of claims 8 or 9, wherein the ligation product is obtained by(i) mixing the 28S rRNA fragment in denatured form, the 5’adpater in renaturedform and the 3’adapter in renatured form with each other, thereby annealing the 5’adapter and the 3’adapter to the 28S rRNA fragment, and (ii) ligating the 5’adapter and the 3’adapter to the 28S rRNA fragment using / with adouble stranded RNA ligase, preferably a T4 RNA ligase 2 (Rnl2) or a Kod1 ligase, thereby obtaining the ligation product.

11. The method of any one of claims 8 to 10, wherein the 5’adapter comprises thefollowing sequence from 5’ to 3’: rCrCrGrGrCrGrGrCrCrGrUrGrGrCrGrUrGrGrArGrUrGrUrUrArArUrUrArArUrG rUrGrCrUrUrUrGrCrCrArUrG (SEQ ID NO: 2), wherein “r” stands for ribonucleotide and the ribonucleotides in bold designate the ribonucleotide sequence reverse complementary to the 5’terminal sequence of the 28S rRNA fragment.

12. The method of any one of claims 9 to 11, whereinthe top strand of the double stranded 3’adapter comprises the following sequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGNNNNNNNNNNCTTGCTCTTA GGTAGTAGGTTC (SEQ ID NO: 3), wherein “r” stands for ribonucleotide, “ / 5Phos / ” indicates that the 5’-terminal ribonucleotide is phosphorylated,“rArArArArArArArArArA” stands for a poly(A) segment, and NNNNNNNNNN is anoptional barcode, and the bottom strand of the double stranded 3’adapter comprises the following sequencefrom 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGNNNNNNNNNNCCTTTTTTTT TTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 7), wherein NNNNNNNNNN is anoptional barcode,stands for a poly(T) segment, + denotes that theproceeding base is LNA modified, and deoxynucleotides in bold designate the deoxynucleotide sequence reverse complementary to the 3’terminal sequence of the 28S rRNA fragment.

13. The method of claim 12, wherein(i) the top strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGAAACAAACACCTTGCT CTTAGGTAGTAGGTTC (SEQ ID NO: 4) and the bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGGTGTTTGTTTCCTTTT(ii) the top strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGCTCTTGTGGGCTTGCTC TTAGGTAGTAGGTTC (SEQ ID NO: 5), and the bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGCCCACAAGAGCCTTT TTTTTTTGAGCTAG+TAG+TGG+TAT (SEQ ID NO: 9), or(iii) the top strand of the double stranded 3’adapter comprises the following sequencefrom 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGAGGGCCGATTCTTGCT CTTAGGTAGTAGGTTC (SEQ ID NO: 6), and the bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’:GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAATCGGCCCTCCTTTT(iv) the top strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGGCAACTGTCTCTTGCT CTTAGGTAGTAGGTTC (SEQ ID NO: 14), andthe bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAGACAGTTGCCCTTT(v) the top strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGTGTTTACCGACTTGCT CTTAGGTAGTAGGTTC (SEQ ID NO: 15), andthe bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGTCGGTAAACACCTTT(vi) the top strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: / 5Phos / rUrArGrCrUrCrArArArArArArArArArAGGGCCAGGATACCTTGCT CTTAGGTAGTAGGTTC (SEQ ID NO: 16), and the bottom strand of the double stranded 3’adapter comprises the followingsequence from 5’ to 3’: GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGGTATCCTGGCCCTTTT14. The method of any one of claims 1 to 13, wherein the methylation is a 2'-ortho-methylation.

15. Use of Gm4020Cm4032 methylation in the 28S ribosomal RNA (rRNA) fragment todiagnose lung cancer in a patient / determine whether the patient suffers from lung cancer.

Images