Novel therapeutic drug for treating PROM1-associated retinal disease

Abstract

The present invention provides a novel therapeutic drug for treating a Prom1-associated retinal disease. Specifically, the present invention provides an optimized Prom1 gene expression cassette, an rAAV viral vector, and a gene therapy drug. The drug of the present invention can specifically express the PROM1 protein in the retinal photoreceptor layer, and is suitable for the clinical treatment of a retinal disease associated with Prom1 gene mutation.

Description

Novel therapeutic drug for treating Prom1-related retinal diseases Technical Field

[0001] This invention relates to the field of genetic engineering. Specifically, this invention relates to therapeutic drugs for treating Prom1-related retinal diseases. Background Technology

[0002] Retinitis pigmentosa (RP) is an ophthalmic disease caused by genetic factors that lead to degeneration of rods and cones, primarily manifested as narrowed visual field and pigment stinging in the central retina, ultimately resulting in blindness. To date, mutations in at least 60 genes are presumed to be responsible for RP. RP is a leading genetic cause of adult blindness, with a global prevalence of 1 in 3000 to 1 in 4000. Besides RP, mutations in these genes can also cause Stargardt's disease, Cone dystrophy (CORD), macular degeneration, Leber congenital amaurosis (LCA), and macular dystrophy. The proteins encoded by these genes are largely related to the maintenance of retinal cone and rod cell function.

[0003] The Prominin-1 gene (Prom1) is primarily expressed at the plasma membrane processes of rod and cone cells in the retinal photoreceptor and is crucial for maintaining photoreceptor structural assembly. Located on chromosome 4p15.32, the Prom1 gene encodes a five-transmembrane glycoprotein with two short N-(extracellular) and C-(cytoplasmic) terminals, and two large extracellular loops (ECLs) containing N-glycosylation sites. Glycosylation plays a vital role in the transmembrane activity of the Prom1 protein and its distribution in retinal photoreceptor cells.

[0004] The vast majority of Prom1 gene mutations are located in the ECL region, exhibiting recessive mutations that lead to severe retinal degenerative diseases such as rod dystrophy, macular dystrophy, or retinitis pigmentosa. Due to its significant genetic heterogeneity and complex pathogenic mechanisms, current treatment options for this disease are very limited. In patients with Prom1 gene mutations, the vast majority of PROM1 protein functions are lost or nearly ineffective, which may be a potential target for developing gene therapy drugs delivered via adeno-associated virus (AAV) vectors. Summary of the Invention

[0005] The purpose of this invention is to provide a novel therapeutic drug for treating Prom1-related retinal diseases.

[0006] In a first aspect of the invention, an expression box is provided, the expression box having a structure of Formula I from the 5'-3' end: Z1-Z2-Z3-Z4-Z5 (I)

[0007] In the formula, each "-" represents an independent bond or nucleotide linkage sequence;

[0008] Z1 is either absent or an enhancer;

[0009] Z2 is the RK1 promoter;

[0010] Z3 is either empty or contains an intron;

[0011] Z4 is the nucleotide sequence encoding the PROM1 protein; and

[0012] Z5 is either none or polyA.

[0013] In another preferred embodiment, the nucleotide sequence encoding the PROM1 protein is a wild-type sequence or a codon-optimized sequence.

[0014] In another preferred embodiment, the nucleotide sequence encoding the PROM1 protein is selected from the group consisting of:

[0015] (a) The nucleotide sequence is shown in SEQ ID NO:3; and

[0016] (b) The nucleotide sequence has ≥95% identity with the nucleotide sequence shown in SEQ ID NO:3, preferably ≥98%, more preferably ≥99%;

[0017] (c) A nucleotide sequence complementary to the nucleotide sequence described in (a) or (b).

[0018] In another preferred embodiment, the nucleotide sequence includes a DNA sequence, a cDNA sequence, or an mRNA sequence.

[0019] In another preferred embodiment, the enhancer is an IRBP enhancer, preferably an hIRBP enhancer.

[0020] In another preferred embodiment, the intron is the SV40 intron.

[0021] In another preferred embodiment, the polyA is hGH polyA.

[0022] In another preferred embodiment, the length of each nucleotide linker sequence is 0-30 nt, preferably 1-15 nt.

[0023] In a second aspect of the invention, a carrier is provided, the carrier comprising an expression cassette as described in the first aspect of the invention.

[0024] In another preferred embodiment, the vector comprises one or more promoters operatively linked to the nucleic acid sequence, enhancer, intron, transcription termination signal, polyadenylation sequence, origin of replication, selectivity marker, nucleic acid restriction site, and / or homologous recombination site.

[0025] In another preferred embodiment, the vector includes plasmids and viral vectors.

[0026] In another preferred embodiment, the vector is selected from the group consisting of lentiviral vectors, adenovirus vectors, adeno-associated virus vectors (AAV), or combinations thereof.

[0027] In another preferred embodiment, the carrier is an AAV carrier.

[0028] In another preferred embodiment, the carrier is an AAV carrier into which an expression cassette as described in the first aspect of the invention is inserted.

[0029] In another preferred embodiment, the vector is used to express human PROM1 protein.

[0030] In another preferred embodiment, the carrier is used to improve retinal visual function, the thickness of the retinal nuclear layer and photoreceptor layer, and / or labeling molecule misalignment.

[0031] In a third aspect of the invention, an adeno-associated virus vector is provided, the adeno-associated virus vector containing an expression cassette as described in the first aspect of the invention.

[0032] In another preferred embodiment, the serotype of the AAV is selected from: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, rh10, RC-C14, RC-C07v5, or mutants thereof, or combinations thereof.

[0033] In another preferred embodiment, the adeno-associated virus vector is used to treat eye diseases and / or restore the subject's vision or light sensitivity.

[0034] In another preferred embodiment, the carrier is used to improve retinal visual function, the thickness of the retinal nuclear layer and photoreceptor layer, and / or labeling molecule misalignment.

[0035] In another preferred embodiment, the sequence of the adeno-associated virus vector is shown in SEQ ID NO:4.

[0036] In a fourth aspect of the invention, a host cell is provided, the host cell containing the vector described in the second aspect of the invention or the adeno-associated virus vector described in the third aspect of the invention, or having an exogenous expression cassette described in the first aspect of the invention integrated into its chromosome.

[0037] In another preferred embodiment, the host cell is a mammalian cell, and the mammal includes humans and non-human mammals.

[0038] In another preferred embodiment, the host cell is selected from the group consisting of HEK cells, photoreceptor cells (including cone cells and / or rod cells), other visual cells (such as bipolar cells, horizontal cells), (optic) nerve cells, or combinations thereof.

[0039] In another preferred embodiment, the host cell is selected from the group consisting of rod cells, cone cells, light-emitting bipolar cells, light-removing bipolar cells, horizontal cells, ganglion cells, cells without long processes, or combinations thereof.

[0040] In another preferred embodiment, the host cell is a photoreceptor cell (i.e., a photoreceptor cell).

[0041] In a fifth aspect of the invention, the use of a vector as described in the second aspect of the invention or an adeno-associated virus vector as described in the third aspect of the invention in the preparation of formulations or compositions for treating eye diseases and / or restoring visual acuity or photosensitivity in a subject is provided.

[0042] In another preferred embodiment, the eye disease is an eye disease related to a Prom1 gene mutation.

[0043] In another preferred embodiment, the Prom1 gene mutation is a recessive mutation of the Prom1 gene, that is, a bis-allelic mutation of the Prom1 gene on chromosomes.

[0044] In another preferred embodiment, the eye disease is selected from the group consisting of: retinitis pigmentosa, macular dystrophy, cone-rod dystrophy, or other photoreceptor diseases caused by recessive Prom1 mutations.

[0045] In another preferred embodiment, the pharmaceutical preparation is used to improve or restore the function of photoreceptor cells in the retina, restore the subject's vision (or light sensitivity), and / or treat retinal degenerative diseases.

[0046] In a sixth aspect of the invention, a pharmaceutical formulation is provided, the formulation comprising (a) a carrier as described in the second aspect of the invention or an adeno-associated virus carrier as described in the third aspect of the invention, and (b) a pharmaceutically acceptable carrier or excipient.

[0047] In another preferred embodiment, the dosage form of the pharmaceutical preparation is selected from the group consisting of lyophilized preparations, liquid preparations, or combinations thereof.

[0048] In another preferred embodiment, the carrier content in the pharmaceutical preparation is 1 × 10⁻⁶. 9 -1×10 16 virus / mL, preferably 1×10 12-1×10 13 One virus per milliliter.

[0049] In another preferred embodiment, the pharmaceutical preparation is used to treat eye diseases and / or restore the subject's vision or light sensitivity.

[0050] In another preferred embodiment, the eye disease is an eye disease related to a Prom1 gene mutation.

[0051] In another preferred embodiment, the Prom1 gene mutation is a recessive mutation of the Prom1 gene, that is, a bis-allelic mutation of the Prom1 gene on chromosomes.

[0052] In another preferred embodiment, the eye disease is selected from the group consisting of: retinitis pigmentosa, macular dystrophy, cone-rod dystrophy, or other photoreceptor diseases caused by recessive Prom1 mutations.

[0053] In another preferred embodiment, the pharmaceutical preparation is used to improve or restore the function of photoreceptor cells in the retina, restore the subject's vision (or light sensitivity), and / or treat retinal degenerative diseases.

[0054] In a seventh aspect of the invention, a treatment method is provided, the method comprising applying a vector described in the second aspect of the invention or an adeno-associated virus vector described in the third aspect of the invention to a desired object.

[0055] In another preferred embodiment, the adeno-associated virus vector is introduced into the eye of the desired subject.

[0056] In another preferred embodiment, the required objects include humans and non-human mammals.

[0057] In another preferred embodiment, the treatment method is a method for treating an eye disease.

[0058] In another preferred embodiment, the eye disease is an eye disease related to a Prom1 gene mutation.

[0059] In another preferred embodiment, the Prom1 gene mutation is a recessive mutation of the Prom1 gene, that is, a bis-allelic mutation of the Prom1 gene on chromosomes.

[0060] In another preferred embodiment, the eye disease is selected from the group consisting of: retinitis pigmentosa, macular dystrophy, cone-rod dystrophy, or other photoreceptor diseases caused by recessive Prom1 mutations.

[0061] In another preferred embodiment, the method is used to improve or restore the function of photoreceptor cells in the retina, restore the subject's vision (or light sensitivity), and / or treat retinal degenerative diseases.

[0062] In an eighth aspect of the invention, a method for preparing PROM1 protein is provided, comprising culturing the host cells described in the fourth aspect of the invention to obtain PROM1 protein.

[0063] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0064] The following figures are used to illustrate specific embodiments of the present invention and are not intended to limit the scope of the invention as defined by the claims.

[0065] Figure 1 shows the rAAV / RK1-Prom1 viral expression vector.

[0066] Figure 2 shows the results of in vitro detection of rAAV / RK1-Prom1 viral vector expression.

[0067] Figure 3 shows the results of in vivo detection of the expression distribution of the rAAV / RK1-Prom1 viral vector.

[0068] Figure 4 shows the results of immunofluorescence staining of sections showing changes in retinal thickness before and after viral injection in Prom1 KO mice.

[0069] Figure 5 shows the results of detecting changes in retinal visual function in Prom1 KO mice before and after viral injection.

[0070] Figure 6 shows the results of the detection of improved opsin translocation, a marker molecule for retinal photoreceptors, before and after viral injection in Prom1 KO mice. Detailed Implementation

[0071] Through extensive and in-depth research, the inventors have developed a novel therapeutic drug for treating Prom1-related retinal diseases. This invention utilizes cDNA amplification of the Prom1 gene from human retinal organoid RNA reverse transcription, and constructs an rAAV viral expression vector in vitro for specific expression of the human Prom1 gene. Using an in vitro model of a human retinal Prom1 gene knockout organoid, the rAAV viral vector was confirmed to express human PROM1 protein normally, indicating that the rAAV viral vector possesses expression activity. In a Prom1 gene knockout mouse model, the rAAV viral vector driven by the specific promoter RK1 specifically expresses PROM1 protein in the retinal photoreceptor layer, with an expression distribution trend consistent with that of wild-type mouse retina, and significantly improves retinal visual function, retinal nuclear layer and photoreceptor layer thickness, and marker molecule misalignment. The rAAV viral vector in this invention is a novel therapeutic vector more suitable for clinical use. Based on this, the invention was completed.

[0072] the term

[0073] To facilitate a clearer understanding of this disclosure, certain terms are first defined. As used herein, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below. Other definitions are set forth throughout the application.

[0074] The term “about” can refer to a value or composition within an acceptable margin of error for a particular value or composition as determined by a person skilled in the art, depending in part on how the value or composition is measured or determined. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0075] As used herein, the terms “containing” or “including (comprise)” can be open-ended, semi-closed, or closed. In other words, the terms also include “consistently made of” or “composed of”.

[0076] Sequence identity is determined by comparing two aligned sequences along a predetermined comparison window (which may be 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the length of a reference nucleotide sequence or a protein) and determining the number of positions where identical residues occur. This is typically expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0077] As used herein, the terms “subject” and “required subject” refer to any mammal or non-mammal. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, cattle, horses, dogs, cats, pigs, sheep, and goats.

[0078] As used herein, the terms “photoreceptor,” “photoreceptor cell,” and “photoreceptor cell” are used interchangeably and include rod cells and cone cells.

[0079] PROM1

[0080] As used herein, the terms “PROM1 protein,” “inventory protein,” and “human PROM1 protein” have the same meaning and may be used interchangeably throughout this document.

[0081] The protein encoded by the Prom1 gene (PROM1 protein) is a transmembrane glycoprotein that has long been used as a biomarker for hematopoietic stem cells. It is expressed in many tissues of the body. In the retina, its encoded protein is located at the base of the outer segment of photoreceptor cells and connects to cilia, playing a crucial role in the formation of the outer segment membrane disc. Previous studies have shown that Prom1 gene knockout mice exhibit disease manifestations similar to RP, while mutant PROM1 gene knock-in mice show abnormal development of the outer segment membrane disc of photoreceptor cells.

[0082] PROM1 Expression Box

[0083] This invention provides an expression cassette for the specific expression of the PROM1 protein, which contains a nucleotide sequence encoding the PROM1 protein. The expression cassette of this invention is driven by a specific promoter, RK1, and can specifically express the PROM1 protein in the photoreceptor layer of the retina.

[0084] The nucleic acid encoding the PROM1 protein described in this invention has the nucleotide sequence shown in SEQ ID NO:3. In another preferred embodiment, the nucleotide sequence has ≥95% identity with the nucleotide sequence shown in SEQ ID NO:3, preferably ≥98%, and more preferably ≥99%.

[0085] The PROM1 coding sequence can be found in the Prom1 genome sequence NCBI Reference Sequence: NG_011696.2.

[0086] The nucleic acid sequence can be DNA, RNA, cDNA, or PNA. The nucleic acid sequence can be genomic, recombinant, or synthetic. The nucleic acid sequence can be isolated or purified. The nucleic acid sequence can be single-stranded or double-stranded. Preferably, the nucleic acid sequence will encode the PROM1 protein as described herein. The nucleic acid sequence can be cloned, for example using standard molecular cloning techniques including restriction enzyme digestion, ligation, and gel electrophoresis, as described in Sambrook et al. (Molecular Cloning: A laboratory manual, Cold Spring Harbour Laboratory Press). The nucleic acid sequence can be isolated, for example using PCR techniques. Isolation means separating the nucleic acid sequence from any impurities and from other nucleic acid sequences and / or proteins that are naturally found to associate with nucleic acid sequences in their source. Preferably, it will also be free of cell material, culture medium, or other chemicals from the purification / production process. The nucleic acid sequence can be synthetic, for example, produced by direct chemical synthesis. The nucleic acid sequence can be provided as naked nucleic acid or can be provided in combination with a protein or lipid.

[0087] The full-length nucleotide sequence or fragment thereof of the present invention can generally be obtained by PCR amplification, recombinant methods, or artificial synthesis. For PCR amplification, primers can be designed based on publicly available nucleotide sequences, especially open reading frame sequences, and the relevant sequence can be amplified using a commercially available cDNA library or a cDNA library prepared according to conventional methods known to those skilled in the art. When the sequence is long, two or more PCR amplifications are often required, and then the fragments amplified from each amplification are spliced ​​together in the correct order. Currently, the DNA sequence encoding the polypeptide (or its fragment, or its derivative) of the present invention can be obtained entirely through chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art.

[0088] This invention also relates to vectors containing the polynucleotides of this invention, and host cells genetically engineered using the vectors or polypeptide coding sequences of this invention. The polynucleotides, vectors, or host cells described above can be isolated.

[0089] As used in this article, "isolated" means that a substance has been separated from its original environment (in the case of a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state within living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances present in their natural state.

[0090] Once the relevant sequence is obtained, it can be obtained in large quantities using recombination methods. This typically involves cloning it into a vector, transferring it into cells, and then isolating the sequence from the proliferated host cells using conventional methods.

[0091] In addition, sequences can be synthesized artificially, especially when the fragment length is short. Typically, long sequences can be obtained by first synthesizing multiple small fragments and then joining them.

[0092] The method of amplifying DNA / RNA using PCR technology is preferred for obtaining the gene of the present invention. Primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and can be synthesized using conventional methods. The amplified DNA / RNA fragments can be separated and purified using conventional methods such as gel electrophoresis.

[0093] Adeno-associated virus

[0094] Because adeno-associated virus (AAV) is smaller than other viral vectors, is non-pathogenic, and can transfect both dividing and non-dividing cells, gene therapy based on AAV vectors targeting ocular diseases, especially hereditary retinal degeneration, has received widespread attention.

[0095] Adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus *Dependent Virus* of the family Parvoviridae. It is currently the simplest single-stranded DNA-deficient virus discovered, requiring a helper virus (usually adenovirus) to participate in replication. It encodes the cap and rep genes in two terminal inverted repeat sequences (ITRs). ITRs play a crucial role in viral replication and packaging. The cap gene encodes the viral capsid protein, and the rep gene is involved in viral replication and integration. AAV can infect a variety of cell types.

[0096] Recombinant adeno-associated virus (rAAV) vectors, derived from non-pathogenic wild-type adeno-associated virus (AAV), are considered one of the most promising gene transfer vectors due to their good safety profile, broad host cell range (dividing and non-dividing cells), low immunogenicity, and long in vivo expression time of exogenous genes. They are widely used in gene therapy and vaccine research worldwide. After more than 10 years of research, the biological characteristics of recombinant AAV have been thoroughly understood, especially regarding their effectiveness in various cell, tissue, and in vivo experiments, for which a wealth of data has been accumulated. In medical research, rAAV is used for gene therapy research on various diseases (including in vivo and in vitro experiments); simultaneously, as a distinctive gene transfer vector, it is also widely used in gene function research, disease model construction, and gene knockout mouse development.

[0097] In a preferred embodiment of the invention, the vector is a recombinant AAV vector. AAVs are relatively small DNA viruses that can stably and site-specifically integrate into the genome of the cells they infect. They can infect a wide range of cells without affecting cell growth, morphology, or differentiation, and they do not appear to be involved in human pathology. The AAV genome has been cloned, sequenced, and characterized. Each AAV contains an inverted terminal repeat (ITR) region of approximately 145 bases at each end, which serves as the origin of viral replication. The remainder of the genome is divided into two important regions with capsid functions: the left portion of the genome containing the rep gene, which is involved in viral replication and viral gene expression; and the right portion of the genome containing the cap gene, which encodes viral capsid proteins.

[0098] AAV vectors can be prepared using standard methods in the art. Any serotype of adeno-associated virus is suitable. Methods for purifying vectors can be found, for example, in U.S. Patent Nos. 6,566,118, 6,989,264, and 6,995,006, the disclosures of which are incorporated herein by reference in their entirety. The preparation of heterozygous vectors is described, for example, in PCT application No. PCT / US2005 / 027091, the disclosures of which are incorporated herein by reference in their entirety. The use of AAV-derived vectors for in vitro and in vivo gene transfer has been described (see, for example, International Patent Application Publications Nos. WO91 / 18088 and WO93 / 09239; U.S. Patent Nos. 4,797,368, 6,596,535, and 5,139,941; and European Patent No. 0488528, all of which are incorporated herein by reference in their entirety). These patent publications describe various AAV-derived constructs in which the rep and / or cap genes are deleted and replaced with the genes of interest, and the uses of these constructs for transporting the genes of interest in vitro (into cultured cells) or in vivo (directly into the organism). Replication-deficient recombinant AAV can be prepared by co-transfecting a plasmid containing two AAV inverted terminal repeat (ITR) regions flanking the nucleic acid sequence of interest, and a plasmid carrying the AAV capsidation genes (rep and cap genes). The resulting AAV recombinants are then purified using standard techniques.

[0099] In some embodiments, the recombinant vector is capsidated into the viral particles. The AAV vectors suitable for use in this invention can be natural serotypes or mutants. Examples of natural AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and rh10. Examples of mutant serotypes include, but are not limited to, RC-C14 (ref. patent application number CN 202310084749.8) and RC-C07v5 (ref. publication number CN117247434A). This disclosure includes recombinant viral particles containing any of the vectors described herein (recombinant because they contain recombinant polynucleotides). Methods for producing such particles are known in the art and are described in U.S. Patent No. 6,596,535.

[0100] Expression vectors and host cells

[0101] The present invention also provides an expression vector for the PROM1 protein, which contains the PROM1 protein expression cassette of the present invention.

[0102] With the provided sequence information, skilled technicians can use available cloning techniques to generate nucleic acid sequences or vectors suitable for transduction into cells.

[0103] The expression vector for the PROM1 protein of the present invention can be provided as a gene therapy vector preferably suitable for transduction and expression in retinal target cells. The vector can be viral or non-viral (e.g., plasmid). Viral vectors include those derived from: adenovirus, including mutant forms of adeno-associated virus (AAV), retrovirus, lentivirus, herpesvirus, vaccinia virus, MMLV, GaLV, simian immunodeficiency virus (SIV), HIV, poxvirus, and SV40. Preferably, the viral vector is replication-defective, although it is envisioned to be replication-deficient, capable of replication, or conditionally replicating. The viral vector can generally remain in an extrachromosomal state without integrating into the genome of the target retinal cells. Preferred viral vectors for introducing the nucleic acid sequence encoding the PROM1 protein into retinal target cells are AAV vectors, such as self-complementary adeno-associated virus (scAAV). Selective targeting can be achieved using specific AAV serotypes (AAV serotypes 2 to 12) or modified versions of any of these serotypes (including AAV 4YF and AAV 7m8 vectors).

[0104] Viral vectors can be modified to delete any non-essential sequences. For example, in AAV, the virus can be modified to delete all or part of the IX gene, Ela, and / or Elb gene. For wild-type AAV, the absence of helper viruses such as adenovirus makes replication very inefficient. For recombinant adeno-associated viruses, preferably, the replication gene and capsid gene are provided in trans form (in the pRep / Cap plasmid), and only the 2ITRs of the AAV genome are preserved and packaged into the virion, while the required adenovirus genes are provided by adenovirus or another plasmid. Similar modifications can be made to lentiviral vectors.

[0105] Viral vectors have the ability to enter cells. However, non-viral vectors such as plasmids can be conjugated with agents to facilitate the uptake of viral vectors by target cells. Such agents include polycationic agents. Alternatively, delivery systems such as liposome-based delivery systems may be used. The vectors used in this invention are preferably adapted for in vivo or in vitro use, and are preferably adapted for human use.

[0106] The vector will preferably contain one or more regulatory sequences to guide the expression of the nucleic acid sequence in retinal target cells. The regulatory sequences may include promoters, introns, enhancers, transcription termination signals, polyadenylation sequences, origins of replication, nucleic acid restriction sites, and homologous recombination sites operatively linked to the nucleic acid sequence. The vector may also include selective markers, for example, to determine the expression of the vector in a growth system (e.g., bacterial cells) or in retinal target cells.

[0107] "Operationally linked" means that nucleic acid sequences are functionally related to their operationally linked sequences such that they are linked in a way that causes them to affect each other's expression or function. For example, a nucleic acid sequence operationally linked to a promoter will have an expression pattern influenced by the promoter.

[0108] Many expression vectors can be used to express the PROM1 protein in mammalian cells (preferably human, more preferably human optic nerve cells or photoreceptor cells). This invention preferably uses adeno-associated virus as the expression vector.

[0109] This invention also provides a host cell for expressing the PROM1 protein. The host cell can be a prokaryotic cell, a lower eukaryotic cell, or a higher eukaryotic cell, such as mammalian cells (including human and non-human mammals). Representative examples include animal cells such as CHO, NSO, COS7, or 293 cells. In a preferred embodiment of this invention, 293T cells, photoreceptor cells (including cone cells and / or rod cells), other visual cells (such as biganglionic cells), and nerve cells are selected as host cells. In another preferred embodiment, the host cell is selected from the group consisting of: rod cells, cone cells, light-emitting bipolar cells, light-removing bipolar cells, horizontal cells, ganglion cells, cells without long processes, or combinations thereof. Preferably, the host cell is a mammalian cell (preferably human, more preferably human optic nerve cells or photoreceptor cells).

[0110] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as *E. coli*, competent cells capable of uptake DNA can be harvested after the exponential growth phase and treated with CaCl2, the steps of which are well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0111] The obtained transformants can be cultured using conventional methods to express the protein encoded by the gene of this invention. Depending on the host cells used, the culture medium can be selected from various conventional media. Culture is carried out under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature adjustment or chemical induction), and the cells are cultured for a further period.

[0112] The peptides used in the methods described above can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If desired, proteins can be separated and purified using various separation methods based on their physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional refolding treatment, treatment with protein precipitants (salting out), centrifugation, permeation, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques, as well as combinations of these methods.

[0113] Formulations and Compositions

[0114] The present invention provides a formulation or composition comprising (a) a carrier as described in the second aspect of the present invention or an adeno-associated virus carrier as described in the third aspect of the present invention, and (b) a pharmaceutically acceptable carrier or excipient.

[0115] In another preferred embodiment, the pharmaceutical preparation is used to treat an eye disease caused by a mutation in the Prom1 gene.

[0116] In another preferred embodiment, the pharmaceutical preparation is used to treat retinitis pigmentosa (RP), preferably retinitis pigmentosa caused by a mutation in the Prom1 gene.

[0117] In this invention, the "active ingredient" in the pharmaceutical composition refers to the vector described herein, such as a viral vector (including adeno-associated virus vectors). The "active ingredient," formulation, and / or composition described herein can be used to treat eye diseases. "Safe and effective amount" means that the amount of the active ingredient is sufficient to significantly improve the condition or symptoms without causing serious side effects. "Pharmaceutically acceptable carrier or excipient" refers to one or more compatible solid or liquid fillers or gel substances suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here refers to the ability of the components in the composition to interact with and incorporate with the active ingredient of this invention without significantly reducing the efficacy of the active ingredient.

[0118] The composition can be liquid or solid, such as powder, gel, or paste. Preferably, the composition is liquid, and more preferably, an injectable liquid. Suitable excipients will be known to those skilled in the art.

[0119] In this invention, the carrier can be administered to the eye via subretinal or intravitreal application. In either administration mode, preferably, the carrier is provided as an injectable liquid. Preferably, the injectable liquid is provided as a capsule or syringe.

[0120] Pharmaceutically acceptable examples of carrier components include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), and emulsifiers (such as Tween). Wetting agents (such as sodium dodecyl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0121] The composition may comprise physiologically acceptable sterile aqueous or anhydrous water, dispersion, suspension, or emulsion, and sterile powder for reconstitution into a sterile injectable solution or dispersion. Suitable aqueous and non-aqueous carriers, diluents, solvents, or excipients include water, ethanol, polyols, and suitable mixtures thereof.

[0122] The expression cassette or vector for expressing PROM1 protein provided by this invention can produce PROM1 protein in vitro or in vivo, and formulations containing the PROM1 expression cassette or vector can be used to prepare drugs for treating eye diseases.

[0123] Treatment

[0124] This invention provides a method for delivering photoreceptor cell function to cells, the method comprising introducing a vector containing a sequence encoding the PROM1 protein into the eye. The method may include administering the nucleic acid vector subretinally or intravitreal to the inner retinal cells of the eye.

[0125] This invention provides a PROM1 protein expression vector for use in a method of treating retinal degeneration by providing photoreceptor cell function to cells. The compositions of this invention can be administered alone or in combination with other therapeutic agents (e.g., formulated in the same pharmaceutical composition).

[0126] This invention also provides a method for enhancing the function of photoreceptor cells in the retina, particularly a method for enhancing the function of photoreceptor cells in the retina after degeneration of rods and / or cones, the method comprising introducing a PROM1 protein expression vector into the vitreous cavity of the eye. The method may include administering a nucleic acid vector to the inner retinal cells, subretinal, or vitreous body of the eye. This invention provides a PROM1 protein expression vector for use in the treatment of retinal degeneration by enhancing the function of photoreceptor cells in the retina.

[0127] This invention also provides a method for restoring vision in a subject, the method comprising introducing a PROM1 protein expression vector into the eye. The method may include administering the nucleic acid vector subretinally or intravitreal to the inner retinal cells of the eye. This invention provides a PROM1 protein expression vector for use in restoring vision in a subject.

[0128] The present invention also provides a method for treating retinal diseases in a subject, the method comprising introducing a PROM1 protein expression vector into the eye. The method may include administering the nucleic acid vector subretinally or intravitreal to the inner retinal cells of the eye. Diseases may be retinal dystrophy, including rod dystrophy, rod-cone dystrophy, cone-rod dystrophy, cone dystrophy, and macular dystrophy; other forms of retinal or macular degeneration, ischemic conditions, retinitis pigmentosa, uveitis, and any other disease resulting from loss of photoreceptor function.

[0129] As used herein, providing photoreceptor function to cells means that cells that previously lacked photoreceptor capacity or whose photoreceptor capacity had completely or partially degenerated become photosensitive after expressing a foreign nucleic acid sequence encoding the PROM1 protein. Such cells may be referred to herein as transformed cells because they contain non-natural nucleic acids. Preferably, the transformed retinal cells exhibit some or all of the photoreceptor capacity of natural photoreceptor cells. Preferably, the transformed cells exhibit at least the same or substantially the same photoreceptor capacity as natural retinal photoreceptor cells. Preferably, the transformed cells exhibit a higher photoreceptor capacity than diseased or degenerating natural retinal photoreceptor cells. Therefore, transformed cells will preferably have an increased number of photoreceptor cells compared to untreated degenerated or diseased cells from the same source, maintained under the same conditions. Transformed cells can be distinguished from natural cells by the presence of foreign nucleic acids therein.

[0130] As used herein, enhancing photoreceptor function means increasing the photoreceptor function of the retina by enhancing the function of photoreceptor cells such as rods or cones and / or by providing photoreceptor function to cells. Therefore, the retina, compared to a retina not treated as described herein, will have an increased ability to receive and transmit light signals, the increase being of any amount.

[0131] As used herein, restored vision in a subject means that the subject shows improved vision compared to before treatment, for example, using a vision test as described herein. Restoration includes any degree of improvement, ranging from complete restoration of vision to perfect or near-perfect vision.

[0132] As used herein, treating a disease means administering a nucleic acid or vector as described herein to improve or alleviate one or more symptoms of a disease selected from the group consisting of: retinal dystrophy, including rod dystrophy, rod-cone dystrophy, cone-rod dystrophy, cone dystrophy, and macular dystrophy; another form of retinal or macular degeneration, retinitis pigmentosa, ischemic conditions, uveitis, and any other disease resulting from the loss of photoreceptor capacity. Improvement or alleviation may result in improvement of peripheral or central vision, and / or daytime or nighttime vision.

[0133] The method of the present invention includes introducing a nucleic acid sequence encoding the PROM1 protein into the vitreous cavity of the eye. Preferably, the method includes contacting cells with a vector (preferably a virus, more preferably adeno-associated virus) containing the nucleic acid sequence encoding the PROM1 protein. Preferably, the cells are retinal cells, preferably cone cells, rod cells, photosensitive bipolar cells, photosensitive bipolar cells, horizontal cells, ganglion cells, and / or cells without long processes.

[0134] When nucleic acid sequences and one or more enzymes are provided in multiple (two or more) doses, these doses can be spaced out at appropriate time intervals, such as from 30 seconds to several hours or one day or more.

[0135] Each dose may contain an effective amount of nucleic acid sequence or viral vector. The effective dose of nucleic acid sequence or viral vector can be 1 × 10⁻⁶ per treatment regimen. 9 -1×10 16 The scope of the virus.

[0136] This invention compensates for the degeneration of photoreceptor cells in the retina by delivering a PROM1 protein expression vector to retinal cells. The cells to which the nucleic acid sequence is targeted are retinal cells that are alive and capable of expressing the foreign nucleic acid sequence. Retinal cells are cells of the retina that are nerve or neuronal cells and are capable of becoming excited and transmitting electrical signals. Preferably, the target retinal cells will be capable of generating electrical signals and initiating signal cascades, resulting in signal transmission to the optic nerve. Preferably, the target retinal cells are cells of the inner retina. Target cells can be rod or cone cells, and / or can be non-photoreceptor cells (i.e., retinal cells that are not light-responsive in their natural form). Target retinal cells can include one or more cell types selected from the group consisting of: rod cells, cone cells, light-emitting bipolar cells, light-removing bipolar cells, horizontal cells, ganglion cells, Miller cells, and / or cells without long processes.

[0137] Therefore, when the target retinal cells are light-emitting bipolar cells, light-reducing bipolar cells, horizontal cells, ganglion cells, and / or cells without long processes targeting the retina, the expression of nucleic acid encoding the PROM1 protein can be termed ectopic expression. Therefore, this invention includes, within its scope, a method for ectopically expressing a nucleic acid sequence encoding the PROM1 protein in non-photoreceptor cells. Such ectopic expression, through the expression of heterologous PROM1 protein therein, has the function of providing photoreceptor cell function to the cells. This is used to increase the photosensitivity observed in degenerating retina.

[0138] Horizontal cells are inner retinal cells that participate in signal processing and feedback to photoreceptor cells; bipolar cells are inner retinal cells and communicate between rod / cone cells and amacrine and / or ganglion cells; amacrine cells are found in the inner retina and allow communication between photoreceptor cells and ganglion cells; ganglion cells are the innermost retinal cells that transmit signals from photoreceptor cells to the optic nerve.

[0139] References to cells herein include cell progeny. Preferably, the modification of cells according to the invention also occurs in subsequent generations of the transformed host cells. Progeny cells may not be identical to the original target cells, but preferably will also exhibit expression of the non-natural PROM1 protein.

[0140] The main advantages of this invention include:

[0141] 1) The expression cassette of the present invention uses a specific RK1 promoter to compensate for the lack of specificity in the distribution of existing therapeutic vectors.

[0142] 2) The expression cassette of the present invention uses the RK1 promoter combined with a specific intron (such as the SV40 intron selected in the present invention) to efficiently express the natural PROM1 protein. The expression intensity and distribution range are better than those of existing technology vectors (such as CN111118016 B). It is also more effective than existing technology vectors in improving retinal thickness degeneration.

[0143] 3) Compared with the prior art, the present invention provides a recombinant rAAV viral vector that can specifically and exclusively express normal human PROM1 protein in retinal photoreceptor cells without codon optimization; the expression cassette of the present invention can be widely used in various AAV vectors, including RC-C14, RC-C07v5 and rAAV2.

[0144] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0145] I. Implementation Materials

[0146] (1) In this embodiment, the restriction endonuclease and buffer required for vector construction were purchased from NEB, the PCR enzyme was purchased from TOYOBO, the RNA reverse transcription kit was purchased from Tiangen, and the vector cloning seamless ligase 2XMUL homologous recombinase was purchased from NEB.

[0147] (2) In this embodiment, the nuclear dye 4',6-diamidinyl-2-phenylindole (DAPI, 40728ES03) for immunofluorescence staining was purchased from Yisheng Biotechnology, 1X phosphate-buffered saline PBS (B320KJ) was purchased from Shanghai Yuanpei Biotechnology, the immunohistochemistry pen (BC004) was purchased from Baisha Biotechnology, the Prom1 immunofluorescence detection antibody was purchased from Abcam, the Rhodopsin antibody was purchased from Abcam, and the Opsin antibody was purchased from Merck.

[0148] II. Experimental Methods

[0149] (I) Obtaining the Prom1 gene based on human retinal organoids

[0150] This invention selects RNA from human retinal organoids as an amplification template and reverse transcribes the RNA into cDNA using a reverse transcription kit. The Prom1 gene is amplified according to the Prom1 genome sequence NCBI Reference Sequence: NG_011696.2: forward primer: ATGGCCCTCGTACTCG (SEQ ID NO: 1);

[0151] Reverse primer: TCATGTTGTGATGG (SEQ ID NO:2)

[0152] (II) Construction of Prom1 gene expression vector

[0153] The amplification product from method (I) was cloned into the target vector. The ligation product was transformed into competent E. coli cells (Stable3) and plated. Positive colonies were identified by PCR, and sequencing by Shanghai Platinum Biotech Co., Ltd. confirmed that the vector rAAV / RK1-Prom1 was successfully ligated. A schematic diagram of the vector is shown in Figure 1.

[0154] (III) rAAV virus packaging

[0155] The rAAV / RK1-Prom1 viral expression vector carrying the Prom1 gene expression cassette, the viral rep and cap(RC) expression plasmids, and the viral packaging helper plasmid were co-transfected into human embryonic kidney-derived HEK-293T cells. After 72 hours, the cells and supernatant were collected. Lysis buffer and totipotent enzyme were added to the cells and supernatant to remove the host cell genome and residual plasmids. The cells were centrifuged horizontally at 4000 rpm for 15 min to obtain crude virus. The crude virus was then subjected to iodixanol sedimentation ultracentrifugation to obtain purified rAAV virus, which was subsequently titered.

[0156] (iv) In vitro detection of rAAV / RK1-Prom1 viral vector expression

[0157] Prom1 gene knockout (Prom1 KO RO) human retinal organoids were selected as in vitro testing models. The organoid preparation method was as follows:

[0158] 1. Electroporation of Cas9 protein and sgRNA targeting the Prom1 gene

[0159] Based on a cell number of 1 x 10 6H9 cells were used to prepare a suspension. Then, 5 μg of Cas9 protein and 100 pmol of sgRNA were electroporated (520 V, Celestix#EX+) into the cell suspension and placed in a 37°C cell culture incubator, during which the cell state was continuously observed. sgRNA targeting fragment: gctgaatagcaaccctgaac (SEQ ID NO:5)

[0160] 2. Single-cell clonal culture

[0161] The electroporated cells were dissociated into single-cell suspensions and flow-sorted into 96-well plates, one cell per well. Once the single cells had grown into cell clones, each clone was passaged, and a subset of cells was taken for genotyping.

[0162] 3. Differentiation of human retinal organoids

[0163] Wild-type H9 cells and Prom1 gene homozygous knockout H9 cells (KO-H9) were used for retinal organoid differentiation. The differentiation steps are as follows:

[0164] 3.1. (D0) Human embryonic stem cell line H9 cells were added to Gentle Cell Dissociation Reagent, digested at 37°C for 6-8 min, and embryoid bodies (EB) were established in ultra-low adsorption 6-well plates.

[0165] 3.2. (D1-D5) Change the medium every 2 days, using 5 ml of NIM medium (DMEM / F12+1xN2+MEM-NEAA+Heparin) per well.

[0166] 3.3. (D7~) Transfer EBs from the low-adsorption plate to the Matrigel Coat 6-well plate using a Pasteur pipette. Perform NIM half-changes on D9, D12, and D15 respectively. From D16 to D25, change the medium every 2 days with 3:1 Medium (DMEM / F12+1x B27+MEM-NEAA).

[0167] 3.4. Organoid isolation. Discard the old culture medium, add 3D-RDM (DMEM / F12 + 10% FBS + MEM-NEAA + 1x B + 100uM Taurine), scrape off the cells using the cross-pipette method, and transfer them to low-absorption 6-well plates using a Pasteur pipette; at D30-D40, select well-defined organoids under a stereomicroscope for long-term culture.

[0168] The cultured organoids were infected with codon-optimized hProm1 (opti-hProm1) virus RC-C14 & CBA.opti-hProm1 and wild-type hProm1 (wt-hProm1) virus RC-C14 & RK1.wt-hProm1, respectively. Six weeks after infection, proteins were extracted for immunofluorescence detection in frozen sections. CBA.opti-hProm1 is the hProm1 expression vector in the prior art (CN 111118016B), and RC-C14 is an AAV2 serotype variant (patent application number 2023100847498). WT-RO represents wild-type retinal organoids as a positive control; KO-RO represents Prom1 gene knockout retinal organoids.

[0169] (V) Retinal injection in Prom1 gene knockout mice

[0170] Two- to three-week-old Prom1 gene knockout (Prom1 KO) mice, as described in the existing technology (CN 110257435 B), were selected as the test model. The specific drug administration was as follows:

[0171] Prom1 KO mice were generalized after full mydriasis, and mydriatic otinate was applied to the ocular surface. The mice were placed under a microscope to fully expose the eyeballs. A 34G needle was used to puncture the sclera 1-2 mm from the limbus. Then, a WPI syringe filled with the drug was inserted along the puncture site to perform subretinal injection according to the experimental objectives.

[0172] 1ul Buffer, 1ul RC-C14&CBA.opti-hProm1, 1ul RC-C14&RK1.wt-hProm1;

[0173] 1ul Buffer, 1ul RC-C14&RK1.wt-hProm1, 1ul RC-C14&CBA.opti-hProm1;

[0174] 1ul Buffer, 1ul RC-C14&RK1.wt-hProm1;

[0175] 1ul Buffer, 1ul RC-C14&RK1.wt-hProm1, 1ul RC-C07v5&RK1.wt-hProm1;

[0176] 1ul Buffer, 1ul rAAV2 / 8&RK1.wt-hProm1.

[0177] After recording the injection time, each mouse was injected with 0.2 ml of the antagonist and then returned to its cage. Subsequently, the entire eye of each mouse was removed for frozen section immunofluorescence detection and retinal visual function testing. RC-C07v5 is an AAV9 serotype variant (patent authorization number CN 117247434 B).

[0178] (vi) Immunofluorescence detection of frozen sections

[0179] Mouse eye tissue was embedded in cryoembryosetting medium and then sectioned. The sections were soaked in PBS at 58°C for 30 min, followed by washing with PBS for 5 min, for a total of 3 times. The tissue was circled with an immunohistochemical pen, and 200 μL of 0.2% Triton X-100 was added to each section, followed by humidified incubation. The sections were washed with PBS for 5 min, for a total of 3 times. BSA was blocked for 30 min, followed by humidified incubation. Primary antibody was added, and the sections were incubated overnight in a humidified chamber. The sections were washed with PBS for 5 min, for a total of 3 times, followed by secondary antibody, and incubated for 1 h in a humidified chamber. The sections were washed with PBS for 5 min, for a total of 3 times, and then added and allowed to stand for 5 min. The sections were washed with PBS for 5 min, for a total of 3 times, and then mounted with an anti-fluorescence quencher. The sections were stored at 4°C protected from light for immunofluorescence detection of hProm1 in the retinal photoreceptor layer, DAPI in the retinal cell nuclear layer, and photoreceptor layer markers (Rhodopsin, Opsin).

[0180] (vii) Retinal visual function testing

[0181] The experimental mice were dark-acclimatized overnight before undergoing visual electrophysiological (ERG) examination. The next day, each group of mice was weighed, and the dosage of anesthetic drug per mouse was calculated at 50 mg / kg.

[0182] Connect the electrodes, power cord, and data cable to their respective positions. After connecting, turn on the power and open the software to the working page. Apply Diclofenac to both eyes of the mouse and also to the corneal contact electrode. Connect the electrodes to ensure the resistance is less than 10 ohms. First, demonstrate to check if the waveform is normal, then stop and begin the dark adaptation 3.0 ERG examination. After completion, remove the mouse and proceed to the next mouse for examination, saving the data. Finally, save and output all examination results.

[0183] III. Research Results

[0184] 3.1 A schematic diagram of the rAAV / RK1-Prom1 viral vector structure is shown in Figure 1.

[0185] hEN is the enhancer, hRK1 is the rhodopsin kinase promoter in the photoreceptor layer, SV40 intron is the intron of simian virus 40 (SV40), and hGHpoly(A) represents the terminator.

[0186] 3.2 In vitro detection of rAAV / RK1-Prom1 viral vector expression

[0187] The immunofluorescence assay results are shown in Figure 2. Red fluorescence represents the intensity of hProm1 expression, and DAPI represents the retinal nuclear layer. No hProm1 expression was observed in the KO-RO group, while significant hProm1 expression was detected in the WT-RO group. Six weeks after infection with RC-C14&CBA.opti-hProm1 and RC-C14&RK1.wt-hProm1 viruses, the most significant hProm1 expression was observed in the RC-C14&RK1.wt-hProm1 infection group, consistent with the trend of hProm1 expression in WT-RO; the weakest expression was observed in the RC-C14&CBA.opti-hProm1 infection group, where CBA.opti-hProm1 is the vector used in the prior art (CN-111118016B).

[0188] These results suggest that the expression distribution trend of hProm1 driven by the RK1 promoter of this invention is similar to that of WT-RO endogenous hProm1, and unexpectedly, it significantly enhances the expression level of PROM1 protein. The expression level of wild-type hProm1 driven by the RK1 promoter is even higher than that of codon-optimized hProm1 driven by the CBA promoter.

[0189] 3.3 In vivo detection of rAAV / RK1-Prom1 viral vector expression distribution

[0190] The PROM1 protein is primarily expressed in the photoreceptor layer of the retina. The promoter used in existing technology (CN-111118016B) is the chicken β-actin promoter CBA, which incorporates a chimeric CMV enhancer and has insufficient expression specificity. Therefore, this invention selects the short-somatic RK1 promoter derived from rhodopsin kinase as a test, and the expression vector RC-C14&CBA.opti-hProm1 using the CBA promoter in existing technology CN-111118016B serves as a control in this study.

[0191] The immunofluorescence results are shown in Figure 3. Rhodopsin (green fluorescence) represents the photoreceptor layer; DAPI (blue fluorescence) represents the nuclear layer. No hProm1 expression was observed in Prom1 KO mice injected with buffer, but after infection with the virus RC-C14&CBA.opti-hProm1, hProm1 was detected distributed locally in the retinal photoreceptor layer and the RPE layer, as indicated by the two red fluorescence points (arrows). In contrast, in Prom1 KO mice infected with the virus RC-C14&RK1.wt-hProm1, hProm1-specific expression was detected throughout the retinal photoreceptor region, as indicated by the red fluorescence points (arrows), consistent with the expression distribution trend of mProm1 (as indicated by the red fluorescence points (arrows)) in wild-type (WT) mice.

[0192] The above results suggest that the RK1 promoter expression specificity in this study is better than that of existing technologies, and the rAAV / RK1-Prom1 viral vector can express hProm1 in the entire photoreceptor layer of the retina, which is closer to the distribution of Prom1 in wild-type mice, and is also better than existing technologies (CN-111118016B).

[0193] 3.4 Immunofluorescence staining of retinal sections before and after viral injection in Prom1 KO mice

[0194] The immunofluorescence staining results are shown in Figure 4. Compared to WT mice, the thickness of the retinal cell nuclear layer and photoreceptor layer in Prom1 KO mice injected with Buffer was significantly thinner. However, Prom1 KO mice injected with the virus RC-C14&RK1.wt-hProm1 showed significant hProm1 expression, as indicated by red fluorescence. Furthermore, the retinal thickness after infection with this virus was significantly greater than that in the Prom1 KO mice injected with Buffer. The horizontal line in the figure represents the thickness from the retinal cell nuclear layer to the photoreceptor layer. In contrast, Prom1 KO mice injected with the same dose of the virus RC-C14&CBA.opti-hProm1 showed a small amount of hProm1 expression, and the improvement in retinal thickness degeneration was not as significant as that of the RC-C14&RK1.wt-hProm1 virus treatment, suggesting that the RC-C14&RK1.wt-hProm1 treatment of this invention has a better therapeutic effect.

[0195] 3.5 Detection of retinal visual function in Prom1 KO mice before and after viral injection

[0196] Figure 5 shows a comparison of retinal visual electrophysiological images under dark adaptation in Prom1 KO mice with the right eye (OD eye) injected with RC-C14&RK1.wt-hProm1 (denoted as OD-Treatd) and the left eye (OS eye) injected with Buffer (denoted as OS-Ctrl). Figure 5A shows that the A wave in the OD-Treated group injected with viral RC-C14&RK1.wt-hProm1 under dark adaptation was significantly improved compared to the OS-Ctrl of the Buffer-injected group; Figure 5B shows that the B wave in the OD-Treatd group injected with viral RC-C14&RK1.wt-hProm1 under dark adaptation was significantly improved compared to the OS-Ctrl of the Buffer-injected group. These results indicate that injection of viral RC-C14&RK1.wt-hProm1 can improve retinal visual function in Prom1 KO mice.

[0197] 3.6 Detection of Improved Opsin Shift in Retinal Photoreceptor Markers Before and After Viral Injection in Prom1KO Mice

[0198] As shown in Figure 6, the immunofluorescence staining results showed that, compared with WT mice, the Opsin distribution in Prom1KO mice injected with Buffer shifted from the photoreceptor layer to the outer nuclear layer and outer reticular layer, showing a significant shift. However, after infection with RC-C14&RK1.wt-hProm1, RC-C07v5&RK1.wt-hProm1, and rAAV2 / 8&RK1.wt-hProm1, Opsin distribution was observed in the photoreceptor layer, while no Opsin signal was observed in the outer nuclear layer or outer reticular layer. The distribution trend was consistent with that of WT mice.

[0199] The above results suggest that Prom1 complementation has a certain improving effect on the molecular misalignment distribution in the photoreceptor layer of KO mice. Furthermore, the RK1.wt-hProm1 expression cassette of this invention can be used with a variety of different AAV vectors.

[0200] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0201] SEQ ID NO.3 hProm1 CDS sequence

[0202] SEQ ID NO.4 rAAV2 / RK1-Prom1 viral vector sequence

[0203] Underlined text represents two AAV2 ITRs, italics represent hEN, italicized underline represents hRK1, bold italics represent SV40 intron, bold black text represents Prom1 CDS (encoded sequence), and bold underline represents hGHpolyA.

Claims

1. An expression box, characterized in that, The expression box has a structure of formula I from the 5'-3' end: Z1-Z2-Z3-Z4-Z5 (I) In the formula, each "-" represents an independent bond or nucleotide linkage sequence; Z1 is either absent or an enhancer; Z2 is the RK1 promoter; Z3 is either empty or contains an intron; Z4 is the nucleotide sequence encoding the PROM1 protein; and Z5 is either none or polyA.

2. The expression box as described in claim 1, characterized in that, The nucleotide sequence encoding the PROM1 protein is selected from the following group: (a) The nucleotide sequence is shown in SEQ ID NO:3; and (b) The nucleotide sequence has ≥95% identity with the nucleotide sequence shown in SEQ ID NO:3, preferably ≥98%, more preferably ≥99%; (c) A nucleotide sequence complementary to the nucleotide sequence described in (a) or (b).

3. The expression box as described in claim 1, characterized in that, The enhancer is an IRBP enhancer.

4. The expression box as described in claim 1, characterized in that, The intron is the SV40 intron.

5. A carrier, characterized in that, The carrier contains the expression cassette as described in claim 1.

6. An adeno-associated virus (AAV) vector, characterized in that, The adeno-associated virus vector contains the expression cassette as described in claim 1.

7. The adeno-associated virus vector as described in claim 6, characterized in that, The serotype of AAV is selected from: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, rh10, RC-C14, RC-C07v5, or a combination thereof.

8. The adeno-associated virus vector as described in claim 6, characterized in that, The sequence of the adeno-associated virus vector is shown in SEQ ID NO:

4.

9. A host cell containing the vector of claim 5 or the adeno-associated virus vector of claim 6, or having an exogenous expression cassette of claim 1 integrated into its chromosome.

10. The host cell as described in claim 9, characterized in that, The host cells are selected from the group consisting of HEK cells, photoreceptor cells (including cone cells and / or rod cells), other visual cells (such as bipolar cells, horizontal cells), (optic) nerve cells, or combinations thereof.

11. Use of the vector of claim 5 or the adeno-associated virus vector of claim 6 in the preparation of formulations or compositions for treating eye diseases and / or restoring visual acuity or photosensitivity in a subject.

12. The use as described in claim 11, characterized in that, The eye disease mentioned is an eye disease related to Prom1 gene mutation.

13. The use as described in claim 11, characterized in that, The eye diseases mentioned are selected from the following group: retinitis pigmentosa, macular dystrophy, cone-rod dystrophy, or a combination thereof.

14. A pharmaceutical preparation, characterized in that, The formulation contains (a) the vector as described in claim 5 or the adeno-associated virus vector as described in claim 6, and (b) a pharmaceutically acceptable vector or excipient.

15. The pharmaceutical formulation as described in claim 14, characterized in that, The pharmaceutical preparation is used to treat eye diseases and / or restore the subject's vision or light perception.

Images