Wd40 protein of cryptococcus neoformans and uses thereof

By targeting essential WD40 proteins in Cryptococcus neoformans, the method addresses drug resistance and blood-brain barrier issues, enabling effective and safe antifungal treatment for cryptococcosis.

WO2025254320A1PCT designated stage Publication Date: 2025-12-11IND ACADEMIC COOP FOUND YONSEI UNIV +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/003983
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-28
Filing Date
2025-03-28
Publication Date
2025-12-11

AI Technical Summary

Technical Problem

Current antifungal treatments for Cryptococcus neoformans, a pathogenic fungus causing cryptococcosis, are limited by drug resistance and the impermeability of the blood-brain barrier, necessitating the development of novel antifungal agents that target evolutionarily conserved, fungal-specific proteins without toxicity to human cells.

Method used

A method for screening antifungal agents by measuring the expression levels or activity of specific WD40 proteins essential for the growth and survival of Cryptococcus neoformans, using candidate substances such as nucleic acids, antibodies, or peptides that inhibit these proteins.

Benefits of technology

This approach effectively identifies antifungal agents that target critical fungal proteins, potentially overcoming drug resistance and blood-brain barrier challenges, providing a safer and more effective treatment for cryptococcosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025003983_11122025_PF_FP_ABST
    Figure KR2025003983_11122025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a method for screening an antifungal agent against Cryptococcus neoformans and an antifungal composition. Utilizing a newly identified gene essential for the growth and survival of Cryptococcus neoformans, the screening method of the present invention can effectively screen an antifungal agent.
Need to check novelty before this filing date? Find Prior Art

Description

WD40 proteins from Cryptococcus neoformans and their uses

[0001] The present invention relates to WD40 proteins of Cryptococcus neoformans and their uses, and more particularly, to a method for screening antifungal agents against Cryptococcus neoformans and an antifungal composition.

[0002]

[0003] Cryptococcus neoformans is a basidiomycete fungus within the pathogenic Cryptococcus species complex that causes cryptococcosis, a potentially fatal disease in humans. Found in various natural environments, including soil and bird droppings, it primarily targets immunocompromised individuals, causing meningitis. Infection begins with inhalation of spores and can spread to various organs. The fungus can evade or multiply within alveolar macrophages and can cross the blood-brain barrier, causing fatal meningitis. Cryptococcosis accounts for 19% of AIDS-related deaths, resulting in 112,000 deaths annually, making it a significant cause of mortality among people living with HIV / AIDS.

[0004] Treatment of these mycoses is limited by the range of available antifungal drugs, further hampered by the impermeability of the blood-brain barrier. Fluconazole is commonly used for maintenance therapy, while amphotericin B and 5-fluorocytosine are recommended for induction therapy. However, long-term use of these drugs has led to the emergence of drug-resistant strains. Therefore, due to side effects and limited efficacy, the development of novel anticryptococcal therapies with unique mechanisms of action is needed. While targeting proteins essential for fungal survival is effective for antifungal drug development, these proteins are often conserved between fungi and humans, posing a risk of potential toxicity. For example, the essential TOR kinase Tor1, which plays a crucial role in nutrient sensing and ribosome biogenesis in eukaryotes, can be inhibited by rapamycin, resulting in significant antifungal activity. However, its cytotoxicity in human cells makes TOR protein inhibition a risky antifungal strategy. Therefore, strategies targeting less evolutionarily conserved, fungal-specific, survival-critical proteins may be advantageous for the development of safe antifungal drugs.

[0005] Accordingly, this study completed the present invention by performing a comprehensive functional analysis of the canonical WD40 protein in C. neoformans and revealing its important role in pathogenicity, stress adaptation, and antifungal drug response.

[0006]

[0007] This research was supported by the National Research Foundation of Korea (NRF) grant funded by the Ministry of Science and ICT (Project ID: 2710017696, 2710017155).

[0008]

[0009] The technical problem to be achieved by the present invention is to provide a method for screening an antifungal agent against Cryptococcus neoformans.

[0010] In addition, the technical problem to be achieved by the present invention is to provide an antifungal composition against Cryptococcus neoformans.

[0011]

[0012] The technical problems to be solved by the present invention are not limited to the technical problems mentioned above, and other technical problems not mentioned can be clearly understood by a person having ordinary skill in the technical field to which the present invention belongs from the description below.

[0013]

[0014] In order to achieve the above technical task, one embodiment of the present invention comprises the steps of contacting a candidate substance with Cryptococcus neoformans; and HIRA, SEA4, PRP19, FAR8, PWP1, SWD1, DOA1, CDH1, SEA2, SPT8, WDP4, SPF38, BUN62, WDP5, SWD2, ELP2, TEX1, WDP6, FBW7, WDR8, BUN107, PEX7, WDP7, DCA7, RRT2, AIP1, WDP8, WDP9, IQW1, WDP10, SWT21, CMR1, GID7, WCP1, REC14, CDT2, SWD3, CRN1, MDV1, SEA of the Cryptococcus. A step of measuring the expression level of mRNA or protein of one or more genes selected from the group consisting of 3, JIP5, RPN14, DUG2, WDP11, WDP12, EED1, VPS15, TUP1, MSL1, GPB1, GIB2, CDC4, SEC13, TIF34, UTP18, UTP7, UTP15, WDP2, ARC40, CDC55, ERB1, PRP46, PRP4, BUB3, SEC31, CDC20, LST8, RRP9, GLE2, YTM1, TAF5, MAK11, CIA1, PSF2, SOF1, SQT1, MET30, PAC11, RSA4, COP1, SEC27, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1 and CDC40, or measuring the activity of the protein; A method for screening antifungal agents against Cryptococcus neoformans including .

[0015] In order to achieve the above technical task, another embodiment of the present invention is HIRA, SEA4, PRP19, FAR8, PWP1, SWD1, DOA1, CDH1, SEA2, SPT8, WDP4, SPF38, BUN62, WDP5, SWD2, ELP2, TEX1, WDP6, FBW7, WDR8, BUN107, PEX7, WDP7, DCA7, RRT2, AIP1, WDP8, WDP9, IQW1, WDP10, SWT21, CMR1, GID7, WCP1, REC14, CDT2, SWD3, CRN1, MDV1, SEA of Cryptococcus neoformans 3,JIP5,RPN14,DUG2,WDP11,WDP12,EED1,VPS15,TUP1,MSL1,GPB1,GIB2,CDC4,SEC13,TIF34,UTP18,UTP7,UTP15,WDP2,ARC40, CDC55,ERB1,PRP46,PRP4,BUB3,SEC31,CDC20,LST8,RRP9,GLE2,YTM1,TAF5,MAK11,CIA1,PSF2,SOF1,SQT1,MET30,PAC11,RSA4, Provided is an antifungal composition for Cryptococcus neoformans, comprising a substance that inhibits the expression of one or more genes among COP1, SEC27, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1, and CDC40, or the expression or activity of a protein expressed therefrom.

[0016]

[0017] The present invention relates to a method for screening an antifungal agent against Cryptococcus neoformans and an antifungal composition. The screening method of the present invention utilizes a newly identified gene essential for the growth and survival of Cryptococcus neoformans, and thus can effectively screen for an antifungal agent.

[0018]

[0019] The effects of the present invention are not limited to the above-described effects, and should be understood to include all effects that can be inferred from the composition of the invention described in the description or claims of the present invention.

[0020]

[0021] Figure 1a illustrates the overall experimental plan of this study. Figures 1b to 1d show the results of WD40 protein analysis of C. neoformans.

[0022] Figures 2 and 3 show the identification of genes essential for survival among the WD40 genes of C. neoformans that make it impossible to produce a defective strain.

[0023] Figure 4 shows the results of phenotypic analysis performed under various growth conditions to confirm the function of the WD40 mutant strain of C. neoformans.

[0024] Figure 5 shows the results of an experiment using an STM-based mouse infection model to analyze the effect of WD40 protein on the pathogenicity of C. neoformans.

[0025] Figures 6 to 13 show the analysis of protein complexes associated with the WD40 protein, identifying major complexes associated with the pathogenicity of C. neoformans.

[0026]

[0027] Hereinafter, the present invention will be described in detail.

[0028]

[0029] The present invention relates to a method for screening antifungal agents against Cryptococcus neoformans.

[0030] The present invention comprises the steps of contacting a candidate substance with Cryptococcus neoformans; and HIRA, SEA4, PRP19, FAR8, PWP1, SWD1, DOA1, CDH1, SEA2, SPT8, WDP4, SPF38, BUN62, WDP5, SWD2, ELP2, TEX1, WDP6, FBW7, WDR8, BUN107, PEX7, WDP7, DCA7, RRT2, AIP1, WDP8, WDP9, IQW1, WDP10, SWT21, CMR1, GID7, WCP1, REC14, CDT2, SWD3, CRN1, MDV1, SEA of the Cryptococcus. A step of measuring the expression level of mRNA or protein of one or more genes selected from the group consisting of 3, JIP5, RPN14, DUG2, WDP11, WDP12, EED1, VPS15, TUP1, MSL1, GPB1, GIB2, CDC4, SEC13, TIF34, UTP18, UTP7, UTP15, WDP2, ARC40, CDC55, ERB1, PRP46, PRP4, BUB3, SEC31, CDC20, LST8, RRP9, GLE2, YTM1, TAF5, MAK11, CIA1, PSF2, SOF1, SQT1, MET30, PAC11, RSA4, COP1, SEC27, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1, and CDC40, or measuring the activity of the protein;

[0031] The above Cryptococcus neoformans strain can be cultured using methods and conditions known in the art.

[0032] The step of contacting the candidate substance with the above Cryptococcus neoformans may involve treating the candidate substance with Cryptococcus neoformans using known means and under known methods and conditions in the art. The treatment may be appropriately performed depending on the desired treatment amount and treatment method.

[0033] The above candidate substances may include, but are not limited to, nucleic acids, antibodies, aptamers, peptides, proteins, compounds, or natural products, for example.

[0034] Measurement of the mRNA expression level can be performed by a method known in the art, for example, by reverse transcription polymerase chain reaction (RT-PCR), competitive reverse transcription polymerase reaction, real-time reverse transcription polymerase reaction, RNase protection assay (RPA), Northern blotting, DNA chip (Microarray), or RNA sequencing analysis.

[0035] Measurement of the expression level of the above protein can be performed by a method known in the art, for example, Western blot, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, tissue immunostaining, immunoprecipitation assay, complement fixation assay, flow cytometry (Fluorescence Activated Cell Sorter, FACS), or protein chip.

[0036] Measurement of the activity of the above protein can be performed by a method known in the art, for example, an enzyme activity measurement method can be used.

[0037] If the above-mentioned measured expression level or activity decreases compared to the control group that did not come into contact with the candidate substance, the candidate substance may be selected as an antifungal agent.

[0038] The above genes are composed of sequences identified by unique numbers listed in Tables 1 and 2, respectively, and HIRA, SEA4, PRP19, FAR8, PWP1, SWD1, DOA1, CDH1, SEA2, SPT8, WDP4, SPF38, BUN62, WDP5, SWD2, ELP2, TEX1, WDP6, FBW7, WDR8, BUN107, PEX7, WDP7, DCA7, RRT2, AIP1, WDP8, WDP9, IQW1, WDP10, SWT21, CMR1, GID7, WCP1, REC14, CDT2, SWD3, CRN1, MDV1, SEA3, JIP5, RPN14, DUG2, WDP11, WDP12, EED1, VPS15, TUP1, MSL1, GPB1, GIB2 and CDC4 are It was confirmed in the present invention that SEC13, TIF34, UTP18, UTP7, UTP15, WDP2, ARC40, CDC55, ERB1, PRP46, PRP4, BUB3, SEC31, CDC20, LST8, RRP9, GLE2, YTM1, TAF5, MAK11, CIA1, PSF2, SOF1, SQT1, MET30, PAC11, RSA4, COP1, SEC27, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1 and CDC40 are genes that express factors essential for the growth of Cryptococcus neoformans.

[0039]

[0040] The present invention relates to an antifungal composition against Cryptococcus neoformans.

[0041] The above composition comprises HIRA, SEA4, PRP19, FAR8, PWP1, SWD1, DOA1, CDH1, SEA2, SPT8, WDP4, SPF38, BUN62, WDP5, SWD2, ELP2, TEX1, WDP6, FBW7, WDR8, BUN107, PEX7, WDP7, DCA7, RRT2, AIP1, WDP8, WDP9, IQW1, WDP10, SWT21, CMR1, GID7, WCP1, REC14, CDT2, SWD3, CRN1, MDV1, SEA of Cryptococcus neoformans. 3, JIP5, RPN14, DUG2, WDP11, WDP12, EED1, VPS15, TUP1, MSL1, GPB1, GIB2, CDC4, SEC13, TIF34, UTP18, UTP7, UTP15, WDP2, ARC40, CDC55, ERB1, PRP46, PRP4, BUB3, SEC31, CDC20, LST8, RRP9, GLE2, YTM1, TAF5, MAK11, CIA1, PSF2, SOF1, SQT1, MET30, PAC11, RSA4, COP1, SEC27, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1 and CDC40, or a substance that inhibits the expression or activity of a protein expressed therefrom.

[0042] The above material may be, but is not limited to, a nucleic acid, an antibody, an aptamer, a peptide, a protein, a compound or a natural product.

[0043] The above substances are HIRA, SEA4, PRP19, FAR8, PWP1, SWD1, DOA1, CDH1, SEA2, SPT8, WDP4, SPF38, BUN62, WDP5, SWD2, ELP2, TEX1, WDP6, FBW7, WDR8, BUN107, PEX7, WDP7, DCA7, RRT2, AIP1, WDP8, WDP9, IQW1, WDP10, SWT21, CMR1, GID7, WCP1, REC14, CDT2, SWD3, CRN1, MDV1, SEA3, JIP5,RPN14,DUG2,WDP11,WDP12,EED1,VPS15,TUP1,MSL1,GPB1,GIB2,CDC4,SEC13,TIF34,UTP18,UTP7,UTP15,WDP2,ARC40,C DC55,ERB1,PRP46,PRP4,BUB3,SEC31,CDC20,LST8,RRP9,GLE2,YTM1,TAF5,MAK11,CIA1,PSF2,SOF1,SQT1,MET30,PAC11,RSA4, It may be an antisense, siRNA (small interfering RNA), or shRNA (short hairpin RNA) nucleic acid having a sequence complementary to the mRNA of any one or more genes of COP1, SEC27, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1, and CDC40, but is not limited thereto.

[0044] The antifungal composition of the present invention can be utilized as an antifungal agent, a pharmaceutical composition, a skin cleansing composition, an antibacterial building material and household goods composition, or a cosmetic composition.

[0045] The above antifungal agent is a drug that prevents and treats fungal infections by inhibiting the proliferation and growth of fungi.

[0046] The above pharmaceutical composition may be administered orally, or parenterally, rectally, topically, transdermally, intravenously, intramuscularly, intraperitoneally, subcutaneously, etc. in the form of a solid, semi-solid, or liquid by adding a commercially available inorganic or organic carrier.

[0047] Examples of preparations for oral administration include tablets, pills, granules, soft / hard capsules, powders, granules, powders, emulsions, syrups, pellets, and beverages. In addition, examples of preparations for parenteral administration include injections, drops, ointments, lotions, sprays, suspensions, emulsions, and suppositories.

[0048] In order to formulate the effective ingredient of the present invention, it can be easily formulated by following a conventional method, and surfactants, excipients, coloring agents, spices, preservatives, stabilizers, buffers, suspending agents, and other commonly used auxiliary agents can be appropriately added and used.

[0049] Additionally, the dosage of the above-mentioned active ingredient will vary depending on the age, sex, and weight of the subject being treated, the specific disease or pathological condition being treated, the severity of the disease or pathological condition, the route of administration, and the prescriber's judgment. Determining the dosage based on these factors is within the skill of those skilled in the art, and typically, the dosage may range from 0.001 mg / kg / day to approximately 2,000 mg / kg / day, but this does not limit the scope of the present invention in any way.

[0050]

[0051] Hereinafter, the present invention will be described in detail by way of examples to specifically explain the present invention.

[0052]

[0053] Experimental method

[0054] 1. Construction of WD40 knockout mutants

[0055] The WD40 gene was deleted by homologous recombination in the C. neoformans H99S strain using a gene disruption cassette harboring a nourseothricin-resistance marker (nourseothricin acetyltransferase; NAT) via a NAT-split marker / dual joint PCR strategy (Tables 1–4). The 5' and 3' flanking regions of the target gene were PCR amplified from H99S genomic DNA (gDNA) using the L1 / L2 and R1 / R2 primer pairs. The NAT marker containing the signature-tagged sequence was amplified from the pNAT-STM plasmid using the M13Fe and M13Re primers. After generating DNA templates through a first PCR for the flanking regions and the NAT marker, a second PCR was performed using the L1 / SM2 and R2 / SM1 primers to construct the NAT-split gene disruption cassette. This cassette was introduced into the H99S strain using biological transformation. C. neoformans cells were cultured in YPD medium at 30°C for 16 h, then plated on YPD agar containing 1 M sorbitol and incubated for an additional 3 h at 30°C. The gene disruption cassette was attached to 600 μg of 0.6 μm gold microcarrier beads (Bio-Rad Laboratories, Hercules, CA, USA) and delivered to the cells using the PDS-100 particle delivery system (Bio-Rad). After recovery at 30°C for 4 h to allow the cell membrane to repair, the cells were harvested and plated on YPD agar containing nourseothricin (100 μg / ml). NAT-positive transformants were confirmed by diagnostic PCR. Southern blot analysis was then used to confirm the genotype of each transformant to ensure that at least two independent mutant strains were constructed for each gene. The wcp1Δ mutation was detected in C. It was also generated in the background of C. deneoformans (JEC21) and C. gattii (R265), and C.The same method as for neoformansH99 was followed. All primers used in this process are listed in Tables 1 to 4.

[0056]

[0057] No.H99 locus tag (Broad ID)Cngene namePrimer namePrimer descriptionPrimer sequence (5'-3')1CNAG_04158HIRAL1CNAG_04158 5' flanking region primer 1GGGGTTGAAGCCTACAAGCTAL2CNAG_04158 5' flanking region primer 2TCACTGGCCGTCGTTTTACGGGTTAGCGAGCACTCTTTGR1CNAG_04158 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGAGGGCAAAAATGTAGCATCGR2CNAG_04158 3' flanking region primer 2GGCTAGCTGTCTTCCTGGTGSOCNAG_04158 diagnostic screening primer, pairing with B79CAAAGGGATTTCGCAGTAGCPOCNAG_04158 Southern blot probe primerATCAGCAAAGTTGCCCTGACSTM commonSTM common primerGCATGCCCTGCCCCTAAGAATTCG2CNAG_06888SEA4L1CNAG_06888 5' flanking region primer 1GCAAACGTTGTGGAGCCTACL2CNAG_06888 5' flanking region primer 2TCACTGGCCGTCGTTTTACATCTGGCCGATCTCTGTCTGR1CNAG_06888 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGATGCATTCATTCGCATTCACR2CNAG_06888 3' flanking region primer 2CCCGTCAACTCACGTTATCCSOCNAG_06888 diagnostic screening primer,pairing with B79GGAACAATGACAGAGCGTTGPOCNAG_06888 Southern blot probe primerTCAGAAGCGGAGGATGTCTT3CNAG_01733PRP19L1CNAG_01733 5' flanking region primer 1CTTCTTTACGCCGACCACATL2CNAG_01733 5' flanking region primer 2TCACTGGCCGTCGTTTTACGGGGGACTCACTAGCACAGAR1CNAG_01733 3' flanking region primer 1TGGTCATAGCTGTTTCCTGCGTTGAGAGTCTTGGGGAAAR2CNAG_01733 3' flanking region primer 2AGCTTTTCGCTAGTGGTGGASOCNAG_01733 diagnostic screening primer, pairing with B79TGCTGTAGCTCTCGCTTTGAPOCNAG_01733 Southern blot probe primerTCGACGAGATCTTCCTTGGT4CNAG_00073FAR8L1CNAG_00073 5' flanking region primer 1TCGTCCTTCGCTTGAAAACTL2CNAG_00073 5' flanking region primer 2TCACTGGCCGTCGTTTTACGTTGCTGACCTTGCTGTTGAR1CNAG_00073 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCCCAACGTGCATCCTTACTTR2CNAG_00073 3' flanking region primer 2TCTCGACCAGTTTGCTGATGSOCNAG_00073 diagnostic screening primer,pairing with B79CCCAAGGAATCTCGCTTGTAPOCNAG_00073 Southern blot probe primerTCTCCCATCTTCTCCATTCG5CNAG_04694PWP1L1CNAG_04694 5' flanking region primer 1AAAGGTAGGGTCGAGGGAGAL2CNAG_04694 5' flanking region primer 2TCACTGGCCGTCGTTTTACTCAGTTGTTCGAGGACACCAR1CNAG_04694 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGTAGCAAGGCAACTCTGCAAR2CNAG_04694 3' flanking region primer 2AGTATCTTGGTGGGGCTGAGSOCNAG_04694 diagnostic screening primer, pairing with B79GCCTGCCCTCTCCTAGACTCPOCNAG_04694 Southern blot probe primerTTACCAACGCCTTTGGATTC6CNAG_01828SWD1L1CNAG_01828 5' flanking region primer 1TTCCCATCACCAGTCAAGL2CNAG_01828 5' flanking region primer 2TCACTGGCCGTCGTTTTACGTGGAATCTACAGCATCTGGR1CNAG_01828 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGGTGGGCTTCTATCTTTCTCR2CNAG_01828 3' flanking region primer 2TTCTGACCCTTTGTTAGGCSOCNAG_01828 diagnostic screening primer,pairing with B79ACATCGATTTTCCAATGTAAPOCNAG_01828 Southern blot probe primerTGACGAGAGAGAAGATGAGTTC7CNAG_05084DOA1L1CNAG_05084 5' flanking region primer 1GCAACTGTCAGAAAAGACCTCL2CNAG_05084 5' flanking region primer 2TCACTGGCCGTCGTTTTACGAAGGCTTGAATCGGTTAGR1CNAG_05084 3' flanking region primer 1ATGGTCATAGCTGTTTCCTGCTTGACTCCGAAAAGGAAGR2CNAG_05084 3' flanking region primer 2GTGTGGAATCTGAAAACCCSOCNAG_05084 diagnostic screening primer, pairing with B79TCCTTCCTCTTCTCCTTTTCPOCNAG_05084 Southern blot probe primerCAAAGAGGAATCATCTGTGG8CNAG_03191CDH1L1CNAG_03191 5' flanking region primer 1TTAGGTTTTCCGTGCTTTGGL2CNAG_03191 5' flanking region primer 2TCACTGGCCGTCGTTTTACACAGGTGACGGAGGTACTGGR1CNAG_03191 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGGGAAGTGGGTTACACCAAAR2CNAG_03191 3' flanking region primer 2TCCTTTCTGTCCGACCTCATSOCNAG_03191 diagnostic screening primer,pairing with B79AATCCGTCCGTTTTCCTTCTPOCNAG_03191 Southern blot probe primerACCCAGCATACCACCATCTC9CNAG_04377SEA2L1CNAG_04377 5' flanking region primer 1TCGCAGAGTTGTAGGTACGCL2CNAG_04377 5' flanking region primer 2TCACTGGCCGTCGTTTTACTTGTGAAGCGATTCATCGTGR1CNAG_04377 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGAACGGGTTGTGGATGTCAATR2CNAG_04377 3' flanking region primer 2CCTGCTTCCTTTGGTCTCACSOCNAG_04377 diagnostic screening primer, pairing with B79TCTGTCTGCCGTCCATGTTAPO1CNAG_04377 Southern blot probe primer 1CGGACGCTCCTGTCTCTCT10CNAG_06597SPT8L1CNAG_06597 5' flanking region primer 1GGGCCTAAGACCCCAAGAGACL2CNAG_06597 5' flanking region primer 2TCACTGGCCGTCGTTTTACGGAGAGCGTTTCTGGAGTTGR1CNAG_06597 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGCTGACACCCAGTTATGCAAR2CNAG_06597 3' flanking region primer 2CCATCTCGCTTCATCGTTCTSOCNAG_06597 diagnostic screening primer,pairing with B79TCCCTCGGGTCTTCAATATGPOCNAG_06597 Southern blot probe primerTACCTCATCCCCAGACCAAA11CNAG_05816WDP4L1CNAG_05816 5' flanking region primer 1ACGTACGTGCACTGTTTTGGL2CNAG_05816 5' flanking region primer 2TCACTGGCCGTCGTTTTACGCTGTAAGCGTGGCGTATGR1CNAG_05816 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTGGCCCTATTATTGGAGCAGR2CNAG_05816 3' flanking region primer 2ACGGCCTGTGACAGAAGAACSOCNAG_05816 diagnostic screening primer, pairing with B79GCCTGGTCCGATATCACTTCPOCNAG_05816 Southern blot probe primerCGAGCTGATGTGTTCTGCAT12CNAG_03584SPF38L1CNAG_03584 5' flanking region primer 1GCAATACACGTACGGGTTCAL2CNAG_03584 5' flanking region primer 2TCACTGGCCGTCGTTTTACTGTTTTCGTCGGCCTCATR1CNAG_03584 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGAGAACCCATCATCTTGACAGGR2CNAG_03584 3' flanking region primer 2CCCCGTCCAGCTACTACAAGSOCNAG_03584 diagnostic screening primer,pairing with B79GTTTTGAAAGGCGTGGATGTPOCNAG_03584 Southern blot probe primerCCTGATGGGTCAAACACACA13CNAG_01337BUN62L1CNAG_01337 5' flanking region primer 1TAGATATTCGGCGGAGGAAAL2CNAG_01337 5' flanking region primer 2TCACTGGCCGTCGTTTTACGAATACCAAAACCGGGACCTR1CNAG_01337 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGGCGTATATTGCCTTCCAGAR2CNAG_01337 3' flanking region primer 2GCGAGTCACATCAGATTCCASOCNAG_01337 diagnostic screening primer, pairing with B79TTTAACTCGTCTGGGGATCGPO1CNAG_01337 Southern blot probe primer 1TCGGGGACGATGAACTAGAG14CNAG_00528WDP5L1CNAG_00528 5' flanking region primer 1ATGCATGTCATCCAGCTCACL2CNAG_00528 5' flanking region primer 2TCACTGGCCGTCGTTTTACACCCATCATGAAGGAGATCGR1CNAG_00528 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTGGGAAATGAAAAGGAAGGAR2CNAG_00528 3' flanking region primer 2TGTAATTCGTTGGCCATGAGSOCNAG_00528 diagnostic screening primer,pairing with B79TGGGGAGCATAGTGCAATAACPO1CNAG_00528 Southern blot probe primer 1TCACTTCTCATTGCCAGTCG15CNAG_03070SWD2L1CNAG_03070 5' flanking region primer 1ACTAGGTCCCCCAGGTATGCL2CNAG_03070 5' flanking region primer 2TCACTGGCCGTCGTTTTACCTTCACGTTGGGGTCAAGTTR1CNAG_03070 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTGCCCATAAAGGACGAAGAGR2CNAG_03070 3' flanking region primer 2TGGAGGAGTGGTTTCTGAGGSOCNAG_03070 diagnostic screening primer, pairing with B79CAAAGCACGAAGCTGACTGAPO1CNAG_03070 Southern blot probe primer 1TTTTGTCCCACAGCATTTCA16CNAG_03940ELP2L1CNAG_03940 5' flanking region primer 1CTTGAAGTGGTGCTGTGGTGL2CNAG_03940 5' flanking region primer 2TCACTGGCCGTCGTTTTAC ACGATGAATCCCAAAGTGCGR1CNAG_03940 3' flanking region primer 1CATGGTCATAGCTGTTTCCTG AGTGATGATCGAAGTGTCCGCR2CNAG_03940 3' flanking region primer 2TGGCAATCACGACACCATTGSOCNAG_03940 diagnostic screening primer,pairing with B79AGTGGCGGTGGAATCGATAGPOCNAG_03940 Southern blot probe primerCAGCTTGCCTTTCAGATCGA17CNAG_07453TEX1L1CNAG_07453 5' flanking region primer 1TGCAACAAATGGACGTTAGGL2CNAG_07453 5' flanking region primer 2TCACTGGCCGTCGTTTTACGCCGCTTTCTTACCATCAGAR1CNAG_07453 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCTATACCGGCCAAACTGTCGR2CNAG_07453 3' flanking region primer 2CTTGCCGGAATCATCAATCTSOCNAG_07453 diagnostic screening primer, pairing with B79GGTTGGGAATTTCCAGCTTTPOCNAG_07453 Southern blot probe primerCCCATTTTGGTTCACCACTC18CNAG_04411WDP6L1CNAG_04411 5' flanking region primer 1TTCGAAACCTGAGAACATCGL2CNAG_04411 5' flanking region primer 2TCACTGGCCGTCGTTTTACATGGCGATATAGTGGGCAATR1CNAG_04411 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCGAAGCATTCGCATTAGTGTR2CNAG_04411 3' flanking region primer 2GCCACAAGCATCTTCAACAASOCNAG_04411 diagnostic screening primer,pairing with B79AAGCAAAACGAAGACCAGGAPOCNAG_04411 Southern blot probe primerCAGCGGAGGTTGTATCGAAT19CNAG_05294FBW7L1CNAG_05294 5' flanking region primer 1CACATCATTCGCACCATCATL2CNAG_05294 5' flanking region primer 2TCACTGGCCGTCGTTTTACAAGAGAGGGACACCCAGGTCR1CNAG_05294 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTTGTCAGAGAGAGGGGAGGAR2CNAG_05294 3' flanking region primer 2CAATGTCCCGATAGGACTGGSOCNAG_05294 diagnostic screening primer, pairing with B79CCAGCACCCTATCCGAACTAPOCNAG_05294 Southern blot probe primerTAGTTGTCGCCGTGCTACTG20CNAG_03037WDR8L1CNAG_03037 5' flanking region primer 1TCGCTAAAAGCAGAACGTCAL2CNAG_03037 5' flanking region primer 2TCACTGGCCGTCGTTTTACCGGGAAAGAGATGGGAAAAGR1CNAG_03037 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTCAGCTTAAGCGAGGGGTTAR2CNAG_03037 3' flanking region primer 2TGGTACCATCGGTCTCACCSOCNAG_03037 diagnostic screening primer,pairing with B79TAAGCGTGGTGCATGATTGTPOCNAG_03037 Southern blot probe primerCTTGGAATGCACCAAAAGGT21CNAG_06282BUN107L1CNAG_06282 5' flanking region primer 1CGATTGAGCTTGCATGAGAAL2CNAG_06282 5' flanking region primer 2TCACTGGCCGTCGTTTTACAGGAATGGGTTCCTTGATCCR1CNAG_06282 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGATAAATGAGGCGCAGAACCR2CNAG_06282 3' flanking region primer 2CGAGCTTCGTGGTCTTCTTTSOCNAG_06282 diagnostic screening primer, pairing with B79TTGGTCACAAGTCCGTGAAAPOCNAG_06282 Southern blot probe primerGAATGTCGTTTTGGGAGACC22CNAG_00516PEX7L1CNAG_00516 5' flanking region primer 1TTCCTTTGCTCCGTCCTCTAL2CNAG_00516 5' flanking region primer 2TCACTGGCCGTCGTTTTACAAGGGGAGAAGGCGAGATTAR1CNAG_00516 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTTGTAATGGCTGCAGACTGGR2CNAG_00516 3' flanking region primer 2TGAAGCTGTTCGTGTCCTTGSOCNAG_00516 diagnostic screening primer,pairing with B79AAGCTGTCAAGGCTGCTTTCPOCNAG_00516 Southern blot probe primerCAATCCGCTGTATCCCAACT23CNAG_07548WDP7L1CNAG_07548 5' flanking region primer 1ACCCTTTAGATAACGCACGL2CNAG_07548 5' flanking region primer 2TCACTGGCCGTCGTTTTACGGTTGTTTGAAAGAGGTGGR1CNAG_07548 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGACATTGAATCACAACCCCR2CNAG_07548 3' flanking region primer 2GACAGCGAGAACAAACAATCSOCNAG_07548 diagnostic screening primer, pairing with B79CAACAACGAACTCAAGACGPOCNAG_07548 Southern blot probe primerGAGATAAAACGCACCTTGAG24CNAG_05824DCA7L1CNAG_05824 5' flanking region primer 1TCACCACTTGTCACTATCTCCL2CNAG_05824 5' flanking region primer 2GCTCACTGGCCGTCGTTTTACGTGGATAGTGTGGAGATGATGR1CNAG_05824 3' flanking region primer 1TGGTCATAGCTGTTTCCTGCTTCGCCCTATGTTCTTTCR2CNAG_05824 3' flanking region primer 2ACGAACATTCTCAACAGAGGSOCNAG_05824 diagnostic screening primer,pairing with B79TTCAGGCTCAAGACTGCTACPOCNAG_05824 Southern blot probe primerCGCTACTTCCCATAAATGC25CNAG_00567RRT2L1CNAG_00567 5' flanking region primer 1GGCTTCAAGGGAAATGTTGAL2CNAG_00567 5' flanking region primer 2TCACTGGCCGTCGTTTTACAGGGACATGACGCAGTGTAAR1CNAG_00567 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTGTGGGCACATGTTCATTCTR2CNAG_00567 3' flanking region primer 2AGATCAGCGCAGTCAAGGTTSOCNAG_00567 diagnostic screening primer, pairing with B79AGCTTGCGCAATTTGAGTCTPOCNAG_00567 Southern blot probe primerCACCATTTTCTGGCTCCACT26CNAG_01547AIP1L1CNAG_01547 5' flanking region primer 1CCCAGTGCAAAGATCGAGAAL2CNAG_01547 5' flanking region primer 2TCACTGGCCGTCGTTTTACGTCAGCCCACCTGCTTTGTAR1CNAG_01547 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTGGGTTGATGGGAATACCAGR2CNAG_01547 3' flanking region primer 2GATTACGCAAGCGGTCATTTSOCNAG_01547 diagnostic screening primer,pairing with B79AGCAAAAACATCGCCATACCPOCNAG_01547 Southern blot probe primerTCCACATTGGTCAGCGTAAC27CNAG_03908WDP8L1CNAG_03908 5' flanking region primer 1CGAGTCTAGTCGGGCTGTCTL2CNAG_03908 5' flanking region primer 2TCACTGGCCGTCGTTTTACGTTTGTCCTCCGCTTGACATR1CNAG_03908 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTGCAGGTGAAGATGGTTCTGR2CNAG_03908 3' flanking region primer 2CAACAAAGCGAAATGAAGCASOCNAG_03908 diagnostic screening primer, pairing with B79TTGCTGGGAAGCTTGATTCTPOCNAG_03908 Southern blot probe primerAAAAAGCCCTTCCTCCAAAA28CNAG_00416WDP9L1CNAG_00416 5' flanking region primer 1ACCCAGGTCTTCATGTCCAGL2CNAG_00416 5' flanking region primer 2TCACTGGCCGTCGTTTTACACGCAACATACCTCGTCTCAR1CNAG_00416 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGAATGGAGGGAGGTGTCTGTR2CNAG_00416 3' flanking region primer 2TAGGACCGATGTAAGTGCCCSOCNAG_00416 diagnostic screening primer,pairing with B79TCAGCATTATCAACCACCCPOCNAG_00416 Southern blot probe primerAGCGGGAGGAAATCTTATC29CNAG_04117IQW1L1CNAG_04117 5' flanking region primer 1GTCGTCTGGTACCTGGCATTL2CNAG_04117 5' flanking region primer 2TCACTGGCCGTCGTTTTACCCTTTGGGAGTGGACGAATAR1CNAG_04117 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGATTTGGAGGACGAACCAGAR2CNAG_04117 3' flanking region primer 2CTCGGCTTGGACCTCTCTCSOCNAG_04117 diagnostic screening primer, pairing with B79CGTATTGGGAGAATCGGAGAPOCNAG_04117 Southern blot probe primerGGTGAAAGGGAGGAATGTGA30CNAG_06382WDP10L1CNAG_06382 5' flanking region primer 1TGTCGACACATTCTTGGGTTAL2CNAG_06382 5' flanking region primer 2TCACTGGCCGTCGTTTTACGGAAGGTGGTTCTGACGAAAR1CNAG_06382 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGGCAAAGGCCTTCCTTATGTR2CNAG_06382 3' flanking region primer 2CGCAGACAAAGGATGTTTGASOCNAG_06382 diagnostic screening primer,pairing with B79CCTTCGTGGTGTTACCTCGTPOCNAG_06382 Southern blot probe primerAGGAGATTCGCTCTGATGGA31CNAG_00927SWT21L1CNAG_00927 5' flanking region primer 1ACTGGCACCGTATGGAGAGTL2CNAG_00927 5' flanking region primer 2TCACTGGCCGTCGTTTTACTTTCGAGTGGTGAGGAAAGGR1CNAG_00927 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTTTCGGGCTCATCTCTGAATR2CNAG_00927 3' flanking region primer 2ACGGTACGGGTCTTCTACGASOCNAG_00927 diagnostic screening primer, pairing with B79TCCACCTGTGCGTCTTGTAGPOCNAG_00927 Southern blot probe primerCATCAACGAGCTTGACAGGA32CNAG_04170CMR1L1CNAG_04170 5' flanking region primer 1GAGAAGGGGTGAGAGGGATTL2CNAG_04170 5' flanking region primer 2TCACTGGCCGTCGTTTTACCGCACTATGCTGTTTCCTCAR1CNAG_04170 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCTGTGTGCTGTCTCCAAATGAR2CNAG_04170 3' flanking region primer 2CACATACGTCACCCCATTCASOCNAG_04170 diagnostic screening primer,pairing with B79AAATTTTCAGCCCACCCTCTPOCNAG_04170 Southern blot probe primerCTCTTCCACCTTTGCCTTGA33CNAG_01561GID7L1CNAG_01561 5' flanking region primer 1CCGCCTAACCTACCACCATAL2CNAG_01561 5' flanking region primer 2TCACTGGCCGTCGTTTTACTCAAAGTTCCAGAGGGTCGTR1CNAG_01561 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGATCTGGCAGCCACCTACAAGR2CNAG_01561 3' flanking region primer 2TGGTCTTGGGTAGTTGTTGCTSOCNAG_01561 diagnostic screening primer, pairing with B79CATTGCGGACATACAGGTTGPOCNAG_01561 Southern blot probe primerATGTCCCGTAATCCTTGCAG34CNAG_03681WCP1L1CNAG_03681 5' flanking region primer 1CTCGGGGAAGATGTACGAAGL2CNAG_03681 5' flanking region primer 2TCACTGGCCGTCGTTTTACAGAGGTGCTTTCACCGTCACR1CNAG_03681 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCGTAGTGCTTTAGCGTGTTTGR2CNAG_03681 3' flanking region primer 2TACCCTTCTTGACGGTTCCASOCNAG_03681 diagnostic screening primer,pairing with B79GCATGCTTTGTGACCAAATGPOCNAG_03681 Southern blot probe primerCGGTCGGTATCAGGAAGAGA35CNAG_05219REC14L1CNAG_05219 5' flanking region primer 1GAGCGAAGAGGCTTGATGAGL2CNAG_05219 5' flanking region primer 2TCACTGGCCGTCGTTTTACTTCAAGGTACGCCAAGGACTR1CNAG_05219 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCAATTTGCAGTTGCTGGAGAR2CNAG_05219 3' flanking region primer 2TCGAGCTTGAAGATGGGAACSOCNAG_05219 diagnostic screening primer, pairing with B79GCGTATTTGTCCATGTGTGCPOCNAG_05219 Southern blot probe primerAGACGTGATCGCAAGAGGAT36CNAG_07824CDT2L1CNAG_07824 5' flanking region primer 1ATAGCTGGTGGTCGTCATCCL2CNAG_07824 5' flanking region primer 2TCACTGGCCGTCGTTTTACGGAGAGGTTCTGAGGGATGGR1CNAG_07824 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGACGGATCTTTGACACGGATAR2CNAG_07824 3' flanking region primer 2TCGAAGGGGCAGAGAGAATASOCNAG_07824 diagnostic screening primer,pairing with B79TGGTGGTGGTAATGGTGATGPOCNAG_07824 Southern blot probe primerATAGCTGGTGGTCGTCATCC37CNAG_01013SWD3L1CNAG_01013 5' flanking region primer 1CTAAGAACCAGCAGCCCAAGL2CNAG_01013 5' flanking region primer 2TCACTGGCCGTCGTTTTACAGAAAATCGCAGAGCCGTAAR1CNAG_01013 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGTCATTTAGATCCGCCGAAAR2CNAG_01013 3' flanking region primer 2AATGTGTGGAAGGGCGTTAGSOCNAG_01013 diagnostic screening primer, pairing with B79TTGTGCCCTCGGATAAATTCPOCNAG_01013 Southern blot probe primerAACTACCAGTCGCGAGGAGA38CNAG_05301CRN1L1CNAG_05301 5' flanking region primer 1GCTGCCAAGCCATCTTTAACL2CNAG_05301 5' flanking region primer 2TCACTGGCCGTCGTTTTACGTTAGTCCTTCCCCCAGCTCR1CNAG_05301 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCGTCCATCGTGTAATGTTGCR2CNAG_05301 3' flanking region primer 2ATTTGGCTGACTGTCGCTCTSOCNAG_05301 diagnostic screening primer,pairing with B79CTTTTTCTCCGGCACTTCAGPOCNAG_05301 Southern blot probe primerTCCCTCAAACGCAGAGTCTT39CNAG_01867MDV1L1CNAG_01867 5' flanking region primer 1CATTGGAGAACAAGCTTGCAL2CNAG_01867 5' flanking region primer 2TCACTGGCCGTCGTTTTACGATCTCCTTGAAAGGGACCAR1CNAG_01867 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCCCGGTTACAGCACTTCAATR2CNAG_01867 3' flanking region primer 2CGACGTGTCAGGATTGAATGSOCNAG_01867 diagnostic screening primer, pairing with B79GAAGGTATGGGGAAGGTGGTPOCNAG_01867 Southern blot probe primerTCCCCATCGTCTTCATCTTC40CNAG_01016SEA3L1CNAG_01016 5' flanking region primer 1ACGCCTCGTTCGATATGCTL2CNAG_01016 5' flanking region primer 2TCACTGGCCGTCGTTTTACAGATCGGCAGGGGGATGTR1CNAG_01016 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTTTACTGTCGCGAGCAAGGTR2CNAG_01016 3' flanking region primer 2GGTGGCCTCGATAGTGTTTGSOCNAG_01016 diagnostic screening primer,pairing with B79CGTATTGGGAGAATCGGAGAPOCNAG_01016 Southern blot probe primerCGTGCACCTGTGTTGCTTAC41CNAG_07951JIP5L1CNAG_07951 5' flanking region primer 1ACTCGGTTCGATGGTTGAAGL2CNAG_07951 5' flanking region primer 2TCACTGGCCGTCGTTTTACGGGCTTGGATGCTGGTATAAR1CNAG_07951 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCAGATTCGGACGAGGAGAAGR2CNAG_07951 3' flanking region primer 2GGGAGAGAAGCGTACGTTGASOCNAG_07951 diagnostic screening primer, pairing with B79GCCCAGTGGAGGTAAGTCAAPOCNAG_07951 Southern blot probe primerAGACACACGACCCTTTGGAC42CNAG_06733RPN14L1CNAG_06733 5' flanking region primer 1CTCGGGTCAAGAGACGTGTGL2CNAG_06733 5' flanking region primer 2TCACTGGCCGTCGTTTTACCATGATCGGTTGGGACATCR1CNAG_06733 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGAATGCGTGGTTTAGGTGAATGR2CNAG_06733 3' flanking region primer 2GGTACGATCCCGTTTCCTTTSOCNAG_06733 diagnostic screening primer,pairing with B79GCGAGAGGGAGATGAGTTTGPOCNAG_06733 Southern blot probe primerGTACATGGCGGACGGGTAG43CNAG_06603DUG2L1CNAG_06603 5' flanking region primer 1AGGGCTGTTAGGCGATAGGTL2CNAG_06603 5' flanking region primer 2TCACTGGCCGTCGTTTTACGGATGGCGATAAGATTGGTGR1CNAG_06603 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCACGAGACTCGCAAGCATTR2CNAG_06603 3' flanking region primer 2GATGGTGAAGCCGTCAAAGTSOCNAG_06603 diagnostic screening primer, pairing with B79GGTCGAGGCCCAGTAAAAACPOCNAG_06603 Southern blot probe primerCCTTTACCAGCCTTCCTCCT44CNAG_05795WDP11L1CNAG_05795 5' flanking region primer 1AGAGGAAGCGTACTGCCAAAL2CNAG_05795 5' flanking region primer 2TCACTGGCCGTCGTTTTACCTTTGGAGGCAGCGACTTTR1CNAG_05795 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTCCAACGATGGAACAATCAAR2CNAG_05795 3' flanking region primer 2AACTGCCCTACGATGTCTGGSOCNAG_05795 diagnostic screening primer,pairing with B79TTGCCTGACACATCTCCAAAPOCNAG_05795 Southern blot probe primerCTTGCGAGTACTTGGGCTTC45CNAG_00752WDP12L1CNAG_00752 5' flanking region primer 1GCAACTGGCTACAATGCAAGL2CNAG_00752 5' flanking region primer 2TGGCCGTCGTTTTACTTCCCTCGATACCATCTCCAAR1CNAG_00752 3' flanking region primer 1TCATAGCTGTTTCCTGCTTGGTCATACGGGATTGGTR2CNAG_00752 3' flanking region primer 2AAAGGGTGATGGGGAAGAGTSOCNAG_00752 diagnostic screening primer, pairing with B79TCCCTTTAACGCCGACACTAPOCNAG_00752 Southern blot probe primerACCTCCTGTTATTGCCAACG46CNAG_02345EED1L1CNAG_02345 5' flanking region primer 1TGATTCCCTCACGAAAGTCL2CNAG_02345 5' flanking region primer 2TCACTGGCCGTCGTTTTACATCTGGATTCCTGTTCGGR1CNAG_02345 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCTTTGCTTGTTCCTTGGAGR2CNAG_02345 3' flanking region primer 2TAATCCCTTCCATCTCTCGSOCNAG_02345 diagnostic screening primer,pairing with B79GCAATGACACTTTATCTCGGPOCNAG_02345 Southern blot probe primerGTCATTGGTAAGTGAATCGC47CNAG_02680VPS15L1CNAG_02680 5' flanking region primer 1AGGACCTTCATCAGGACGACL2CNAG_02680 5' flanking region primer 2TCACTGGCCGTCGTTTTACAAACTACCTCCCCCGTTACR1CNAG_02680 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCCAAATGTATGGATTCGCCR2CNAG_02680 3' flanking region primer 2CTGCGAATCTCGTCTAAGGSOCNAG_02680 diagnostic screening primer, pairing with B79TTGAAAGGTCCCACCAGACPOCNAG_02680 Southern blot probe primerGGGAGGAAGTGAGGAGTATG48CNAG_02153TUP1L1CNAG_02153 5' flanking region primer 1TCTCCGCTCGAAGGTAGTGTL2CNAG_02153 5' flanking region primer 2TCACTGGCCGTCGTTTTACTGCTTGTGGACGTGTTAGGAR1CNAG_02153 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGTTCCATTCAATTCTGGCACAR2CNAG_02153 3' flanking region primer 2TGGTCTGTGCTAGCGTTACAASOCNAG_02153 diagnostic screening primer,pairing with B79CAAGCGCCTCAACGTATTTTPOCNAG_02153 Southern blot probe primerAATGCAGCAGACTCACATCG49CNAG_03297MSL1L1CNAG_03297 5' flanking region primer 1TCGCATTTGAACCTCGCTCL2CNAG_03297 5' flanking region primer 2CTGGCCGTCGTTTTACGGTTTAGTGGTGGCGTATTACR1CNAG_03297 3' flanking region primer 1GTCATAGCTGTTTCCTGTGAGGACTCCCTATGAAGCCR2CNAG_03297 3' flanking region primer 2TTCTCCCACTACCCAAAACCCCTCCNAG_03297 diagnostic screening primer 1TACGGCATCTTCCACCAGTCCNAG_03297 diagnostic screening primer 2CACTCATACCGTTCTCCTGACCNAG_03297 Southern blot probe primer 1CCATCCATCCATAAACACACCNAG_03297 Southern blot probe primer 2GATGGTAGTATCCTCACTGGC50CNAG_01262GPB1L1CNAG_01262 5' flanking region primer 1GGGTTTTGTCTCGGTCGTAAL2CNAG_01262 5' flanking region primer 2TCACTGGCCGTCGTTTTACCTCGCAGCTTGTCCTTCAGR1CNAG_01262 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCATGGATTACGGATGCAACAR2CNAG_01262 3' flanking region primer 2CCCATCATCGCCTCTATCATSOCNAG_01262 diagnostic screening primer,pairing with B79ACATGGTTCCGTTAGGCAAGPOCNAG_01262 Southern blot probe primerGCAGGGAGTAGATGGAGCAG51CNAG_05465GIB2L1CNAG_05465 5' flanking region primer 1GCGGCTACATGAGCTCTACCL2CNAG_05465 5' flanking region primer 2TCACTGGCCGTCGTTTTACGTTGCCCTTGAACATGAGGTR1CNAG_05465 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGCCGGTTTCTCTGACAACCTCR2CNAG_05465 3' flanking region primer 2GCAGGACGAGATGAAGAGGASOCNAG_05465 diagnostic screening primer, pairing with B79AAGGATCGCTTTGCGTGTAGPOCNAG_05465 Southern blot probe primerCTAAGGGTGTGGTCCCAAGA52CNAG_00693CDC4L1CNAG_00693 5' flanking region primer 1GCGGACAACGTGAAATGTGL2CNAG_00693 5' flanking region primer 2TCACTGGCCGTCGTTTTACGGCCATTTGCAGAATCTAGGR1CNAG_00693 3' flanking region primer 1CATGGTCATAGCTGTTTCCTGGATGAGGGTGAGGAGGATGAR2CNAG_00693 3' flanking region primer 2CGTCATTTGCACTGTCGAATASOCNAG_00693 diagnostic screening primer, pairing with B79TGCATTAGCACCGTTCAGTCPOCNAG_00693 Southern blot probe primerACTCTCTCCAGGGGCATTTT,

[0058]

[0059] No.H99 locus tag (Broad ID)Cngene namePrimer namePrimer descriptionPrimer sequence (5'-3')1CNAG_04194SEC13L1CNAG_04194 5' flanking region primer 1AGTGTTTCGGTGATAACGGL2CNAG_04194 5' flanking region primer 2CACTCGAATCCTGCATGCGGTAGATTGATAAGACTGR1CNAG_04194 3' flanking region primer 1ACAACGACTTCACCAATCATGGTATGTTCCGGAACCR2CNAG_04194 3' flanking region primer 2TTTGAGGAGCAAGAGAGTTGSOCNAG_04194 diagnostic screening primer, pairing with B79TCTTCAAGCCCATCTTCTCPOCNAG_04194 Southern blot probe primerCGCTTCCCATAATAGTCAAG2CNAG_00602TIF34L1CNAG_00602 5' flanking region primer 1ACGTGGTCATGATGTGGAAAL2CNAG_00602 5' flanking region primer 2GCCACTCGAATCCTGCATGCTTTTGCTGCTACGCTTTTR1CNAG_00602 3' flanking region primer 1CGACAACGACTTCACCAATCATGGTGAGCATATGGACGR2CNAG_00602 3' flanking region primer 2ATTTTGACGAAGACGCCAACSOCNAG_00602 diagnostic screening primer,pairing with B79GCACACTGTGGATTCTGGTGPOCNAG_00602 Southern blot probe primerTTGAAGCGGAAAAGAGGAGA3CNAG_06798UTP18L1CNAG_06798 5' flanking region primer 1CCACCTTCACACATGTACGCL2CNAG_06798 5' flanking region primer 2GCCACTCGAATCCTGCATGCTGTATCTTGTATTGAGATR1CNAG_06798 3' flanking region primer 1CGACAACGACTTCACCAATCATGCCCAGAAACAAGAAGR2CNAG_06798 3' flanking region primer 2ATGATGGCTTTCGTCAGCTTSOCNAG_06798 diagnostic screening primer, pairing with B79GGAGGGCAAAGGTCTTGAATPOCNAG_06798 Southern blot probe primerAGAGCGTACGTCGTTGTCCT4CNAG_06778WDP1L1CNAG_06778 5' flanking region primer 1CTGGGTTCCACGTTTAGCATL2CNAG_06778 5' flanking region primer 2GCCACTCGAATCCTGCATGCCGTTGCTATTGCAGTAGAR1CNAG_06778 3' flanking region primer 1CGACAACGACTTCACCAATCATGCAGGGATACAGCAACR2CNAG_06778 3' flanking region primer 2TTTCTCGTGTCCACCCTACCSOCNAG_06778 diagnostic screening primer,pairing with B79ATGAAGGCTGAGATCGGAGAPOCNAG_06778 Southern blot probe primerGATGAGGGGACAGAACCAGA5CNAG_06748UTP7L1CNAG_06748 5' flanking region primer 1AGGTGCCCATGTCCAGTATCTTL2CNAG_06748 5' flanking region primer 2CACTCGAATCCTGCATGCGTTTGGGAGATGGGGATTR1CNAG_06748 3' flanking region primer 1CGACAACGACTTCACCAATCATGGACGCCCTCTTAACAR2CNAG_06748 3' flanking region primer 2TAATTCCACGCCATTTTGGTSOCNAG_06748 diagnostic screening primer, pairing with B79ATGTCAAAACCGGCTCATCTPOCNAG_06748 Southern blot probe primerACATCTTGCAAGGCGATTTT6CNAG_00775UTP15L1CNAG_00775 5' flanking region primer 1GGATGGACATTGTGCTGTTGL2CNAG_00775 5' flanking region primer 2GCCACTCGAATCCTGCATGCTTTGGGTACGGCCTATAGR1CNAG_00775 3' flanking region primer 1CGACAACGACTTCACCAATCATGGAGTTTCTGCCGCTGCGCACCR2CNAG_00775 3' flanking region primer 2GAACGCCAAGATATCCTCCASOCNAG_00775 diagnostic screening primer,pairing with B79TGAGGTAGCTAGTTGAAGGAGAGGPOCNAG_00775 Southern blot probe primerCACGTCGAAGACCTGAACAA7CNAG_00916WDP2L1CNAG_00916 5' flanking region primer 1CCGAACGGTCAAAAACAGTAL2CNAG_00916 5' flanking region primer 2CACTCGAATCCTGCATGCCTTGTATTTGCGCTAGAGR1CNAG_00916 3' flanking region primer 1CGACAACGACTTCACCAATCATGGAGGGCTTCGACCTCR2CNAG_00916 3' flanking region primer 2CTTGTATTTGCGCTAGAGSOCNAG_00916 diagnostic screening primer, pairing with B79AAAAACGCAGAGACAAGGTGPOCNAG_00916 Southern blot probe primerCTTGTATTTGCGCTAGAG8CNAG_05878ARC40L1CNAG_05878 5' flanking region primer 1CGTCTGATGCGCAAAGTTTAL2CNAG_05878 5' flanking region primer 2CACTCGAATCCTGCATGCTGTTGGTAAGAGGGAGGAR1CNAG_05878 3' flanking region primer 1CGACAACGACTTCACCAATCATGTCTGCCCCAGAAGTAR2CNAG_05878 3' flanking region primer 2CGGGCCTATCATACGTGAGTSOCNAG_05878 diagnostic screening primer,pairing with B79ATTCAGTGATACGGGCTTCGPOCNAG_05878 Southern blot probe primerGAAACGGCCACGTCTATTGT9CNAG_06696CDC55L1CNAG_06696 5' flanking region primer 1TTGCTAAACGGTAGTATCGGL2CNAG_06696 5' flanking region primer 2CACTCGAATCCTGCATGCGGTATGAATCCGGTTGGTR1CNAG_06696 3' flanking region primer 1CGACAACGACTTCACCAATCATGGATGTCGAACCAACGR2CNAG_06696 3' flanking region primer 2TTGATGTGATAGGCGTGAGSOCNAG_06696 diagnostic screening primer, pairing with B79CCCGATAGGCTTCATACTTACPOCNAG_06696 Southern blot probe primer 1AGACGGACCTTCAGTAATGTC10CNAG_03975ERB1L1CNAG_03975 5' flanking region primer 1ATGTCGCGCTACTTCCTTCAL2CNAG_03975 5' flanking region primer 2GCCACTCGAATCCTGCATGCCTTGACCGGTCTCTTGCTGR1CNAG_03975 3' flanking region primer 1CGACAACGACTTCACCAATCATGGCACCCCAACCACTCR2CNAG_03975 3' flanking region primer 2TCTTCGGCAGAAGTCCAAGSOCNAG_03975 diagnostic screening primer,pairing with B79GTTCTTCCTCCCGCCTTTACPOCNAG_03975 Southern blot probe primerTCATCCTCCTCATCGTCTCC11CNAG_03271PRP46L1CNAG_03271 5' flanking region primer 1CTGGATAGCGCATGTCTCAAL2CNAG_03271 5' flanking region primer 2CACTCGAATCCTGCATGCTGGTGAAAACGGAGCTACR1CNAG_03271 3' flanking region primer 1CGACAACGACTTCACCAATCATGTCAGCATCACTTGAAR2CNAG_03271 3' flanking region primer 2CCCATATCTTTCAGCCAGGASOCNAG_03271 diagnostic screening primer, pairing with B79CGAGGGTAGGTGGTGGTAGAPOCNAG_03271 Southern blot probe primerGTTTGCTCCCTGCTCGTACT12CNAG_01439PRP4L1CNAG_01439 5' flanking region primer 1GCCAGAAGACAAGTCGGAAGL2CNAG_01439 5' flanking region primer 2CACTCGAATCCTGCATGCCGCGGTGTGCAGGAGGAGR1CNAG_01439 3' flanking region primer 1CGACAACGACTTCACCAATCATGGACTTGGACGACCTCR2CNAG_01439 3' flanking region primer 2CTCCAACCTTCTCCGTGTGTSOCNAG_01439 diagnostic screening primer,pairing with B79GGCTCAGGGAACCATGAATAPOCNAG_01439 Southern blot probe primerCTTCTTGCGTTCGAGCTCTT13CNAG_02267BUB3L1CNAG_02267 5' flanking region primer 1CAAACCAAGAGACGGGAAAAL2CNAG_02267 5' flanking region primer 2CACTCGAATCCTGCATGCGACGTTTTATGAGATGTAGAR1CNAG_02267 3' flanking region primer 1ACAACGACTTCACCAATCATGTCCTCAGGTAAGCATCTR2CNAG_02267 3' flanking region primer 2GCGTAGGCGAGATTGTAAGCSOCNAG_02267 diagnostic screening primer, pairing with B79CAGCTCACTCACCGACAGAAPOCNAG_02267 Southern blot probe primer 1CTGGTGGACACACATCTTGG14CNAG_04803SEC31L1CNAG_04803 5' flanking region primer 1CTTGATCCGCATTGTCTTCAL2CNAG_04803 5' flanking region primer 2CACTCGAATCCTGCATGCTTTGCGATTGGCGACTTGR1CNAG_04803 3' flanking region primer 1ACAACGACTTCACCAATCATGAAACTCAAGGACATCR2CNAG_04803 3' flanking region primer 2GCCTTCAAATCCCAAACAGASOCNAG_04803 diagnostic screening primer,pairing with B79CGCTTGGTGGAAATGAAGATPOCNAG_04803 Southern blot probe primer 1GAGCTGAGATTCGTTGCTGA15CNAG_07756CDC20L1CNAG_07756 5' flanking region primer 1GCTTGAAGCTGGAAGGTTTGL2CNAG_07756 5' flanking region primer 2CACTCGAATCCTGCATGCGAAGGGACCGTTTTTGACR1CNAG_07756 3' flanking region primer 1ACAACGACTTCACCAATCATGCTTGGAGAACATACAR2CNAG_07756 3' flanking region primer 2TCGCCACTCTATTTGCACAGSOCNAG_07756 diagnostic screening primer, pairing with B79ATCGACAACATGCGACCATAPOCNAG_07756 Southern blot probe primer 1GCTCTCGGACTTCGGTAGTG16CNAG_06107LST8L1CNAG_06107 5' flanking region primer 1CATTGATGCGGAGTGAGTTGL2CNAG_06107 5' flanking region primer 2CACTCGAATCCTGCATGCTTTCGTTGATCCTTCCACR1CNAG_06107 3' flanking region primer 1ACAACGACTTCACCAATCATGGCCCCAGCACCTACAR2CNAG_06107 3' flanking region primer 2GAACAACGGGAACGTGTCTTSOCNAG_06107 diagnostic screening primer,pairing with B79CATTGGGGCGACTAGAACATPOCNAG_06107 Southern blot probe primerAGATGAACGGACCCATTGAG17CNAG_04802RRP9L1CNAG_04802 5' flanking region primer 1CCATACCTGAGGCAAGCACTL2CNAG_04802 5' flanking region primer 2CACTCGAATCCTGCATGCAGCGGATTCTGCGGTTCCR1CNAG_04802 3' flanking region primer 1ACAACGACTTCACCAATCATGCCTGACCCATTTTTTR2CNAG_04802 3' flanking region primer 2TCCCATACACCCATCACCTTSOCNAG_04802 diagnostic screening primer, pairing with B79CTGGACCAGTGTGCTTTTCAPOCNAG_04802 Southern blot probe primerATCCTCCCGACCCTCTCTAA18CNAG_06077GLE2L1CNAG_06077 5' flanking region primer 1AAGCGGGGAGGTAGTGTTCTL2CNAG_06077 5' flanking region primer 2CACTCGAATCCTGCATGCGGTCGAGGATGTGCGCGGR1CNAG_06077 3' flanking region primer 1ACAACGACTTCACCAATCATGCTGTCCACTTTCCGAR2CNAG_06077 3' flanking region primer 2GCATCTCCGGTAGGAAAACASOCNAG_06077 diagnostic screening primer,pairing with B79GGGAAGGAAATACGGTGGATPOCNAG_06077 Southern blot probe primerTCGCCACAGCAAGTATATCG19CNAG_06318YTM1L1CNAG_06318 5' flanking region primer 1TCCTCTCAGCTTTGGCATCTL2CNAG_06318 5' flanking region primer 2CACTCGAATCCTGCATGCCTTTCGTTGGGTATAAACR1CNAG_06318 3' flanking region primer 1ACAACGACTTCACCAATCATGTCGATCGACCCAGCTR2CNAG_06318 3' flanking region primer 2GCGTCAGGAAGGACGTAGAGSOCNAG_06318 diagnostic screening primer, pairing with B79TACCGATTGTGGCAAGCATAPOCNAG_06318 Southern blot probe primerGCCGAGAACCTGGTTTATGA20CNAG_05428TAF5L1CNAG_05428 5' flanking region primer 1GGGTGATTGTTGATGCAGTGL2CNAG_05428 5' flanking region primer 2CACTCGAATCCTGCATGCATTTTTGGGTCGCGGATGR1CNAG_05428 3' flanking region primer 1CGACAACGACTTCACCAATCATGTCTCAGTCCCCAGACR2CNAG_05428 3' flanking region primer 2GGCCATTGACTACACACCTGSOCNAG_05428 diagnostic screening primer,pairing with B79CCCATCAATCCTGCTGTGTAPOCNAG_05428 Southern blot probe primerCTCCTCCTTGTTCACCTGTCGT21CNAG_01898MAK11L1CNAG_01898 5' flanking region primer 1ATCTCTGTCAGCCACCGACTL2CNAG_01898 5' flanking region primer 2CACTCGAATCCTGCATGCTGTGTTTAATTGATATAAGR1CNAG_01898 3' flanking region primer 1CGACAACGACTTCACCAATCATGGGTAAACACGGTAAAR2CNAG_01898 3' flanking region primer 2TTGACCCTTCCAGAGTGACCSOCNAG_01898 diagnostic screening primer, pairing with B79TGCATCTTCATAGCGAGCACPOCNAG_01898 Southern blot probe primerCGGCCTTCTCCTTCTTTTCT22CNAG_04900CIA1 L1CNAG_04900 5' flanking region primer 1GGTCGGTGTACTTGGCTTGTL2CNAG_04900 5' flanking region primer 2CACTCGAATCCTGCATGCTTTTGATATAATGGTTTTR1CNAG_04900 3' flanking region primer 1ACAACGACTTCACCAATCATGCCTCGGCTCCAATCCR2CNAG_04900 3' flanking region primer 2GCAGGATAAGGTGGAAACGASOCNAG_04900 diagnostic screening primer,pairing with B79TACGTAGTTTCGGGGTTTCGPOCNAG_04900 Southern blot probe primerAGCGGGTAGGGTTGAAAGAT23CNAG_01630PSF2L1CNAG_01630 5' flanking region primer 1GTGTGCTGTGAAGTGGAAGL2CNAG_01630 5' flanking region primer 2CACTCGAATCCTGCATGCCGTGGCGAGTGGTTAGTTR1CNAG_01630 3' flanking region primer 1CGACAACGACTTCACCAATCATGACAGTCCCCGGCCACR2CNAG_01630 3' flanking region primer 2CGGACTCCAACTAACATCATSOCNAG_01630 diagnostic screening primer, pairing with B79TTGGACGAAGGATAGATGACPOCNAG_01630 Southern blot probe primerCCATTCTCCATTTCTGGAC24CNAG_07957SOF1L1CNAG_07957 5' flanking region primer 1AGAGGGCCTGTACCCTCTGTL2CNAG_07957 5' flanking region primer 2CACTCGAATCCTGCATGCTTTTGCGGTTGTTTTATGR1CNAG_07957 3' flanking region primer 1CGACAACGACTTCACCAATCATGGTAAGCTCAAGCCTCR2CNAG_07957 3' flanking region primer 2ACACTGGTCTCGCTCTGGTTSOCNAG_07957 diagnostic screening primer,pairing with B79TGCGGTCCATTCCTCTATTCPOCNAG_07957 Southern blot probe primerCACCAAGAGCGTCAACAAAA25CNAG_00822SQT1L1CNAG_00822 5' flanking region primer 1GACATCGCCACTATCGGAACL2CNAG_00822 5' flanking region primer 2GCCACTCGAATCCTGCATGCATTTACAAATGTGCTGGAACR1CNAG_00822 3' flanking region primer 1CGACAACGACTTCACCAATCATGTCTGTCGACGAGGAAGR2CNAG_00822 3' flanking region primer 2ATGCGTGAAATTGGGACTTGSOCNAG_00822 diagnostic screening primer, pairing with B79CGGTAAACAGGCCAAGTAGCPOCNAG_00822 Southern blot probe primerACCCCAACTGTTGTCTGCTC26CNAG_05773MET30L1CNAG_05773 5' flanking region primer 1CAAACGCAAAATCCCAGACTL2CNAG_05773 5' flanking region primer 2CACTCGAATCCTGCATGCGGTGGGAGAGGTAAGGCCR1CNAG_05773 3' flanking region primer 1ACAACGACTTCACCAATCATGTCTCCTTCTGCGCCAR2CNAG_05773 3' flanking region primer 2CCCATTTTCATTTTCGTGCTSOCNAG_05773 diagnostic screening primer,pairing with B79GGAGAAGCGAATACGAGCAGPOCNAG_05773 Southern blot probe primerGGTCAAAATGCCTTCCAAAA27CNAG_04407PAC11L1CNAG_04407 5' flanking region primer 1GCCCAACACTCCTGAACATTL2CNAG_04407 5' flanking region primer 2CACTCGAATCCTGCATGCGATCGGGGTACGCTACAGR1CNAG_04407 3' flanking region primer 1ACAACGACTTCACCAATCATGAGCGACAGGAGACGGR2CNAG_04407 3' flanking region primer 2TTGAGCGTCGTCATAACCAASOCNAG_04407 diagnostic screening primer, pairing with B79TCCGGGAAGAAGTCACAATCPOCNAG_04407 Southern blot probe primerTCGACCAGTTCGTTGACATC28CNAG_01432RSA4 L1CNAG_01432 5' flanking region primer 1TGCAGGTGATCGAGAAAATGL2CNAG_01432 5' flanking region primer 2CACTCGAATCCTGCATGCGGTGGAAGGTTGTGGATGR1CNAG_01432 3' flanking region primer 1ACAACGACTTCACCAATCATGGCTACTCAACTCCCCR2CNAG_01432 3' flanking region primer 2TTTGAAGCAGACGCAATACGSOCNAG_01432 diagnostic screening primer,pairing with B79GGGAACTTGCGAGGTAACTGPOCNAG_01432 Southern blot probe primerGCTAGAGTCAGCGGGTATGC29CNAG_03554COP1 L1CNAG_03554 5' flanking region primer 1AAGAGCCTCTGGCTTCTTCCL2CNAG_03554 5' flanking region primer 2CACTCGAATCCTGCATGCCTTGCCCCGAGTATCTCAR1CNAG_03554 3' flanking region primer 1ACAACGACTTCACCAATCATGCAGATGCTCACAAAGR2CNAG_03554 3' flanking region primer 2AGGATGGAAAGAAGCCCAGTSOCNAG_03554 diagnostic screening primer, pairing with B79TGAGTCTATCGCTGGTGTCGPOCNAG_03554 Southern blot probe primerTGGATTGTTCCGTTATGCAA30CNAG_04074SEC27L1CNAG_04074 5' flanking region primer 1CCCACCCTTGTTCCTCAGTL2CNAG_04074 5' flanking region primer 2GCCACTCGAATCCTGCATGCGGTTACTCAAGCAAGCGAGR1CNAG_04074 3' flanking region primer 1CGACAACGACTTCACCAATCATGGTAAGTGACAATCCCR2CNAG_04074 3' flanking region primer 2CCGAGTTTCCAAGAGACCAGSOCNAG_04074 diagnostic screening primer,pairing with B79TTCCACACTTCCCCTGTACCPOCNAG_04074 Southern blot probe primerCTGATCGGGCCAGTAGTTTC31CNAG_07439UTP21 L1CNAG_07439 5' flanking region primer 1AGGATGGGAATCGGTAGGACL2CNAG_07439 5' flanking region primer 2CACTCGAATCCTGCATGCGTTGAAGGGTTTTTGAAGR1CNAG_07439 3' flanking region primer 1ACAACGACTTCACCAATCATGATTCCCTCTTTAGAAR2CNAG_07439 3' flanking region primer 2CCGGATGCATTAACGAAGATSOCNAG_07439 diagnostic screening primer, pairing with B79GGGCATCCTTACAAGAGCAGPOCNAG_07439 Southern blot probe primerCCTTCCCACTGAGGTCGTTA32CNAG_05101DIP2L1CNAG_05101 5' flanking region primer 1GTATGGCCAGAAGAGCGAAGL2CNAG_05101 5' flanking region primer 2CACTCGAATCCTGCATGCGTCTGCCTGTTCGAATATR1CNAG_05101 3' flanking region primer 1CGACAACGACTTCACCAATCATGGTCAAGTCATATATGR2CNAG_05101 3' flanking region primer 2CTCTTGATCCTCGGCTTCACSOCNAG_05101 diagnostic screening primer,pairing with B79AGGATCAAGGCTTTGGAAGAPOCNAG_05101 Southern blot probe primerTGAGACCGCAAAAGTGACAG33CNAG_03645WDP3L1CNAG_03645 5' flanking region primer 1GCCATAAAGCTGGATGGGTAL2CNAG_03645 5' flanking region primer 2GCCACTCGAATCCTGCATGCTATGGCAAATTGAAAGAAGAR1CNAG_03645 3' flanking region primer 1CGACAACGACTTCACCAATCATGGCTGAAACTTCGCAAR2CNAG_03645 3' flanking region primer 2TCCAAGGAGAACAGGATTGGSOCNAG_03645 diagnostic screening primer, pairing with B79ATCATCAAGGGAGTGCCAAGPOCNAG_03645 Southern blot probe primerTTACGTGCCTGCCTCTTTCT34CNAG_02982UTP13L1CNAG_02982 5' flanking region primer 1GAGGCTGAGGTGTTGTGGATL2CNAG_02982 5' flanking region primer 2GCCACTCGAATCCTGCATGCTTTTGTAGTAGGTATACCR1CNAG_02982 3' flanking region primer 1CGACAACGACTTCACCAATCATGAGCGGAACCCACTCGR2CNAG_02982 3' flanking region primer 2CATCGGGGGTAACATCAATCSOCNAG_02982 diagnostic screening primer,pairing with B79GGTGGGAGGAAAGTGTTGAAPOCNAG_02982 Southern blot probe primerTGCACTTCAGTGACCAAAGC35CNAG_03124PWP2L1CNAG_03124 5' flanking region primer 1TCGTCAGGTCCTCCAACTTCL2CNAG_03124 5' flanking region primer 2CACTCGAATCCTGCATGCTGTCACTGGATATCGTTCR1CNAG_03124 3' flanking region primer 1CGACAACGACTTCACCAATCATGAAGTCTAACTTCGTCR2CNAG_03124 3' flanking region primer 2GTCCCGAGAAACGGTGTAAASOCNAG_03124 diagnostic screening primer, pairing with B79GGTCCTCGTCTTTTTGGACAPOCNAG_03124 Southern blot probe primerAGGAGATCAGCCGAAGATCA36CNAG_01063KOG1L1CNAG_01063 5' flanking region primer 1CCTCATCATCGTCGGCTAATL2CNAG_01063 5' flanking region primer 2CACTCGAATCCTGCATGCGGCGAGTGCTACGTCGGCR1CNAG_01063 3' flanking region primer 1CGACAACGACTTCACCAATCATGACCCAGTACGGAGAGR2CNAG_01063 3' flanking region primer 2AGGCTGACGGGAATGTATTGSOCNAG_01063 diagnostic screening primer,pairing with B79TGAGGTATCCCAGGAAGTGCPOCNAG_01063 Southern blot probe primerCCTCCTCATCCACAAATGCT37CNAG_03349CDC40L1CNAG_03349 5' flanking region primer 1AGAAGCAAGGAGGTGGACAAL2CNAG_03349 5' flanking region primer 2CACTCGAATCCTGCATGCGGCGTAATGGCTGACGGCR1CNAG_03349 3' flanking region primer 1CGACAACGACTTCACCAATCATGCCTTCTCTGATCGCAR2CNAG_03349 3' flanking region primer 2TACCGCCTCGCTTTCTCTTASOCNAG_03349 diagnostic screening primer, pairing with B79GGTGGTGAAATCCCGATATGPOCNAG_03349 Southern blot probe primerCTTTCGCCACAGATGTCAAA,

[0060]

[0061] Primer namePrimer descriptionPrimer sequence (5'-3')B1026M13 Forward extendedGTAAAACGACGGCCAGTGAGCB1027M13 Reverse extendedCAGGAAACAGCTATGACCATGB79Screening primerTGTGGATGCTGGCGGAGGATAB1454NAT split marker primer 1AAGGTGTTCCCCGACGACGAATCGB1455NAT split marker primer 2AACTCCGTCGCGAGCCCCATCAACB1886NEO split marker primer 1TGGAAGAGATGGATGTGCB1887NEO split marker primer 2ATTGTCTGTTGTGCCCAGB679qRT-PCR primer forACT1CGCCCTTGCTCCTTCTTCTATGB680qRT-PCR primer forACT1GACTCGTCGTATTCGCTCTTCGB8953qRT-PCR primer forLAC1CACCCTTTGGAAGTTGTGGB8954qRT-PCR primer forLAC1TGATAATTGCAGAGTACCGB3737qRT-PCR primer forBZP4AGCCAGGTAATCTTGGAGGB8521qRT-PCR primer forBZP4CAATATACGAATCACTCCCB6394qRT-PCR primer forHOB1CCTCGCAAGTTCCCCAGCTAB8519qRT-PCR primer forHOB1GTATGAGGTCTTGTCCACCB8654qRT-PCR primer forITR1ACTTCAACCGAGGTCATACTCB8655qRT-PCR primer forITR1AAGATTCCGATACCAAGGGCB8658qRT-PCR primer forITR3CCCCTTTGGTCAGGTGATTTCB8659qRT-PCR primer forITR3CGCTGAAATAGGGATGGAACAGB8656qRT-PCR primerforMPR1CGAGGTTCTTGATGATGCTGB8657qRT-PCR primer forMPR1ATCCGAGGAAAGTCTGAGCCB8598qRT-PCR primer forFZC31AAATGTCCCGAAAAGGAAGB4951qRT-PCR primer forFZC31TCTCTTCTTCTTCTGACCTGCB9243qRT-PCR primer forGAT201CATCCCGTCGCCACAGCB9422qRT-PCR primer forGAT201GGAGTATGGCTGAAATCTGB9061qRT-PCR primer forPDR802TTTCGTAGCCTGTAAGTGGCB4913qRT-PCR primer forPDR802GGAACATTGGGAAAAGGTG

[0062]

[0063] Gene nameGene nameStrain names (YSB #)GenotypesParentsCNAG_04158HIRA9421, 9422MATαhiraΔ::NAT STM#295H99SCNAG_06888SEA411112, 11114MATαsea4Δ::NAT STM#169H99SCNAG_01733PRP199493, 9494MATαprp19Δ::NAT STM#125H99SCNAG_00073FAR89101, 9102MATαfar8Δ::NAT STM#230H99SCNAG_04694PWP19003, 9004MATαpwp1Δ::NAT STM#273H99SCNAG_01828SWD17459, 7460MATαswd1Δ::NAT STM#6H99SCNAG_05084DOA17605, 7606MATαdoa1Δ::NAT STM#102H99SCNAG_03191CDH19135, 9136MATαcdh1Δ::NAT STM#288H99SCNAG_04377SEA29401, 9402MATαsea2Δ::NAT STM#123H99SCNAG_06597SPT89121, 9122MATαspt8Δ::NAT STM#218H99SCNAG_05816WDP49110, 9111MATαCNAG_05816Δ::NAT STM#6H99SCNAG_03584SPF388995, 8996MATαspf38Δ::NAT STM#282H99SCNAG_01337BUN628824, 8825MATαbun62Δ::NAT STM#295H99SCNAG_00528WDP511398, 11399MATαCNAG_00528Δ::NAT STM#230H99SCNAG_03070SWD211408, 11409MATαswd2Δ::NAT STM#282H99SCNAG_03940ELP27732, 7733MATαelp2Δ::NAT STM#150H99SCNAG_07453TEX110035, 10036MATαtex1Δ::NAT STM#184H99SCNAG_04411WDP69092, 9094MATαCNAG_04411Δ::NAT STM#159H99SCNAG_05294FBW79313,9314MATαfbw7Δ::NAT STM#122H99SCNAG_03037WDR88927, 8928MATαwdr8Δ::NAT STM#290H99SCNAG_06282BUN10711313, 11314MATαbun107Δ::NAT STM#177H99SCNAG_00516PEX79068, 9069MATαpex7Δ::NAT STM#58H99SCNAG_07548WDP77499, 7500MATαCNAG_07548Δ::NAT STM#201H99SCNAG_05824DCA77550, 7551MATαdca7Δ::NAT STM#159H99SCNAG_00567RRT29161, 9162MATαrrt2Δ::NAT STM#119H99SCNAG_01547AIP19321, 9320MATαaip1Δ::NAT STM#5H99SCNAG_03908WDP89114, 9115MATαaip1Δ::NAT STM#5H99SCNAG_00416WDP98815, 8816MATα CNAG_03908Δ::NAT STM#219H99SCNAG_04117IQW19201, 9205MATα CNAG_00416Δ::NAT STM#288H99SCNAG_06382WDP108936, 8937MATαiqw1Δ::NAT STM#150H99SCNAG_00927SWT219200, 9317MATα CNAG_06382Δ::NAT STM#242H99SCNAG_04170CMR110313, 10314MATαswt21Δ::NAT STM#116H99SCNAG_01561GID710309, 10311MATαcmr1Δ::NAT STM#296H99SCNAG_03681CYP1210389, 10390MATαgid7Δ::NAT STM#6H99SCNAG_05219REC149345, 9346MATαcyp12Δ::NAT STM#218H99SCNAG_07824CDT29343, 9344MATαrec14Δ::NAT STM#296H99SCNAG_01013SWD310237, 10238MATαcdt2Δ::NAT STM#116H99SCNAG_05301CRN110823,10824MATαswd3Δ::NAT STM#119H99SCNAG_01867MDV110839, 10840MATαcrn1Δ::NAT STM#43H99SCNAG_01016SEA310242, 10243MATαmdv1Δ::NAT STM#146H99SCNAG_07951JIP59595, 9596MATαsea3Δ::NAT STM#146H99SCNAG_06733RPN1410830, 10831MATαjip5Δ::NAT STM#220H99SCNAG_06603DUG210496, 10497MATαrpn14Δ::NAT STM#242H99SCNAG_05795WDP1111403, 11404MATα CNAG_06603Δ::NAT STM#219H99SCNAG_00752WDP1210524, 10525MATαCNAG_00752Δ::NAT STM#210H99SCNAG_02345EED17608, 7609MATαeed1Δ::NAT STM#146H99SCNAG_02680VPS151500, 1501MATαvps15Δ::NAT STM#123H99SCNAG_02153TUP110038, 10039MATαtup1Δ::NAT STM#204H99SCNAG_03297MSL113MATαmsl1Δ::NAT STM#123H99SCNAG_01262GPB111027, 11028MATαgpb1Δ::NAT STM#125H99SCNAG_05465GIB211021, 11022MATαgib2Δ::NAT STM#150H99SCNAG_00693CDC4 (variant)11015, 11016MATαcdc4Δ::NAT STM#125H99S,

[0064]

[0065] 2. Construction of strains with WCP1 complementation, domain deletion, and epitope tags.

[0066] To confirm the phenotype observed in the wcp1Δ mutant, a plasmid containing WCP1 was generated using the Gibson assembly method for mutant complementation. A full-length WCP1 gene fragment containing the 5' flanking region (including 1000 bp of the WCP1 promoter), the entire ORF, and the 3' flanking region (including 500 bp of the WCP1 terminator) was amplified by Phusion PCR using H99 gDNA as a template, and this amplified MATα WCP1 gene fragment was cloned into the pNEO plasmid. The Wcp1 domain deletion strain was constructed by expressing each domain deletion allele (WCP1 PPIaseΔ and WCP1 WD40Δ ) was generated by complementation of the wcp1Δ mutant. Specific primers were designed to amplify a truncated version of the WCP1 gene that lacks the corresponding domain. WCP1 PPIaseΔ In the case of WCP1, the region corresponding to the PPIase domain was deleted, leaving only the 5' and 3' flanking sequences fused to the remaining region of the ORF. WD40Δ For , the WD40 domain coding region was deleted in a similar manner. The PCR products were cloned into the pNEO plasmid via Gibson assembly. These plasmids were then linearized with MfeI and introduced into the wcp1Δ mutant strain (YSB10389) via biological transformation. Targeted reintegration of the wild-type and domain-deleted WCP1 alleles into the original site was confirmed by diagnostic PCR using specific primer sets. To monitor the subcellular localization of Wcp1 and perform proteomic analysis, the C-terminus of WCP1 was tagged with a fluorescent protein (mCherry) or a 4xFLAG epitope, and the pNEO_mCherry plasmid was cloned and introduced into the wcp1Δ mutant strain via biological transformation.

[0067]

[0068] 3. Construction of C. neoformans CTR4 promoter replacement strain

[0069] Thirty-seven WD40 genes that remained intact after multiple knockout attempts underwent CTR4 promoter replacement. The primer pair B354 / B355 was used to amplify the NAT-CTR4 promoter by PCR using pNAT-CTR4 as a template. Approximately 800 bp of the promoter region and approximately 800 bp of the 5' region of each target gene were amplified using H99 gDNA as a template using the primer pairs CTR4_L1 / CTR4_L2 and CTR4_R1 / CTR4_R2, respectively. After amplifying the promoter, 5' exon region, and NAT-CTR4 in the first PCR round, the 5' and 3' regions of the NAT-CTR4-split cassette were amplified in a second PCR round using the primer pairs CTR4_L1 / SM2 and CTR4_R2 / SM1. The target insertion cassette was transformed into C. neoformansH99. Stable transformants were selected and screened for correct insertion using diagnostic PCR, and Southern blot analysis was performed using gene-specific probes to confirm the correct genotype of the promoter replacement strain.

[0070]

[0071] 4. Growth and chemical sensitivity tests

[0072] C. neoformans cultures were cultured at 30°C for 16 h. These cultures were serially diluted 10-fold (1–10 4) and inducing environmental stresses were spotted onto YPD agar plates containing various chemicals. The tested stress conditions included osmotic stress (sorbitol), cation / salt stress (NaCl and KCl) under glucose-rich (YPD) or glucose-depleted (YP) conditions, oxidative stress (H2O2, tert-butyl hydroperoxide, menadione, and diamide), toxic heavy metal stress (CdSO4), genotoxic stress (methyl methanesulfonate and hydroxyurea), cell membrane destabilizing stress (sodium dodecyl sulfate), cell wall destabilizing stress (calcofluor white and Congo red), ER stress (tunicamycin and dithiothreitol), and antifungal drug susceptibility (fludioxonil, fluconazole, amphotericin B, and flucytosine). In addition, C. To assess the growth of neoformans strains, serially diluted cells were spotted onto YPD agar plates and incubated at 25°C, 37°C (with or without 5% CO2), and 39°C. Cells were cultured at 30°C for 1–5 days, and plates were photographed daily.

[0073]

[0074] 5. Crossbreeding test

[0075] To evaluate the efficiency of one-way crossover, each MATαWD40 mutant (constructed from the H99S strain) and the MATα KN99a strain were cultured in YPD medium at 30°C for 16 h. The cells were then washed twice with phosphate-buffered saline (PBS) and resuspended in the same concentration (10 7 cells / ml) and then spotted onto V8 agar medium (pH 5). The plates were incubated in the dark at 25°C for 14 days. Filament growth was monitored and photographs were taken weekly.

[0076]

[0077] 6. In vitro virulence factor production assay

[0078] To evaluate capsule production, each WD40 mutant was cultured at 30°C, spotted onto Dulbecco's modified Eagle's (DME) agar, and then incubated at 37°C for 2 days. After incubation, the cells were scraped and suspended in distilled water. The suspended cells were stained with India ink (BactiDrop; Remel, San Diego, CA, USA) and observed under a differential interference contrast (DIC) microscope (BX51, Olympus, Tokyo, Japan). Capsule thickness was determined by subtracting the cell diameter from the total capsule diameter (total diameter - cell body diameter). For quantitative analysis, 50 cells were measured for each WD40 mutant and the H99S strain. To evaluate melanin production, each WD40 mutant was cultured on YPD medium at 30°C for 16 h, washed with PBS, and then spotted (3 μL) onto Niger seed agar containing 0.1% or 0.2% glucose. Plates were cultured at 37°C and photographed after 1–3 days. For WD40 mutants showing growth defects at 37°C, both melanin and capsule production efficiencies were evaluated at 30°C. For urease production, each WD40 mutant was cultured at 30°C for 16 h, washed with distilled water, and then inoculated into rapid urea medium (RUH) in 10 ml medical tubes (SPL Life Sciences) (10 8 (dog cells). The cells were cultured in a shaking incubator at 30°C for 2 hours. After culture, the cells were harvested by centrifugation, and the absorbance of the supernatant was measured at 570 nm using a DU 730 UV / Vis spectrometer (Beckman Coulter).

[0079]

[0080] 7. STM-based mouse infectivity assay

[0081] A set of WD40 mutants with a unique signature tag NAT selection marker were cultured at 30°C for 16 h. The ste50Δ (STM#234) mutant was used as a virulent control strain. The mutants and control strains were pelleted, washed three times with PBS, suspended in PBS, and then inoculated with equal numbers (5x10 5 (dog cells) were collected. 7-week-old C57BL / 6 mice (Jackson Laboratory, Bar Harbor, ME, USA) were anesthetized by intraperitoneal injection of Avertin (2,2,2-tribromoethanol, T48402, Sigma-Aldrich, St. Louis, MO, USA), and 5x10 5 Pooled mutant cells (dissolved in 50 μl of PBS) were infected via nasal inhalation. To prepare the input WD40 genomic DNA library, 200 μl of the pooled strain was spread on YPD medium containing 100 μg / ml chloramphenicol, cultured at 30°C for 3 days, and then collected by scraping. Infected mice were sacrificed with an overdose of Avertin 14 dpi. The lungs, brain, kidney, liver, and spleen of the infected mice were harvested and homogenized in 5 ml of PBS. The homogenized tissues were spread on YPD medium containing 100 μg / ml chloramphenicol, cultured at 30°C for 3 days, and then collected by scraping. Genomic DNA was extracted from the collected input and output cells using the cetyl trimethylammonium bromide (CTAB) method. Quantitative PCR was performed using tag-specific primers (Tables 1 to 4) using a qRT-PCR system (CFX96, Bio-Rad, Hercules, CA, USA). The STM score was 2 -ΔΔCTThe STM score was calculated using the method and the relative change in genomic DNA amount was calculated. The average fold change between the input and output samples was calculated as the log score (log22-(Ct,Target-Ct,STE50)output-(Ct,Target-Ct,STE50)input).

[0082]

[0083] 8. Gene expression analysis

[0084] To measure the expression levels of WCP1 and RAM pathway-related genes (CBK1, KIC1, MOB2, TAO3, SOG2), the H99S strain and the wcp1Δ mutant were cultured in liquid YPD medium at 30°C for 16 h, and then the initial OD 600 When this was 0.2, the cells were subcultured into fresh liquid YPD medium. The cells reached the early logarithmic phase (OD 600 When the culture reached a confluency of 0.6–0.8, the culture was divided into two equal parts. One half was incubated in a shaking incubator at 37°C (basal sample), and the other half was incubated in a 5% CO2 incubator at 37°C with horizontal shaking at 180 rpm for 24 h. After 24 h of incubation, the culture was pelleted using liquid nitrogen and lyophilized. Total RNA was extracted from each sample using the Easy-BLUE RNA extraction kit (iNtRON Biotechnology, Gyeonggi-do, Korea), and cDNA was synthesized using RTase (Thermo Scientific, Waltham, MA, USA). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed with the target gene-specific primer pairs listed in Tables 1–4.

[0085]

[0086] 9. Proteomic analysis of Wcp1-interacting proteins

[0087] To identify Wcp1-interactors, Wcp1-mCherry and Wcp1-4xFLAG strains were used in in vivo pull-down experiments, followed by mass spectrometry-based proteomics analysis. Initially, these strains were cultured in 50 ml of YPD medium at 30°C for 16 h, and then subcultured in 500 ml of fresh YPD medium to determine the OD 600 It was cultured until it reached 0.8. At this stage, 150 ml of the culture was dispensed and cultured for 24 hours at 30°C, 37°C, or 37°C with 5% CO2. After culture, the cells were harvested, frozen in liquid nitrogen for more than 30 minutes, and then lyophilized. Total protein was extracted from the lyophilized cells using a lysis buffer (without SDS) containing 50 mM Tris-Cl (pH 7.5), 1% sodium deoxycholate, 5 mM sodium pyrophosphate, 0.2 mM sodium orthovanadate, 50 mM sodium fluoride (NaF), 1% Triton X-100, 0.5 mM phenylmethylsulfonyl fluoride, and 2.5x protease inhibitor cocktail solution (Merck Millipore). For the Wcp1-mCherry strain, RFP-Trap Agarose (ChromoTek, USA) was added to the extracted lysate and incubated overnight at 4°C with rotation. For the Wcp1-4xFLAG strain, anti-FLAG antibody (Sigma-Aldrich, F1804) was added to the lysate and incubated overnight at 4°C with rotation. Next, Dynabeads TMProtein A (Invitrogen, USA) was added to the mixture and incubated at 4°C for 6 h with rotation. Agarose and Dynabeads were washed three times with lysis buffer containing 50 mM NaCl. Finally, bound proteins were eluted using SDS sample buffer (50 mM Tris-Cl, 2% SDS, 10% glycerol, 0.01% β-mercaptoethanol).

[0088] For in-gel digestion, digestion buffer was prepared by mixing 100 mM ammonium bicarbonate (NH4HCO3) and acetonitrile in a 1:1 ratio, and 2 ml of buffer was used per sample. Each sample was treated with 500 μl of buffer and gently shaken for 30 minutes. If Coomassie staining remained, the buffer was replaced, and the process was repeated every 30 minutes until the gel slices were completely destained. An additional wash step was then performed: 500 μl of a 1:1 mixture of distilled water and acetonitrile was added and shaken for 30 minutes to further wash the gel slices. Next, 500 μl of pure acetonitrile was added, and the samples were incubated for 30 minutes to dehydrate the gel. The gel slices turned opaque white, indicating complete dehydration. Otherwise, fresh acetonitrile was added, and the samples were incubated for 15 minutes. Once completely dehydrated, the buffer was removed, and the gel slices were dried using a speed vacuum. The dried gel slices were then transferred to a new tube for enzymatic digestion. Sequencing-grade trypsin (Promega, V5111) was used for trypsin digestion. For Coomassie-stained gels, 100–200 ng of trypsin was used per gel. The trypsin stock solution (100 ng / μL) was diluted 20-fold to the working concentration of the Coomassie gel (5 ng / μL). For digestion, 20 μL of the diluted trypsin solution was added to each dried gel sample to ensure sufficient coverage. The samples were incubated on ice for 10 minutes, then 50 mM NH4HCO3 was added until the gel slices were completely submerged and incubated on ice for an additional 10 minutes. Digestion was performed overnight at 37°C or accelerated using a microwave digestion system at 37°C for 10–30 minutes. For peptide extraction, 30 μL of 5% formic acid (FA) in 50% acetonitrile was added to each sample, followed by gentle shaking for 30 minutes to 1 hour. The supernatant containing the peptides was collected and transferred to a new tube. This extraction step was repeated twice.This was repeated once with 50–10 μl of fresh 5% FA / 50% acetonitrile and once with 50–100 μl of 100% acetonitrile. The collected supernatants were frozen and dried using a speed vacuum, and the dried peptides were reconstituted with 20–30 μl of 0.1% FA in distilled water.

[0089] Mass spectrometry was performed using a Thermo Scientific Orbitrap Exploris 240 mass spectrometer (Thermo Scientific, USA) equipped with a Dionex U 3000 RSLCnano HPLC system. Fractions were reconstituted in solvent A (water / acetonitrile, 98:2 v / v, 0.1% formic acid) and injected into the LC-nano ESI-MS / MS system. Samples were first collected on an Acclaim PepMap 100 trap column (100 μm x 2 cm, nanoViper C18, 5 μm, 100Å, Thermo Scientific, part number 164564), washed with solvent A (water / can, 98:2 v / v, 0.1% formic acid) for 6 min at a flow rate of 4 μl / min, and then separated on a PepMap RSLC C18 column (75 μm x 15 cm, nanoViper C18, 3 μm, 100Å, Thermo Scientific, part number ES900) at a flow rate of 300 nl / min. The LC gradient was from 2% to 8% solvent B for 10 min, then from 8% to 30% for 55 min, then to 90% solvent B (100% acetonitrile and 0.1% formic acid) for 4 min, and then back to 2% solvent B for 20 min. Mass spectrometric data were acquired using Xcalibur software version 4.4. The Orbitrap analyzer scanned precursor ions in the mass range of 350–1800 m / z at a resolution of 60,000 at m / z 200. Mass data were automatically processed using Proteome Discoverer 2.5 (Thermo Scientific, USA).

[0090]

[0091] Experimental results

[0092] 1. Analysis of WD40 protein in C. neoformans

[0093] The overall experimental plan of this study is illustrated in Figure 1a. The WDSP database (http: / www.wdspdb.com / wdsp / ) was used to identify potential WD40 genes in the C. neoformans (strain H99) genome, and the presence of WD40 repeats was confirmed through protein sequence analysis and classification using InterPro (https: / www.ebi.ac.uk / interpro / ). This analysis identified 140 putative WD40 genes in C. neoformans. Of these, 94 were classified into a high-confidence group by the WDSP database, and 18 and 28 were classified into medium- and low-confidence groups, respectively. The 94 high-confidence WD40 proteins contained at least six WD40 repeats, which are known to ensure the stable formation of the WD40 β-propeller structure, which is important for PPI. Therefore, C. We focused on these 94 canonical WD40 proteins from S. neoformans (Fig. 1b). This analysis revealed three important insights. Approximately half of all WD40 proteins are evolutionarily diverse. Most WD40 proteins from model fungal organisms contain six to eight WD40 repeats (Fig. 1c). One-third of the WD40 proteins are considered essential in S. cerevisiae, S. pombe, and C. albicans (Fig. 1d).

[0094]

[0095] 2. Construction of a C. neoformans WD40 deletion mutant library

[0096] To gain comprehensive insights into the pathobiological functions of the C. neoformans WD40 protein, we aimed to generate signature-tagged gene deletion mutants for 94 canonical WD40 genes and analyze their phenotypic characteristics in vitro and in vivo. Signature-tagged gene deletion mutants were available only for the kinase gene VPS15 and the Msi1-like gene MSL1. For the remaining 92 WD40 genes, we aimed to construct a high-quality library of signature-tagged WD40 gene deletion mutants by generating at least two independent mutants for each gene and genotyping them using diagnostic PCR and Southern blot analysis. As a result, we generated 100 new mutant strains (103 mutants), and systematically analyzed the functions of 52 WD40 genes. Detailed information on the destruction strategy, primer sequences, Southern blot results, and mutant phenotypic data can be found in the Cryptococcus neoformans WD40 Phenotype Database (http: / WD40.cryptococcus.org), which was developed specifically for this study.

[0097]

[0098] 3. The hypothesized essential WD40 protein of C. neoformans

[0099] Despite repeated attempts, we were unable to generate targeted knockout mutants for 42 of the WD40 genes, suggesting their potential essentiality. Supporting this hypothesis, BLAST matrix analysis showed that most of these 42 WD40 proteins are evolutionarily conserved across 35 species (Fig. 1b). To investigate further, we aimed to generate conditional expression strains for these hypothesized essential WD40 genes by replacing their native promoters with the copper-regulated CTR4 (copper transporter 4) promoter. This approach successfully generated promoter replacement strains for all but five WD40 genes (CNAG_06824, 06684, 01600, 07440, and 06772). Notably, 36 of the 37 promoter replacement strains exhibited significant growth defects under copper-containing repressive conditions (Fig. 2a), further suggesting their potential essentiality in C. neoformans. In contrast, one strain (CNAG_06778; designated Wdp1) did not exhibit growth impairment under these conditions. Interestingly, orthologs of this strain are evolutionarily conserved in most fungi, except for S. cerevisiae, S. pombe, and C. albicans. To further explore the essentiality of Wdp1, we generated heterozygous diploid mutants using the engineered diploid strain AI187 and performed random spore assays. Analysis of 55 haploid spores (34 MATa and 21 MATα) revealed 21 knockout spores (15 MATa and 6 MATα), suggesting that Wdp1 is not an essential gene (Fig. 3). The disrupted allele, tagged with a signature, was PCR amplified from genomic DNA extracted from the knockout spores and used to generate new knockout strains from the H99 strain by biotransformation.

[0100] Given the potential of the essential WD40 protein as an antifungal drug target, we investigated whether altering its expression could affect susceptibility to known antifungal drugs. Specifically, suppression of UTP7, UTP15, ARC40, CDC55, ERB1, PRP46, BUB3, RRP9, TAF5, PSF2, MET30, PAC11, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1, and CDC40 increased growth defects in the presence of specific antifungal drugs. Among these, ARC40, RRP9, PSF2, MET30, UTP13, and PWP2 genes showed significant synergistic effects with most antifungal drugs, suggesting their potential as promising targets for antifungal drugs (Fig. 2b). To quantify the growth of strains exhibiting synergistic effects in Figure 2b, colony intensities of spotting data were measured using the Image Lab 3.0 tool (Figure 2c). All values ​​in the graph were normalized to the average colony intensity of WT in YPD (upper panel) or YPD + CuSO4 (lower panel) conditions. While no significant differences were observed under basal conditions, colony intensities were significantly reduced compared to the untreated control under inhibitory conditions combined with sublethal concentrations of antifungal agents. These results highlight the potential of essential WD40 proteins, particularly those exhibiting synergistic effects with existing antifungal agents, as promising targets for antifungal therapy (Figure 2).

[0101]

[0102] 4. In vitro and in vivo phenotypic profiling of C. neoformans WD40 protein

[0103] Utilizing a comprehensive WD40 mutant library, we performed in vitro phenotypic analyses under 31 different conditions, including temperature-dependent growth (25°C, 30°C, 37°C, and 39°C), high CO₂ tolerance, virulence factor production (capsule, melanin, and urease), positive mating, stress responses and adaptation (osmotic / cationic salt, oxidative, genotoxic, ER, cell wall / membrane, and heavy metal stress), and susceptibility to antifungal drugs. A heatmap (Fig. 4) was used to graphically represent the complete phenotypic dataset of WD40 deletion mutants. This systematic phenotypic analysis revealed that approximately 82% (43 of 52) of the WD40 mutants exhibited at least one striking in vitro phenotype, of which 77% (33 of 43) had not been previously functionally characterized. Furthermore, among the 52 WD40 proteins, those with reported associations with specific complexes were assigned to the "Associated Complexes" category, suggesting that these proteins likely serve as important scaffolds for forming diverse complexes across multiple biological pathways. Furthermore, based on their predicted functions, these proteins could be classified into five categories: chromatin / biogenesis and splicing, protein degradation and turnover / ribosome biogenesis, cytoskeleton / transport, signal transduction, and unclassified. These phenotypic insights into the WD40 mutants suggest that WD40 proteins may play direct or indirect roles in a wide range of cellular functions in C. neoformans.

[0104] To assess the contribution of the WD40 protein to C. neoformans pathogenicity, we performed a signature tag mutation (STM)-based organ infectivity assay using a murine intranasal infection model (Fig. 5). This approach identified 31 WD40 genes associated with infectivity in multiple organs. To gain further insight into how the WD40 protein mediates virulence regulation in C. neoformans, we integrated in vitro phenotypic characteristics with STM-based infectivity data and classified these genes into three distinct groups. The first group consisted of 18 genes (MSL1, HIRA, SWD1, SWD2, SWD3, TUP1, SPF38, PRP19, WCP1, FAR8, CDC4, CDH1, DOA1, BUN62, PWP1, VPS15, SEA2, and SEA4), deletion mutants of which exhibited three or more in vitro phenotypic profiles. These genes are involved in core pathogenic processes, including virulence factor production (capsule and melanin biosynthesis) and stress adaptation. Within this group, 16 of the 18 genes, excluding DOA1 and BUN62, most frequently affected temperature adaptability. This observation highlights that temperature regulation is a well-known virulence factor. In particular, TUP1, SWD2, and HIRA, which showed the most extensive phenotypic changes in deletion mutant strains, play essential roles in chromatin remodeling, transcriptional regulation, and genome stability. Furthermore, VPS15, a kinase important for vacuolar protein sorting, highlights the important function of these proteins in response to host-induced stress. The second group consisted of seven genes (WDR8, ELP2, REC14, GID7, PEX7, RRT2, and WDP7) whose deletion mutants showed one or two distinct in vitro defects that could be linked to pathogenicity-related functions.These mutants exhibited phenotypes associated with stress responses, such as deficiencies in specific virulence factors or impaired cell membrane / cell wall integrity, which may be important under host-specific environmental pressures that are difficult to replicate in vitro. A third group included six genes that lacked detectable in vitro phenotypic characteristics (WDP10, WDP9, and DUG2) or did not appear to be associated with reduced pathogenicity in vivo in deletion mutants (SPT8, RPN14, and WDP5). These genes may function in host-specific processes, including nutrient acquisition, immune evasion, or infection-induced metabolic pathways. These findings highlight the need for in vivo models to capture their biological significance.

[0105] Additional organ-specific infectivity analyses revealed that deletion mutants of VPS15, PWP1, PEX7, CDH1, GID7, HIRA, SWD2, TUP1, ELP2, WCP1, WDP10, SEA2, and MSL1 exhibited reduced infectivity in all five organs tested (lung, brain, kidney, liver, and spleen) (Figs. 4 and 5c). The corresponding gene names are highlighted in red (Fig. 4). As described above, many of these genes play important roles in stress adaptation and antifungal drug resistance, reinforcing their importance for the pathogen's survival under environmental and host-induced stress conditions. Notably, the PWP1 deletion mutant showed the most severe reduction in infectivity in all organs tested, and its role in virulence-related stress responses was further supported by its increased sensitivity to high temperature, melanin production, osmotic stress, and SDS-induced membrane stress. Additionally, deletion mutants of PRP19, SWD3, FAR8, SEA4, CDC4, DOA1, WDP7, WDR8, SWD1, RPN14, BUN62, SPT8, SPF38, REC14, DUG2, WDP5, RRT2, and WDP9 showed reduced pathogenicity in at least one tested organ, but not consistently across all five organs; the corresponding gene names are highlighted in green (Figure 4). Interestingly, deletion mutants of SWD1 and RPN14 showed reduced pathogenicity only in systemic infections involving the brain, kidney, liver, and spleen following pulmonary infection. These tissue-specific changes in infection may provide insights into the role of specific genes in the infection process.

[0106] Taken together, these results provide compelling evidence that the WD40 protein is an essential regulator of C. neoformans virulence. Integrating in vitro stress response data with in vivo infectivity profiles will enhance our understanding of the molecular mechanisms driving pathogenicity and identify key regulatory genes, such as PWP1, as promising targets for antifungal therapeutic development.

[0107]

[0108] 5. WD40-dependent epigenetic regulators play diverse roles in C. neoformans.

[0109] Systematic in vitro and in vivo phenotypic profiling revealed that several WD40 components of protein complexes involved in epigenetic regulation (COMPASS, HIRA, PRP19, SAGA, EED, ERP2, TUP1) play diverse roles in diverse pathobiological features of C. neoformans. Core WD40 subunits Swd1 and Swd3 of the COMPASS (Set1-associated protein complex) complex, which methylates lysine K4 of histone H3 (H3K4) in yeast and humans, played crucial roles in stress responses and virulence factor production. In contrast, the accessory protein Swd2 exhibited a less distinct phenotype (Fig. 6).

[0110] The HIRA (Histone cell cycle regulation defective homolog A) complex also plays an important role in C. neoformans. Notably, the cryptococcal HIRA complex appears structurally distinct from the S. cerevisiae HIRA complex, which consists of Hir1, Hir2, Hir3, and Hpc2, but is very similar to the Drosophila HIRA complex (Fig. 7a). CNAG_04158 (here designated Hira) is more directly homologous to Drosophila Hira than to S. cerevisiae Hir1, and direct homologs of yeast Hir2, Hir3, and Hpc2 were not found in C. neoformans (Figs. 7a and 7e). Instead, this pathogen contains a hypothetical protein (CNAG_05043; here designated Yem1) that has low similarity to the Drosophila Yemanuclein-α protein. To explore their functions, we generated yem1Δ and hiraΔ yem1Δ double deletion mutant strains and performed phenotypic analyses. The hiraΔ mutant exhibited increased sensitivity to suboptimal growth temperature, antifungals (amphotericin B, fluconazole, and flucytosine), and oxidative, osmotic, cell wall / membrane destabilizing, genotoxic, and ER stress (Fig. 7b). In contrast, the yem1Δ mutant exhibited a milder phenotype than the hiraΔ mutant, suggesting that Yem1 may play an auxiliary role in the cryptococcal HIRA complex. Supporting this, the hiraΔ yem1Δ mutant phenotypically replicated the hiraΔ mutant. Interestingly, both hiraΔ and yem1Δ mutants exhibited increased capsule production (Fig. 7c). Furthermore, when unilaterally crossed with the MATa wild-type strain, the hiraΔ and hiraΔ yem1Δ mutants failed to produce filaments, whereas the yem1Δ mutant exhibited wild-type filament levels (Fig. 7d).In vivo mouse infection assays revealed that the hiraΔ mutant significantly reduced fungal burden in all organs examined (lung, liver, kidney, spleen, and brain), with the greatest attenuation in lung, liver, and kidney (Fig. 7f). Notably, despite the intact overall cell morphology in vitro, the combined effects of increased capsule production, impaired mating filament formation, and increased stress sensitivity suggest that disruption of HIRA-mediated chromatin regulation is a key factor impairing host adaptation and virulence. Collectively, these findings highlight the critical role of the HIRA complex in regulating diverse virulence determinants, linking distinct in vitro phenotypes with the markedly attenuated in vivo infectivity of C. neoformans.

[0111] The Prp19 complex, also known as the Nineteen Complex (NTC), is a critical component of the spliceosome essential for pre-mRNA splicing. It stabilizes the spliceosome during the catalytic step, ensuring efficient splicing and preventing intron retention, which is crucial for proper mRNA maturation. In this study, the prp19Δ strain showed severe sensitivity to a host temperature of 37°C (Fig. 8a). Analysis of the expression of key genes involved in heat shock regulation and thermotolerance signaling pathways revealed that Prp19 regulates the expression of genes encoding heat shock proteins, including HSP12, HSP1201, and SSA1 (Fig. 8b). It also regulates various pathways involving MPK1, HOG1, and CRZ1. Consistent with its role in mRNA splicing, experiments were performed to determine whether the Prp19 complex affects intron retention. The results showed that intron retention of the HSP1201 transcript was increased in prp19Δ, which is consistent with the C. These results suggest that the PRP19 complex of S. neoformans contributes to heat tolerance by regulating the mRNA splicing of heat shock proteins (Fig. 8c). In particular, we found that Hsf1, a key transcription factor for heat tolerance, binds to the PRP19 promoter, suggesting that Hsf1 acts as an upstream regulator of PRP19 under heat stress conditions (Fig. 8d).

[0112] In addition to its role in thermotolerance, we found that the Prp19 complex contributes to membrane stability. We confirmed that Prp19 plays a critical role in resistance to membrane-associated stresses, including fluconazole, SDS, and osmotic stress (Fig. 8e). Specifically, when ergosterol staining was performed using filipin III, the prp19Δ mutant had increased ergosterol levels compared to the wild-type strain under basal conditions (Fig. 8f). This increase in ergosterol is likely a compensatory response to membrane instability caused by Prp19 deficiency. Indeed, quantification of ergosterol levels confirmed that the prp19Δ mutant had increased ergosterol compared to wild-type cells under basal conditions (Fig. 8g). In vivo mouse infection assays revealed that the prp19Δ mutant had a significantly reduced fungal burden compared to the wild-type strain, with the most pronounced attenuation observed in the lungs and moderate reductions observed in the liver and brain (Fig. 8h). These in vivo results are consistent with our in vitro findings, where prp19Δ cells exhibited a severe growth defect at 37°C (Fig. 8a), altered expression of key heat shock transcripts such as HSP1201 and increased intron retention (Figs. 8b and 8c), and increased sensitivity to membrane stressors with compensatory ergosterol enrichment (Figs. 8e and 8g). Taken together, these data suggest that Prp19 is essential for maintaining thermotolerance and membrane stability in C. neoformans, and its deficiency severely impairs the pathogen's ability to adapt to the hostile conditions it encounters, particularly in the lungs.

[0113]

[0114] 6. Cyclophilin containing WD40 promotes high CO2 tolerance in C. neoformans.

[0115] In addition to traditional cryptococcal virulence factors such as capsule, melanin, urease, and thermotolerance, recent studies have highlighted CO2 tolerance as a key virulence factor due to the striking contrast in CO2 concentrations between the natural environment and the mammalian host. Studies have demonstrated that the Ras, calcineurin, MAPK, and RAM pathways are crucial for CO2 tolerance. Furthermore, a specific genetic locus controlling CO2 tolerance has been identified in C. neoformans, directly linking this trait to virulence.

[0116] In this study, we found that several WD40 protein complexes are also involved in CO2 tolerance (Fig. 9a). In particular, mutants of the COMPASS complex (swd1Δ and swd3Δ), the STRIPAK complex (far8Δ), the HIRA complex (hiraΔ), the Vps34 / PI3K complex (vps15Δ), the U5 micronuclear ribonucleoprotein complex (spf38Δ), the APC / C complex (cdh1Δ), and the cyclophilin protein (CNAG_03681) showed reduced growth under 5% CO2 at 37°C compared to ambient 37°C conditions, further suggesting that high CO2 tolerance is mediated through complex biological processes. Among these, the CNAG_03681 mutant showed the most pronounced sensitivity to 5% CO2 at 37°C, similar to the RAM pathway mutants (Fig. 9a). CNAG_03681 was named Wcp1 (WD40-containing cyclophilin 1) because it contains a WD40 domain in the N-terminal region and a peptidyl-prolyl cis-trans isomerase (PPIase) domain in the C-terminal region (Fig. 9b).

[0117] Interestingly, the involvement of Wcp1 in CO2 tolerance at 37°C, but not at 30°C, highlights the link between CO2 tolerance and thermotolerance. This link is further underscored by the abnormal morphogenesis observed in the wcp1Δ mutant at elevated temperatures and high CO2 levels. Specifically, at 37°C and 5% CO2, the wcp1Δ mutant exhibited severe morphological alterations, including cell clumping and enlarged vacuoles without detachment, compared to ambient CO2 conditions (Fig. 9c). These results suggest that Wcp1 and its associated complexes are crucial for mediating CO2 tolerance under host-like conditions. To confirm that the CO2 tolerance phenotype is indeed linked to Wcp1, we generated a wcp1Δ::WCP1 complementation strain that fully recovered the wild-type phenotype (Fig. 9d).

[0118] Cryptococcus neoformans contains 13 cyclophilin proteins. Interestingly, Wcp1 is the only one characterized by the WD40 domain. Wcp1 consists of eight WD40 repeats and one PPIase domain (Fig. 9b). To investigate the effect of each domain on CO2 tolerance, we constructed a WD40 domain (wcp1Δ::WCP1 WD40Δ ) or PPIase domain (wcp1Δ::WCP1 PPIaseΔ ) were constructed to construct a complementation strain with a deletion in one of the WD40 and PPIase domains (Fig. 9d). The results showed that both the WD40 and PPIase domains are essential for the overall function of Wcp1. The strain lacking the WD40 domain exhibited more severe growth defects under high temperature and high CO2 conditions than the strain lacking the PPIase domain. This suggests that the interaction and complex formation of the WD40 domain with specific proteins are essential for the role of Wcp1 in CO2 tolerance and thermotolerance.

[0119] We generated a wcp1Δ::WCP1-mCherry strain and monitored Wcp1-mCherry localization to investigate the cellular localization of Wcp1. The wcp1Δ::WCP1-mCherry strain phenotypically replicated the wild-type strain, confirming that the Wcp1-mCherry fusion protein was functional. Interestingly, we found that Wcp1-mCherry was constitutively enriched in the nucleus regardless of growth temperature and CO2 concentration (Fig. 9e). This suggests that a Wcp1-containing complex may play a role in transcriptional control.

[0120] To determine whether the role of Wcp1 in CO2 tolerance is conserved across diverse Cryptococcus species, the Wcp1 orthologs were deleted in Cryptococcus deneoformans strain JEC21 (CNB01790) and Cryptococcus deuterogattii R265 (CNBG_0084) strains (Fig. 9f). Similar to the C. neoformans swcp1Δ mutant, both the C. deneoformans and C. deuterogattii wcp1Δ mutants exhibited growth defects at 37°C and 5% CO2 compared to 37°C alone. This finding suggests that the function of Wcp1 in high temperature and CO2 tolerance is broadly conserved across Cryptococcus species.

[0121] To gain deeper insight into the Wcp1-dependent mechanisms underlying CO2 tolerance, we investigated the functional link between Wcp1 and known CO2 tolerance-related signaling pathways, focusing particularly on the RAM pathway. For this purpose, WCP1 was constitutively overexpressed in a kic1Δ mutant background by replacing its native promoter with the histone 3 (H3) promoter (kic1ΔWCP1). OE ) to assess whether the heat tolerance and CO2 tolerance phenotypes of RAM pathway mutants can be rescued (Fig. 9g). Conversely, KIC1 was constitutively overexpressed under the H3 promoter in a wcp1Δ mutant background (wcp1ΔKIC1OE ). The results are wcp1Δ and wcp1ΔKIC1 OE No significant growth differences were observed between strains. However, kic1ΔWCP1 OE The strain showed significant growth recovery at 37°C compared to the kic1Δ strain, but this recovery was not clearly observed under 37°C+5% CO2 conditions (Fig. 9g). These results suggest that Wcp1 may act downstream of the RAM pathway, and that the regulatory mechanisms controlling thermotolerance and CO2 tolerance may be different. In addition, the elongated pseudohyphal morphology was observed in kic1ΔWCP1. OE persistence in the strain, indicating that regulation of morphology, thermotolerance and CO2 tolerance may be controlled by separate pathways.

[0122] To investigate the role of Wcp1 in the pathogenicity of C. neoformans, wild-type, wcp1Δ, and complemented strains were used in a mouse model of cryptococcosis. The results showed that the virulence of the wcp1Δ mutant was significantly attenuated compared to the wild-type and complemented strains in a mouse host model (Fig. 9h). Further analysis of the fungal burden in infected organs recovered from sacrificed mice revealed that brain tissue infected with the wcp1Δ mutant had a significantly reduced fungal burden compared to brain tissue infected with the wild-type and complemented strains (Fig. 9i). These results suggest that Wcp1 is essential for the survival, proliferation, and invasion of C. neoformans within brain tissue during infection. Overall, these results indicate that Wcp1 is essential for the pathogenicity of C. neoformans.

[0123]

[0124] 7. Extracellular pH-dependent role of Wcp1 in high CO2 tolerance

[0125] CO2 passively diffuses into the cell and forms bicarbonate (HCO3) - ) is converted to a proton (H +), which is important for maintaining acid-base balance and regulating intracellular pH. Therefore, the role of Wcp1 in high CO2 tolerance may vary depending on pH. To test this hypothesis, we analyzed the growth of the wcp1Δ mutant under various pH conditions, regardless of high CO2 exposure. As a result, the growth defect of the wcp1Δ mutant under high CO2 was rescued more as the pH became neutral or alkaline (Fig. 10). However, although the wcp1Δ mutant still showed increased sensitivity to high CO2 at neutral pH, the growth defect was less pronounced than under acidic conditions (Fig. 10). This indicates that Wcp1 may contribute to balancing acidity and alkalinity in response to CO2 dissociation under high CO2 conditions.

[0126] To determine whether other WD40 proteins and complexes associated with CO2 tolerance exhibit similar pH-dependent responses, phenotypic analyses were performed in media with various pH levels (Fig. 11). The results revealed a clear trend. WD40 mutants associated with CO2 tolerance generally exhibited enhanced growth at 37°C as the pH changed from acidic to neutral. However, under alkaline pH conditions, most mutants exhibited reduced growth compared to neutral pH, with the vps15Δ and far8Δ mutants exhibiting particularly severe growth defects. In contrast, under high CO2 conditions, the far8Δ, spf38Δ, and hiraΔ mutants exhibited progressively reduced growth, a pattern opposite to that observed in the wcp1Δ mutant. These results suggest that Wcp1 responds to CO2 differently from other WD40 proteins, highlighting the complexity of the mechanisms underlying the CO2 tolerance phenotype and the diverse roles played by WD40 proteins in this process.

[0127]

[0128] 8. Identification of Wcp1-interacting proteins and signaling pathways

[0129] To directly identify Wcp1-interacting proteins, we generated epitope-tagged Wcp1 strains and performed in vivo pull-down experiments, followed by liquid chromatography (LC) / mass spectrometry (MS)-based proteomic analysis. To reduce false positives due to nonspecific epitope binding, we generated two distinct epitope-tagged Wcp1 strains, Wcp1-4xFLAG and Wcp1-mCherry, each epitope fused in-frame to the C terminus of Wcp1. Complementation with either the Wcp1-4xFLAG or Wcp1-mCherry allele fully restored the wild-type phenotype in the wcp1Δ mutant, indicating that both alleles are functional ( Figures 9D and S12 ).

[0130] Under basal conditions (ambient air, 30°C), 49 proteins, excluding Wcp1 itself, were identified as common interactors of Wcp1 in both the Wcp1-4xFLAG and Wcp1-mCherry strains (Fig. 13a). Supporting the quality of the proteomic analysis, Wcp1 had the highest Sequest HT score (1054.51). Proteins with a Sequest HT score less than 9.0 were considered insignificant. Of these, 48 proteins were found in all pulldown samples from the Wcp1-mCherry strain cultured at 30°C, 37°C, and 37°C with 5% CO2, suggesting that they are major Wcp1-interacting proteins (Fig. 13a). Notably, none of the proteins were specific to the 37°C + 5% CO2 condition. Several heat shock proteins were identified as Wcp1-interactors, supporting the role of Wcp1 in thermotolerance: CNAG_00334 (Hsp75-like protein, ranked 1st), CNAG_01727 (Ssa1, ranked 2nd), CNAG_06150 (Hsp90-like protein, ranked 11th), CNAG_06208 (Heat shock 70 kDa protein 4, ranked 13th), and CNAG_06208 (Hsp60-like protein, ranked 47th). In addition, two proteins involved in the sulfur amino acid metabolism pathway, Met6 (CNAG_01890) and Met3 (CNAG_04215), were also identified as Wcp1-interactors. Interestingly, Met3 is known to play a role in thermotolerance in C. neoformans independent of its function in sulfur amino acid biosynthesis.

[0131] To further explore the proteomic connections between Wcp1 and other signaling pathways, we performed STRING (Search Tool for the Retrieval of Interacting Genes / Proteins) and GO term analysis. The results showed that most Wcp1-interacting proteins were involved in ribosome-related processes, consistent with previous studies highlighting chaperone proteins involved in protein folding. Proteins involved in ATP binding and translation elongation were also identified (Figures 13b and 13c). Further analysis revealed that most Wcp1-interacting proteins were involved in ribosome-related processes, consistent with previous studies highlighting chaperone proteins involved in protein folding. Proteins involved in ATP binding and translation elongation were also identified (Figures 13b and 13c). These findings suggest that Wcp1 serves as a key hub for modulating thermotolerance and maintaining cellular homeostasis in C. neoformans.

[0132] Next, we investigated whether Wcp1-interactors are also involved in high CO2 tolerance. Among the top-ranked Wcp1-interactors, CNAG_00334 was predicted to be essential in C. neoformans based on genome-wide transposon sequencing (TnSeq) analysis. Therefore, we generated deletion mutants for Ssa1, the second-highest-ranked Wcp1-interacting protein. The ssa1Δ mutant showed a weak increase in sensitivity to 5% CO2 at 37°C. For the remaining Wcp1-interacting proteins, nine deletion mutants were available from a C. neoformans gene deletion library (generated by Hiten Madhani's lab in the KN99α background). Notably, two of these (CNAG_02974 (voltage-dependent anion channel protein 2, designated Vac2) and CNAG_04215 (Met3)) also showed a weak increase in sensitivity to 5% CO2. The vac2Δ and met3Δ mutants generated in the H99 strain background exhibited similarly high CO2 sensitivity. Ultimately, three proteins (Ssa1, Vac2, and Met3) were shown to be involved in the role of Wcp1 in high CO2 tolerance (Fig. 13d).

[0133] In summary, we identified the RAM pathway as one of the upstream pathways of Wcp1, and identified Vac2, Ssa1, and Met3 as proteins that interact with Wcp1. These interactions likely form a complex that regulates CO2 tolerance and thermotolerance.

Claims

1. A step of contacting a candidate substance with Cryptococcus neoformans; and HIRA, SEA4, PRP19, FAR8, PWP1, SWD1, DOA1, CDH1, SEA2, SPT8, WDP4, SPF38, BUN62, WDP5, SWD2, ELP2, TEX1, WDP6, FBW7, WDR8, BUN107, PEX7, WDP7, DCA7, RRT2, AIP1, WDP8, WDP9, IQW1, WDP10, SWT21, CMR1, GID7, WCP1, REC14, CDT2, SWD3, CRN1, MDV1, SEA of the above Cryptococcus A step of measuring the expression level of mRNA or protein of one or more genes selected from the group consisting of 3, JIP5, RPN14, DUG2, WDP11, WDP12, EED1, VPS15, TUP1, MSL1, GPB1, GIB2, CDC4, SEC13, TIF34, UTP18, UTP7, UTP15, WDP2, ARC40, CDC55, ERB1, PRP46, PRP4, BUB3, SEC31, CDC20, LST8, RRP9, GLE2, YTM1, TAF5, MAK11, CIA1, PSF2, SOF1, SQT1, MET30, PAC11, RSA4, COP1, SEC27, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1 and CDC40, or measuring the activity of the protein; A method for screening antifungal agents against Cryptococcus neoformans comprising:

2. A method for screening an antifungal agent against Cryptococcus neoformans, further comprising a step of selecting the candidate substance as an antifungal agent when the measured expression level or activity decreases compared to a control group that has not come into contact with the candidate substance in claim 1.

3. In claim 1, the HIRA, SEA4, PRP19, FAR8, PWP1, SWD1, DOA1, CDH1, SEA2, SPT8, WDP4, SPF38, BUN62, WDP5, SWD2, ELP2, TEX1, WDP6, FBW7, WDR8, BUN107, PEX7, WDP7, DCA7, RRT2, AIP1, WDP8, WDP9, IQW1, WDP10, SWT21, CMR1, GID7, WCP1, REC14, CDT2, SWD3, CRN1, MDV1, SEA3, JIP5, RPN14, DUG2, WDP11, WDP12, EED1, VPS15, TUP1, MSL1, GPB1, GIB2 and CDC4 are selected from the group consisting of Cryptococcus neoformans. A method for screening antifungal agents against Cryptococcus neoformans, a gene expressing a factor essential for growth.

4. A method for screening an antifungal agent for Cryptococcus neoformans, wherein in claim 1, SEC13, TIF34, UTP18, UTP7, UTP15, WDP2, ARC40, CDC55, ERB1, PRP46, PRP4, BUB3, SEC31, CDC20, LST8, RRP9, GLE2, YTM1, TAF5, MAK11, CIA1, PSF2, SOF1, SQT1, MET30, PAC11, RSA4, COP1, SEC27, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1 and CDC40 are genes that express factors essential for the survival of Cryptococcus neoformans.

5. HIRA, SEA4, PRP19, FAR8, PWP1, SWD1, DOA1, CDH1, SEA2, SPT8, WDP4, SPF38, BUN62, WDP5, SWD2, ELP2, TEX1, WDP6, FBW7, WDR8, BUN107, PEX7, WDP7, DCA7, RRT2, AIP1, WDP8, WDP9, IQW1, WDP10, SWT21, CMR1, GID7, WCP1, REC14, CDT2, SWD3, CRN1, MDV1, SEA of Cryptococcus neoformans 3,JIP5,RPN14,DUG2,WDP11,WDP12,EED1,VPS15,TUP1,MSL1,GPB1,GIB2,CDC4,SEC13,TIF34,UTP18,UTP7,UTP15,WDP2,ARC40, CDC55,ERB1,PRP46,PRP4,BUB3,SEC31,CDC20,LST8,RRP9,GLE2,YTM1,TAF5,MAK11,CIA1,PSF2,SOF1,SQT1,MET30,PAC11,RSA4, An antifungal composition for Cryptococcus neoformans, comprising a substance that inhibits the expression of any one or more genes selected from COP1, SEC27, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1, and CDC40, or the expression or activity of a protein expressed therefrom.

6. An antifungal composition for Cryptococcus neoformans according to claim 1, wherein the substance is a nucleic acid, an antibody, an aptamer, a peptide, a protein, a compound or a natural product.

7. In claim 1, the material is HIRA, SEA4, PRP19, FAR8, PWP1, SWD1, DOA1, CDH1, SEA2, SPT8, WDP4, SPF38, BUN62, WDP5, SWD2, ELP2, TEX1, WDP6, FBW7, WDR8, BUN107, PEX7, WDP7, DCA7, RRT2, AIP1, WDP8, WDP9, IQW1, WDP10, SWT21, CMR1, GID7, WCP1, REC14, CDT2, SWD3, CRN1, MDV1, SEA3, JIP5,RPN14,DUG2,WDP11,WDP12,EED1,VPS15,TUP1,MSL1,GPB1,GIB2,CDC4,SEC13,TIF34,UTP18,UTP7,UTP15,WDP2,ARC40,C DC55,ERB1,PRP46,PRP4,BUB3,SEC31,CDC20,LST8,RRP9,GLE2,YTM1,TAF5,MAK11,CIA1,PSF2,SOF1,SQT1,MET30,PAC11,RSA4, An antifungal composition for Cryptococcus neoformans comprising an antisense, siRNA (small interfering RNA), or shRNA (short hairpin RNA) nucleic acid having a sequence complementary to the mRNA of any one or more genes selected from the group consisting of COP1, SEC27, UTP21, DIP2, WDP3, UTP13, PWP2, KOG1, and CDC40.

Citation Information

Patent Citations

  • Use of the CnKTR3 gene encoding a mannoslytransferase for treating mycoses by Cryptococcus neoformans

    KR1020150008298A

  • Novel kinase for treatment and prevention of fungal infection and the use thereof

    KR1020170077064A