Treatment of neurofibromatosis type 2 by inhibitors of g6PD, ACSL3 and / or oxsm
Inhibiting G6PD, ACSL3, and OXSM enzymes offers a promising treatment for neurofibromatosis type 2 by selectively targeting and eliminating NF2-tumor cells, providing a potential cure for this genetic condition.
Patent Information
- Application Number
- PCT/EP2025/066359
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-13
- Filing Date
- 2025-06-12
- Publication Date
- 2025-12-18
AI Technical Summary
There is currently no effective pharmacological therapy for neurofibromatosis type 2 (NF2), a genetic condition characterized by benign tumors along peripheral nerves, leading to significant morbidity and nerve damage, with existing treatments like bevacizumab showing promise but potential toxicity and limited efficacy.
Inhibition of enzymes involved in promoting cellular reductive capacity, specifically glucose-6-phosphate-dehydrogenase (G6PD), acyl-CoA synthetase long chain family member 3 (ACSL3), and 3-oxoacyl-ACP synthase (OXSM), using inhibitors to target and cause death of NF2-tumor cells.
This approach provides a potential cure for NF2 by selectively targeting and eliminating NF2-tumor cells without significant side effects, addressing the unmet need for effective treatment options.
Smart Images

Figure IMGF000027_0001 
Figure IMGF000027_0002 
Figure 00000059_0000
Abstract
Description
New PCT-Patent Application Deutsches Krebsforschungszentrum Vossius Ref.: AJ1277 PCT Treatment of neurofibromatosis type 2 by inhibitors of G6PD, ACSL3 and / or OXSM The present invention relates to an inhibitor of an enzyme being involved in promoting cellular reductive capacity, preferably glucose-6-phosphate-dehydrogenase (G6PD) or acyl-CoA synthetase long chain family member 3 (ACSL3) for use in treating neurofibromatosis type 2 or in preventing neurofibromatosis type 2 tumors. In this specification, a number of documents including patent applications and manufacturer’s manuals are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference. Neurofibromatosis Type 2 (NF2) is a genetic condition characterized by predisposition to benigntumors of the peripheral nervous system 1. It is caused by homozygous loss-of-function of thehomonymous gene NF22, 3 in Schwann cells, the glia that ensheath peripheral nerves. Individuals withNFII typically harbor a germline mutation in one of the two NF2 alleles. Recurrent, stochastic, somaticloss of the second NF2 allele gives rise to tumors throughout the lifetime of the patients 1. Thesetumors grow and constrict the nerves. Since cranial nerves are often affected, this leads to balance problems, dizziness, headaches, facial weakness, and loss of hearing or sight. To the best knowledgeof the inventors there is currently no approved pharmacological therapy for NFII 4, 5 althoughbevacizumab is showing great promise 6. Tumors are surgically resected, leading to nerve damage.Since patients recurrently develop new tumors, this results in significant morbidity.NF2 is an upstream regulator of the Hippo / YAP pathway 7, 8. When NF2 is mutated, the Hippo tumorsuppressor pathway is inactivated, leading to activation of the downstream oncogenic transcription factors YAP and TAZ. This pathway is difficult to target pharmacologically because most of the upstream pathway components are tumor suppressors, and hence already inactive in the tumor condition, and the downstream effector components YAP / TAZ are transcriptional coactivators, which are difficult to target with small molecules. Recent work has focused on the development of inhibitors targeting the TEAD transcription factors, which recruit YAP / TAZ to chromatin via their DNA-bindingdomains 7, 8, 9. Although this approach may be promising 10, toxicity may arise, given that genetic lossof YAP / TAZ may lead to impaired maintenance of Schwann cell myelination or to impairedremyelination after injury, and consequently impaired nerve function 11, 12, 13, 14. Only fewpharmacological options are available for NF2 and there is currently no cure for NF2. Hence, there is an ongoing and still unmet need of treatment options for NF2 which need is addressed by the invention as described herein. In more detail, a synthetic lethality approach is described and shown to identify genes that only cause cell death when they are inactivated in combination with NF2 loss-of-function. Pharmacological inhibition of the identified gene products can specifically cause death of NF2- tumors. The identified gene products are G6PD (Glucose-6-phosphate dehydrogenase), ACSL3 (Acyl-CoA Synthetase Long Chain Family Member 3), and 3-oxoacyl-ACP (Acyl Carrier Protein) synthase (OXSM). All three gene products are therapeutic novel targets for the treatment of NF2. Accordingly, the present invention relates to an inhibitor of (a) an enzyme being involved in promoting cellular reductive capacity, preferably of glucose-6-phosphate-dehydrogenase (G6PD) or acyl-CoA synthetase long chain family member 3 (ACSL3), or (b) 3-oxoacyl-ACP (Acyl Carrier Protein) synthase (OXSM) for use in treating neurofibromatosis type 2 or in preventing neurofibromatosis type 2 tumors (i.e. tumors caused by neurofibromatosis type 2). The present invention also relates to the use of an inhibitor of (a) an enzyme being involved in promoting cellular reductive capacity, preferably of glucose-6-phosphate-dehydrogenase (G6PD) or acyl-CoA synthetase long chain family member 3 (ACSL3), or (b) 3-oxoacyl-ACP (Acyl Carrier Protein) synthase (OXSM) for the manufacture of a medicament for the treatment of neurofibromatosis type 2 or for the prevention of neurofibromatosis type 2 tumors. The present invention likewise relates to a method of treating a subject having neurofibromatosis type 2 or being at risk of developing neurofibromatosis type 2 by administering to the subject a therapeutically effective amount of an inhibitor of (a) an enzyme being involved in promoting cellular reductive capacity, preferably of glucose-6-phosphate-dehydrogenase (G6PD) or acyl-CoA synthetase long chain family member 3 (ACSL3), (b) or 3-oxoacyl-ACP (Acyl Carrier Protein) synthase (OXSM). In connection with the above aspects of the invention it is of note that glucose-6-phosphate- dehydrogenase (G6PD) and acyl-CoA synthetase long chain family member 3 (ACSL3) are both enzymes being involved in promoting cellular reductive capacity. It is therefore believed that the inhibition of enzymes being involved in promoting cellular reductive capacity is generally suitable for treating neurofibromatosis type 2 or in preventing neurofibromatosis type 2 tumors.Glucose-6-phosphate-dehydrogenase (G6PD) (EC 1.1.1.49) is a cytosolic enzyme that catalyzes thechemical reaction D-glucose 6-phosphate + NADP+ + H2O ⇌ 6-phospho-D-glucono-1,5-lactone +NADPH + H+. NADPH is required for the reductive biosynthesis of fatty acids, cholesterol, nucleotides, and amino acids and cholesterol and G6PD is required for lipogenesis. G6PD is therefore involved in promoting cellular reductive capacity Glucose-6-phosphate dehydrogenase deficiency (G6PDD), which is the most common enzyme deficiency worldwide, is an inborn error of metabolism that predisposes to red blood cell breakdown. It is an X-linked recessive disorder that results in a defective glucose-6- phosphate dehydrogenase enzyme. Glucose-6-phosphate dehydrogenase is an enzyme which protects red blood cells, which carry oxygen from the lungs to tissues throughout the body. A defect of the enzyme results in the premature breakdown of red blood cells. Most of the affected subjects have no symptoms. G6PD-deficient individuals do not appear to acquire any illnesses more frequently than other people. Two variants (G6PD A− and G6PD Mediterranean) are the most common in human populations. G6PD A− has an occurrence of 10% of Africans and African-Americans while G6PD Mediterranean is prevalent in the Middle East. The known distribution of the mutated allele is largely limited to people of Mediterranean origins (Spaniards, Italians, Greeks, Armenians, Sephardi Jews and other Semitic peoples). Both variants are believed to stem from a strongly protective effect against Plasmodium falciparum and Plasmodium vivax malaria.Acyl-CoA synthetase long chain family member 3 (ACSL3) (EC 6.2.1.3) is an enzyme of the long-chainfatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all enzymes of this family catalyze the chemical reaction of the conversion of free long-chain fatty acids into fatty acyl-CoA esters (ATP + a long-chain fatty acid+ CoA => AMP + diphosphate + a long-chain fatty acyl-CoA), and thereby play a key role in lipid biosynthesis and fatty acid degradation. Acyl-CoA esters are substrates for lipid synthesis and beta-oxidation, ACSL3 is therefore involved in promoting cellular reductive capacity. ACSL3 regulates lipid droplet biogenesis and neutral lipid accumulation. ACSL3 is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates.3-oxoacyl-ACP (Acyl Carrier Protein) synthase (OXSM) (EC 2.3.1.41) is a beta-ketoacyl synthetase. Theenzyme is required for elongation of fatty acid chains in the mitochondria. The chemical reaction is a fatty acyl-[ACP] + H++ malonyl-[ACP] = a 3-oxoacyl-[ACP] + CO2+ holo-[ACP] and proceeds in the forward direction. OXSM plays a role in the biosynthesis of lipoic acid as well as longer chain fatty acids required for optimal mitochondrial function. OXSM condenses malonyl-ACP with an even-numbered acyl-ACP, extending the growing acyl chain by two carbons and releasing a molecule of carbon dioxide.The condensation reaction catalyzed by OXSM creates a keto-acyl intermediate, and subsequent enzymes in the mtFAS cycle carry out a series of reduction and dehydration reactions to return the newly elongated acyl chain to a fully saturated state, as in cytosolic FAS. OXSM is the key enzyme of the mtFAS II pathway, catalyzing the chain-elongating reaction of the fatty acid synthesis cycle. The inhibitor of G6PD, ACSL3 or OXSM is preferably a specific inhibitor of G6PD, ACSL3 or OXSM, which means that it does not inhibit any other targets when being administered to a subject. The inhibitor of G6PD, ACSL3 or OXSM with increasing preference has the effect that the respective enzyme can catalyze its chemical reaction at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, and at least 90% less efficient as compared to the absence of the inhibitor. Most preferably the inhibitor completely or essentially completely inhibits the catalytic activity of the G6PD, ACSL3 or OXSM. Methods and instrumentation for measuring catalytic activity are known in the art; see, for example, Kudeyarov et al. (2017), MEDICAL AND BIOLOGICAL MEASUREMENTS, 60:291–296. The nature of the inhibitor of G6PD, ACSL3 or OXSM is not particularly limited. An inhibitor of G6PD, ACSL3 or OXSM can be identified by routine means. For example, the efficiency of several inhibitors (e.g. libraries of small molecule inhibitors, antibodies or antibody mimetics) may be determined simultaneously in high-throughput formats. High-throughput assays, independently of being biochemical, cellular or other assays, generally may be performed in wells of microtiter plates, wherein each plate may contain 96, 384 or 1536 wells. Handling of the plates, including incubation at temperatures other than ambient temperature, and bringing into contact of test compounds with the assay mixture is preferably effected by one or more computer-controlled robotic systems including pipetting devices. In case large libraries of test compounds are to be screened and / or screening is to be effected within a short time, mixtures of, for example 10, 20, 30, 40, 50 or 100 test compounds may be added to each well. In case a well exhibits the expected activity, said mixture of test compounds may be de-convoluted to identify the one or more test compounds in said mixture giving rise to said activity. Examples of suitable inhibitors and suitable classes of inhibitors will be described herein below. The inhibitors can be administered to the subject at a suitable dose and / or a therapeutically effective amount. The length of treatment needed to observe changes and the interval following treatment for responses to occur vary depending on the desired effect. The particular amounts and / or length of the treatment may be determined by conventional tests which are well known to the person skilled in theart. Suitable tests are, for example, described in Tamhane and Logan (2002), “Multiple Test Procedures for Identifying the Minimum Effective and Maximum Safe Doses of a Drug”, Journal of the American statistical association, 97(457):1-9. Neurofibromatosis type 2 (NF2, neurofibromatosis type II, NFII) is a genetic condition that causes tumours to grow along your nerves. The tumours are usually non-cancerous (benign) but may cause a range of symptoms, such as hearing loss that gradually gets worse over time, hearing ringing or buzzing in the ears (tinnitus) and balance problems (particularly when moving in the dark or walking on uneven ground). There is currently no cure for NF2 and current treatment is limited to regular monitoring and treating any problems as they occur. Surgery can be used to remove most tumours, although it carries a risk of causing problems, such as complete deafness or facial weakness. Therefore, the risks and potential benefits need to be carefully considered before treatment. Most people with NF2 eventually develop significant hearing loss and often benefit from using a hearing aid or learning to lip read. Special implants can sometimes be inserted to improve a person's hearing. NF2 tends to get worse over time. Most people with NF2 eventually lose their hearing completely, and some people require a wheelchair or other type of mobility device. Tumours developing inside the brain and spinal cord can place a strain on the body and shorten life expectancy. In the appended examples a genome-wide CRISPR / Cas9 screen for synthetic-lethal genes that, when inhibited, cause death of NF2 mutant Schwann cells but not NF2 wildtype cells is described. The screen identified ACSL3, G6PD and OXSM as three synthetic-lethal partners for NF2. ACSL3 and G6PD are both involved in promoting cellular reductive capacity). According to the best knowledge of the inventors the finding that the inhibition of an enzyme being involved in promoting cellular reductive capacity (e.g. ACSL3 or G6PD) or OXSM can be a cure for NF2 was not known from or suggested in the prior art. In particular it was neither known from nor suggested in the prior art that the inhibition an enzyme being involved in promoting cellular reductive capacity (e.g. ACSL3 or G6PD) and / or OXSM specifically causes death of cells with NF2 loss-of-function. In accordance with a preferred embodiment of the invention the inhibitor is an inhibitor of G6PD. The examples show that NF2 mutant Schwann cells are more oxidized than control cells, in part due to reduced expression of genes involved in NADPH generation such as ME1. Since G6PD and ME1 redundantly generate cytosolic NADPH, lack of either one is compatible with cell viability, but not down-regulation of both. Since as discussed above genetic deficiency for G6PD is tolerated in thehuman population, this suggests that in particular G6PD is an excellent pharmacological target for NF2 since its inhibition is not expected to result in any unacceptable side effects. In accordance with a more preferred embodiment in addition to the inhibitor of G6PD an inhibitor of ACSL3 and / or an inhibitor of OXSM is / are used in treating neurofibromatosis type 2 or in preventing neurofibromatosis type 2 tumors. While the inhibition of G6PD, ACSL3 or OXSM will be sufficient in order to obtain a curative or disease preventive effect in treating tumors caused by neurofibromatosis type 2 or in preventing neurofibromatosis type 2 tumors, the use of an inhibitor of two or all three of G6PD, ACSL3 and OXSM may be advantageous in certain cases. For instance, if any inhibitor of G6PD, ACSL3 or OXSM causes an unwanted side effect this side effect may be reduced or even avoided by lowering the dose of this inhibitor and using in addition a further inhibitor. In accordance with another preferred embodiment of the invention the inhibitor is an inhibitor of ACSL3 or OXSM. While in particular the inhibition of G6PD is not expected to result in any unacceptable side effects, also the inhibition of ACSL3 and / or OXSM will be sufficient in order to obtain a curative or disease preventive effect in treating tumors caused by neurofibromatosis type 2 or in preventing neurofibromatosis type 2 tumors. In accordance with a more preferred embodiment in addition to the inhibitor of ACSL3 or OXSM an inhibitor of G6PD is used in treating neurofibromatosis type 2 or in preventing neurofibromatosis type 2 tumors. As discussed above, the inhibition of two or all three of G6PD, ACSL3 or OXSM in parallel may be advantageous in certain scenarios. In accordance with a further preferred embodiment (i) G6PD comprises or consists of the nucleic acid sequence of SEQ ID NO: 1 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto, and / or comprises or consists of the amino acid sequence of SEQ ID NO: 2 or a sequence being at least 80%, preferably atleast 90% and most preferably at least 95% identical thereto; (ii) ACSL3 comprises or consists of the nucleic acid sequence of SEQ ID NO: 3 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto, and / or comprises or consists of the amino acid sequence of SEQ ID NO: 4 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto; and / or (iii) OXSM comprises or consists of the nucleic acid sequence of SEQ ID NO: 5 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto, and / or comprises or consists of the amino acid sequence of SEQ ID NO: 6 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto. SEQ ID NO: 1 is the nucleotide sequence of human G6PD. SEQ ID NO: 3 is the nucleotide sequence of human ACSL3. SEQ ID NO: 5 is the nucleotide sequence of human OXSM. SEQ ID NO: 2 is the amino acid sequence of human G6PD. SEQ ID NO: 4 is the amino acid sequence of human ACSL3. SEQ ID NO: 6 is the amino acid sequence of human OXSM. In accordance with the present invention, the term “percent (%) sequence identity” describes the number of matches (“hits”) of identical nucleotides / amino acids of two or more aligned nucleic acid or amino acid sequences as compared to the number of nucleotides or amino acid residues making up the overall length of the template nucleic acid or amino acid sequences. In other terms, using an alignment, for two or more sequences or subsequences the percentage of amino acid residues or nucleotides that are the same (e.g. 80%, 90% or 95% identity) may be determined, when the (sub)sequences are compared and aligned for maximum correspondence over a window of comparison, or over a designated region as measured using a sequence comparison algorithm as known in the art, or when manually aligned and visually inspected. This definition also applies to the complement of any sequence to be aligned. Nucleotide and amino acid sequence analysis and alignment in connection with the present invention are preferably carried out using the NCBI BLAST algorithm (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Nucleic Acids Res.25:3389-3402). BLAST can be used for nucleotide sequences (nucleotide BLAST) and amino acid sequences (protein BLAST). The skilled person is aware of additional suitable programs to align nucleic acid sequences. As defined herein, sequence identities of at least 80% identical, preferably at least 90% identical, andmost preferred at least 95% are envisaged by the invention. However, also envisaged by the invention are with increasing preference sequence identities of at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100%. In accordance with a further preferred embodiment of the invention, the inhibitor is an inhibitor of the nucleic acid molecule encoding the G6PD, ACSL3 or OXSM protein, or is an inhibitor of the G6PD, ACSL3 or OXSM protein. Hence, the inhibitor may be an inhibitor of the nucleic acid molecule encoding G6PD, ACSL3 or OXSM, or may be an inhibitor of the protein G6PD, ACSL3 or OXSM. In the former case the inhibitor may interfere with the transcription of the genomic DNA encoding G6PD, ACSL3 or OXSM into mRNA and / or the translation of the mRNA into protein. Interfering with the transcription or translation reduces the amount of the G6PD, ACSL3 or OXSM enzyme in cells thereby achieving that the enzyme can catalyze its chemical reaction less efficient as compared to the absence of the inhibitor. Inhibitors that interfere with the transcription include compounds interfering with the transcriptional machinery and / or its interaction with the promoter of a gene and / or with expression control elements remote from the promoter such as enhancers. Inhibitors that interfere with the translation include compounds interfering with the translational machinery. The compound inhibiting the expression may specifically interfere with the promoter region controlling the expression. Preferably, the transcription or the translation is reduced by at least 50%, more preferred at least 75% such as at least 90% or 95%, even more preferred at least 98% and most preferred by about 100% (e.g., as compared to the same experimental set up in the absence of the compound). In the latter case the inhibitor may bind to the enzyme G6PD, ACSL3 or OXSM and blocks its activity. In this case the inhibitor may also be designated as enzyme inhibitor. An enzyme inhibitor reduces or stops ("inhibits") the enzymatic activity of the target enzyme, either by binding to the enzyme's active site (thus preventing the substrate itself from binding) or by binding to another site on the enzyme such that the enzyme's catalysis of the reaction is blocked. Enzyme inhibitors may bind reversibly or irreversibly. Irreversible inhibitors form a chemical bond with the enzyme such that the enzyme is inhibited until the chemical bond is broken. By contrast, reversible inhibitors bind non-covalently and may spontaneously leave the enzyme, allowing the enzyme to resume its function. Reversible inhibitors produce different types of inhibition depending on whether they bind to the enzyme, the enzyme-substrate complex, or both.The term “nucleic acid molecule” in accordance with the present invention includes DNA, such as cDNA or double or single stranded genomic DNA and RNA. In this regard, "DNA" (deoxyribonucleic acid) means any chain or sequence of the chemical building blocks adenine (A), guanine (G), cytosine (C) and thymine (T), called nucleotide bases, that are linked together on a deoxyribose sugar backbone. DNA can have one strand of nucleotide bases, or two complimentary strands which may form a double helix structure. "RNA" (ribonucleic acid) means any chain or sequence of the chemical building blocks adenine (A), guanine (G), cytosine (C) and uracil (U), called nucleotide bases, that are linked together on a ribose sugar backbone. RNA typically has one strand of nucleotide bases, such as mRNA. Included are also single- and double-stranded hybrid molecules, i.e., DNA-DNA, DNA-RNA and RNA-RNA. The nucleic acid molecule may also be modified by many means known in the art. Non-limiting examples of such modifications include methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.). Nucleic acid molecules, in the following also referred as polynucleotides, may contain one or more additional covalently linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (e.g., acridine, psoralen, etc.), chelators (e.g., metals, radioactive metals, iron, oxidative metals, etc.), and alkylators. The polynucleotides may be derivatized by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage. Further included are nucleic acid mimicking molecules known in the art such as synthetic or semi-synthetic derivatives of DNA or RNA and mixed polymers. Such nucleic acid mimicking molecules or nucleic acid derivatives according to the invention include phosphorothioate nucleic acid, phosphoramidate nucleic acid, 2’-O-methoxyethyl ribonucleic acid, morpholino nucleic acid, hexitol nucleic acid (HNA), peptide nucleic acid (PNA) and locked nucleic acid (LNA) (see Braasch and Corey, Chem Biol 2001, 8: 1). LNA is an RNA derivative in which the ribose ring is constrained by a methylene linkage between the 2’-oxygen and the 4’-carbon. Also included are nucleic acids containing modified bases, for example thio-uracil, thio-guanine and fluoro-uracil. A nucleic acid molecule typically carries genetic information, including the information used by cellular machinery to make proteins and / or polypeptides. The nucleic acid molecule of the invention may additionally comprise promoters, enhancers, response elements, signal sequences, polyadenylation sequences, introns, 5'- and 3'- non- coding regions, and the like. The term “protein” as used herein interchangeably with the term “polypeptide” describes linear molecular chains of amino acids, including single chain proteins or their fragments, containing at least 50 amino acids. The term “peptide” as used herein describes a group of molecules consisting of up to49 amino acids, whereas the term “polypeptide” (also referred to as "protein") as used herein describes a group of molecules consisting of at least 50 amino acids. The term “peptide” as used herein describes a group of molecules consisting with increased preference of at least 15 amino acids, at least 20 amino acids at least 25 amino acids, and at least 40 amino acids. The group of peptides and polypeptides are referred to together by using the term "(poly)peptide". (Poly)peptides may further form oligomers consisting of at least two identical or different molecules. The corresponding higher order structures of such multimers are, correspondingly, termed homo- or heterodimers, homo- or heterotrimers etc.. Furthermore, peptidomimetics of such proteins / (poly)peptides where amino acid(s) and / or peptide bond(s) have been replaced by functional analogues are also encompassed by the invention. Such functional analogues include all known amino acids other than the 20 gene- encoded amino acids, such as selenocysteine. The terms “(poly)peptide” and “protein” also refer to naturally modified (poly)peptides and proteins where the modification is effected e.g. by glycosylation, acetylation, phosphorylation and similar modifications which are well known in the art. In accordance with a more preferred embodiment (i) the inhibitor of the nucleic acid molecule is selected from a small molecule, an aptamer, a siRNA, a shRNA, a miRNA, a ribozyme, an antisense nucleic acid molecule, a CRISPR-Cas (e.g. Cas9 or Cpf1)- based construct, a meganuclease, a zinc finger nuclease, and a transcription activator-like (TAL) effector (TALE) nuclease, and / or (ii) the inhibitor of the protein is selected from a small molecule, an antibody or an antigen binding fragment thereof, an antibody mimetic or an aptamer. The "small molecule" as used herein is preferably an organic molecule. Organic molecules relate or belong to the class of chemical compounds having a carbon basis, the carbon atoms linked together by carbon-carbon bonds. The original definition of the term organic related to the source of chemical compounds, with organic compounds being those carbon-containing compounds obtained from plant or animal or microbial sources, whereas inorganic compounds were obtained from mineral sources. Organic compounds can be natural or synthetic. The organic molecule is preferably an aromatic molecule and more preferably a heteroaromatic molecule. In organic chemistry, the term aromaticity is used to describe a cyclic (ring-shaped), planar (flat) molecule with a ring of resonance bonds that exhibits more stability than other geometric or connective arrangements with the same set of atoms. Aromatic molecules are very stable, and do not break apart easily to react with other substances. In a heteroaromatic molecule at least one of the atoms in the aromatic ring is an atom other than carbon, e.g. N, S, or O. For all above-described organic molecules the molecular weight is preferably in the range of 200 Da to 1500 Da and more preferably in the range of 300 Da to 1000 Da.Alternatively, the "small molecule" in accordance with the present invention may be an inorganic compound. Inorganic compounds are derived from mineral sources and include all compounds without carbon atoms (except carbon dioxide, carbon monoxide and carbonates). Preferably, the small molecule has a molecular weight of less than about 2000 Da, or less than about 1000 Da such as less than about 500 Da, and even more preferably less than about 250 Da. The size of a small molecule can be determined by methods well-known in the art, e.g., mass spectrometry. The small molecules may be designed, for example, based on the crystal structure of the target molecule, where sites presumably responsible for the biological activity can be identified and verified in in vivo assays such as in vivo high-throughput screening (HTS) assays. Aptamers are nucleic acid molecules or peptide molecules that bind a specific target molecule. Aptamers are usually created by selecting them from a large random sequence pool, but natural aptamers also exist in riboswitches. Aptamers can be used for both basic research and clinical purposes as macromolecular drugs. Aptamers can be combined with ribozymes to self-cleave in the presence of their target molecule. These compound molecules have additional research, industrial and clinical applications (Osborne et. al. (1997), Current Opinion in Chemical Biology, 1:5-9; Stull & Szoka (1995), Pharmaceutical Research, 12, 4:465-483). Nucleic acid aptamers are nucleic acid species that normally consist of (usually short) strands of oligonucleotides. Typically, they have been engineered through repeated rounds of in vitro selection or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms. Peptide aptamers are usually peptides or proteins that are designed to interfere with other protein interactions inside cells. They consist of a variable peptide loop attached at both ends to a protein scaffold. This double structural constraint greatly increases the binding affinity of the peptide aptamer to levels comparable to an antibody's (nanomolar range). The variable peptide loop typically comprises 10 to 20 amino acids, and the scaffold may be any protein having good solubility properties. Currently, the bacterial protein Thioredoxin-A is the most commonly used scaffold protein, the variable peptide loop being inserted within the redox-active site, which is a -Cys-Gly-Pro-Cys-loop (SEQ ID NO: 10) in the wild protein, the two cysteins lateral chains being able to form a disulfide bridge. Peptide aptamer selection can be made using different systems, but the most widely used is currently the yeast two- hybrid system.Aptamers offer the utility for biotechnological and therapeutic applications as they offer molecular recognition properties that rival those of the commonly used biomolecules, in particular antibodies. In addition to their discriminatory recognition, aptamers offer advantages over antibodies as they can be engineered completely in a test tube, are readily produced by chemical synthesis, possess desirable storage properties, and elicit little or no immunogenicity in therapeutic applications. Non-modified aptamers are cleared rapidly from the bloodstream, with a half-life of minutes to hours, mainly due to nuclease degradation and clearance from the body by the kidneys, a result of the aptamers' inherently low molecular weight. Unmodified aptamer applications currently focus on treating transient conditions such as blood clotting, or treating organs such as the eye where local delivery is possible. This rapid clearance can be an advantage in applications such as in vivo diagnostic imaging. Several modifications, such as 2'-fluorine-substituted pyrimidines, polyethylene glycol (PEG) linkage, fusion to albumin or other half-life extending proteins etc. are available to scientists such that the half-life of aptamers can be increased for several days or even weeks. In accordance with the present invention, the term "small interfering RNA (siRNA)", also known as short interfering RNA or silencing RNA, refers to a class of 18 to 30, preferably 19 to 25, most preferred 21 to 23 or even more preferably 21 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology. Most notably, siRNA is involved in the RNA interference (RNAi) pathway where the siRNA interferes with the expression of a specific gene. In addition to their role in the RNAi pathway, siRNAs also act in RNAi-related pathways, e.g. as an antiviral mechanism or in shaping the chromatin structure of a genome. siRNAs naturally found in nature have a well-defined structure: a short double-strand of RNA (dsRNA) with 2-nt 3' overhangs on either end. Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group. This structure is the result of processing by dicer, an enzyme that converts either long dsRNAs or small hairpin RNAs into siRNAs. siRNAs can also be exogenously (artificially) introduced into cells to bring about the specific knockdown of a gene of interest. Essentially any gene for which the sequence is known can thus be targeted based on sequence complementarity with an appropriately tailored siRNA. The double-stranded RNA molecule or a metabolic processing product thereof is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and / or DNA methylation. Exogenously introduced siRNAs may be devoid of overhangs at their 3' and 5' ends, however, it is preferred that at least one RNA strand has a 5'- and / or 3'-overhang. Preferably, one end of the double-strand has a 3'-overhang from 1 to 5 nucleotides, more preferably from 1 to 3 nucleotides and most preferably 2 nucleotides. The other end may be blunt-ended or has up to 6nucleotides 3'-overhang. In general, any RNA molecule suitable to act as siRNA is envisioned in the present invention. The most efficient silencing was so far obtained with siRNA duplexes composed of 21-nt sense and 21-nt antisense strands, paired in a manner to have a 2-nt 3'- overhang. The sequence of the 2-nt 3' overhang makes a small contribution to the specificity of target recognition restricted to the unpaired nucleotide adjacent to the first base pair (Elbashir et al.2001).2'-deoxynucleotides in the 3' overhangs are as efficient as ribonucleotides, but are often cheaper to synthesize and probably more nuclease resistant. Delivery of siRNA may be accomplished using any of the methods known in the art, for example by combining the siRNA with saline and administering the combination intravenously or intranasally or by formulating siRNA in glucose (such as for example 5% glucose) or cationic lipids andpolymers can be used for siRNA delivery in vivo through systemic routes either intravenously (IV) orintraperitoneally (IP) (Fougerolles et al. (2008), Current Opinion in Pharmacology, 8:280-285; Lu et al.(2008), Methods in Molecular Biology, vol.437: Drug Delivery Systems – Chapter 3: Delivering Small Interfering RNA for Novel Therapeutics). A short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. shRNA uses a vector introduced into cells and utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the siRNA that is bound to it. si / shRNAs to be used in the present invention are preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA / RNA synthesizer. Suppliers of RNA synthesis reagents are Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). Most conveniently, siRNAs or shRNAs are obtained from commercial RNA oligo synthesis suppliers, which sell RNA-synthesis products of different quality and costs. In general, the RNAs applicable in the present invention are conventionally synthesized and are readily provided in a quality suitable for RNAi. Further molecules effecting RNAi include, for example, microRNAs (miRNA). Said RNA species are single-stranded RNA molecules. Endogenously presented miRNA molecules regulate gene expression by binding to a complementary mRNA transcript and triggering the degradation of said mRNA transcript through a process similar to RNA interference. Accordingly, exogenous miRNA may be employed as an inhibitor after introduction into the respective cells.A ribozyme (from ribonucleic acid enzyme, also called RNA enzyme or catalytic RNA) is an RNA molecule that catalyses a chemical reaction. Many natural ribozymes catalyse either their own cleavage or the cleavage of other RNAs, but they have also been found to catalyse the aminotransferase activity of the ribosome. Non-limiting examples of well-characterised small self-cleaving RNAs are the hammerhead, hairpin, hepatitis delta virus, and in vitro-selected lead-dependentribozymes, whereas the group I intron is an example for larger ribozymes. The principle of catalytic self-cleavage has become well established in recent years. The hammerhead ribozymes are characterised best among the RNA molecules with ribozyme activity. Since it was shown that hammerhead structures can be integrated into heterologous RNA sequences and that ribozyme activity can thereby be transferred to these molecules, it appears that catalytic antisense sequences for almost any target sequence can be created, provided the target sequence contains a potential matching cleavage site. The basic principle of constructing hammerhead ribozymes is as follows: A region of interest of the RNA, which contains the GUC (or CUC) triplet, is selected. Two oligonucleotide strands, each usually with 6 to 8 nucleotides, are taken and the catalytic hammerhead sequence is inserted between them. The best results are usually obtained with short ribozymes and target sequences. A recent development, also useful in accordance with the present invention, is the combination of an aptamer, recognizing a small compound, with a hammerhead ribozyme. The conformational change induced in the aptamer upon binding the target molecule can regulate the catalytic function of the ribozyme. The term “antisense nucleic acid molecule”, as used herein, refers to a nucleic acid which is complementary to a target nucleic acid. An antisense molecule in accordance with the invention is capable of interacting with the target nucleic acid, more specifically it is capable of hybridizing with the target nucleic acid. Due to the formation of the hybrid, transcription of the target gene(s) and / or translation of the target mRNA is reduced or blocked. Standard methods relating to antisense technology have been described (see, e.g., Melani et al., Cancer Res. (1991) 51:2897-2901). The antisense nucleic acid molecule may also be an antisense oligonucleotide, such as a LNA-GapmeR, an AntagomiR, or an antimiR. LNA-GapmeRs or simply GapmeRs are potent antisense oligonucleotides used for highly efficient inhibition of mRNA and lncRNA function. GapmeRs function by RNase H dependent degradation of complementary RNA targets. They are an excellent alternative to siRNA for knockdown of mRNA andlncRNA. They are advantageously taken up by cell without transfection reagents. GapmeRs contain a central stretch of DNA monomers flanked by blocks of LNAs. The GapmeRs are preferably 14-16 nucleotides in length and are optionally fully phosphorothioated. The DNA gap activates the RNAse H- mediated degradation of targeted RNAs and is also suitable to target transcripts directly in the nucleus. LNA-GapmeRs are routinely designed using established algorithms. LNA-GapmeRs to a selected target are commercially available including positive and negative controls, for example, from Exiqon. As mentioned, AntimiRs are oligonucleotide inhibitors that were initially designed to be complementary to a miRNA. AntimiRs against miRNAs have been used extensively as tools to gain understanding of specific miRNA functions and as potential therapeutics. AntimiRs are preferably AntagomiRs. AntagomiRs are synthetic 2-O-methyl RNA oligonucleotides, preferably of 21 to 23 nucleotides which are preferably fully complementary to the selected target RNA. While AntagomiRs were initially designed against miRNAs they may also be designed against mRNAs. AntagomiRs are preferably synthesized with 2ʹ-OMe modified bases (2ʹ-hydroxyl of the ribose is replaced with a methoxy group), phosphorothioate (phosphodiester linkages are changed to phosphorothioates) on the first two and last four bases, and an addition of cholesterol motif at 3ʹ end through a hydroxyprolinol modified linkage. The addition of 2ʹ-OMe and phosphorothioate modifications improve the bio-stability whereas cholesterol conjugation enhances distribution and cell permeation of the AntagomiRs. Antisense molecules (including antisense oligonucleotides, such as LNA-GapmeR, an AntagomiR, an antimiR), siRNAs and shRNAs of the present invention are preferably chemically synthesized using a conventional nucleic acid synthesizer. Suppliers of nucleic acid sequence synthesis reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). CRISPR / Cas technologies are applicable in nearly all cells / model organisms and can be used for knock out mutations, chromosomal deletions, editing of DNA sequences and regulation of gene expression. The regulation of the gene expression can be manipulated by the use of a catalytically dead Cas9 enzyme (dCas9) that is conjugated with a transcriptional repressor to repress transcription of a specific gene. Similarly, catalytically inactive, "dead" Cpf1 nuclease (CRISPR from Prevotella and Francisella-1) can be fused to synthetic transcriptional repressors or activators to downregulate endogenous promoters, e.g. the promoter which controls gene expression. Alternatively, the DNA-binding domain of zincfinger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs) can bedesigned to specifically recognize the gene or its promoter region or its 5`-UTR thereby inhibiting the expression of the gene. Inhibitors provided as inhibiting nucleic acid molecules that target the gene or a regulatory molecule involved in expression are also envisaged herein. Such molecules, which reduce or abolish the gene expression or a regulatory molecule include, without being limiting, meganucleases, zinc finger nucleases and transcription activator-like (TAL) effector (TALE) nucleases. Such methods are described in Silva et al., Curr Gene Ther.2011;11(1):11-27; Miller et al., Nature biotechnology.2011;29(2):143- 148, and Klug, Annual review of biochemistry.2010; 79:213-231. The term “antibody” as used in accordance with the present invention comprises, for example, polyclonal or monoclonal antibodies. Furthermore, also derivatives or fragments thereof, which still retain the binding specificity to the target are comprised in the term "antibody"; i.e. antigen binding fragments of (complete) antibodies. Antibody fragments or derivatives comprise, inter alia, Fab or Fab’ fragments, Fd, F(ab')2, Fv or scFv fragments, single domain VH or V-like domains, such as VhH or V- NAR-domains, as well as multimeric formats such as minibodies, diabodies, tribodies or triplebodies, tetrabodies or chemically conjugated Fab’-multimers (see, for example, Harlow and Lane "Antibodies, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 198; Harlow and Lane “Using Antibodies: A Laboratory Manual” Cold Spring Harbor Laboratory Press, 1999; Altshuler EP, Serebryanaya DV, Katrukha AG. 2010, Biochemistry (Mosc)., vol. 75(13), 1584; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol.23(9), 1126). The multimeric formats in particular comprise bispecific antibodies that can simultaneously bind to two different types of antigen. The first antigen can be found on the protein of the invention. The second antigen may, for example, be a tumor marker that is specifically expressed on cancer cells or a certain type of cancer cells. Non-limiting examples of bispecific antibodies formats are Biclonics (bispecific, full length human IgG antibodies), DART (Dual-affinity Re-targeting Antibody) and BiTE (consisting of two single-chain variable fragments (scFvs) of different antibodies) molecules (Kontermann and Brinkmann (2015), Drug Discovery Today, 20(7):838-847). The term "antibody" also includes embodiments such as chimeric (human constant domain, non- human variable domain), single chain and humanised (human antibody with the exception of non- human CDRs) antibodies. Various techniques for the production of antibodies are well known in the art and described, e.g. in Harlow and Lane (1988) and (1999) and Altshuler et al., 2010, loc. cit. Thus, polyclonal antibodies can be obtained from the blood of an animal following immunisation with an antigen in mixture withadditives and adjuvants and monoclonal antibodies can be produced by any technique which provides antibodies produced by continuous cell line cultures. Examples for such techniques are described, e.g. in Harlow E and Lane D, Cold Spring Harbor Laboratory Press, 1988; Harlow E and Lane D, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999 and include the hybridoma technique originally described by Köhler and Milstein, 1975, the trioma technique, the human B-cell hybridoma technique (see e.g. Kozbor D, 1983, Immunology Today, vol.4, 7; Li J, et al. 2006, PNAS, vol. 103(10), 3557) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, Alan R. Liss, Inc, 77-96). Furthermore, recombinant antibodies may be obtained from monoclonal antibodies or can be prepared de novo using various display methods such as phage, ribosomal, mRNA, or cell display. A suitable system for the expression of the recombinant (humanised) antibodies may be selected from, for example, bacteria, yeast, insects, mammalian cell lines or transgenic animals or plants (see, e.g., US patent 6,080,560; Holliger P, Hudson PJ.2005, Nat Biotechnol., vol. 23(9), 11265). Further, techniques described for the production of single chain antibodies (see, inter alia, US Patent 4,946,778) can be adapted to produce single chain antibodies specific for an epitope of a protein. Surface plasmon resonance as employed in the BIAcore system can be used to increase the efficiency of phage antibodies. As used herein, the term “antibody mimetics” refers to compounds which, like antibodies, can specifically bind antigens, but which are not structurally related to antibodies. Antibody mimetics are usually artificial peptides or proteins with a molar mass of about 3 to 20 kDa. In accordance with an even more preferred embodiment the antibody mimetic is selected from the group consisting of Anticalins, Affibodies, Adnectins, DARPins, Avimers, Nanofitins, Affilins, β-Wrapins, ADAPT, Monobodies, RasIns, FingRs, Pronectins, Centyrins, Affimers, Adhirons, Affitins, αReps, Repebodies, i-bodies, Fynomers and Kunitz domain proteins. “Anticalins” are an emerging class of clinical-stage biopharmaceuticals with high potential as an alternative to antibodies. Anticalin molecules are generated by combinatorial design from natural lipocalins, which are abundant plasma proteins in humans, and reveal a simple, compact fold dominated by a central β-barrel, supporting four structurally variable loops that form a binding site. Reshaping of this loop region results in Anticalin proteins that can recognize and tightly bind a wide range of medically relevant targets, from small molecules to peptides and proteins, as validated by X- ray structural analysis. Their robust format allows for modification in several ways, both as fusion proteins and by chemical conjugation, for example, to tune plasma half-life (Rothe and Skerra (2018) BioDrugs 32, 233–243.)."Affibodies", in accordance with the present invention, are a family of antibody mimetics derived from the Z-domain of staphylococcal protein A. Affibodies are structurally based on a three-helix bundle domain. An affibody has a molecular mass of around 6 kDa and is stable at high temperatures and under acidic or alkaline conditions. Target specificity is obtained by randomisation of amino acids located in two alpha-helices involved in the binding activity of the parent protein domain (Feldwisch, J & Tolmachev, V.
[2012] Methods Mol. Biol.899:103-126). "Adnectins" and also “Monobodies”, in accordance with the present invention, are based on the 10th extracellular domain of human fibronectin III (10Fn3), which adopts an Ig-like sandwich fold with 2 to 3 exposed loops, but lacks the central disulphide bridge (Gebauer, M. & Skerra, A.
[2009] Curr. Opin. Chem. Biol. 13:245-255). Adnectins and Monobodies with the desired target specificity can be genetically engineered by introducing modifications into specific loops or other surface areas of the protein. "DARPins", in accordance with the present invention, are designed ankyrin repeat domains that provide a rigid interface arising from typically three repeats corresponding to an artificial consensus sequence, whereby six positions per repeat are randomised. Consequently, DARPins lack structural flexibility (Gebauer, M. & Skerra, A.
[2009] Curr. Opin. Chem. Biol.13:245-255). The term “Avimer”, as used herein, refers to a class of antibody mimetics which consist of two or more peptide sequences of 30 to 35 amino acids each, which are derived from A-domains of various membrane receptors and which are connected by linker peptides. Binding of target molecules occurs via the A-domain and domains with desired binding specificity can be selected, for example, by phage display techniques. The target specificity of the different A-domains contained in an Avimer may, but do not have to be identical (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4):155-68). “Nanofitins” and also an “Affitins” are antibody mimetic proteins that are derived from the DNA binding protein Sac7d of Sulfolobus acidocaldarius. Nanofitins and Affitins usually have a molecular weight of around 7kDa and are designed to specifically bind a target molecule by randomising the amino acids on the binding surface (Mouratou B, Béhar G, Paillard-Laurance L, Colinet S, Pecorari F., (2012) Methods Mol Biol.; 805:315-31 and Koide et al.1998, J. Mol. Biol.284:1141–51). The term “Affilin”, as used herein, refers to antibody mimetics that are developed by using either gamma-B crystalline or ubiquitin as a scaffold and modifying amino-acids on the surface of theseproteins by random mutagenesis. Selection of affilins with the desired target specificity is effected, for example, by phage display or ribosome display techniques. Depending on the scaffold, affilins have a molecular weight of approximately 10 or 20kDa. As used herein, the term affilin also refers to di- or multimerised forms of affilins (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4):155-68). As used herein, the term "β-Wrapins” designates affibody protein homodimers with a disulfide bond between the pair of Cys28 residues connecting the two identical monomer subunits, referred to as subunits 1 and 2. The scaffold used in engineering β-wrapins is ΖΑβ3, an Αβ-binding affibody protein that not only prohibits the initial aggregation of Αβ monomers into toxic forms, but also dissociates pre-formed oligomeric aggregates by sequestering and stabilizing a β-hairpin conformation of Αβ monomers (Orr et al. (2018), Computers & Chemical Engineering, 116(4):322-332). As used herein, the term "ABD-Derived Affinity Proteins (ADAPT)” refers to a class of antibody mimetics that has been created using the albumin-binding domain (ABD) of streptococcal protein G as a stable protein scaffold (Garousi et al (2015), Cancer Res.; 75(20):4364-71). By diversifying a surface of the domain that is not directly involved in albumin binding, molecules can be selected to bind a novel target and still retain their ability to bind albumin. This strategy has been used to select binders to a number of proteins, for example, the cancer-related epidermal growth factor receptor 3. As used herein “RasIns” are 10FnIII-based antibody mimetics. Hence, they use the 10th domain of human fibronectin as their scaffold RasIns are disulfide-free intrabodies. They were shown to be stable inside cells and also when fused with a fluorescent protein label (Cetin et al. (2017), J Mol Biol.; 429(4):562–573). As used herein, the term “FingRs (Fibronectin intrabodies generated with mRNA display)” designates recombinant antibody-like proteins also being based on the 10FnIII scaffold (Gross et al. (2013), Neuron.; 78(6): 971–985.). As used herein, the term “Pronectins” designates recombinant antibody-like proteins being based on the fourteenth type-III scaffold of human fibronectin (14Fn3). The well-characterized fibronectin protein is prevalent throughout the human body. Human fibronectin, an extracellular protein, is naturally abundant in human serum. Intelligent loop-diversity has been designed to closely mimic the natural human repertoire and avoid sequence immunogenicity. The intrinsic properties of a Pronectin align with the pharmacological properties needed to make it a successful drug, including high potency,specificity, stability, favorable small size, and high-yield production in E. coli and yeast(http: / / www.protelica.com / pronectin_tech.html). As used herein, the term “Centyrins” designates recombinant antibody-like proteins being based on the consensus tenascin FN3 framework (Tencon) (Diem et al. (2014), Protein Eng., Des. and Sel. 27, 419–429). Centryins against different targets, e.g. human c-MET, rTNFα and mIL-17A, were generated. As used herein, “Affimers” refer to small proteins that bind to target molecules with similar specificity and affinity to that of antibodies. These engineered non-antibody binding proteins are designed to mimic the molecular recognition characteristics of monoclonal antibodies in different applications. In addition, these affinity reagents have been optimized to increase their stability, make them tolerantto a range of temperatures and pH, reduce their size, and to increase their expression in E. coli andmammalian cells. Derived from the cysteine protease inhibitor family of cystatins, which function in nature as cysteine protease inhibitors, these 12–14 kDa proteins share the common tertiary structureof an ^-helix lying on top of an anti-parallel β-sheet (Tiede et al. (2017), eLife.; 6: e24903).The class of recombinant antibody-like proteins designated as “Adhirons” herein is based on a phytocystatin consensus sequence as the scaffold (Tiede et al. (2014) Protein Eng. Des. Sel. 27, 145- 55). The class of recombinant antibody-like proteins designated as “αRep” herein is derived from alpha- helicoidal HEAT-like repeat protein scaffolds. In more detail, the αRep proteins are derived from a natural family of modular proteins comprising alpha-helical repeats, related to HEAT repeats, named after Huntingtin, the elongation factor 3 (EF3), the protein phosphatase 2A (PP2A), and the yeast kinase TOR. The association of several HEAT repeats forms alpha-solenoids of various lengths, which are naturally found in a number of cellular proteins involved in intracellular transport and protein- protein interaction (Hadpech et al. (2017), Scientific Reports; 7:Article number16335). As used herein, the term “Repebodies” designates recombinant antibody-like proteins which are composed of leucine-rich repeat (LRR) modules. In more detail, the binding scaffold of Repebodies is based on variable lymphocyte receptors, which are nonimmunoglobulin antibodies composed of LRR modules in jawless vertebrates. A template scaffold was first constructed by joining consensus repeat modules between the N- and C-capping motifs of variable lymphocyte receptors. The N-terminal domain of the template scaffold was redesigned based on the internalin-B cap by analyzing the modular similarity between the respective repeat units using a computational approach (Lee at al. (2012), Proc Natl Acad Sci; 109(9): 3299-3304).As used herein, the term “i-bodies” refers to recombinant antibody-like proteins built on the scaffold of a human protein and engineered with two loops that mimic the shape of shark antibodies. These loops are responsible for binding or interacting with a particular target (in circulation or on a cell) that is causing disease. The i-body is a human analogue of the antigen binding domain of the shark antibody, which combines the advantages of monoclonal antibodies (high target specificity and affinity) with the beneficial stability features of small molecules (https: / / www.ibodies.eu / ). As used herein, the term "Fynomer" refers to a non-immunoglobulin-derived binding polypeptide derived from the human Fyn SH3 domain. Fyn SH3-derived polypeptides are well-known in the art and have been described e.g. in Grabulovski et al. (2007) JBC, 282, p. 3196-3204, WO 2008 / 022759, Bertschinger et al (2007) Protein Eng Des Sel 20(2):57-68, Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255, or Schlatter et al. (2012), MAbs 4:4, 1-12). A “Kunitz domain peptide” is derived from the Kunitz domain of a Kunitz-type protease inhibitor such as bovine pancreatic trypsin inhibitor (BPTI), amyloid precursor protein (APP) or tissue factor pathway inhibitor (TFPI). Kunitz domains have a molecular weight of approximately 6kDa and domains with the required target specificity can be selected by display techniques such as phage display (Weidle et al., (2013), Cancer Genomics Proteomics; 10(4):155-68). In accordance with another more preferred embodiment the inhibitor of the nucleic acid molecule comprises or consists of (a) a nucleic acid sequence which comprises or consists of a nucleic acid sequence being complementary to at least 12 continuous nucleotides of a nucleic acid sequence selected from SEQ ID NOs 1, 3 and 5, (b) a nucleic acid sequence which comprises or consists of a nucleic acid sequence which is at least 70% identical to the complementary strand of one or more nucleic acid sequences selected from SEQ ID NOs 1, 3 and 5, (c) a nucleic acid sequence which comprises or consists of a nucleic acid sequence according to (a) or (b), wherein the nucleic acid sequence is DNA or RNA, (d) an expression vector expressing the nucleic acid sequence as defined in any one of (a) to (c), preferably under the control of a glial cells-specific promoter, preferably Schwann cells-specific promoter, or (e) a host comprising the expression vector of (d).The nucleic acid sequences as defined in items (a) to (c) of this preferred embodiment comprise or consist of sequences being complementary to nucleotides as defined by one or more of SEQ ID NOs 1, 3 and 5 described herein above. Hence, the nucleic acid sequences as defined in items (a) to (c) comprise or are antisense nucleic acid sequences. The nucleic acid sequence according to item (a) of this further preferred embodiment of the invention comprises or consists of a sequence which is with increasing preference complementary to at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides of one or more selected from SEQ ID NOs 1, 3 and 5. These at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, or at least 21 nucleotides are preferably a contiguous part of one or more selected from SEQ ID NOs 1, 3 and 5. The format of the nucleic acid sequence according to item (a) is not particularly limited as long as it comprises or consists of at least 12 continuous nucleotides being complementary to a nucleic acid sequence selected from SEQ ID NOs 1, 3 and 5. The nucleic acid sequence according to item (a) comprises or consists of an antisense oligonucleotide. Hence, the nucleic acid sequence according to item (a) reflects the above-mentioned basic principle of the antisense technology which is the use of an oligonucleotide for silencing a selected target RNA through the exquisite specificity of complementary-based pairing. Therefore, it is to be understood that the nucleic acid sequence according to item (a) is preferably in the format of an siRNA, shRNA or an antisense oligonucleotide as defined herein above. The antisense oligonucleotides are preferably LNA-GapmeRs, AntagomiRs, or antimiRs. The nucleic acid sequence according to item (b) requiring at least 70% identity to the complementary strand of one or more nucleic acid sequences selected from SEQ ID NOs 1, 3 and 5 is considerably longer than the nucleic acid sequence according to item (a) which comprises an antisense oligonucleotide and comprises at least 12 continuous nucleotides of a nucleic acid sequence selected from SEQ ID NOs 1, 3 and 5. A nucleic acid sequence according to item (b) of the above preferred embodiment of the invention is capable of interacting with, more specifically hybridizing with the target mRNA. By formation of the hybrid the translation of the mRNA is reduced or blocked. The sequence identity of the molecule according to item (b) in connection with a sequence selected from SEQ ID NOs 1, 3 and 5 is with increasing preference at least 75%, at least 80%, at least 85%, at least 90%, at least 92.5%, at least 95%, at least 98%, at least 99% and 100%. The sequence identity in connection with each of SEQ ID NOs 1, 3 and 5 can be individually selected. Means and methods fordetermining sequence identity are known in the art. As discussed above, preferably the BLAST (Basic Local Alignment Search Tool) program is used for determining the sequence identity with regard to one or more of SEQ ID NOs 1, 3 and 5. In the nucleic acid sequence according to item (c) the nucleotide sequences may be RNA or DNA. RNA or DNA encompasses chemically modified RNA nucleotides or DNA nucleotides. As commonly known RNA comprises the nucleotide U while DNA comprises the nucleotide T. In accordance with items (d) and (e) of the above preferred embodiment the inhibitor may also be an expression vector or host (e.g. host cell), respectively being capable of producing a nucleic acid sequence as defined in any one of items (a) to (c). An expression vector may be a plasmid that is used to introduce a specific transcript into a target cell. Once the expression vector is inside the cell, the protein that is encoded by the gene is produced by the cellular-transcription and translation machinery ribosomal complexes. The plasmid is in general engineered to contain regulatory sequences that act as enhancer and / or promoter regions and lead to efficient transcription of the transcript. In accordance with the present invention the expression vector preferably contains a glial cells-specific promoter, preferably Schwann cells-specific promoter. Preferred promoters Schwann-cell specific promoters shown in SEQ ID NOs 7-9. SEQ ID NO: 7 is the human P0 promoter, SEQ ID NO: 8 the human PMP22 promoter and SEQ ID NO: 9 the human MBP promoter. Also envisioned herein are Schwann-cell specific promoters that are with increasing preference at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least98%, and at least 99% identical to one of SEQ ID NOs 7-9.Non-limiting examples of expression vectors include prokaryotic plasmid vectors, such as the pUC- series, pBluescript (Stratagene), the pET-series of expression vectors (Novagen) or pCRTOPO (Invitrogen) and vectors compatible with an expression in mammalian cells like pREP (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, pIZD35, pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (Edge Biosystems) pTriEx-Hygro (Novagen) and pCINeo (Promega). Examples for plasmid vectors suitable for Pichia pastoris comprise e.g. the plasmids pAO815, pPIC9K and pPIC3.5K (all Intvitrogen). For the formulation of a pharmaceutical composition a suitable vector is selected in accordance with good manufacturing practice. Such vectors are known in the art, for example, from Ausubel et al, Hum Gene Ther.2011 Apr; 22(4):489-97 or Allay et al., HumGene Ther. May 2011; 22(5): 595–604. A typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Moreover, elements such as origin of replication,drug resistance gene, regulators (as part of an inducible promoter) may also be included. The lacpromoter is a typical inducible promoter, useful for prokaryotic cells, which can be induced using thelactose analogue isopropylthiol-b-D-galactoside ("IPTG"). For recombinant expression and secretion,the polynucleotide of interest may be ligated between e.g. the PelB leader signal, which directs the recombinant protein in the periplasm and the gene III in a phagemid called pHEN4 (described in Ghahroudi et al, 1997, FEBS Letters 414:521-526). Additional elements might include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from retroviruses, e.g., RSV, HTLVI, HIVI, and the early promoter of the cytomegalovirus (CMV). However, cellular elements can also be used (e.g., the human actin promoter). Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109). Alternatively, the recombinant (poly)peptide can be expressed in stable cell lines that contain the gene construct integrated into a chromosome. The co-transfection with a selectable marker such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells. The transfected nucleic acid can also be amplified to express large amounts of the encoded (poly)peptide. The DHFR (dihydrofolate reductase) marker is useful to develop cell lines that carry several hundred or even several thousand copies of the gene of interest. Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al.1991, Biochem J.227:277-279; Bebbington et al. 1992, Bio / Technology 10:169-175). Using these markers, the mammalian cells are grown in selective medium and the cells with the highest resistance are selected. As indicated above, the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria. For vector modification techniques, see Sambrook and Russel (2001), Molecular Cloning: A Laboratory Manual, 3 Vol. Generally, vectors can contain one or more origins of replication (ori) and inheritance systems for cloning or expression, one or more markers for selection in the host, e.g., antibiotic resistance, and one or more expression cassettes. Suitable origins of replication (ori) include, for example, the Col E1, the SV40 viral and the M 13 origins of replication.The sequences to be inserted into the vector can e.g. be synthesized by standard methods, or isolated from natural sources. Ligation of the coding sequences to transcriptional regulatory elements and / or to other amino acid encoding sequences can be carried out using established methods. Transcriptional regulatory elements (parts of an expression cassette) ensuring expression in prokaryotes or eukaryotic cells are well known to those skilled in the art. These elements comprise regulatory sequences ensuring the initiation of the transcription (e.g., translation initiation codon, promoters, enhancers, and / or insulators), internal ribosomal entry sites (IRES) (Owens, Proc. Natl. Acad. Sci. USA 98 (2001), 1471- 1476) and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers, and / or naturally-associated or heterologous promoter regions. Preferably, the nucleotide sequence as defined in item (a) of the above preferred embodiment of the invention is operatively linked to such expression control sequences allowing expression in prokaryotic or eukaryotic cells. The host is preferably a host cell, such as a prokaryotic or eukaryotic cell. A suitable eukaryotic host may be a mammalian cell, an amphibian cell, a fish cell, an insect cell, a fungal cell or a plant cell.Representative examples of bacterial cells are E. coli, Streptomyces and Salmonella typhimurium cells;of fungal cells are yeast cells; and of insect cells are Drosophila S2 and Spodoptera Sf9 cells. It is preferred that the cell is a mammalian cell such as a human cell. Mammalian host cells that could be used include, human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells. The cell may be a part of a cell line, preferably a human cell line. Appropriate culture mediums and conditions for the above- described host cells are known in the art. The host is preferably a host cell and more preferably an isolated host cell. The host is also preferably a non-human host. In accordance with a preferred embodiment of the invention, (I) the inhibitor of G6PD is selected from G6PDi-1, RRX-001, DHEA, Polydatin, 6-aminonicotinamide, Fluasterone, CB63, CB70, CB72, CB104, compounds 25, 29 and 32 and / or (II) the inhibitor of ACSL3 is Triacsin C. The inhibitors according to this preferred embodiment are small molecule inhibitors. G6PDi-1 is (Cas No. 2457232-14-1) is 4-([5-oxo-6H,7H,8H,9H-cyclohepta[d]pyrimidin-2- yl]amino)thiophene-2-carbonitrile. G6PDi-1 is commercially available.RRX-001 (Cas No. 925206-65-1) is 1-Bromoacetyl-3,3-dinitroazetidine. RRX-001 is commerciallyavailable.Dehydroepiandrosterone (DHEA), also known as androstenolone, (Cas No. 53-43-0) is 3β-Hydroxyandrost-5-en-17-one. DHEA is commercially available. Polydatin (Cas No. 65914-17-2) is also known as Piceid and is resveratrol 3-O-β-D-glucopyranosid or resveratrol-3-β-mono-D-glucosid. Polydatin is commercially available. 6-aminonicotinamide (Cas No. 329-89-5) is 6-Amino-pyridin-3-carbamid. 6-aminonicotinamide is commercially available. Fluasterone (Cas No.112859-71-9) is 3β-dehydroxy-16α-fluoro- DHEA or 16α-fluoroandrost-5-en-17- one. Fluasterone is commercially available. CB63, CB70, CB72, and CB104 are glucose-6-phosphate dehydrogenase inhibitors being described in Preuss et al. (2013), SLAS Discovery, 18(3):286-297.The following compounds 25, 29 and 32 are glucose-6-phosphate dehydrogenase inhibitors being described in Koperniku et al. (2022), J Med Chem.; 65(6): 4403–4423.Triacsin C (Cas No. 76896-80-5) is (2E,4E,7E)-2,4,7-undecatrienal nitrosohydrazone. Triacsin C is commercially available. In accordance with a preferred embodiment of the invention, the inhibitor is formulated as a pharmaceutical composition. In accordance with the present invention, the term “pharmaceutical composition” relates to a composition for administration to a patient, preferably a human patient. The pharmaceutical composition of the invention comprises the compounds recited above. The composition may be in solid, liquid or gaseous form and may be, inter alia, in the form of (a) powder(s), (a) tablet(s), (a)solution(s) or (an) aerosol(s). It may, optionally, comprise further molecules capable of altering thecharacteristics of the inhibitors according to the invention thereby, for example, stabilizing, modulating and / or activating their function. The dosage regimen of a pharmaceutical composition can be determined by the attending physician and clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. The therapeutically effective amount for a given situation will readily be determined by routine experimentation and is within the skills and judgement of the ordinary clinician or physician. Generally, the regimen as a regular administration of the pharmaceutical composition should be in the range of 1 µg to 5 g units per day. However, a more preferred dosage is in the range of 0.01 mg to 100 mg, even more preferably 0.01 mg to 50 mg and most preferably 0.01 mg to 10 mg per day. Furthermore, if for example said compound comprises or is an nucleic acid molecule, such as an siRNA, the total pharmaceutically effective amount of pharmaceutical composition administered will typically be less than about 75 mg per kg of body weight, such as for example less than about 70, 60, 50, 40, 30, 20, 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, or 0.0005 mg per kg of body weight. More preferably, the amount will be less than 2000 nmol of nucleic acid molecule per kg of body weight, such as for example less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075 or 0.00015 nmol per kg of body weight. The inhibitor(s) or the pharmaceutical composition may be administered, for example, orally, parenterally, such as subcutaneously, intravenously, intramuscularly, intraperitoneally, intrathecally, transdermally, transmucosally, subdurally, locally or topically via iontopheresis, sublingually, byinhalation spray, aerosol or rectally and the like in dosage unit formulations optionally comprising conventional pharmaceutically acceptable carriers or excipients. In accordance with a more preferred embodiment the pharmaceutical composition comprises the inhibitor and at least one pharmaceutically acceptable carrier, excipient or diluent. Hence, the inhibitor is preferably admixed with a pharmaceutically acceptable carrier, excipient ordiluent to form a pharmaceutical composition. By “pharmaceutically acceptable carrier, excipient ordiluent” is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type (see also Handbook of Pharmaceutical Excipients 6ed. 2010,Published by the Pharmaceutical Press). Ways of administering inhibitors to humans are alsodescribed, for example, in De Fougerolles et al., Current Opinion in Pharmacology, 2008, 8:280-285. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil / water emulsions, various types of wetting agents, sterile solutions, organic solvents including DMSO etc. Compositions comprising such carriers can be formulated by well known conventional methods. In accordance with another more preferred embodiment the subject wherein neurofibromatosis type 2 is to be treated or the neurofibromatosis type 2 tumors are to be prevented is a mammal. Non-limiting examples of mammals are rodents (e.g. mice, rats, hamsters, and genuine pig) and mammalian farm animals (e.g. cow, pig, goat and sheep) and monkeys and apes (e.g. macaque and chimpanzee). In accordance with another more preferred embodiment the mammal is a human. In this connection it is noted that the experiments in the appended examples were conducted with human Schwann cells and emphasize that current treatment option of NF2 in humans are limited and that no cure is available. Regarding the embodiments characterized in this specification, in particular in the claims, it is intended that each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends from. For example, in case of an independent claim 1 reciting 3 alternatives A, B and C, a dependent claim 2 reciting 3 alternatives D, Eand F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise. Similarly, and also in those cases where independent and / or dependent claims do not recite alternatives, it is understood that if dependent claims refer back to a plurality of preceding claims, any combination of subject-matter covered thereby is considered to be explicitly disclosed. For example, in case of an independent claim 1, a dependent claim 2 referring back to claim 1, and a dependent claim 3 referring back to both claims 2 and 1, it follows that the combination of the subject-matter of claims 3 and 1 is clearly and unambiguously disclosed as is the combination of the subject-matter of claims 3, 2 and 1. In case a further dependent claim 4 is present which refers to any one of claims 1 to 3, it follows that the combination of the subject-matter of claims 4 and 1, of claims 4, 2 and 1, of claims 4, 3 and 1, as well as of claims 4, 3, 2 and 1 is clearly and unambiguously disclosed.The above considerations apply mutatis mutandis to all appended claims.The figures show: Figure 1: Synthetic lethality screen identifies G6PD and ACSL3 as NF2-synthetic-lethal genes. (A) NF2 knockout (NF2-KO) cells have reduced YAP phosphorylation and elevated Akt phosphorylation. Western blot analysis of lysates from isogenic NF2 WT and KO human Schwann cell lines. ERK 42 / 44:pThr 202 / pTyr204. (B) At low cell density (2500 cells / 0.32cm2), NF2-KO cells proliferate at roughly thesame rate as NF2-WT cells. Relative cell number measured by CellTiter-Glo. Results are shown as afold-change relative to the first timepoint (16hrs post seeding). n=4 (C) NF2-KO cells are not contactinhibited compared to NF2 WT cells. Real time, impedance-based (iCelligence) cell growth analysis ofNF2 WT and KO isogenic Schwann cells starting at medium confluence (5000 cells / 0.32cm2). n=4. (D)At high confluence, NF2 KO Schwann cells are more packed and less elongated compared to NF2 WTcells. Images taken at full confluence (96hrs timepoint from panel c). (E) Schematic diagram of thegenome-wide synthetic lethality screen to identify genes that are synthetic-lethal with NF2 loss-of- function.(F) Scatter plot of the abundance of each sgRNA from the library at passage 7 (endpoint) normalizedto passage 0 for both NF2-WT (x-axis) and NF2-KO#1 (y-axis) cells. Each dot represents a single sgRNA, and abundance is calculated as the log2 Fold Change (FC) of passage 7 / passage 0.(G) Top hits showing a differential proliferative / viability effect in NF2 KO cells compared to NF2-WT cells. Figure 2: Validation of NF2 / G6PD synthetic lethality(A-C) sgRNA-mediated depletion of G6PD causes reduced viability of NF2-KO cells but not NF2-WTcells. (A) Relative cell number 4 days after seeding (7 days post infection), assessed by CellTiter-Glo. (B) Cell toxicity analyzed with CellTox. Values are normalized to total cell number (CellTiter-Glo). (C) Representative control immunoblots to assess G6PD knock-out efficiency. Bars = mean ± SEM. *p<0.05, **p<0.01 by two-way ANOVA and Sidak’s multiple comparisons test. n=4 for (A) and 3 for (B)biological replicates. (D) Pharmacological inhibition of G6PD (25μΜ G6PDi-1, 96hrs) reduces viabilityof NF2-KO but not NF2-WT Schwann cells. Bars = mean ± SEM. ***p<0.001, ****p<0.0001 by one-wayANOVA and Dunnett’s multiple comparisons test. n=5 biological replicates. (E-F) Pharmacologicalinhibition of G6PD strongly reduces viability of NF2-KO cells, as seen if the cells are passaged 3 times in the presence or absence of G6PDi-1 to prevent wildtype cells from reaching confluence and no longer proliferating. Cells are stained with crrystal violet. (E) Representative image. (F) ****p<0.0001by one-way ANOVA and Dunnett’s multiple comparisons test .n=3 biological replicates. (G) NF2-KOSchwann cells form tumors when implanted subcutaneously in NOD SCID gamma (NSG) mice. Top panel: macroscopic image of the excised tumor. Middle & bottom panels: hematoxylin and eosin stained tumor at two different magnifications, showing a necrotic center and invasion of the tumor into neighboring muscle.´(H-I) Induction of G6PD knockdown with two different shRNAs impairs viability of NF2 KO cells. (H) Immunoblot control of G6PD knockdown upon Dox treatment (1µg / mL for 24h) of human Schwann cell lines stably transfected to carry indicated shRNAs. (I) Relative cell number 4 days after induction (1μg / ml doxycycline, Dox) of control or G6PD shRNA, each compared to non- induced controls (DMSO). Bars = mean ± SEM. **p<0.01, ****p<0.0001 by one-way ANOVA andDunnett’s multiple comparisons test. n=4 biological replicates. (J-K) G6PD knockdown reduces growthof NF2-KO Schwann cell tumor xenografts. Tumor volumes as a function of time of NSG mice injected subcutaneously with indicated Schwann cell lines and treated + / - Dox for 26 weeks. shRNA targeting Renilla Luciferase (RLuc) was used as a negative control. Animals were randomized into the +dox vs - dox groups. Graphs show mean volumes; error bars=SEM. ns>0.05, ****p<0.0001 by multiple unpairedt-test comparison analysis. n=9-10 mice / group. (L) Inhibition of G6PD does not kill NF2- / +heterozygous Schwann cells. ns>0.05, ****p<0.0001 by one-way ANOVA and Dunnett’s multiple comparisons test. n=3 biological replicatesFigure 3: Validation of ACSL3 / G6PD synthetic lethality(A-C) sgRNA-mediated depletion of ACSL3 causes reduced viability of NF2-KO cells but not NF2-WTcells. (A) Relative cell number 4 days after seeding (7 days post infection), assessed by CellTiter-Glo. (B) Cell toxicity analyzed with CellTox. Values are normalized to total cell number (CellTiter-Glo). (C) Representative control immunoblots to assess ACSL3 knock-out efficiency. Bars = mean ± SEM. ***p<0.001, ****p<0.0001 by two-way ANOVA and Sidak’s multiple comparisons test. n=5 (j) or 3 (i) biological replicates. (D-E) Induction of ACSL3 knockdown with two different shRNAs impairs viability of NF2 KO cells. (D) Immunoblot control of ACSL3 knockdown upon Dox treatment (1µg / mL for 24h) of human Schwann cell lines stably transfected to carry indicated shRNAs. (E) Relative cell number 4 days after induction (1μg / ml doxycycline) of control or ACSL3 shRNA, each compared to non-induced controls (DMSO). Bars = mean ± SEM. ***p<0.001 by one-way ANOVA and Dunnett’s multiple comparisons test. n=4 biological replicates. (F) ACSL3 knockdown reduces growth of NF2-KO Schwann cell tumor xenografts. Tumor volume as a function of time of NSG mice injected subcutaneously with indicated Schwann cell lines and treated + / - Dox for 26 weeks. Animals were randomized into the +dox vs -dox groups. Graphs show mean volumes; error bars=SEM. ns>0.05, **p<0.01 by multiple unpaired t-test comparison analysis. n=8-10 mice / group. Figure 4: Characterization of the synthetic lethality caused by G6PD or ACSL3 (A-B) The synthetic lethality between ACSL3 and NF2 is rescued by treating cells with a lipid mix (1%) (A) but not by the antioxidant n-acetylcysteine (NAC, 1mM) (B). Relative cell number (CellTiter-Glo) normalized to the control sgRNA for each condition. Bars = mean ± SEM. ****p<0.0001 by two-wayANOVA and Tukey’s multiple comparisons test. n=4 (A) or 3 (B) biological replicates. (C) Syntheticlethality of NF2 and ACSL3 is rescued by Liproxstatin. Relative cell number (CellTiter-Glo) upon treatment with the ferroptosis inhibitor Liproxstatin. Value are normalized to control sgRNA. Bars = mean ± SEM. Statistical analysis shown is a two-way ANOVA and Tukey’s multiple comparisons test;n=5 biological replicates. (D) NF2 knockout Schwann cells have mildly elevated lipid peroxidationlevels, assessed using BODIPY 581 / 591 C11 and flow cytometry. Ratio of oxidized / reduced lipids were normalized to untreated NF2-WT background levels. Erastin treatment (10μM-5hrs) was used as a positive control for lipid peroxidation. Bars = mean ± SEM. *p<0.05, **p<0.01 by two-way ANOVA andTukey’s multiple comparisons test. n=3 biological replicates. (E-G) The synthetic lethality between NF2and G6PD is rescued by (G) the antioxidant n-acetylcysteine (NAC, 1mM), but not by (E) Liproxstatin (1μM), or by (F) supplementation with 1% Lipid Mix. Relative cell numbers, normalized to the DMSO control treatment condition, assayed by CellTiter-Glo. G6PDi-1 used at 25µM. Bars = means ± SEM.****p<0.0001 by two-way ANOVA and Tukey’s multiple comparisons test. n=3 biological replicates.(H) G6PDi-1 induces cell death (assayed by CellTox) in NF2-KO Schwann cells, and is rescued by NAC.Cell death values are normalized to cell number (CellTiter-Glo). Bars = mean ± SEM. *p<0.05, **p<0.01, ***p<0.001 by two-way ANOVA and Tukey’s multiple comparisons test. n>3 biological replicates. Figure 5: NF2-KO Schwann cells are more oxidized than control cells(A) NF2 KO Schwann cells have reduced AKR1C1, 2 and 3 mRNA levels compare to isogenic NF2-WTcontrols, assayed by Q-RT-PCR. Bars = mean ± SEM. Dots = biological replicates. ***p<0.001, ****p<0.0001 by one-way ANOVA and Dunnett’s multiple comparisons test. n=4 biological replicates (B) NF2 KO Schwann cells have reduced AKR1C3 and increased ACSL3 protein levels compare toisogenic NF2-WT controls. (C) NF2-KO Schwann cells have reduced ME1 mRNA levels, assayed by Q-RT-PCR, compared to NF2 WT isogenic controls. Bars = mean ± SEM. n=3 biological replicates, **p<0.01by one-way ANOVA and Dunnett’s multiple comparisons test. (D) NF2-KO Schwann cells have reducedlevels of ME1 protein compared to NF2-WT isogenic controls. (E) NF2-KO Schwann cells have reducedME1 activity compared to NF2 WT isogenic controls. Bars = mean ± SEM. n=7 biological replicates.****p<0.0001 by two-way ANOVA and Tukey’s multiple comparisons test. (F) NF2-KO Schwann cellshave reduced G6PD activity compared to NF2 WT isogenic control cells. Bars = mean ± SEM. *p<0.05by one-way ANOVA and Dunnett’s multiple comparisons test. n=5 biological replicates. (G) NF2-KOSchwann cells have a reduced NADPH / NADP+ratio compared to isogenic controls. Dots = biological replicates. *p<0.05, **p<0.01 by one-way ANOVA and Dunnett’s multiple comparisons test. n=8biological replicates. (H) ME1 mRNA levels are significantly reduced in NF2 mutant and cystic vestibularschwannomas from patients compared to control vestibular nerve. Data are re-analyzed from 33. Dots= individual patients. Bars = mean ± Std. Dev. **p<0.01, ***p<0.001 by Brown-Forsythe and WelchANOVA and Dunnetts’s multiple comparisons test. n>7. (I) AKR1C1, 2 and 3 mRNA levels areconsistently reduced in different types of vestibular schwannomas (VS: sporadic, cystic and NF2)compared to control vestibular nerve. Data are re-analyzed from 33. Dots = individual patients. Bars =mean ± Std. Dev. *p<0.05 by Brown-Forsythe and Welch ANOVA and Dunnetts’s multiple comparisons test. n>7 Figure 6: NF2 and ME1 are synthetic lethal in Schwann cells(A) Relative oxidized glutathione levels are increased in NF2-KO Schwann cells after treatment withG6PDi-1 and rescued by n-acetylcysteine (NAC). Bars = mean ± SEM. **p<0.01, ***p<0.001 by two-way ANOVA and Tukey’s multiple comparisons test. n=4 biological replicates. (B) G6PD inhibition andME1 inhibition display synthetic lethality in Schwann cells. Cell number (by CellTiter-Glo) of NF2-WT cells treated + / - G6PDi-1 + / - ME1 inhibitor, normalized to the non-treated DMSO condition. Bars =mean ± SEM. ****p<0.0001 by one-way ANOVA and Dunnett’s multiple comparisons test. n=3biological replicates. (C-D) Re-expression of ME1 rescues the sensitivity of NF2-KO Schwann cells toG6PD inhibition. (C) Immunoblot of ME1 levels in NF2-WT cells, NF2-KO cells, and a monoclonal line of NF2-KO cells transfected to express ME1. (D) Relative cell numbers of the indicated cell lines 4 days after treatment with 25µM G6PDi-1, normalized to untreated cells. ns>0.05, ****p<0.0001 by one- way ANOVA and Dunnett’s multiple comparisons test. n=4 biological replicates Figure 7: Characterization of NF2 KO Schwann cell lines.(A) Molecular characterization of the two NF2 KO Schwann cell lines (DNA and resulting proteintruncations) targeting exons 1 and 2. (B) NF2-KO cells do not express a truncated form of NF2. Immunoblot of NF2-WT and NF2-KO cells with an antibody that detects the c-terminal region of NF2. (C) NF2-KO Schwann cells, but not the NF2-WT parental line, can form anchorage-independent clones in soft agar (7 days). (D) Gene Ontology enrichment on genes differentially expressed in NF2-KO#1 cells compared to NF2-WT cells (|log2FC|>2 and Benjamini-Hochberg p <0.01), analysed with ShinyGo 18.(E) Immunoblot analysis of Cas9 expression in the cell lines that were used for the synthetic lethalityscreen. Figure 8: Support to figure 2. (A-C) siRNA-mediated knockdown of G6PD or ACSL3 causes synthetic lethality with NF2 loss-of- function in Schwann cells. (A) Relative cell number, assayed by CellTiter-Glo, normalized to control siRLuc. Dots = biological replicates. Bars = mean ± SEM. **p<0.01, ***p<0.001 by two-way ANOVA and Tukey’s multiple comparisons test. n=4 biological replicates. (B) Control immunoblot for G6PDknockdown. (C) Control immunoblot for ACSL3 knockdown. (D) Pharmacological inhibition of G6PDinduces cell death of NF2-KO Schwann cells, assayed by flow cytometry as PI-positive cells 96hrs after treatment with G6PDi-1 (25μΜ). Bars = mean ± SEM. **p<0.01 by one-way ANOVA and Dunnett’s multiple comparisons test. n=3 biological replicates. (E) Inhibition of G6PD causes synthetic lethality with NF2 loss-of-function also in Schwann cells growing in culture conditions with reduced growth factor stimulation (5% FBS). Ratio of cell number in the +G6PDi-1 inhibitor condition normalized to the -inhibitor condition, assayed by CellTiter Glo. Bars = mean ± SEM. **p<0.01 by one-way ANOVA and Dunnett’s multiple comparisons test. n=3 biologicalreplicates. (F) Tumor take rate for the indicated Schwann cell lines, either in the absence or presenceof doxycycline in the drinking water to induce knockdown. (G) A dose-response curve with G6PDi-1reveals that 25µM G6PDi-1 causes roughly a 50% inhibition in G6PD activity. Dots = biological replicates. Bars = mean ± SEM. ****p<0.0001 by unpaired t-test. n=6 biological replicates.(H) Molecular characterization of the "NF2- / +" heterozygous Schwann cell line (DNA and resultingprotein truncations). Allele 1 leads to a frameshift mutation and premature stop codon whereas allele2 leads to loss of 1 amino acid. (I) NF2- / + cells have reduced NF2 protein levels but not reduced YAPphosphorylation, detected via immunoblotting with the indicated antibodies. (J) NF2- / + cellsproliferate like NF2-wildtype cells, indicating that the remaining levels of NF2 in these cells are sufficient to provide full NF2 activity. Figure 9: NF2-KO cells die in response to G6PD inhibition via a caspase-independent cell death mechanism. (A) NF2-KO cells treated with 25µM G6PDi-1, which induces cells death, does not lead toany visible caspase cleavage, detected by immunoblotting. (B) Pan-caspase inhibitor Emricasan doesnot rescue reduced cell viability caused by G6PDi-1 in NF2-KO cells. ****p<0.0001 by two-way ANOVA and Sidak’s multiple comparisons test n=4 biological replicates. (C) 25µM Emricasan efficiently blocks cleavage of caspase 3 induced by treatment with staurosporin. Figure 10: Knockdown of NF2 reduces ME1 and AKR1C3 protein levels also in primary Schwann cells.(A) Immunoblot analysis of indicated protein levels in primary Schwann cells 96hrs after siRNA-mediated knockdown of NF2 or RLuc (negative control). Numbers indicate protein levels normalized to calnexin. (B) Compared to ipn ipn02.32λ cells, HEI-193 cells have expression of a hypomorphic "isoform 3" of NF2, reduced YAP phosphorylation, reduced ME1 levels and reduced AKR1C3 levels. (C) G6PD levels are reduced in different types of vestibular schwannomas (VS: sporadic, cystic and NF2)compared to control vestibular nerve. Data are re-analyzed from 33. Dots = individual patients. Bars =mean ± Std. Dev. *p<0.05, **p<0.01 by Brown-Forsythe and Welch ANOVA and Dunnetts’s multiple comparisons test. n>7 Figure 11: Support to figure 5. (A) Mechanistic model for why inhibition of G6PD leads to lethality in NF2-KO cells. Loss of NF2 leads to a more oxidized cellular state in part due to reduced expression of NADPH-producing enzymes. As a result, NF2-KO cells rely more strongly on G6PD for NADPH production compared to NF2-WT cells. IfG6PD is also inhibited pharmacologically in NF2-KO cells, then the cells die due to oxidative stress. (B)NF2-KO Schwann cells do not have elevated basal ROS levels compared to isogenic NF2-WT cells. ROS levels assayed via flow cytometry using the ROS sensor CM-H2DCFDA (5μM-30min). Oligomycin (5μM- 30min) was used as a positive control. Bars = mean ± SEM. **p<0.01 by one-way ANOVA and Dunnett’smultiple comparisons test. n=3 biological replicates (C) Pharmacological inhibition of G6PD in NF2-WTSchwann cells leads to lower levels of reduced NADPH normalized to NADP+. n=4 biological replicates.***p<0.001 by two-way ANOVA and Tukey’s multiple comparisons test. (D) Dose response curve withME1 inhibitor identifies that 10μΜ ME1 inhibitor decreases ME1 enzymatic activity to the levels observed in NF2 KO cells (Figure 4h). Results are normalized to enzymatic activity in wild type cells. Dots = biological replicates. ***p<0.001, ****p<0.0001 by two-way ANOVA and Tukey’s multiple comparisons test. n=3 biological replicates. Figure 12: Knockout of NF2 in HEI-193 cells causes them to die upon G6PD inhibition (A) Knockout of NF2 in HEI-193 cells leads to reduced YAP phosphorylation but no further reductionin ME1 levels, which are already low (see Fig.10B). (B) Pharmacological inhibition of G6PD with25µM G6PDi-1 kills NF2-KO HEI-193 cells, and the lethality is rescued by NAC, indicating it is due to oxidative stress. Dots = biological replicates. ns>0.05, ****p<0.0001 by two-way ANOVA and Tukey’smultiple comparisons test. n=3 biological replicates. (C) G6PD inhibition leads to oxidized glutathionein NF2-KO HEI-193 cells, and this is rescued by treatment with NAC. Dots = biological replicates. ns>0.05, ****p<0.0001 by two-way ANOVA and Tukey’s multiple comparisons test. n=3 biological replicates. Figure 13: Synthetic lethality between NF2 and G6PD is not observed in other cell lines tested. NF2 was knocked-out in (A) HeLa cells, (B) immortalized human umbilical vein endothelial cells (HUVEC), (C) U2OS cells, (D) HCT116 cells and (E) immortalized human fibroblasts. Top panels show immuno-blots for the indicated proteins in each of the respective cell lines compared to the NF2- wildtype parental controls. Bottom panels show relative cell number quantified by CellTiter-Glo for cells treated + 25µM G6PDi-1 for 4 days, normalized cell treated without inhibitor for 4 days. Bars = mean ± SEM. Statistical analysis shown is a one-way ANOVA and Dunnett’s multiple comparisons test. n≥3 biological replicates. The Examples illustrate the invention: Example 1 - Generation of an isogenic pair of NF2-WT and NF2-KO human Schwann Cells It was aimed to identify genes that cause cell lethality when inhibited in NF2 mutant Schwann cells but do not cause lethality when inhibited in wildtype cells. To this end, a pair of isogenic Schwann cell lines that differ only by their NF2 status was first generated. Starting with the human Schwann cell line ipn02.32λ, which is a wildtype line (“WT”) derived from normal human nerve, and therefore expressesNF216 (Fig. 1A), NF2 was knocked-out by CRISPR / Cas9 using two independent sgRNAs that target itsfirst two coding exons respectively. This yielded two independent lines containing NF2 frameshiftmutations, which should lead to premature stop codons, and very short, truncated NF2 peptides (Fig. 7A). These knockout cells have no detectable NF2 protein, and display the expected decrease in YAP phosphorylation and increase in Akt phosphorylation (Fig.1A, Fig.7B). As expected from the fact thatHippo / YAP signaling mediates contact inhibition 17, the NF2-KO lines have a similar proliferation rateas NF2-WT cells at low cell densities (Fig.1B), but then start diverging at higher confluence and fail to arrest proliferation at a cell density that causes contact inhibition in NF2-WT cells (Fig.1C). Instead, at high densities, NF2-KO cells pack very tightly, lose their elongated morphology, and start growing on top of each other (Fig. 1D). Compared to NF2-WT cells, NF2-KO cells acquire characteristics of transformed cells such as the ability to form anchorage-independent colonies in a soft-agar assay (Fig. 7C). A comparison of gene expression in NF2-KO vs NF2-WT cells by RNA-seq followed by GeneOntology enrichment analysis using ShinyGo 18 identified changes in gene sets related to oncogenicsignaling (TGF-beta, Hippo, PI3K-Akt) and cell adhesion (Fig.7D). Example 2 - Genome-wide sgRNA screen identifies G6PD and ACSL3 as synthetic-lethal partners for NF2 Cas9 was next introduced into the NF2-WT and NF2-KO#1 cells (Fig. 7E) and a genome-wide CRISPR / Cas9 screen was performed to identify synthetic-lethal partners for NF2 in Schwann cells (Fig.1E). The screen was performed using the Toronto CRISPR Human Knockout Library (TKO v3) 19 with89916 sgRNAs targeting 17232 human genes. The abundance of each sgRNA was measured after 7 cell passages and compared it to the initial sgRNA representation in the library at passage 0, for both NF2- WT and NF2-KO cells (Fig. 1F). This identified many genes required for cell viability in both cell lines (“essential genes”, Fig. 1F). At the other end of the spectrum, the sgRNAs that caused the largestincrease in proliferation were all 6 of the sgRNAs targeting NF2 (green dots, Fig.1F). This indicates thatSchwann cell proliferation is exquisitely sensitive to NF2, possibly explaining why loss of NF2 in peopleleads predominantly to schwannomas 20. As expected, the sgRNAs targeting NF2 had little-to-no effecton proliferation of NF2-KO cells, since these cells already lack NF2 and overproliferate. Of note, during the sgRNA screen, cells were split soon after reaching confluence, hence sgRNAs that either increase the proliferation rate during exponential growth, or blunt contact inhibition, were enriched by the end of the screen. Interestingly, almost all sgRNAs that caused increased proliferation of WT cells had a blunted effect in NF2-KO cells (Fig.1F), indicating that NF2 signaling is the predominant proliferation- suppressive pathway in Schwann cells. It was asked if there are any target genes whose knockout reduces the number of NF2-KO cells but not NF2-WT cells. Figure 1G shows the top genes sorted by their differential effect on NF2-KO versus NF2-WT cells. any gene that causes increased proliferation of NF2-WT cells was excluded from further consideration, since these are potentially tumor suppressors and could lead to tumors if targeted pharmacologically in patients. Likewise, any gene that causes reduced cell numbers in NF2-WT cellswas excluded since targeting them pharmacologically could be toxic. From this, G6PD was identifiedas a top hit, as it causes no proliferative defects in NF2-WT cells but reduces the number of NF2-KOcells, and ACSL3 as a second hit that has a mild negative effect on NF2-WT cells. G6PD in particularcaught our attention because 400 million people worldwide are deficient for G6PD, and people with reductions in G6PD activity down to ~10% of normal have little or no phenotypes as long as oxidativetriggers are avoided by lifestyle management 15. This suggests G6PD could potentially be targetedpharmacologically with an acceptable side-effect profile. Likewise, ACSL3 knockout mice are born atthe expected Mendelian ratio with no obvious defects during development or adulthood 21, 22.Example 3 - Inhibition of G6PD causes death of NF2-KO Schwann cells and impairs growth of NF2-KO xenograft tumors It was next confirmed that G6PD loss-of-function causes synthetic lethality in combination with NF2 loss-of-function using 4 different targeting modalities – sgRNAs, shRNAs, siRNAs and a small molecule inhibitor. Growth and viability curves were performed with either NF2-WT or NF2-KO cells transduced with sgRNAs targeting either G6PD or a negative control locus (AAVS1) (Fig.2A-C): NF2-WT and NF2- KO cells both showed a similar increase in cell number over the course of 4 days when transduced withnegative-control sgRNA (Fig.2A). Although G6PD loss-of-function (Fig.2C) showed no significant effecton NF2-WT cell numbers, it reduced the number of NF2-KO cells by roughly 50% at day 4 (Fig.2A). The reduction in cell number was due at least in part to a significant, 6-fold increase in cell death uponG6PD loss-of-function in NF2-KO cells, assessed by CellTox (Fig. 2B). Next, G6PD was knocked-downusing an siRNA that targets a different sequence than the sgRNA. siRNA-mediated knockdown of G6PD also reduced the number of NF2-KO but not NF2-WT Schwann cells (Fig. 8A-C). A small-moleculeinhibitor for G6PD (G6PDi-1) was recently reported 23. Four days of treatment with this inhibitorreduced the number of NF2-KO cells but not NF2-WT cells (Fig.2D) with a corresponding increase in cell death in NF2-KO cells (Fig. 8D). This experimental setup cannot yield large differences in cell numbers because after 4 days the wildtype cells become confluent in the dish and stop proliferating. If instead the cells are split every 2 days and maintained either in the presence or absence of G6PDi-1 for 3 passages, this reveals a very large drop in the viability of NF2-KO cells treated with G6PDi-1 (Fig. 2E-F). The synthetic lethality was also observed if the cells were grown in medium containing 5% FBS instead of 10% FBS, and hence in conditions of lower growth factor stimulation (Fig.8E).A schwannoma xenograft model involving subcutaneous injection of NF2-KO Schwann cells into NOD SCID gamma (NSG) mice was next established. In agreement with the soft-agar assays herein (Fig.7C), NF2-WT Schwann cells do not form subcutaneous tumors, despite using Matrigel, precluding us fromtesting G6PD knockdown in NF2-WT cells in vivo, whereas NF2-KO cells form tumors that grow flat andnodular (Fig.2G). For xenograft experiments NF2-KO lines were generated stably carrying doxycycline(dox)-inducible shRNA constructs targeting either RLuc as a negative non-targeting control or twodifferent regions of G6PD (Fig. 2H). Again, knockdown of G6PD reduces the proliferation of NF2-KOcells in cell culture (Fig. 2I). Control NF2-KO Schwann cells reliably generated palpable tumors thatgrew, both in the presence and in the absence of doxycycline (dox) (Fig.8F, Fig.2J). In contrast, NF2-KO Schwann cells with a G6PD knockdown (+dox) yielded much fewer palpable tumors (Fig. 8F), andthe ones that formed subsequently completely regressed so that no detectable G6PD knockdowntumors were present at the end of the follow-up (Fig.2K). Although tumors containing G6PD shRNA in the absence of dox reliably formed palpable tumors that grew (Fig.8F), they grew less well than control tumors, probably due to leakiness of the inducible shRNA. Nonetheless, the difference in tumor growth between +dox and -dox was highly significant (p=0.00003). Example 4 - A 50% inhibition of G6PD is sufficient for synthetic lethality An important issue for the possible future clinical application of these findings is to understand the degree of G6PD inhibition needed to cause the death of NF2-KO Schwann cells. 400 million peopleworldwide are deficient for G6PD to varying degrees 15. From this, it was known that inhibition of G6PDbelow 5-10% of residual activity (Class I) leads to jaundice and chronic haemolytic anemia, whereaspeople with higher activity levels have few or no clinical symptoms 15. To study this in more detail,pharmacological inhibition of G6PD was used, since G6PD activity can be titrated more precisely pharmacologically than with shRNA-mediated knockdown. The previous results indicated that 25µM G6PDi-1 is sufficient to cause death of NF2-KO cells (Fig. 2D). A titration of G6PDi-1 was therefore performed and G6PD activity was measured, and it was found that 25µM G6PDi-1 leads to roughly 50% inhibition of G6PD (Fig.8G). Hence this is within the range of G6PD inhibition that would be clinically tolerable. Example 5 - G6PD inhibition does not kill NF2+ / - heterozygous cells Often NFII patients are heterozygous for NF2 loss-of-function in many of the cells in their bodies, with loss or mutation of the remaining NF2 allele leading to tumor formation in some cells. Hence another important consideration is whether G6PD inhibition kills NF2 heterozygous cells, because this would lead to severe toxicity. To test this, CRISPR / Cas9 was used to generate a Schwann cell line that has a frame-shift mutation and a premature stop codon on one NF2 allele (Fig. 8H). The second allele hasthe loss of a triplet, leaving the rest of the coding sequence in-frame, from which protein is produced (Fig. 8I) that is predicted to lack one amino acid. This line ("NF2- / +") therefore has a level of NF2 function that is equal to, or less than, that of heterozygous cells. NF2- / + cells proliferate like NF2-WT cells (Fig.8J), in agreement with previous studies showing that even a small amount of NF2 protein issufficient to provide full NF2 activity 24, 25. Interestingly, pharmacological inhibition of G6PD did notlead to lethality of the NF2- / + cells (Fig.2L). Example 6 - Inhibition of ACSL3 causes death of NF2-KO Schwann cells and impairs growth of NF2- KO xenograft tumorsNext, it was confirmed that ACSL3 knockdown is also synthetic-lethal with NF2 loss-of-function inSchwann cells using different targeting modalities. Knockout or knockdown of ACSL3 using sgRNAs orsiRNAs, respectively, impairs viability of NF2-KO cells but not NF2-WT cells (Fig.3A-C, Fig.8A,C). Partialknockdown of ACSL3 via doxycycline-inducible shRNA constructs impairs proliferation of NF2-KO cellsin cell culture (Fig.3D-E) and also significantly impairs growth of NF2-KO schwannoma xenografts (Fig. 3F). Example 7 - G6PD and ACSL3 are synthetic lethal with NF2 due to oxidative stress Interestingly, both G6PD and ACSL3 are involved in lipid biogenesis and in fighting oxidative stress. G6PD is the first and rate-limiting enzyme in the pentose phosphate pathway and is the predominantsource of NADPH used by cells as a reducing agent to synthesize lipids and to fight oxidative stress 26.ACSL3 is a member of the acyl-CoA synthetase family which conjugates mono-unsaturated fatty acids to coenzyme-A (CoA) for lipid biogenesis, thereby reducing the susceptibility of plasma membranelipids to oxidation 27. It was therefore asked whether ACSL3 and G6PD are synthetic lethal with NF2due to oxidative stress and / or lipid biogenesis. Since NF2-KO cells proliferate more than NF2-WT cells, it was hypothesized that they might either have a higher requirement for lipid biogenesis, or a higher requirement for reducing equivalents, which are needed for lipid biogenesis. Hence, it was tested if the synthetic lethality of ACSL3 loss-of-function could be rescued by supplementing cells either with additional exogenous lipids, or with the antioxidant N-acetylcysteine (NAC). Interestingly, the lipid mix, but not NAC, rescued the synthetic lethality of ACSL3 (Fig. 4A-B), suggesting the synthetic lethality is related to the lipid conjugation function of ACSL3. ACSL3 conjugates mono-unsaturated fatty acids (MUFAs) onto CoA for lipid biosynthesis, reducing the abundance of polyunsaturated fatty acids (PUFAs) in cell membranes, whichare prone to peroxidation and hence to induction of ferroptosis 27. Indeed, treatment of cells with theferroptosis inhibitor Liproxstatin rescued the lethality caused by ACSL3 knockout in NF2-KO cells (Fig.4C), indicating the cells are dying by ferroptosis. An analysis of lipid peroxidation levels with Bodipy C11 revealed that NF2-KO cells have mildly but significantly elevated levels of lipid peroxidation compared to NF2-WT cells (Fig. 4D). In sum, this suggests NF2-KO cells are poised to undergo ferroptosis compared to WT cells due to elevated lipid oxidation. This is conceptually consistent witha previous report that NF2 mutant mesothelioma cells are sensitive to ferroptosis 28.Unlike for ACSL3, the synthetic lethality between G6PD and NF2 cannot be rescued by liproxstatin (Fig. 4E) or by supplementing cells with a lipid mix (Fig.4F). Nonetheless, the synthetic lethality with G6PD is rescued by addition of the antioxidant NAC (Fig.4G-H), suggesting again that the underlying cause of the NF2 / G6PD synthetic lethality is oxidative stress. The form of cell death induced by combined loss of NF2 and G6PD is not clear. Since it is not rescued by Liproxstatin (Fig.4E) it is not ferroptosis. Although some caspase cleavage was seen when NF2 and G6PD were knock out with sgRNAs (Fig.2C), this is likely due to the viral infection since it is also present in the control cells treated with control sgRNA (lane 1). Indeed, pharmacological inhibition of G6PD in NF2-KO cells does not cause caspase cleavage (Fig.9A). The lethality is also not rescued by Emricasan, a pan-caspase inhibitor (Fig.9B) suggesting they are not dying via caspase-dependent apoptosis, but some other cell death mechanism. As a control, it was verified that the same concentration of Emricasan efficiently blocks caspase cleavage induced by staurosporin (Fig.9C). Example 8 - NF2-KO Schwann cells have a more oxidized redox state It was noticed in the RNA-seq data that NF2-KO cells have lower expression of several enzymes that fight oxidation. For instance, expression of all three members of the aldosterone reductase family 1(AKR1C1, 2 and 3) which reduce lipid peroxides to lipid alcohols 29 thereby protecting cells fromferroptosis 30, are lower in two independent NF2-KO lines compared to control cells (Fig. 5A). This isalso visible at the protein level for the one tested AKR1 member, AKR1C3 (Fig. 5B). In addition, the level of GPX4, a glutathione-dependent lipid peroxidase that plays a key role in protecting cells fromferroptosis 30, is also mildly reduced (Fig.5B). The attenuated levels of AKR1C1, AKR1C2, AKR1C3 andGPX4 could explain why NF2-KO cells are sensitized to ferroptosis when ACLS3 is inhibited 30.Amongst the most down-regulated genes in NF2-KO Schwann cells is Malic Enzyme 1 (ME1) (Fig.5C). ME1 and G6PD are two of the four enzymes that generate cytosolic NADPH, which is used by cells to fight oxidative stress, with G6PD being the predominant NADPH source and ME1 the second mainsource 31. By immunoblotting, it was found that NF2-KO cells not only have strongly reduced levels ofME1 (Fig.5D), but also mildly reduced levels of G6PD. Consistent with this, NF2-KO cells have reducedME1 and G6PD activity (Fig.5E-F) and a lower ratio of reduced NADPH to oxidized NADP+ (Fig.5G). In sum, NF2-KO Schwann cells have lower levels of reducing equivalents (NADPH) and lower levels of enzymes that help counteract oxidative stress.It was next asked if these effects are a general feature of loss of NF2 in Schwann cells. First, NF2 wasknocked-down using two independent siRNAs in primary human Schwann cells and found that this leads to a drop in ME1, AKR1C3 and GPX4 also in these cells (Fig. 10A). Of note, these primary cells have an independent genetic background from the immortalized ipn02.32λ Schwann cell line that were used above. Next, the HEI-193 human schwannoma line was analyzed, which has a point mutation that causes a splicing defect in the NF2 transcript, and thereby a partial NF2 loss-of-function32. As expected, these cells express NF2 'isoform 3' which runs lower than full-length NF2, and they have reduced YAP phosphorylation (Fig. 10B). In addition, they have low levels of ME1 and AKR1C3 (Fig. 10B). Interestingly, HEI-193 cells have elevated levels of ME3, which also synthesizes NADPH, perhaps as a compensatory effect. Next, it was tested whether reduced levels of AKR1, 2, 3 and ME1 can also be observed in primaryschwannomas from patients. To this end, data from Gugel et al.33 were reanalyzed who profiled non-irradiated vestibular schwannomas (VS) from 49 patients – 36 sporadic VS, 13 NF2 mutant VS, and 9 cystic VS - and compared them to 7 control vestibular nerve samples. This revealed that vestibular schwannomas have significantly reduced expression of all four genes (Fig. 5H-I) as well as reduced expression of G6PD (Fig. 10C). Of note, these measurements were done by microarray rather than RNA-seq, and the tumor samples contain addition cell types besides Schwann cells, both of which reduce the magnitude of the gene expression changes that can be observed. The fact that all four genes drop in expression in NF2 mutant vestibular schwannomas in patients, as they do upon loss of NF2 in the sural-nerve derived ipn02.32λ Schwann cell line that was used herein for most of the experiments here, suggests that this biology is conserved in Schwann cells from different locations of the body. In sum, loss of NF2 in Schwann cells is associated with reduced expression of several anti- oxidative genes in multiple different genetic backgrounds across different cell lines and patients. Example 9 - Low ME1 levels can cause synthetic lethality with G6PD The data presented above raise the mechanistic hypothesis that inhibition of G6PD is lethal in NF2-KO cells because NF2-KO cells have a more oxidized redox state. This oxidized redox state is due in part to reduced expression of NADPH-producing enzymes such as ME1 (Fig.11A), but it cannot be excluded that loss of NF2 also leads to increased oxidative stress. According to this hypothesis, NF2-KO cells canbuffer these redox changes by relying on NADPH produced by G6PD, but if G6PD is also inhibited this leads to cell death. To test this hypothesis, the redox status of cells was first assessed via the ratio of oxidized to reduced glutathione. Although NF2-KO cells have a lower ratio of reduced NADPH to oxidized NADP+ (Fig.5G), this imbalance does not translate into a change in the basal oxidation state of glutathione in NF2-KO cells compared to NF2-WT cells (Fig. 6A, bars 4 & 7 versus 1) nor in elevated ROS levels (Fig. 11B), suggesting that the remaining NADPH is sufficient for NF2-KO cells to maintain a proper redox balance further downstream. Likewise, inhibition of G6PD in wildtype cells reduces the NADPH / NADP+ ratio (Fig.11C) but does not cause significant oxidation of glutathione (bar 2 vs 1, Fig.6A). In contrast, G6PD inhibition in NF2-KO cells causes the glutathione pool to become significantly more oxidized (bars 5&8 versus 4&7 respectively, Fig.6A). This is rescued by addition of NAC (Fig.6A), in agreement with the rescue of lethality by NAC (Fig.4G). Thus NF2-KO cells rely more strongly on G6PD for production of reducing equivalents compared to wildtype cells. It was next asked whether inhibition of ME1 in NF2-WT cells recapitulates the phenotype, causing them to become sensitive to G6PD inhibition. To this end, a titration was first performed of an ME1 inhibitor (Fig.11D) and it was found that 10µM ME1-i causes a similar drop in ME1 activity as was observed in NF2-KO cells (Fig.5E). Consistent with the mechanistic hypothesis as proposed herein, pharmacological inhibition of only G6PD did not reduce viability of NF2-WT cells, nor did inhibition of ME1 only (Fig. 6B). Combined inhibition of G6PD and ME1, however, caused a significant, synergistic drop in viability of NF2-WT cells (Fig. 6B), indicating that the two enzymes function redundantly in Schwann cells to support viability, and that their combined inhibition is sufficient to explain why G6PD inhibition causes NF2-KO Schwann cells to die. Also the reverse was tested - whether re-expression of ME1 in NF2-KO cells rescues their viability upon G6PD inhibition. To this end a monoclonal NF2-KO line was generated that re-expresses ME1 (Fig.6C). Re-expression of ME1 was sufficient to rescue the death of NF2-KO cells upon G6PD inhibition (Fig. 6D). Finally, it was tested whether this concept also holds true in other Schwann cells. Unfortunately, very few immortalized NF2-wildtype human Schwann cell lines exist. Primary cells are not suitable because they do not remain proliferative for a sufficient number of doublings to perform a genetic manipulation followed by proliferation curves. It was therefore turned to HEI-193 cells which express NF2, albeit a mutant version (Fig.10B). NF2-KO HEI-193 cells were generated, and it was found that they have lessphospho-YAP compared to the parental HEI-193 line (Fig.12A), indicating that the NF2 in HEI-193 cells is still partially active. Just as observed in the ipn02.32λ line, knockout of NF2 in HEI-193 cells sensitized them to G6PD inhibition, and this is rescued by NAC, indicating that they die due to oxidative stress (Fig.12B). Just as in the ipn02.32λ line, knockout of NF2 alone, or inhibition of G6PD alone, did not cause an increase in glutathione oxidation, but combined inhibition of G6PD and NF2 did (Fig.12C). In conclusion, also HEI-193 cells become sensitized to G6PD inhibition when NF2 is knocked out. It was noted, however, that the parental HEI-193 line already has low ME1 levels (Fig.10B) which do not drop further upon complete NF2 knockout (Fig.12A). Thus, ME1 expression is not the sole reason why loss of NF2 causes cells to become more oxidized, in agreement with the many changes in redox genes caused by NF2 loss (Fig.5). Example 10 - Synthetic lethality between NF2 and G6PD is specific to Schwann cells The synthetic lethality between NF2 and G6PD could be specific to Schwann cells, or it could be a general phenomenon observed in different cell types. To distinguish these two options, an NF2-KO was introduced using CRISPR / Cas9 into a variety of different cancer and non-cancer cell lines. In some cells such as HeLa cells (cervical cancer line) or human umbilical vein endothelial cells (HUVECs), loss of NF2 does not lead to reduction of YAP phosphorylation, indicating that the NF2 pathway is not active in these cells (Fig.13A-B). In some cells, such as the osteosarcoma U2OS line, loss of NF2 leads to a strong reduction in YAP phosphorylation (Fig. 13C), however these cells express little ME1 so no change in ME1 expression can be observed. Finally, in some cells such as the colorectal carcinoma HCT116 line or immortalized human fibroblasts, NF2-KO causes a drop in YAP phosphorylation, indicating that the NF2 pathway is functional, but does not cause a drop in ME1 (Fig.13D-E). In all cases, loss of NF2 does not sensitize these cells to pharmacological G6PD inhibition (Fig.13A-E). Thus, the synthetic lethality between NF2 and G6PD seems to be fairly specific for Schwann cells. Example 11 – Methods Chemical compounds G6PDi-1 inhibitor was custom synthesized by Otava Chemicals or purchased from Merck / Sigma (#SML2980). Ferroptosis inhibitor Liproxstatin (#SML1414), chemically defined Lipid Mixture (#L0288), InSolution Staurosporin (#569396), Erastin (#7781) and N-Acetyl L-Cysteine / NAC (#A7250) were purchased from Merck / Sigma. Malic Enzyme 1 inhibitor (#HY-124861) was from Hölzel and Oligomycin (#SAFSO4876) from VWR international. Emricasan (PF 03491390) was purchased from MedChemExpress.Cell lines & culturing The immortalized human Schwann cell line ipn02.32λ was a generous gift of Dr. Margaret Wallace (University of Florida). Immortalized human umbilical vein endothelial cells (HUVEC, #INS-CI-1002) and immortalized human fibroblasts (huFIB, #INS-CI-1010) were purchased from InScreenex. HUVEC were cultured on 0,5% gelatin matrix (#INS-SU-10, InScreenex) and expanded in the corresponding complete medium (#INS-ME-1011, InScreenex). HuFIB were grown on collagen coating (#INS-SU-1017) and their respective medium (#INS-ME-1001), both from Inscreenex. Primary human Schwann cells from Creative Bioarrays (#CSC-7715W) were grown on 2μg / cm2poly-L-lysine (#0403, Sciencell) and cultured with commercial medium (#1701, Sciencell). Parental HEI-193 line was kindly provided by Prof. Valerio Magnaghi (University of Milan). Immortalized Schwann cells (ipn02.32λ), HEI-193, Hela, HCT116 and U20S cell lines were cultured in high-glucose Dulbecco’s Modified Eagle Medium (#41965-062, Gibco), supplemented with 10% fetal bovine serum (FBS, Sigma) and 100U / ml penicillin / streptomycin (#15140-122, Life Technologies). Absence of mycoplasma was confirmed by regular testing of cell cultures (Eurofins Genomics). No cell identification was performed. Generation of NF2-KO and NF2- / + ipn02.32λ cell lines sgRNA oligos targeting the NF2 gene locus were designed using the ChopChop sgRNA design tool (https: / / chopchop.cbu.uib.no / ). Sequences of oligos used to generate the NF2-KO lines are given in Table 2. Table 2: Sequences of oligos used in this study. Purpose Oligo Name Oligo SequenceGeneration of NF2 KO #1 cells sgNF2#1 Forward 5ʹ- CACCGGTACACAATCAAGGACACAG -3ʹsgNF2#1 Reverse 5ʹ- AAACCTGTGTCCTTGATTGTGTACC -3ʹ Generation of NF2 KO #2 cells sgNF2#2 Forward 5ʹ- CACCGCGAGATGGAGTTCAATTGCG -3ʹsgNF2#2 Reverse 5ʹ-AAACCGCAATTGAACTCCATCTCGC-3ʹ NF2 exon1 PCR genotype NF2 exon 1Forward 5ʹ- AAAGGGCTCAGAGTGCAGG-3ʹNF2 exon1 Reverse 5ʹ- TTTCGGTTCTGCCCGTCTCT -3ʹNF2 exon2 PCR genotype NF2 exon 2Forward 5ʹ- AGAGTGGAGAGTGCAGAGAAAAGG -3ʹNF2 exon2 Reverse 5ʹ- TGATGAGCTAGGCGCCTGCT-3ʹGeneration of AAVS1 (control)sgAAVS1 Forward 5ʹ- ACCGGGAGGCCTGGAGCATTGGGG-3ʹsgRNA in PLCKOsgAAVS1 Reverse 5ʹ- AAACCCCCAATGCTCCAGGCCTCC-3ʹGeneration of G6PD sgRNA in sgG6PD Forward 5ʹ- ACCGACTGATGGAAGGCATCGCCC -3ʹ PLCKO sgG6PD Reverse 5ʹ- AAACGGGCGATGCCTTCCATCAGT -3ʹ Generation of ACSL3 sgRNA in sgACSL3 Forward 5ʹ- ACCGATGTACACAAGTGGATCCAC -3ʹ PLCKO sgACSL3 Reverse 5ʹ- AAACGTGGATCCACTTGTGTACAT -3ʹ 5ʹ- CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACA Clone inducible shRNA shRLuc Forward TTTCGAAGTACTCAGCGTTTTT -3ʹ targeting RLuc (neg control) 5ʹ- AATTAAAAACGCTGAGTACTTCGAAATGTCCTCGA shRLuc Reverse GGACATTTCGAAGTACTCAGCG -3ʹ 5ʹ- shG6PD#1 CCGGTCAGTCGGATACACACATATTCTCGAGAATA Forward TGTGTGTATCCGACTGATTTTT -3ʹ 5ʹ- shG6PD#1 AATTAAAAATCAGTCGGATACACACATATTCTCGA Clone inducible shRNA Reverse GAATATGTGTGTATCCGACTGA -3ʹ targeting G6PD 5ʹ- shG6PD#2 CCGGCCTCATGGTGCTGAGATTTCTCGAGAAATCT Forward CAGCACCATGAGGTTTTT -3ʹ 5ʹ- shG6PD#2 AATTAAAAACCTCATGGTGCTGAGATTTCTCGAGA Reverse AATCTCAGCACCATGAGG -3ʹ 5ʹ- shACSL3#1 CCGGGCGGACATTGAGCGAATGTATCTCGAGATA Forward CATTCGCTCAATGTCCGCTTTTT-3ʹ 5ʹ- shACSL3#1 AATTAAAAAGCGGACATTGAGCGAATGTATCTCG Clone inducible shRNA Reverse AGATACATTCGCTCAATGTCCGC-3ʹ targeting ACSL3 5ʹ- shACSL3#2 CCGGGCGGACATTGAGCGAATGTATCTCGAGATA Forward CATTCGCTCAATGTCCGCTTTTT -3ʹ 5ʹ- shACSL3#2 AATTAAAAAGCGGACATTGAGCGAATGTATCTCG Reverse AGATACATTCGCTCAATGTCCGC-3ʹ Generation of ME1 re-ME1 Forward 5'-GCTAGCATGGAGCCCGAAGCCCCCCGT-3'expressing NF2KO lineME1 Reverse 5'-GCGGCCGCCTACTGGTCAACTTTGGTCTG-3'ME1 Forward 5ʹ- GTTGTGGCGTGTGGATTGAGG -3ʹME1 Reverse 5ʹ- AAGCCGACCCTCTTCCAAGTG -3ʹAKR1C3 Forward 5ʹ- AGATGGCCTAGACAGAAATCTCCA -3ʹ AKR1C3 Reverse 5ʹ- GCGTCACCATCCACACACAG -3ʹ Q-RT-PCR AKR1C2 Forward 5'-CCGAAGCAAGATTGCAGATGGC-3' AKR1C2 Reverse 5'-TTTCAGTGACCTTTCCAAGGCTG-3' AKR1C1 Forward 5'-GCAAGTCAAAAGACATTGTTCTGG-3' AKR1C1 Reverse 5'-TTGCCAAGGCACAAAGGACTGG-3'Rpl13a Forward 5ʹ- CCGCCCTACGACAAGAAA-3ʹ Rpl13a Reverse 5ʹ- CAGGGTGGCTGTCACTGC -3ʹ siG6PD#18 : J- 008181-18 target sequence: ACAGAUACAAGAACGUGAAsiG6PD#19 : J- siRNA for G6PD (set of 4:LQ-008181-19 target sequence:CCGUGUACACCAAGAUGAU008181-02-0002) siG6PD#20: J- 008181-20 target sequence:CAGAUAGGCUGGAACCGCAsiG6PD#21: J- 008181-21 target sequence:AUUCACGAGUCCUGCAUGAsiACSL3#5 : J- 010061-05 target sequence:UAACUGAACUAGCUCGAAAsiACSL3#6 : J- siRNA for ACSL3 (set of 4:LQ-010061-06 target sequence:GCAGUAAUCAUGUACACAA010061-00-0002) siACSL3#7 : J- 010061-07 target sequence:CAACGUAAUCUGUUUAUUCsiACSL3#8 : J- 010061-08 target sequence:GAUACGGGCUCACUGAAUCsiNF2#18 : D- 003917-18-0002 target sequence:CUUACGCCGUCCAGGCCAA siRNA for NF2 (individual) siNF2#19 : D- 003917-19-0002 target sequence:AGAAGCAGAUUUUAGAUGA siRNA for Rluc P-002070-01-50 target sequence:AAAAACATGCAGAAAATGCTGOligos were synthesized by Sigma-Aldrich and cloned into the px459 plasmid (#62988, Addgene),according to the published protocol 43. To generate NF2 knockouts, wild type cells were transfectedwith px459 plasmids containing sgNF2 sequences. Schwann cell line ipn02.32λ, HUVEC and HuFib lines were transfected using Metafectene Pro reagent (#T040, Biontex), while HCT116, Hela and U2OS were transfected with Lipofectamine 3000 (#L3000001,ThermoFisher Scientific) following the manufacturer’s instructions. For the generation of the NF2- / + line, transfection of NF2-WT cells was done using PEI reagent (#408727, Sigma) at a ratio 1:3.48hrs post transfection, cells were treated with 1.5μg / ml Puromycin (#P9620, Sigma) for 72hrs. After puromycin treatment and expansion of the surviving population, single clone selection was performed via cell dilution. For the generation of HEI-193 KO lines, subconfluent cells were infected in the presence of 6μg / ml Polybrene with lentiviral particles harboring Lenti-Cas9-2A-Blast (#73310, Addgene). 48hrs post infection, cells were treated with 5μg / ml Blasticidin for 72hrs. A second round of infection was performed in the surviving pooled population, with lentiviruses harboring sgRNA oligo targeting either the control AAVS1 locus or NF2 (exon2) into the lentiviral PLCKO vector (#73311 Addgene). After 3 days of Puromycin selection (1.5ug / ml), single cell clone expansion was performed.Genotyping of NF2KO and NF2- / + ipn02.32λ single clones Genomic DNA of the selected clones was isolated using DNeasy Blood and Tissue Kit (#69504, Qiagen). For the validation of editing events in single cell clones, primer pairs were designed 100-150bp up and downstream of the sgRNA targeting site. Sequences are provided in Table 2. The resulting PCR products were purified from an agarose gel using the NucleoSpin Gel and PCR Clean-up kit (#740609, Macherey- Nagel) and introduced into the TOPO™ TA Cloning™ vector (#450640, Invitrogen). After bacterial transformation of the ligation product, TOPO clones were selected (~ 10 per cell line) for Sanger sequencing, to detect the indels occurring in NF2. Generation of ME1 re-expressing NF2-KO Schwann cell line The ME1 ORF was amplified from a ME1orf Gateway clone (Clone ID #130654902, GPCF, DKFZ, Heidelberg, Germany) using Phusion enzyme (#M0530L, NEB) according to manufacturer’s description. The oligos for this PCR are provided in Table 2. The ME1 ORF was gel-purified, cloned into PCRII-TOPO (#450640, Thermofischer Scientific) and sequence-verified. The ME1 ORF was then excised from the PCRII-TOPO plasmid using Nhe1 and Not1 restriction enzymes, and ligated into the same sites of a PiggyBAC transposon vector, and verified by restriction mapping. NF2 KO Schwann cell lines were then transfected with this vector together with a PiggyBAC transposase plasmid in a 1:1 ratio using PEI. After puromycin selection, serial dilutions of the surviving population were performed in order to analyze single cell clones. Generation of lentiviruses and infections Lentiviral particles were produced by transfecting Lenti-X™ 293T with either 2ndgeneration lentiviral packaging system (pMD2.G #12259 and psPAX2 #12260, Addgene) or the 3rdgeneration Virapower system (#K497500, Invitrogen), together with the plasmid of interest, using TransIT-LT1 reagent according to the manufacturer’s protocol (#2304, Mirus). Supernatants were collected after 48–72hrs and sterile-filtered (0.45μm filters, #SLHV033RS, Merck / Millippore). Target cells were infected with viral supernatants, supplemented with 3.5μg / ml Polybrene Transfection reagent (#TR-1003-G, Merck / Millipore). After 48hrs, transduced cells were selected by addition of 3μg / ml Puromycin (#P9620, Sigma), for another 48hrs. Generation of Cas9 expressing lines Subconfluent NF2-WT and NF2-KO#1 cells were infected in the presence of 6μg / ml Polybrene with lentiviral particles harboring Lenti-Cas9-2A-Blast (#73310, Addgene). 48hrs post infection, cells were treated with 5μg / ml Blasticidin for 72hrs and single clones were obtained via cell dilution, in order to achieve homogeneous Cas9 expression levels in the selected lines for the Synthetic Lethality screen.Cas9-expressing lines were maintained in culture in the presence of 5μg / ml Blasticidin (A11139-03, Gibco). Prior to the synthetic lethality screen Blasticidin was removed from the cultures. Synthetic lethality screen The genome-wide pooled synthetic lethality screen was performed using the Toronto CRISPR HumanKnockout Library – TKO v319 which was obtained from Addgene. The screen protocol was based on 44with minor adaptations: Subconfluent NF2-WT / Cas9 and NF2-KO / Cas9 cell lines were infected in the presence of 6μg / ml polybrene (#TR-1003-G, Merck Millipore) with the 90k TKO sgRNAs library at a multiplicity of infection (MOI) of 0.3, to achieve 500-fold coverage (individual sgRNA-editing events represented in 500 cells). The next day, puromycin-containing medium (4μg / ml) was added to the infected cells for 48hrs. After selection, a portion of the puromycin-resistant population from each cell line was harvested for freezing and sequencing (T0 start point) and another portion was seeded for further culture expansion. Genomic DNA from cell pellets of both start-point (T0) and end-point (T=passage 7) were extracted using the QIAamp DNA Blood Maxi kit (#51192, Qiagen). To amplify the sgRNA sequences, a total of 140 PCR reactions were performed using 1μg of genomic or plasmid library DNA, Q5 Hot Start HF polymerase (#M0493L, NEB), and primers harboring the Illumina TruSeq adapter sequences. PCR products were purified using DNA Clean and Concentrator TM-100 (#C1016-50, Zymo Research) and MagSi-NGSprep Plus beads (#SL-MDKT-01500, Steinbrenner). Sample concentrations were measured using the Qubit HS DNA Assay (#Q32851, Thermo Fisher). Library amplicon size was verified using the DNA High Sensitivity Assay on a BioAnalyzer 2100 (Agilent) and then sequenced on a NextSeq (Illumina) with 75bp single-end sequencing and addition of 25% PhiX control v3 (Illumina). Lentiviral plasmid cloning For validation of the Synthetic Lethality screen results, sgRNAs targeting G6PD, ACSL3 and control AAVS1 (oligo sequences provided in Table 2) were cloned into the lentiviral PLCKO vector (#73311Addgene) according to the established protocol 45. For the inducible knockdown system, shRNAssequences targeting G6PD, ACSL3 and control RLuc (oligos provided in Table 2) were cloned into thelentiviral Tet-pLKO-puro vector (#21915, Addgene) according to the standard protocol 46.Schwann cell cancer xenograft experiment All animal experiments were done in accordance with the guidelines of the responsible national authority, and with approval of the local Governmental Authority for Animal Experimentation (Regierungspräsidium Karlsruhe, Germany, license 35-9185.81 / G-30 / 20). Mice were maintained in a 12hrs light-dark cycle with unrestricted Kliba diet 3307 and water. After adaptation, mice were randomized according to age. In half of the mice, for knockdown induction, doxycycline (#D9891,Sigma; 1mg / ml) was provided via drinking water supplemented with 5% saccharose three days prior to cell transplantation and was continued throughout the experiment. Controls received drinking water with 5% saccharose. Under isoflurane inhalation anesthesia (1-1.5% in air, 0.5 L / min), 10 x 106cells suspended in 200µl of a 1:1 (v / v) mix of DMEM (#41965-062, Gibco) / Matrigel (growth factor reduced, Corning #3821.00.00) were injected subcutaneously into the right flank of 8+ 1 week-old female NOD SCID gamma (NSG) mice that were recruited from the Center for Preclinical Research, DKFZ, Heidelberg. Tumor volume was measured with a caliper up to three times a week and calculated according to the formula: V = (length (mm) x width (mm)²) / 2. Weight of mice was documented once weekly. Necropsies were taken when one tumor diameter reached 1.3 cm or when any other pre- defined humane endpoint was reached. Animal wellbeing was monitored regularly and animals were euthanized if any humane endpoints were reached in accordance with the approved license. Cell proliferation assaysReal time cell growth of semi-confluent cells was monitored using the xCELLigence DP System (OLS,OMNI Life Science).10.000 cells / well were seeded on E plate L8 PET (0.64cm2) and impedance-based real-time proliferation was assessed over 96hrs (96 sweeps with 1hr interval). In the xCELLigence system, impedence correlates with cell number if other cell properties stay equal. Images of fully confluent cultures (96hrs) were taken using a 4x objective with a Leica Microscope (DMIL LED FLUO, Leica Microsystems). Proliferation curves of sub-confluent cells (2500cells / 0.34cm2) were measured with CellTiter-Glo (CTG) viability assay (#G9242, Promega) which quantifies total ATP in a well, which correlates with cell number. Crystal Violet staining To study the effect of G6PDi-1 on Schwann cell proliferation over several population doublings, 200.000 cells / well were seeded in a 6-well plate and passaged 1:4 every 48hrs, up to 3 passages. To compare the proliferation of NF2- / + cells vs NF2-WT and NF2-KO cells, 100.000 cells / well were seeded in a 12-well plate in biological triplicates. Cells were fixed for 20min at room temperature with ice cold MetOH. Afterwards 2xPBS washes were performed and fixed cells were stained with 0.5% crystal violet (#V5265, Sigma), diluted in 20% methanol / ddH20 for 20min. After staining, extensive washes were performed with ddH2O and plates were allowed to dry. For quantification analysis, 10% acetic acid was added on top of the fixed cells and the Crystal Violet solution was measured at OD590nm, using a spectrophotometer (Biospectrometer, Eppendorf).Validation of synthetic lethality Synthetic lethality associations of NF2 / G6PD and NF2 / ACSL3 were evaluated via CellTiter-Glo (CTG) viability assay (#G9242, Promega) and CellTox cell death assay (#G8742, Promega). After puromycin selection, infected cells were seeded in 96-well plates (2500 cells / well) and allowed to attach for 16hrs. Cell number evaluation was performed using the automated cell counter TC20 (Biorad). Samples were analysed for cell viability and cytotoxicity at the selected endpoint (Tend= 96hrs / 4days post seeding). Likewise, for experiments including treatment with inhibitors, 2500 cells were seeded in 96-well / plates (2500 cells / well).16hrs post seeding, cells were treated with the inhibitor and CTG and CellTox assays were performed 4 days post treatment. Measurement of luminescence was done with TriStar Multimode Reader (LB 942, Berthold) and CellTox generated fluorescence was measured with Spectrostar Omega plate reader (BMG Labtech: Ex 485-12 nm / Em 520 nm). Induction of shRNA expression was performed by treating cells with 1μg / ml doxycycline hyclate (#D9891, Sigma) and the endpoint was at 96hrs post doxycycline addition. Immunoblot analysis & antibodies Protein extraction was performed with 1%SDS in PBS, supplemented with 1x protease and phosphatase inhibitor (#04693159001 and #4906837001 respectively, both from Roche). Cell lysates were sonicated for 10sec to shear DNA (12% amplitude, Branson Digital Sonifier W-250D) and boiled for 3min at 95oC. Protein concentration was determined by BCA protein assay (Thermo Fisher Scientific) and colorimetric analysis was performed with a Spectrostar Omega plate reader (BMG Labtech, OD562nm). 10-20μg of total cell lysates were loaded on SDS-Page gels and transferred to Amersham nitrocellulose membranes (Merck). Description of all antibodies and dilutions used in this study are described in the Table 1.Table 1: Antibodies Chemiluminescence was recorded with the Chemidoc Imager (Bio-Rad) and quantified using Image Lab software (Bio-Rad). RNA extraction, quantitative RT-PCR and RNAseq For qRT-PCR, total RNA was extracted with TRIzol reagent (#15596026, Invitrogen) following manufacturer’s instructions. cDNA was synthesised with the MaximaH minus Reverse Transcriptase(#EP0753, ThermoScientific) using 2μg of total RNA as a template. Quantitative PCR was performed using Maxima SYBR Green / Rox (Fermentas), normalised to Rpl13a. The annealing temperature was set at 60oC. Oligo primer sequences are provided in Table 2. For RNAseq, total RNA was isolated using the RNeasy Mini Kit (#74106, Qiagen). Deep sequencing library preparation and data analysis wasperformed as previously described 47. All sequencing data have been deposited at NCBI Geo(GSE219141). Gene enrichment analysis was done with ShinyGO software 18.RNA interference (siRNA) Human Schwann cells were seeded at a density of 2x105cells per well on six-well plates. The next day, cells were transfected with Lipofectamine RNAiMAX (#13778-500, Invitrogen) with a final concentration of 20nM siRNA per well. For subsequent expression analysis, cells were lysed 96hrs post transfection. The following siRNAs were used (sequences provided in Table 2): siRLuc : P-002070-01-50 (individual, ThermoFischer) siNF2#1 : siGenome D-003917-18-0002 (individual) siNF2#2 : siGenome D-003917-19-0002 (individual) siG6PD : OnTarget plus LQ-008181-02-0002 (pool of 4) siACSL3: OnTarget plus LQ-010061-00-0002 (pool of 4) Enzymatic activity assays and metabolite levels G6PD activity was assayed using a commercially available kit, according to the manual’s instructions (#MET-5081, Cell Biolabs) and samples were analysed with a Spectrostar Omega plate reader (BMG Labtech, OD450nm). ME1 activity was performed on fresh cytosolic extracts as follows. The cells were collected and resuspended in 100mM Tris-HCl lysis buffer containing 0.02% Digitonin to release cytosolic content but not mitochondrial content. The suspension was incubated on ice for 10 min and then centrifuged at 10000g for 10 min at 4oC. The supernatant containing the cell cytosolic extract was collected. The extracts were added to a reaction solution containing 100mM Tris-HCl, 1mM MnCl2, 1mM NH4Cl, 100mM KCl and 1mM NADP+final concentrations. After adding 10mM L-malate, the reaction plate was mixed by shaking briefly and immediately read as fluorescent intensity (Ex 355- 20 / Em LP460) for 1 hour with data collected every minute. The wells without L-malate were used as a blank. The data, subtracted from the blank data and normalized to protein concentration, were plotted and the slopes quantified to determine the relative cytosolic ME1 activity. Oxidized vs reduced NADP levels were assessed using NADP / NADPH Quantitation kit (#MAK038, Sigma) and glutathione levels were evaluated with GSH / GSSG-Glo™ Assay (#V6611, Promega).FACS For the assessment of reactive oxygen species (ROS) levels, the general ROS indicator CM-H2DCFDA was used (#C6827, ThermoScientific) and for lipid ROS levels BODIPY™ 581 / 591 C11 (#D3861, ThermoScientific). Subconfluent cells were cultured overnight in standard conditions and 30min before FACS analysis, cells were incubated with 2.5μΜ of the appropriate cell permeant ROS indicator. Oligomycin treatment (5μΜ for 30min) was used as a positive control for ROS generation. FACS analysis was performed with Guava easyCyte HT (Millipore), using BlueV (Ex 450 / 45) and Yellow G (Em 575 / 25) lasers. Assessment of G6PDi-1-induced cell death was done with propidium iodide staining (#P4170, Sigma). FACS analysis was done using BlueV (Ex 450 / 45) and Red G (Em 695 / 50) lasers. Soft agar assay Soft agar assay was performed using the cell transformation assay kit (#ab235699, Abcam). 10.000 cells were seeded on soft agar matrix, following instructions of the kit and colonies were visualized after 7 days with a Leica Microscope (DMIL LED FLUO, Leica Microsystems) Statistical analysis Statistical analyses were done using GraphPad Prism 9 Software Figure preparation Figures were prepared using Affinity Software (https: / / affinity.serif.com / en-gb / ) REFERENCES1. Evans DG. Neurofibromatosis type 2 (NF2): a clinical and molecular review. Orphanet J RareDis 4, 16 (2009).2. Petrilli AM, Fernandez-Valle C. Role of Merlin / NF2 inactivation in tumor biology. Oncogene35, 537-548 (2016).3. Baser ME, Contributors to the International NFMD. The distribution of constitutional andsomatic mutations in the neurofibromatosis 2 gene. Hum Mutat 27, 297-306 (2006).4. Cumpston EC, Rhodes SD, Yates CW. Advances in Targeted Therapy for NeurofibromatosisType 2 (NF2)-Associated Vestibular Schwannomas. Curr Oncol Rep 25, 531-537 (2023).5. Feltri ML, Weaver MR, Belin S, Poitelon Y. The Hippo pathway: Horizons for innovativetreatments of peripheral nerve diseases. J Peripher Nerv Syst 26, 4-16 (2021).6. Plotkin SR, et al. Multicenter, prospective, phase II study of maintenance bevacizumab forchildren and adults with NF2-related schwannomatosis and progressive vestibular schwannoma. Neuro Oncol 25, 1498-1506 (2023).7. Zheng Y, Pan D. The Hippo Signaling Pathway in Development and Disease. Developmentalcell 50, 264-282 (2019).8. Johnson R, Halder G. The two faces of Hippo: targeting the Hippo pathway for regenerativemedicine and cancer treatment. Nature reviews Drug discovery 13, 63-79 (2014).9. Barry ER, Simov V, Valtingojer I, Venier O. Recent Therapeutic Approaches to Modulate theHippo Pathway in Oncology and Regenerative Medicine. Cells 10, (2021).10. Laraba L, et al. Inhibition of YAP / TAZ-driven TEAD activity prevents growth of NF2-null schwannoma and meningioma. Brain 146, 1697-1713 (2023).11. Jeanette H, et al. YAP and TAZ regulate Schwann cell proliferation and differentiation during peripheral nerve regeneration. Glia 69, 1061-1074 (2021).12. Deng Y, et al. A reciprocal regulatory loop between TAZ / YAP and G-protein Galphas regulates Schwann cell proliferation and myelination. Nature communications 8, 15161 (2017).13. Grove M, et al. YAP / TAZ initiate and maintain Schwann cell myelination. eLife 6, (2017).14. Mindos T, et al. Merlin controls the repair capacity of Schwann cells after injury by regulating Hippo / YAP activity. The Journal of cell biology 216, 495-510 (2017).15. Gomez-Manzo S, et al. Glucose-6-Phosphate Dehydrogenase: Update and Analysis of New Mutations around the World. International journal of molecular sciences 17, (2016).16. Li H, Chang LJ, Neubauer DR, Muir DF, Wallace MR. Immortalization of human normal and NF1 neurofibroma Schwann cells. Lab Invest 96, 1105-1115 (2016).17. Morrison H, et al. The NF2 tumor suppressor gene product, merlin, mediates contact inhibition of growth through interactions with CD44. Genes Dev 15, 968-980 (2001).18. Ge SX, Jung D, Yao R. ShinyGO: a graphical gene-set enrichment tool for animals and plants. Bioinformatics 36, 2628-2629 (2020).19. Hart T, et al. Evaluation and Design of Genome-Wide CRISPR / SpCas9 Knockout Screens. G37,2719-2727 (2017).20. Ferner RE, O'Doherty MJ. Neurofibroma and schwannoma. Curr Opin Neurol 15, 679-684(2002). 21. Rossi Sebastiano M, et al. ACSL3-PAI-1 signaling axis mediates tumor-stroma cross-talk promoting pancreatic cancer progression. Sci Adv 6, (2020).22. Padanad MS, et al. Fatty Acid Oxidation Mediated by Acyl-CoA Synthetase Long Chain 3 Is Required for Mutant KRAS Lung Tumorigenesis. Cell reports 16, 1614-1628 (2016).23. Ghergurovich JM, et al. A small molecule G6PD inhibitor reveals immune dependence on pentose phosphate pathway. Nature chemical biology 16, 731-739 (2020).24. Shalem O, et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343,84-87 (2014). 25. Yang C, et al. Missense mutations in the NF2 gene result in the quantitative loss of merlin protein and minimally affect protein intrinsic function. Proceedings of the National Academyof Sciences of the United States of America 108, 4980-4985 (2011).26. Stanton RC. Glucose-6-phosphate dehydrogenase, NADPH, and cell survival. IUBMB Life 64,362-369 (2012). 27. Magtanong L, et al. Exogenous Monounsaturated Fatty Acids Promote a Ferroptosis- Resistant Cell State. Cell Chem Biol 26, 420-432 e429 (2019).28. Wu J, et al. Intercellular interaction dictates cancer cell ferroptosis via NF2-YAP signalling. Nature 572, 402-406 (2019).29. Tang D, Chen X, Kang R, Kroemer G. Ferroptosis: molecular mechanisms and health implications. Cell research 31, 107-125 (2021).30. Zheng J, Conrad M. The Metabolic Underpinnings of Ferroptosis. Cell metabolism 32, 920-937(2020).31. Chen L, et al. NADPH production by the oxidative pentose-phosphate pathway supports folate metabolism. Nat Metab 1, 404-415 (2019).32. Lepont P, Stickney JT, Foster LA, Meng JJ, Hennigan RF, Ip W. Point mutation in the NF2 gene of HEI-193 human schwannoma cells results in the expression of a merlin isoform with attenuated growth suppressive activity. Mutation research 637, 142-151 (2008).33. Gugel I, et al. Contribution of mTOR and PTEN to Radioresistance in Sporadic and NF2- Associated Vestibular Schwannomas: A Microarray and Pathway Analysis. Cancers 12,(2020). 34. Stepanova DS, et al. An Essential Role for the Tumor-Suppressor Merlin in Regulating Fatty Acid Synthesis. Cancer research 77, 5026-5038 (2017).35. Klasson TD, et al. ACSL3 regulates lipid droplet biogenesis and ferroptosis sensitivity in clear cell renal cell carcinoma. Cancer & metabolism 10, 14 (2022).36. Quan J, et al. Acyl-CoA synthetase long-chain 3-mediated fatty acid oxidation is required for TGFbeta1-induced epithelial-mesenchymal transition and metastasis of colorectal carcinoma. Int J Biol Sci 18, 2484-2496 (2022).37. Dore MP, Davoli A, Longo N, Marras G, Pes GM. Glucose-6-phosphate dehydrogenase deficiency and risk of colorectal cancer in Northern Sardinia: A retrospective observational study. Medicine (Baltimore) 95, e5254 (2016).38. Pes GM, Errigo A, Soro S, Longo NP, Dore MP. Glucose-6-phosphate dehydrogenase deficiency reduces susceptibility to cancer of endodermal origin. Acta Oncol 58, 1205-1211(2019). 39. Ju HQ, et al. Disrupting G6PD-mediated Redox homeostasis enhances chemosensitivity in colorectal cancer. Oncogene 36, 6282-6292 (2017).40. Chen X, et al. Modulation of G6PD affects bladder cancer via ROS accumulation and the AKT pathway in vitro. Int J Oncol 53, 1703-1712 (2018).41. Debeb BG, et al. Histone deacetylase inhibitor-induced cancer stem cells exhibit high pentose phosphate pathway metabolism. Oncotarget 7, 28329-28339 (2016).42. Poulain L, et al. High mTORC1 activity drives glycolysis addiction and sensitivity to G6PD inhibition in acute myeloid leukemia cells. Leukemia 31, 2326-2335 (2017).43. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nature protocols 8, 2281-2308 (2013).44. Imkeller K, Ambrosi G, Boutros M, Huber W. gscreend: modelling asymmetric count ratios in CRISPR screens to decrease experiment size and improve phenotype detection. Genomebiology 21, 53 (2020).45. Hart T, et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell 163, 1515-1526 (2015).46. Wiederschain D, et al. Single-vector inducible lentiviral RNAi system for oncology target validation. Cell cycle 8, 498-504 (2009).47. Clemm von Hohenberg K, et al. Cyclin B / CDK1 and Cyclin A / CDK2 phosphorylate DENR to promote mitotic protein translation and faithful cell division. Nature communications 13, 668(2022).
Claims
CLAIMS 1. An inhibitor of an enzyme being involved in promoting cellular reductive capacity, preferably glucose-6-phosphate-dehydrogenase (G6PD) or acyl-CoA synthetase long chain family member 3 (ACSL3) for use in treating neurofibromatosis type 2 or preventing neurofibromatosis type 2 tumors.
2. The inhibitor for use of claim 1, wherein the inhibitor is an inhibitor of G6PD.
3. The inhibitor for use of claim 2, wherein in addition to the inhibitor of G6PD an inhibitor of ACSL3 is used in treating neurofibromatosis type 2 or in preventing neurofibromatosis type 2 tumors.
4. The inhibitor for use of claim 1, wherein the inhibitor is an inhibitor of ACSL3.
5. The inhibitor for use of claim 4, wherein in addition to the inhibitor of ACSL3 an inhibitor of G6PD is used in treating neurofibromatosis type 2 or preventing neurofibromatosis type 2 tumors.
6. The inhibitor for use of any one of claims 1 to 5, wherein (i) G6PD comprises or consists of the nucleic acid sequence of SEQ ID NO: 1 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto, and / or comprises or consists of the amino acid sequence of SEQ ID NO: 2 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto; and / or (ii) ACSL3 comprises or consists of the nucleic acid sequence of SEQ ID NO: 3 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto, and / or comprises or consists of the amino acid sequence of SEQ ID NO: 4 or a sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical thereto.
7. The inhibitor for use of any one of claims 1 to 6, wherein the inhibitor is an inhibitor of the nucleic acid molecule encoding the G6PD or ACSL3 protein, or is an inhibitor of the G6PD or ACSL3 protein.
8. The inhibitor for use of claim 7, wherein(i) the inhibitor of the nucleic acid molecule is selected from a small molecule, an aptamer, a siRNA, a shRNA, a miRNA, a ribozyme, an antisense nucleic acid molecule, a CRISPR-Cas (e.g. Cas9 or Cpf1)-based construct, a meganuclease, a zinc finger nuclease, and a transcription activator-like (TAL) effector (TALE) nuclease, and / or (ii) the inhibitor of the protein is selected from a small molecule, an antibody or an antigen binding fragment thereof, an antibody mimetic or an aptamer.
9. The inhibitor for use of claim 8, wherein the antibody mimetic is selected from the group consisting of Anticalins, Affibodies, Adnectins, DARPins, Avimers, Nanofitins, Affilins, β-Wrapins, ADAPT, Monobodies, RasIns, FingRs, Pronectins, Centyrins, Affimers, Adhirons, Affitins, αReps, Repebodies, i-bodies, Fynomers and Kunitz domain proteins.
10. The inhibitor for use of claim 8 or 9, wherein the inhibitor of the nucleic acid molecule comprises or consists of (a) a nucleic acid sequence which comprises or consists of a nucleic acid sequence being complementary to at least 12 continuous nucleotides of a nucleic acid sequence selected from SEQ ID NOs 1, 3 and 5, (b) a nucleic acid sequence which comprises or consists of a nucleic acid sequence which is at least 70% identical to the complementary strand of one or more nucleic acid sequences selected from SEQ ID NOs 1, 3 and 5, (c) a nucleic acid sequence which comprises or consists of a nucleic acid sequence according to (a) or (b), wherein the nucleic acid sequence is DNA or RNA, (d) an expression vector expressing the nucleic acid sequence as defined in any one of (a) to (c), preferably under the control of a glial cells-specific promoter, preferably Schwann cells-specific promoter, or (e) a host comprising the expression vector of (d).
11. The inhibitor for use of any one of claims 1 to 11, wherein the (I) the inhibitor of G6PD is selected from G6PDi-1, RRX-001, DHEA, Polydatin, 6- aminonicotinamide, Fluasterone, CB63, CB70, CB72, CB104, , compounds 25, 29 and 32; and / or (II) the inhibitor of ACSL3 is Triacsin C.
12. The inhibitor for use of any one of claims 1 to 11, wherein the inhibitor is formulated as a pharmaceutical composition.
13. The inhibitor for use of claim 12, wherein the pharmaceutical composition comprises the inhibitor and at least one pharmaceutically acceptable carrier, excipient or diluent.
14. The inhibitor for use of any one of claims 1 to 13, wherein the subject wherein neurofibromatosistype 2 is to be treated or neurofibromatosis type 2 tumors are to be prevented is a mammal.
15. The inhibitor for use of claim 14, wherein the mammal is a human.
Citation Information
Patent Citations
Single polypeptide chain binding molecules
US4946778A
Method for producing antibodies in plant cells
US6080560A
Specific and high affinity binding proteins comprising modified SH3 domains of FYN kinase
WO2008022759A2
Peptide vaccine and peptide vaccine composition for cranial nerve disease
US20200147194A1
8-ethyl-6-(ARYL)pyrido [2,3-d]pyrimidin-7(8H) -ones for the treatment of nervous system disorders and cancer
WO2013043232A2