Genetic test method and genetic test kit for t cell receptor (TCR) or b cell receptor (BCR)

The single-cell analysis method with molecular barcodes on RT probe-immobilized beads addresses the limitations of current tests by precisely profiling TCR or BCR variable regions, improving the prediction of immune checkpoint inhibitor drug efficacy.

WO2025258291A1PCT designated stage Publication Date: 2025-12-18HITACHI LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/017194
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-13
Filing Date
2025-05-12
Publication Date
2025-12-18

AI Technical Summary

Technical Problem

Current immunohistochemistry and genomic tests for selecting patients for immune checkpoint inhibitor (ICI) treatment are indirect and do not accurately assess the patient's immune status, leading to a low response rate due to averaging immune cell measurements, which fail to capture diversity and heterogeneity.

Method used

A single-cell analysis method using a chip with microchambers and RT probe-immobilized beads for constructing cDNA libraries, incorporating molecular barcodes to sequence TCR or BCR variable regions, allowing precise immune cell profiling through NGS.

Benefits of technology

Enables accurate immune status assessment by correlating TCR or BCR variable region sequences with cell identification barcodes, enhancing the prediction of ICI drug efficacy by analyzing individual immune cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JP2025017194_18122025_PF_FP_ABST
    Figure JP2025017194_18122025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides a genetic test method and a genetic test kit for immune cells in blood. Specifically, the present invention provides a genetic test method and a genetic test kit for analyzing a variable region of a T cell receptor (TCR) or a B cell receptor (BCR) in a single cell analysis technique.
Need to check novelty before this filing date? Find Prior Art

Description

Genetic testing method and genetic testing kit for T cell receptor (TCR) or B cell receptor (BCR)

[0001] The present invention relates to a genetic testing method and a genetic testing kit, and more specifically to a genetic testing method and a genetic testing kit that target immune cells in blood.

[0002] Immune checkpoint inhibitors (ICIs) are anticancer drugs that inhibit the binding of cancer cells to immune cells, preventing cancer cells from escaping immune cell attack. While ICIs have been shown to be effective in increasing 5-year survival rates compared to other anticancer drugs, their response rate is low at 20-30%, posing challenges for the testing technology needed to narrow down the patients likely to benefit from ICI. Companion diagnostics for ICI currently used in clinical testing include immunohistochemistry, which examines the expression of PD-1 and mismatch repair deficiency (dMMR), tumor mutation burden (TMB), which examines gene mutation burden, and microsatellite instability (MSI), which examines genomic instability. However, the tumor shrinkage effect of drugs selected based on the results of these tests has not yet reached 50%. The reason these tests are not able to narrow down the patient population appropriately is that they target cancer tissue and are indirect immunological tests, so they are unable to accurately evaluate the patient's immune status. To evaluate a patient's immune status, a technology is required to evaluate immune cells. Measuring immune cells in bulk (multiple cells together) results in an average value for all of the patient's immune cells, making it impossible to evaluate the diversity and heterogeneity of immune cells, so a technology is needed to analyze individual immune cells.

[0003] The present inventors have developed a single-cell analysis technology that uses a chip with 100 microchambers arranged two-dimensionally to capture a large number of cells at once, constructs a cDNA library on RT (Reverse Transcription) probe-immobilized beads pre-filled into the microchambers, and performs expression analysis of immune cells at the single-cell level (Patent Document 1, Non-Patent Document 1). The RT probes contain, from the 5' end, a consensus sequence for amplification, a cell identification barcode (which identifies cells with hundreds of different sequences), a unique molecular identifier (UMI), and an oligo(dT) sequence. Using the cDNA library synthesized on the immobilized beads as a template, hundreds of genes are amplified by multiplex PCR using the consensus sequence for amplification of the RT probes and sequences specific to each of hundreds of pre-selected immune-related genes. The products amplified by multiplex PCR are sequenced using a next-generation sequencer (NGS), and each of the hundreds of genes is counted using a molecular identification barcode. By compiling the expression profiles of the hundreds of genes selected for each cell identification barcode, it is possible to determine the immune state of the cells contained in the sample.

[0004] US11053536B (Patent No. 5997278)

[0005] Shirai et al. , Sci. Rep. , 6:36014, 2016

[0006] To further improve the accuracy of immune status assessment, the inventors attempted to develop a method that combines previously developed single-cell analysis with repertoire analysis, which evaluates the sequence and expression level of T cell receptors (TCRs) or B cell receptors (BCRs), and determines to which antigens a patient's immune cells respond, as well as how strongly they respond. TCRs are composed of a dimer of an α chain and a β chain, each with a variable region and a constant region. BCRs also have a variable region and a constant region. The constant region corresponds to the portion of the TCR or BCR that spans the cell membrane, while the variable region corresponds to the portion present extracellularly that binds to antigens. To determine which antigens are recognized by the TCR or BCR expressed, it is necessary to know the mRNA sequence of the variable region. However, the full-length mRNAs of TCRs and BCRs are too long to analyze in one go using NGS, which poses a challenge. In human genes, the TCR constant region is longer than 700 bases, and the total length of the constant region and variable region (300-400 bases) combined exceeds 1,000 bases. The BCR constant region is also approximately 400-2,800 bases, and the total length combined with the variable region (approximately 300-500 bases) exceeds 700 bases. Therefore, the TCR gene and BCR gene far exceed the 600 bases that can be analyzed at one time by NGS. When attempting to sequence the variable region of a TCR or BCR using previously developed single-cell analysis techniques, it is impossible to analyze the cell tag and molecular barcode attached to the end of the constant region of a TCR or BCR by an RT probe together with the variable region of the TCR or BCR by NGS due to their length.

[0007] Therefore, an object of the present invention is to provide a genetic testing method and a genetic testing kit for analyzing the cell barcode and molecular barcode attached to the end of the constant region of a TCR or BCR together with the variable region of the TCR or BCR using NGS in single-cell analysis technology.

[0008] The present inventors discovered that by constructing a first-strand cDNA library on RT probe-immobilized beads that had been previously loaded into a microchamber, and then inserting a second molecular identification barcode into the constant region near the variable region of a TCR or BCR when synthesizing a second-strand cDNA library, and amplifying and sequencing two fragments, namely, a fragment containing the variable region and the second molecular identification barcode, and a fragment containing the second molecular identification barcode and the constant region, the first molecular identification barcode, and the cell identification barcode, it is possible to clarify the correspondence between the variable region and the first molecular identification barcode and the cell identification barcode through the second molecular identification barcode, which led to the completion of the present invention.

[0009] In one aspect, the present invention provides a method for genetic testing of a T cell receptor (TCR) or a B cell receptor (BCR), comprising the steps of: capturing mRNA eluted from a single cell using an RT probe immobilized on a solid surface and including, in order from the 5' end, a consensus sequence, a cell identification barcode, a first molecular identification barcode, and an oligo(dT) sequence; using the captured mRNA as a template, performing a reverse transcription reaction in a reverse transcription reaction solution including a reverse transcriptase having a template switching function and a template switching oligo (TSO) to generate a first-strand cDNA having a known sequence added to its 3' end; degrading the mRNA; hybridizing a primer that binds to the known sequence at the 3' end and a primer for inserting a second molecular identification barcode to the first-strand cDNA, and then cleaving the first-strand cDNA; a step of performing an extension reaction using cDNA as a template, wherein the primer for inserting a second molecular identification barcode binds to a constant region adjacent to a variable region of a TCR or BCR and includes a second molecular identification barcode; a step of ligating, with a ligase, the second strand cDNA extended from the primer that binds to the known sequence at the 3' end and the second strand cDNA extended from the primer for inserting the second molecular identification barcode; and a step of amplifying a fragment including the second molecular identification barcode and the variable region of a TCR or BCR using a primer that binds to the known sequence at the 5' end of the second strand cDNA and a first primer that binds to the constant region of a TCR or BCR, and amplifying the second strand cDNA. The method includes the steps of: amplifying a fragment including the second molecular identification barcode, the constant region of TCR or BCR, the cell identification barcode, and the first molecular identification barcode using a second primer that binds to the constant region of TCR or BCR in the cDNA and a primer that binds to the common sequence; analyzing the sequence of the amplified fragment; and associating the sequence of the variable region of TCR or BCR with the cell identification barcode and the first molecular identification barcode via the second molecular identification barcode.

[0010] In another aspect, the present invention provides a method for predicting or determining the efficacy of an anticancer drug in a subject, comprising: analyzing the sequence and expression level of the variable region of TCR or BCR for each cell contained in a sample obtained from the subject using the method; and evaluating the immune status of the cells based on the results of the analysis.

[0011] In yet another aspect, the present invention provides a kit for genetic testing of a T cell receptor (TCR) or a B cell receptor (BCR), comprising: a primer that binds to a known sequence added by a Template Switching Oligo (TSO); and a primer for inserting a second molecular identification barcode, wherein the primer for inserting the second molecular identification barcode binds to a constant region adjacent to the variable region of the TCR or BCR and comprises a second molecular identification barcode.

[0012] This specification includes the disclosure of Japanese Patent Application No. 2024-096155, filed on June 13, 2024, from which this application claims priority.

[0013] The present invention provides a genetic testing method and a genetic testing kit that can associate the sequence of a TCR or BCR variable region with a cell identification barcode and a first molecular identification barcode via a second molecular identification barcode, thereby enabling repertoire analysis in single-cell analysis. Therefore, the present invention is useful in fields such as basic research, testing, and drug discovery, where patient stratification is performed by predicting the effectiveness of anticancer drugs, and the effectiveness of anticancer drugs is assessed.

[0014] 1 is a schematic diagram showing an example of single-cell analysis using a microchamber. FIG. 1 is a schematic diagram showing an example of a method for introducing a second molecular identification barcode into a constant region near a variable region of a TCR. FIG. 2 is a schematic diagram showing an example of a protocol for inserting a second molecular identification barcode into a constant region close to a variable region of a TCR. FIG. 3 is a schematic diagram showing an example of a method for amplifying a fragment using only second strand cDNA into which a second molecular identification barcode has been inserted as a template. FIG. 4 is a flowchart showing an embodiment of a genetic testing method in which a second molecular identification barcode is inserted into a constant region close to a variable region of a TCR, and the sequence of the variable region of the TCR is analyzed by correlating it with the cell identification barcode and the first molecular identification barcode. FIG. 5 is a graph showing the results of evaluating, by real-time PCR, the insertion efficiency of the second molecular identification barcode when the reaction temperature in the second strand cDNA synthesis reaction is set to 50° C. or 65° C. FIG. 6 is a photograph showing the results of electrophoresis of TCRA and TCRB fragments amplified by PCR.

[0015] The objectives, features, advantages, and ideas relating to the present invention will be apparent to those skilled in the art from the description in this specification. Those skilled in the art can easily reproduce the present invention from the description in this specification. The embodiments and specific examples of the invention described below show preferred embodiments of the present invention and are presented for illustration or explanation purposes, and are not intended to limit the present invention thereto. It will be apparent to those skilled in the art that various changes and modifications can be made based on the description in this specification without departing from the spirit and scope of the present invention disclosed herein.

[0016] (1) Genetic Testing Method In one aspect, the present invention provides a genetic testing method for T cell receptors (TCR) or B cell receptors (BCR), the method comprising the steps of: capturing mRNA eluted from a single cell using an RT probe immobilized on a solid surface, the RT probe including, in order from the 5' end, a consensus sequence, a cell identification barcode, a first molecular identification barcode, and an oligo(dT) sequence; using the captured mRNA as a template, performing a reverse transcription reaction in a reverse transcription reaction solution including a reverse transcriptase having a template switching function and a template switching oligo (TSO) to generate a first-strand cDNA having a known sequence added to its 3' end; degrading the mRNA; hybridizing a primer that binds to the known sequence at the 3' end and a primer for inserting a second molecular identification barcode to the first-strand cDNA, and then a step of performing an extension reaction using cDNA as a template, wherein the primer for inserting a second molecular identification barcode binds to a constant region adjacent to a variable region of a TCR or BCR and includes a second molecular identification barcode; a step of ligating, with a ligase, the second strand cDNA extended from the primer that binds to the known sequence at the 3' end and the second strand cDNA extended from the primer for inserting the second molecular identification barcode; and a step of amplifying a fragment including the second molecular identification barcode and the variable region of a TCR or BCR using a primer that binds to the known sequence at the 5' end of the second strand cDNA and a first primer that binds to the constant region of a TCR or BCR, and amplifying the second strand cDNA. The method includes the steps of: amplifying a fragment including the second molecular identification barcode, the constant region of TCR or BCR, the cell identification barcode, and the first molecular identification barcode using a second primer that binds to the constant region of TCR or BCR in the cDNA and a primer that binds to the common sequence; analyzing the sequence of the amplified fragment; and associating the sequence of the variable region of TCR or BCR with the cell identification barcode and the first molecular identification barcode via the second molecular identification barcode.

[0017] In the present invention, the cells to be measured are not particularly limited as long as they have a TCR or BCR gene, and may be, for example, cells isolated from a body fluid sample such as blood, tissue collected from a living body, or cultured cells. When the cells to be measured are cells in a body fluid or tissue collected from a living body, it is preferable to previously isolate T cells or B cells whose immune state is to be evaluated using an apparatus such as a flow cytometer.

[0018] The solid phase is preferably made using a material with a large surface area to increase the efficiency of mRNA capture, and for example, it is preferable to use one or more beads, a porous structure, a mesh structure, etc. When beads are used as the solid phase, they can be made from resin materials (such as polystyrene), oxides (such as glass), metals (such as iron), Sepharose, and combinations thereof. For ease of operation, it is preferable to use magnetic beads. The solid phase is preferably one with a diameter of 10 nm to 10 μm, for example, beads with a diameter of 10 nm to 10 μm.

[0019] An RT probe including, in order from the 5' end, a common sequence, a cell identification barcode, a first molecular identification barcode, and an oligo(dT) sequence is immobilized on the surface of the solid phase. Such an RT probe can be synthesized by a conventional oligonucleotide synthesis method, and can be immobilized on the solid phase by any method known in the art.

[0020] By introducing the common sequence into the RT probe, this sequence can be used as a common primer or a sequence to which the common primer binds in the PCR amplification step. Therefore, the common sequence can have a base length that functions as a primer, for example, a length of 10 to 30 bases.

[0021] The cell identification barcodes used have a known sequence (for example, 2 to 20 bases long, depending on the expected number of cells) that differs for each cell. For example, if a random sequence of 5 bases is used, 4 5This makes it possible to identify 1024 cells. In other words, in one operation, 1024 single cells can be analyzed (at the single-cell level) while identifying the mRNA derived from each cell. For the first molecular identification barcode, a molecular identification barcode having a different random sequence (e.g., 5 to 20 bases long depending on the expected number of molecules) is used for each RT probe molecule (mRNA molecule or mRNA-derived DNA molecule). When the first molecular identification barcode (e.g., 7 bases) is introduced into the probe, 4 7 = 1.6 x 10 5 Since the first molecular identification barcode can identify molecules, it is possible to identify the molecule from which amplification products derived from the same cell and having the same gene sequence are derived from sequence data on the amplification products obtained by a next-generation sequencer (NGS).In other words, amplification bias can be corrected using the first molecular identification barcode, allowing highly accurate quantitative data to be obtained.The RT probe may further include a sample identification barcode for identifying the sample from which the cell is derived.The above-mentioned cell identification barcode and first molecular identification barcode are described in detail, for example, in WO2014 / 141386.

[0022] The degree of polymerization of the oligo(dT) sequence may be such that it can hybridize with the poly(A) sequence of the mRNA and capture the mRNA on the solid phase to which the oligo(dT) is immobilized, for example, about 10 to 20 bases.

[0023] The mRNA eluted from a single cell is captured by an RT probe immobilized on a solid surface. In this invention, "capturing mRNA" refers to extracting mRNA molecules contained within the cell and separating them from other cellular components. Specifically, mRNA is eluted from the cell using a cell lysis solution known in the art. For example, cells can be lysed using protease, chaotropic salts such as guanidine thiocyanate and guanidine hydrochloride, surfactants such as Tween and SDS, or commercially available cell lysis reagents (e.g., lysis solution), and the nucleic acids contained therein, i.e., mRNA, can be eluted. If necessary, the status of cell lysis can be monitored using an observation device. The eluted mRNA is captured by the RT probe by binding to the oligo(dT) sequence of the RT probe.

[0024] Next, a first-strand cDNA having a sequence complementary to the mRNA sequence or a portion thereof is synthesized by reverse transcription using the captured mRNA as a template. This first-strand cDNA synthesis, i.e., complementary strand synthesis, can be carried out by a method known in the art, by performing a reverse transcription reaction in a reverse transcription reaction solution containing a reverse transcriptase having template switching function and a template switching oligo (TSO), and a known sequence (TS) is added to the 3' end of the resulting first-strand cDNA.

[0025] After the synthesis reaction, the mRNA is degraded and removed using, for example, an RNase (such as RNase H). As a result, a cDNA library composed of first-strand cDNAs corresponding to the mRNAs is produced on the solid phase surface.

[0026] If necessary, a washing solution is used to wash the solid phase, device, etc. to remove unwanted components and reagents.

[0027] If necessary, excess RT probes immobilized on the solid surface that did not contribute to first-strand cDNA synthesis are removed, for example, by digesting them with Exonuclease I.

[0028] Next, a primer that binds to the known sequence (TS) at the 3' end and a primer for inserting a second molecular identification barcode are hybridized to the first strand cDNA, followed by an extension reaction using the first strand cDNA as a template. The extension reaction can be carried out using a DNA polymerase known in the art.

[0029] The DNA polymerase preferably has low 5'→3' nuclease activity, and more preferably lacks 5'→3' nuclease activity. If the DNA polymerase has high 5'→3' nuclease activity, the DNA polymerase that synthesizes second-strand cDNA from a primer of known sequence (TS) added by Template Switching Oligo will degrade the primer for inserting the second molecular identification barcode that is hybridized to the first-strand cDNA during the extension reaction, preventing the synthesis of cDNA into which the second molecular identification barcode has been inserted. On the other hand, DNA polymerases with high 3'→5' nuclease activity are preferred because they have a high ability to correct synthesis errors. For example, it is preferable to use Q5 High-Fidelity DNA Polymerase, Phusion High-Fidelity DNA Polymerase, or the like.

[0030] The second molecular identification barcode is contained in both of the two amplified fragments generated in the subsequent amplification reaction described below, and as a result, is a barcode for correlating the two amplified fragments to determine that they are derived from the same first-strand cDNA, and its sequence design is the same as that of the first molecular identification barcode. The second molecular identification barcode may include multiple types of second molecular identification barcodes. By comparing multiple types of second molecular identification barcodes with each other, the accuracy of the correspondence can be improved.

[0031] The primer for inserting the second molecular identification barcode is designed so that one of the two amplified fragments generated in the subsequent amplification step described below contains the entire variable region of the TCR or BCR, and that the amplified fragment has a length suitable for analysis by NGS (e.g., 600 bases or less). Specifically, the primer for inserting the second molecular identification barcode binds to a constant region adjacent to the variable region of the TCR or BCR, and contains a second molecular identification barcode. The "constant region adjacent to the variable region of the TCR or BCR" refers to a portion of the constant region located near the boundary between the variable and constant regions of the TCR or BCR. Specifically, to amplify an amplification fragment containing a TCR variable region (300 to 400 bases) or a BCR variable region (300 to 500 bases), "proximal to the TCR or BCR variable region" means within 300 bases, preferably within 200 bases, more preferably within 150 bases, and even more preferably within 100 bases from the boundary between the variable region and the constant region.

[0032] The second molecular identification barcode insertion primer is designed to bind to the constant region of the first-strand cDNA and insert the second molecular identification barcode into the second-strand cDNA generated by extension of the second molecular identification barcode insertion primer. Preferably, the second molecular identification barcode insertion primer has sequences complementary to the constant regions of the TCR or BCR on the first-strand cDNA at both ends, with the second molecular identification barcode between them. That is, the second molecular identification barcode insertion primer includes, from the 5' end, sequence 1 complementary to the constant region of the TCR or BCR, the second molecular identification barcode, and sequence 2 complementary to the constant region of the TCR or BCR. The length and sequence of the complementary sequence portion are such that it can bind to the constant region of the TCR or BCR even in the presence of the (non-complementary) second molecular identification barcode. Specifically, the length of the sequence complementary to the constant region is adjusted so that the Tm value is higher than the temperature at which the DNA polymerase that synthesizes the second strand cDNA is active.

[0033] In one embodiment, the primer for inserting the second molecular identifier barcode binds to a constant region within 200 bases of the boundary between the variable and constant regions of the TCR or BCR, thereby inserting the second molecular identifier barcode into the constant region within 200 bases of the boundary between the variable and constant regions of the TCR or BCR.

[0034] In one embodiment, the primer for inserting a second molecular identification barcode may have a specific fixed base at one or both ends of the second molecular identification barcode. The specific fixed base may include any number of bases (e.g., 1 to 10 bases, preferably 2 to 8 bases, 2 to 5 bases, or 2 to 3 bases). By adding this specific fixed base to the end of the primer for inserting a second molecular identification barcode, the second-strand cDNA produced by extension of the primer for inserting a second molecular identification barcode can be distinguished from the first-strand cDNA that served as the template, and in the subsequent amplification step, only the second-strand cDNA can be amplified as a template.

[0035] In one embodiment, the 5' end of the primer for inserting the second molecular identification barcode is phosphorylated, which adds a phosphate group to the resulting second-strand cDNA, enabling efficient ligation reaction with a ligase, as described below.

[0036] The above-mentioned primer binding to the known sequence at the 3' end and the primer for inserting a second molecular identification barcode are used to perform an extension reaction using the first strand cDNA as a template, and then the second strand cDNA extended from the primer binding to the known sequence at the 3' end and the second strand cDNA extended from the primer for inserting a second molecular identification barcode are ligated with a ligase. The ligase is not particularly limited as long as it is capable of ligating blunt ends of cDNA, and commercially available ligases such as T4 DNA Ligase and Rapid DNA Ligation Kit manufactured by Thermo Fisher Scientific, and Blunt / TA Ligase Master Mix and Quick Ligation Kit manufactured by New England Biolabs can be used. TM Kit, Hi-T4 DNA Ligase, etc. can be used.

[0037] Subsequently, an amplification reaction is carried out to amplify the following two fragments: (a) a fragment containing the second molecular identification barcode and the variable region of the TCR or BCR is amplified using a primer that binds to the known sequence (TS) at the 5' end of the second strand cDNA and a first primer that binds to the constant region of the TCR or BCR, and (b) a fragment containing the second molecular identification barcode, the constant region of the TCR or BCR, the cell identification barcode, and the first molecular identification barcode is amplified using a second primer that binds to the constant region of the TCR or BCR in the second strand cDNA and a primer that binds to a common sequence.

[0038] The first primer is designed to bind to the TCR or BCR constant region 3' to the second molecular identification barcode, so that a fragment containing the entire TCR or BCR variable region and the second molecular identification barcode is amplified. Furthermore, the first primer is designed within 600 bases of the primer that binds to the known sequence (TS) at the 5' end, so that the amplified fragment is preferably 600 bases or less.

[0039] The second primer is designed to bind to the variable and / or constant region of the TCR or BCR 5' to the second molecular identification barcode, so that a fragment containing the second molecular identification barcode, the constant region of the TCR or BCR, the cell identification barcode, and the first molecular identification barcode is amplified. There is no limit to the length of the fragment amplified by the second primer.

[0040] The primers (four types) used in the amplification reaction can be designed and synthesized appropriately depending on the amplification conditions to be adopted, and the DNA polymerase used is not particularly limited as long as it is a polymerase used in conventional amplification reactions.

[0041] The amplified fragments are then subjected to sequence analysis, which can be performed using, for example, next-generation sequencing (NGS).

[0042] Based on the results of sequence analysis of (a) a fragment containing a second molecular identification barcode and a TCR or BCR variable region, and (b) a fragment containing the second molecular identification barcode, a TCR or BCR constant region, a cell identification barcode, and a first molecular identification barcode, the sequence of the TCR or BCR variable region is associated with the cell identification barcode and the first molecular identification barcode via the second molecular identification barcode contained in both fragments. This makes it possible to understand which molecule derived from which cell expresses which TCR or BCR, and to what extent, the TCR or BCR has which sequence.

[0043] In one embodiment, the method of the present invention is a method for genetic testing of TCR or BCR at the single-cell level, and by combining it with a single-cell analysis device such as those described in Patent Document 1 (US11053536B) or US10646869B, genetic testing can be performed more efficiently and with higher accuracy. Specifically, using a device such as those described in Patent Document 1 or US10646869B, cell capture → cell lysis → mRNA capture → cDNA synthesis by reverse transcription reaction is performed for each cell in multiple micro-reaction chambers. 10 micro-magnetic beads (e.g., Φ: 1 μm) to which RT probes are immobilized are placed in the micro-reaction chambers. 5 Because they are packed so densely, there are a total of 10 10There are more than 1000 RT probes available, and it is possible to capture trace amounts of mRNA from a single cell and synthesize cDNA without sample loss.

[0044] In this specification, unless otherwise specified, the terms "consensus sequence," "cell identification barcode," "molecular identification barcode," "known sequence," etc. are intended to encompass both a certain sequence and a sequence complementary thereto. For example, a known sequence refers to both a known sequence at the 3' end added by a reverse transcription reaction, and a sequence identical to the initially added known sequence and a sequence complementary thereto, which are generated by a complementary strand synthesis reaction, an extension reaction, or an amplification reaction.

[0045] The genetic testing method of the present invention will be specifically described with reference to the schematic diagrams of FIGS.

[0046] Figure 1 is a schematic diagram showing an example of single-cell analysis using microchambers. A chip 101 contains 100 microchambers 102 arranged two-dimensionally. These microchambers are pre-filled with RT (Reverse Transcription) probe-immobilized beads 103. The RT probes 105 contain, from the 5' end, a consensus sequence 106 for amplification, a cell identification barcode 107 (which identifies cells using hundreds of different sequences), a molecular identification barcode 108 (Unique Molecular Identifier, UMI), and an oligo(dT) sequence (Figure 1B omits SEQ ID NO: 1, described below). A cell suspension is added to the chip and aspirated, allowing one cell 104 to enter each microchamber. When cell lysis solution is added, the cells are disrupted, and the poly(A) tail of the mRNA 109 contained within them binds to the oligo(dT) sequence of the RT probe immobilized on the beads and is captured on the beads. A reaction solution containing reverse transcriptase is added to synthesize a first-strand cDNA library on the beads, and a cell identification barcode and a molecular identification barcode are attached to the end of each molecule of the first-strand cDNA 110. Using this first-strand cDNA library as a template, several hundred genes are amplified by multiplex PCR using a consensus sequence for RT probe amplification and sequences specific to each of several hundred pre-selected immune-related genes. The products amplified by multiplex PCR are sequenced using NGS, and each of the several hundred genes is counted using the molecular identification barcode. By compiling the expression profiles of the several hundred genes selected for each cell identification barcode, the immune state of the cells contained in the sample can be determined.

[0047] FIG. 2 is a schematic diagram showing an example of a method for introducing a second molecular identification barcode into a constant region near a variable region of a TCR. FIG. 2A shows first-strand cDNA synthesized from TCR mRNA contained in cells isolated using a chip equipped with microchambers. During cDNA synthesis, a first molecular identification barcode 203 and a cell identification barcode 204 are added to the end of the constant region 202. As shown in FIG. 2B, a second molecular identification barcode 205 is introduced into the constant region 202 near a variable region 201 of a TCR. The insertion position of the second molecular identification barcode 205 may be any position so long as the chain length from the TCR variable region 201 to the second molecular identification barcode 205 is shorter than 600 bases. Because the TCR variable region 201 is 300 to 400 bases long, the constant region is preferably within 200 bases from the variable region, more preferably within 150 bases, and even more preferably within 100 bases. As shown in Figure 2C, when a fragment containing the variable region 201 and the second molecular identification barcode 205 and a fragment containing the second molecular identification barcode 205 and the constant region 202, the first molecular identification barcode 203, and the cell identification barcode 204 are amplified, the fragment containing the variable region 201 and the second molecular identification barcode 205 has a chain length of 600 bases or less, which can be analyzed by a single NGS run. In this case, the fragment containing the second molecular identification barcode 205 and the constant region 202, the first molecular identification barcode 203, and the cell identification barcode 204 exceeds the analytical limit of NGS (600 bases). However, since it is not necessary to analyze the entire length of the fragments, and it is sufficient to analyze the first molecular identification barcode, the second molecular identification barcode, and the cell identification barcode located at both ends of each fragment, this problem can be solved by performing the analysis in a paired-end read mode, in which analysis is performed from both ends. From the above, by amplifying and sequencing each of the two fragments, it is possible to clarify the correspondence between the variable region and the first molecular identification barcode and cell identification barcode through the second molecular identification barcode.

[0048] Figure 3 is a schematic diagram showing an example of a protocol for inserting a second molecular recognition barcode into the constant region adjacent to the variable region of a TCR. First, in Figure 3A, the poly(A) tail portion of mRNA 301 is captured by RT probe-immobilized beads 304, and first-strand cDNA 308 is synthesized by reverse transcriptase. The reverse transcriptase adds a cytosine-rich sequence to the 3' end of first-strand cDNA 308 by its terminal transferase activity. In Figure 3B, this cytosine-rich sequence is hybridized with Template Switching Oligo 309, which contains a guanine residue at its 3' end. In Figure 3C, the reverse transcriptase performs an extension reaction up to the end of Template Switching Oligo 309. In FIG. 3D, after the mRNA portion is degraded with RNase H, a primer 310 that binds to the template switching oligo region and a primer 311 that binds to the constant region 303 adjacent to the variable region 302 are hybridized. The primer (primer for inserting a second molecular identification barcode) 311 that hybridizes to the constant region 303 adjacent to the variable region 302 is phosphorylated at the 5' end, and a second molecular identification barcode 312 is inserted into the primer. In FIG. 3E, a second strand cDNA 313 is synthesized using DNA polymerase starting from the two primers. In FIG. 3F, the two second strand cDNAs synthesized from the two primers are ligated at a ligation junction 314 using DNA ligase. This series of procedures allows the synthesis of a molecule in which second molecular recognition barcode 312 is inserted into constant region 303 adjacent to TCR variable region 302. Finally, in Figure 3G, a fragment containing second molecular recognition barcode 312 and variable region 302 is amplified using primer 310 that binds to the Template Switching Oligo region and primer 315 that binds to constant region 303.At the same time, a fragment containing the second molecular identification barcode 312, the constant region 303, the cell identification barcode 306, and the first molecular identification barcode 305 is amplified using a primer 316 that binds to the constant region 303 and a primer 317 that binds to the amplification common sequence 307 at the 3' end of the second strand cDNA.

[0049] The primer for inserting the second molecular identification barcode has the second molecular identification barcode inserted into its central portion, which is not complementary to the first strand cDNA and does not bind to it. Therefore, it is necessary to adjust the length of the sequences complementary to the constant regions at both ends so that the Tm value is higher than the temperature at which the DNA polymerase synthesizing the second strand cDNA is active, by combining the sequences complementary to the constant regions at both ends with the non-complementary sequence in between. For example, if the DNA polymerase is active at 50°C, the primer for inserting the second molecular identification barcode is designed to have a Tm value of 50°C or higher, preferably 55°C or higher.

[0050] 4 is a schematic diagram showing an example of a method for amplifying a fragment using only second strand cDNA into which a second molecular identification barcode has been inserted as a template. Primer 401 for inserting the second molecular identification barcode has sequences 402 at both ends that bind to constant region 303 adjacent to variable region 302 of TCR (sequence 402 is complementary to the constant region), and the region between them has second molecular identification barcode 403 as well as several fixed bases 404. In FIG. 4, two fixed bases, GT, are provided as an example. Second-strand cDNA with a second molecular identification barcode 403 inserted is synthesized and ligated with second-strand cDNA extended from the Template Switching Oligo sequence using DNA ligase. A TCR fragment is then amplified using primer 405 that binds to the Template Switching Oligo region and primer 406 (the sequence GCCTTTTGGGTGTGGGAGATCTCTGCTTCTGAAC (SEQ ID NO: 21) is shown as an example) that binds to the TCR constant region 303. By using a fixed base inserted together with the second molecular identification barcode at the end of the primer that binds to the TCR constant region 303, amplification can be performed using only the second-strand cDNA with the second molecular identification barcode inserted as a template, without using first-strand cDNA without the second molecular identification barcode inserted as a template. The PCR for amplifying this fragment may be nested PCR, in which a first amplification is performed with a primer that binds to a TCR constant region without a fixed base at the end, followed by a second amplification with a primer that binds to a TCR constant region that has a fixed base at the end.

[0051] 5 is a flowchart illustrating an embodiment of a genetic testing method in which a second molecular identification barcode is inserted into a constant region adjacent to a TCR variable region, and the sequence of the TCR variable region is correlated with the cell identification barcode and the first molecular identification barcode for analysis. First, mRNA eluted from a single cell is captured using an RT probe (comprising a common sequence, a cell identification barcode, a first molecular identification barcode, and an oligo(dT) sequence) immobilized on a solid surface (S501). Next, first-strand cDNA is synthesized in a reverse transcription reaction solution containing a reverse transcriptase with template switching function and a template switching oligo (TSO), and a known sequence is added to the 3' end (S502). The mRNA is then digested with RNase H (S503). A primer that binds to the known sequence at the 3' end and a primer for inserting a second molecular identification barcode are hybridized to the first-strand cDNA, followed by an extension reaction (S504). A second-strand cDNA molecule synthesized from two primers using the first-strand cDNA as a template is ligated with ligase (S505). A fragment containing the second molecular identification barcode and variable region is amplified using a primer that binds to the known sequence at the 5' end of the second-strand cDNA and a primer that binds to the TCR constant region, and a fragment containing the second molecular identification barcode, constant region, cell identification barcode, and first molecular identification barcode is amplified using a primer that binds to the TCR constant region and a primer that binds to a common sequence at the 3' end of the second-strand cDNA (S506). The amplified product is analyzed by NGS in paired-end read mode (setting to sequence both ends of the fragment) (S507). Finally, the sequence of the variable region is associated with the cell identification barcode and the first molecular identification barcode via the second molecular identification barcode (S508).

[0052] The method of the present invention allows for analysis of the sequence and expression of TCR or BCR variable regions at the single-cell level using fragments of a length suitable for analysis by NGS. Because molecular identification barcodes (first and second molecular identification barcodes) can be inserted at specified locations, the molecular identification barcodes can be inserted while avoiding important variable region regions. Furthermore, because cell identification barcodes are used, TCRs or BCRs (particularly TCRA and TCRB pairs) expressed in each cell can be processed together after the cell identification barcodes are attached, allowing for convenient analysis of TCRs or BCRs in multiple cells at the single-cell level.

[0053] The above-described method according to the present invention can be used to predict or determine the effect of an anticancer drug in a subject. Accordingly, in one aspect, the present invention relates to a method for predicting or determining the effect of an anticancer drug in a subject (a method for assisting in the prediction or determination of the effect of an anticancer drug), comprising the steps of: analyzing the sequence and expression level of the variable region of a TCR or BCR for each cell contained in a sample obtained from the subject using the genetic testing method according to the present invention; and evaluating the immune status of the cells based on the results of the analysis.

[0054] By assessing the immune state of cells in a sample obtained from a subject, it is possible to predict or determine the effectiveness of an anticancer drug in the subject. Depending on the predicted effect, it may be possible to decide whether to start or continue administration of the anticancer drug to the subject, not administer the anticancer drug, or suspend or discontinue administration of the anticancer drug.

[0055] (2) Genetic Testing Kit The above-described method according to the present invention can be carried out more easily and conveniently by using a kit containing at least a primer for inserting the second molecular identification barcode.

[0056] That is, in one aspect, the present invention provides a genetic testing kit, which includes: a primer that binds to a known sequence added by a Template Switching Oligo (TSO); and a primer for inserting a second molecular identification barcode.

[0057] The kit of the present invention may further comprise a DNA polymerase and / or a ligase.

[0058] The second molecular identification barcode insertion primer is as described in the previous section, binds to a constant region adjacent to the variable region of a TCR or BCR, and contains a second molecular identification barcode. In one embodiment, the second molecular identification barcode insertion primer binds to a constant region within 200 bases of the boundary between the variable and constant regions of a TCR or BCR. In one embodiment, the second molecular identification barcode insertion primer is phosphorylated at its 5' end. As described in the previous section, the second molecular identification barcode insertion primer has sequences complementary to the constant regions of a TCR or BCR on the first-strand cDNA at both ends, and contains a second molecular identification barcode therebetween. The length of the sequences complementary to the constant regions at both ends is adjusted to match the temperature at which the DNA polymerase (which may be included in the kit) synthesizing the second-strand cDNA is active, so that the Tm value of the second molecular identification barcode insertion primer is higher than the reaction temperature.

[0059] As described in the previous section, the DNA polymerase is preferably one with low 5' to 3' nuclease activity, more preferably one lacking 5' to 3' nuclease. The ligase is also as described in the previous section, and is not particularly limited as long as it is a ligase that can ligate the blunt ends of cDNA, and commercially available ligases can be used.

[0060] The kit of the present invention may further comprise a reverse transcriptase and a template switching oligo. The reverse transcriptase is also as described in the previous section, and any reverse transcriptase having a template switching function can be used.

[0061] The kits of the present invention may further include other components necessary for performing library preparation for NGS, such as substrates, etc. They may also include instructions describing procedures and protocols for performing library preparation.

[0062] In one embodiment, the kit of the present invention is for carrying out the above-mentioned genetic testing method of the present invention. The kit of the present invention is useful for TCR or BCR repertoire analysis in single-cell analysis. The kit of the present invention may be used to carry out TCR or BCR repertoire analysis alone in single-cell analysis, or may be used to simultaneously carry out TCR or BCR repertoire analysis and expression analysis of specific genes related to the immune response of cells other than TCR or BCR by dividing the reaction solution into two after second-strand cDNA synthesis.

[0063] Furthermore, the kit according to the present invention can be used for stratifying patients based on the prediction of the efficacy of anticancer drugs, and for determining the efficacy of anticancer drugs.

[0064] Example 1 In this example, a second-strand cDNA library into which a second molecular recognition barcode was inserted was prepared using a Jurkat cell RNA library, and the results of evaluating the insertion efficiency are described.

[0065] Following the protocol for Template Switching RT Enzyme Mix (NEB), first-strand cDNA was synthesized by adding the Template Switching Oligo sequence to Jurkat cell total RNA (extracted using RNeasy Mini Kit (Qiagen)). 7 After removing the supernatant (15 ng / μL), 2.7 μL of a solution containing 15 ng / μL mRNA and 1.7 mM dNTP was added and left on ice for 2 minutes. A solution containing a mixture of each reagent was added to the beads so that the final concentration after addition to the beads was 1x Template Switching RT Buffer, 3.75 μL Template Switching Oligo, and 1x Template Switching RT Enzyme Mix. The beads were then left at 42°C for 90 minutes and 85°C for 5 minutes, after which the beads were washed with wash buffer (0.1% Tween 20, 10 mM Tris (pH 8.0)).

[0066] 20 μL of the reaction solution for RNA degradation and second-strand cDNA synthesis was added to the beads. The reaction solution for RNA degradation and second-strand cDNA synthesis consisted of 1x Q5 Hot Start High-Fidelity Master Mix (NEB), 0.25 U / μL E. coli RNase H (NEB), 2 μM forward primer, 0.2 μM second molecular identifier barcode insertion primer (TCRA), and 0.2 μM second molecular identifier barcode insertion primer (TCRB). After incubation at 37°C for 15 minutes, 95°C for 1 minute, and 50°C for 10 minutes, the beads were washed with wash buffer. The forward primer used was the variable region forward primer (common to TCRA and TCRB): 5'-CATTGCAAGCAGTGGTATCAAC-3' (SEQ ID NO: 15).

[0067] 20 μL of the ligation reaction solution was added to the beads. The ligation reaction solution consisted of 1x T4 DNA Ligase Buffer (Thermo Fisher Scientific) and 0.05 U / μL T4 DNA Ligase (Thermo Fisher Scientific). After leaving the mixture at room temperature for 10 minutes, the beads were washed with wash buffer and then suspended in 20 μL of wash buffer.

[0068] The real-time PCR reaction solution consisted of 1x Premix Ex Taq (Perfect Real Time) (Takara), 0.2 μM real-time PCR forward primers (TCRA and TCRB), 0.2 μM real-time PCR reverse primers (TCRA and TCRB), 0.2 μM second molecular identifier barcode uninserted sequence detection probes (TCRA and TCRB), and 0.2 μM second molecular identifier barcode inserted sequence detection probes (TCRA and TCRB). 2 μL of bead suspension was added to 30 μL of reaction solution. The PCR cycle was 95°C, 30 s → (95°C, 5 s → 60°C, 30 s) × 40.

[0069] The sequences of the primers and probe are as follows:RT probe: 5'-CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGCGTACNNNNNNNTTTTTTTTTTTTTTTTTTVN-3' (SEQ ID NO: 1, N at positions 39 to 45 = A, G, C or T, V at position 65 = A, G or C, N at position 65 = A, G, C or T) Template Switching Oligo: 5'-GCTAATCATTGCAAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3' (SEQ ID NO: 2, rG = RNA base) Second molecular identification barcode insertion primer (TCRA): 5'-GCCGTGTACCAGCTGAGAGACTCTAAATAAGGTTCGCAGTCTGTCTGCCTATTCACCGATTTTG-3' (SEQ ID NO: 3) Second molecular identification barcode insertion primer (TCRB): 5'-CCCACCCGAGGTCGCTGTGAAGGTTCGTTCAGAAGCAGAGATCTCCCA-3' (SEQ ID NO: 4) Real-time PCR forward primer (TCRA): 5'-CTCAGCATCCGGCCAAATA-3' (SEQ ID NO: 5) Real-time PCR reverse primer (TCRA): 5'-AATCGGTGAATAGGCAGACAG-3' (SEQ ID NO: 6) Real-time PCR forward primer (TCRB): 5'-ACCGTTGTAGAGGACCTGAA-3' (SEQ ID NO: 7) Real-time PCR reverse primer (TCRB): 5'-CACACCAGTGTGGCCTTTTG-3' (SEQ ID NO: 8) 0.2 μM second molecular identification barcode non-inserted sequence detection probe (TCRA): 5'-GAGACTCTAAATCCAGTGACAAGT-3' (SEQ ID NO: 9) 0.2 μM second molecular identification barcode inserted sequence detection probe (TCRA): 5'-GAGACTCTAAATAAGGTTCGCAGT-3' (SEQ ID NO: 10) 0.2 μM second molecular identification barcode non-inserted sequence detection probe (TCRB): 5'-CGCTGTGTTTGAGCCATCAGAAGC-3' (SEQ ID NO: 11) 0.2 μM second molecular identification barcode inserted sequence detection probe (TCRB): 5'-CGCTGTGAAGGTTCGTTCAGAAGC-3' (SEQ ID NO: 12).

[0070] In the RT probe, the 30 bases on the 5' side of the underlined portion correspond to the consensus sequence, the underlined portion corresponds to the 8-base cell identification barcode, the N base portion on the 3' side of the underlined portion corresponds to the 7-base first molecular identification barcode, and the T base portion on the 3' side of that corresponds to oligo(dT).In addition, in the primer for inserting the second molecular identification barcode, the underlined portion corresponds to the 7-base second molecular identification barcode inserted, and the 5' end is phosphorylated.

[0071] The probes for detecting sequences without a second molecular identification barcode each have FAM as a fluorescent dye bound to the 5' end and BHQ-1 as a quencher bound to the 3' end.The probes for detecting sequences with a second molecular identification barcode each have HEX as a fluorescent dye bound to the 5' end and BHQ-1 as a quencher bound to the 3' end.

[0072] Figure 6 shows the results of evaluating the insertion efficiency of the second molecular identification barcode by real-time PCR when the reaction temperature in the second-strand cDNA synthesis reaction was 50°C or 65°C. Figure 6A shows the evaluation results for TCRA, and Figure 6B shows the evaluation results for TCRB. The white bars represent molecules 601 into which the second molecular identification barcode was inserted, and the gray bars represent molecules 602 into which the second molecular identification barcode was not inserted. When the reaction temperature for second-strand cDNA synthesis was 65°C, which is higher than the Tm value of the primer for inserting the second molecular identification barcode, no second molecular identification barcode was inserted. On the other hand, when the reaction temperature for second-strand cDNA synthesis was 50°C, which is lower than the Tm value of the primer for inserting the second molecular identification barcode, it was found that the second molecular identification barcode was inserted. Since the total number of molecules into which the second molecular identification barcode was inserted and the number of molecules into which the second molecular identification barcode was not inserted when the primer for inserting the second molecular identification barcode was added was approximately the same as the number of molecules into which the second molecular identification barcode was not inserted when the primer for inserting the second molecular identification barcode was not added, it is believed that the second molecular identification barcode was inserted into the 2nd strand cDNA synthesized when the primer for inserting the second molecular identification barcode was added.

[0073] Example 2 In this example, the second-strand cDNA library prepared in Example 1 into which the second molecular identification barcode was inserted was used to amplify two fragments: a fragment containing the variable region and the second molecular identification barcode, and a fragment containing the second molecular identification barcode, the constant region, the first molecular identification barcode, and the cell identification barcode.

[0074] 18 μL of pre-amplification reaction solution was added to 2 μL of the bead suspension synthesized with 2nd strand cDNA, and PCR was performed. The pre-amplification reaction solution consisted of 1x Ex Taq Buffer (Takara), 0.2 mM dNTP, 2 μM pre-amplification forward primer, 2 μM pre-amplification reverse primer, and 0.075 U / μL TaKaRa Ex Taq (Takara). The PCR cycle was 98 ° C, 30 s → (98 ° C, 10 s → 60 ° C, 15 s → 72 ° C, 1 min) x 10 → 72 ° C, 2 min.

[0075] After pre-amplification, 30 μL of wash buffer and 35 μL of AMPure XP (Beckman Coulter) were added to the reaction solution, mixed, and left to stand for 5 minutes. After removing the supernatant, the mixture was washed twice with 200 μL of 70% ethanol. 20 μL of wash buffer was added, left to stand for 5 minutes, and the supernatant was collected.

[0076] The PCR reaction solution for amplifying the variable region consists of 1x Ex Taq Buffer, 0.2mM dNTP, 0.2mM dNTP, 0.2μM variable region forward primer (TCRA, TCRB common), 2μM variable region reverse primer (TCRA and TCRB each), 0.075U / μL TaKaRa Ex Taq. The PCR reaction solution for amplifying the constant region consists of 1x Ex Taq Buffer, 0.2mM dNTP, 0.2mM dNTP, 0.2μM constant region forward primer (TCRA and TCRB each), 2μM constant region reverse primer (TCRA, TCRB common), 0.075U / μL TaKaRa Ex Taq. The PCR cycle was 98°C, 30 s → (98°C, 10 s → 72°C, 30 s) x 5 → (98°C, 10 s → 60°C, 15 s → 72°C, 1 min) x 1 ... The following cycle was used: (98°C, 10 s → 60°C, 15 s → 72°C, 1 min) x 1 → (98°C, 10 s → 72°C, 30 s) x 5 → (98°C, 10 s → 60°C, 15 s → 72°C, 1 min) x 1 → (98°C, 10 s → 72°C, 30 s) x 5 → (98°C, 10 s → 60°C, 15 s → 72°C, 1 min) x 25 → 72°C, 2 min.

[0077] The primer sequences are as follows: Pre-amplification forward primer: 5'-CATTGCAAGCAGTGGTATCAAC-3' (SEQ ID NO: 13) Pre-amplification reverse primer: 5'-CCATCTCATCCCTGCGTGTCT-3' (SEQ ID NO: 14) Variable region forward primer (common to TCRA and TCRB): 5'-CATTGCAAGCAGTGGTATCAAC-3' (SEQ ID NO: 15) Variable region reverse primer (TCRA): 5'-GACACATTTGTTTGAGAATCAAAATCGGTGAATAGGCAGACAGAC-3' (SEQ ID NO: 16) Variable region reverse primer (TCRB): 5'-GTGGCCTTTTGGGTGTGGGAGATCTCTGCTTCTG-3' (SEQ ID NO: 17) Constant region forward primer (TCRA): 5'-CCCTGCCGTGTACCAGCTGAGAGACTCTAAAT-3' (SEQ ID NO: 18) Constant region forward primer (TCRB): 5'-GGACCTGAACAAGGTGTTCCCACCCGAGGTCGCTG-3' (SEQ ID NO: 19) Reverse primer for constant region (common to TCRA and TCRB): 5'-CCATCTCATCCCTGCGT-3' (SEQ ID NO: 20)

[0078] Figure 7 shows the results of electrophoresis of PCR-amplified fragments of TCRA and TCRB. To amplify two fragments, one containing the variable region and the second molecular identification barcode, and the other containing the second molecular identification barcode and the constant region, the first molecular identification barcode, and the cell identification barcode, PCR was performed using a combination of a primer using a terminal common sequence and a gene-specific primer. As shown in Figure 7, clear bands were observed for both TCRA and TCRB, representing the fragment containing the variable region and the second molecular identification barcode, and the fragment containing the second molecular identification barcode and the constant region, the first molecular identification barcode, and the cell identification barcode (white arrows in Figure 7).

[0079] In this way, second-strand cDNA is synthesized using a primer for inserting the second molecular identification barcode, and PCR is performed using a combination of a primer using the terminal common sequence and a gene-specific primer to amplify a fragment containing the TCR variable region and the second molecular identification barcode, and a fragment containing the second molecular identification barcode and the TCR constant region, the first molecular identification barcode, and the cell identification barcode. By analyzing the sequence of each fragment by NGS, the correspondence between the variable region and the first molecular identification barcode and the cell identification barcode can be clarified via the second molecular identification barcode.

[0080] 101: Chip 102: Microchamber 103: RT probe-immobilized bead 104: Cell 105: RT probe 106: Common sequence for amplification 107: Cell identification barcode 108: Molecular identification barcode 109: mRNA 110: 1st strand cDNA 201: TCR variable region 202: TCR constant region 203: First molecular identification barcode 204: Cell identification barcode 205: Second molecular identification barcode 301: mRNA 302: TCR variable region 303: TCR constant region 304: RT probe-immobilized bead 305: First molecular identification barcode 306: Cell identification barcode 307: Common sequence for amplification 308: 1st strand cDNA 309: Template Switching Oligo 310...Primer binding to Template Switching Oligo region 311...Primer for inserting second molecular identification barcode 312...Second molecular identification barcode 313...2nd strand cDNA 314...Ligation junction 315, 316...Primers binding to constant region 317...Primer binding to known sequence at 3' end 401...Primer for inserting second molecular identification barcode 402...Sequence complementary to constant region 403...Second molecular identification barcode 404...Fixed base 405...Primer binding to Template Switching Oligo region 406...Primer binding to constant region of TCR 601...Molecule with second molecular identification barcode inserted 602...Molecule without second molecular identification barcode inserted

[0081] SEQ ID NOs: 1 to 22: DNA (synthetic constructs), synthetic oligonucleotides

Claims

1. A method for genetic testing of T cell receptors (TCR) or B cell receptors (BCR), comprising the steps of: capturing mRNA eluted from a single cell using an RT probe immobilized on a solid surface, the RT probe comprising, in order from the 5' end, a consensus sequence, a cell identification barcode, a first molecular identification barcode, and an oligo(dT) sequence; using the captured mRNA as a template, performing a reverse transcription reaction in a reverse transcription reaction solution containing a reverse transcriptase having a template switching function and a template switching oligo (TSO) to generate first-strand cDNA with a known sequence added to the 3' end; degrading the mRNA; hybridizing a primer that binds to the known sequence at the 3' end and a primer for inserting a second molecular identification barcode to the first-strand cDNA, and then a step of performing an extension reaction using cDNA as a template, wherein the primer for inserting a second molecular identification barcode binds to a constant region adjacent to a variable region of a TCR or BCR and includes a second molecular identification barcode; a step of ligating, with a ligase, the second strand cDNA extended from the primer that binds to the known sequence at the 3' end and the second strand cDNA extended from the primer for inserting the second molecular identification barcode; and a step of amplifying a fragment including the second molecular identification barcode and the variable region of a TCR or BCR using a primer that binds to the known sequence at the 5' end of the second strand cDNA and a first primer that binds to the constant region of a TCR or BCR, and amplifying the second strand cDNA. The method includes the steps of: amplifying a fragment including the second molecular identification barcode, the constant region of TCR or BCR, the cell identification barcode, and the first molecular identification barcode using a second primer that binds to the constant region of TCR or BCR in the cDNA and a primer that binds to the common sequence; analyzing the sequence of the amplified fragment; and associating the sequence of the variable region of TCR or BCR with the cell identification barcode and the first molecular identification barcode via the second molecular identification barcode.

2. The method of claim 1, wherein the primer for inserting the second molecular identifier barcode binds to a constant region within 200 bases from the boundary between the variable region and the constant region of a TCR or BCR, thereby inserting the second molecular identifier barcode into the constant region within 200 bases from the boundary between the variable region and the constant region of a TCR or BCR.

3. The method of claim 1, wherein the primer for inserting the second molecular identification barcode has specific fixed bases at both ends or one end of the second molecular identification barcode.

4. The method of claim 1, wherein the 5' end of the second molecular identification barcode insertion primer is phosphorylated.

5. The method of claim 1, wherein the second molecular identification barcodes include a plurality of types of second molecular identification barcodes.

6. A method for predicting or determining the effectiveness of an anticancer drug in a subject, comprising the steps of: analyzing the sequence and expression level of the variable region of TCR or BCR for each cell contained in a sample obtained from the subject using the method of claim 1; and evaluating the immune status of the cells based on the results of said analysis.

7. A kit for genetic testing of T cell receptors (TCR) or B cell receptors (BCR), comprising: a primer that binds to a known sequence added by a Template Switching Oligo (TSO); and a primer for inserting a second molecular identification barcode, wherein the primer for inserting the second molecular identification barcode binds to a constant region adjacent to the variable region of the TCR or BCR and comprises a second molecular identification barcode.

8. The kit according to claim 7, wherein the second molecular identification barcode insertion primer binds to a constant region within 200 bases from the boundary between the variable and constant regions of a TCR or BCR.

9. The kit according to claim 7, wherein the 5' end of the primer for inserting the second molecular identification barcode is phosphorylated.

10. The kit according to claim 7, further comprising a DNA polymerase and / or a ligase.

11. A kit according to claim 7 for carrying out the method according to claim 1.

Citation Information

Patent Citations

  • Methods for screening B-cell lymphocytes

    JP2019534004A

  • High-throughput cloning of paired bipartite immune receptor polynucleotides and its applications

    JP2021534245A

  • Tag-sequence-attached two-dimensional cdna library device, and gene expression analysis method and gene expression analysis apparatus each utilizing same

    WO2014020657A1