Genetically modified microorganism and a method for producing BIO-indigo

Abstract

The present disclosure provides gene constructs comprising genes coding forenzymes involved in: converting tryptophan into indole; converting indole into indoxyl; and production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate. When such gene constructs are expressed in a genetically modified microorganism of the present disclosure, they enable the significant production and accumulation of tryptophan, indole and / or indoxyl within the cells, without the need to supply tryptophan from external sources. The genetically modified microorganism of the present disclosure includes one or more overexpressed genes alongwith one or more knocked-down genes such as tryptophan operon regulator, tyrosine aminotransferase, aspartate aminotransferase, tryptophan repressor protein, pykA, pykF, and combinations thereof. The genetically modified microorganism is capable of using glucose and glycerol as a carbon source to grow and produce indigo. The present disclosure also provides methods for preparing the genetically modified microorganism as well as method of producing indigo from said microorganism.

Description

GENETICALLY MODIFIED MICROORGANISM AND A METHOD FOR PRODUCING BIO-INDIGO FIELD OF THE DISCLOSURE

[0001] The present disclosure relates to recombinant gene construct and a corresponding genetically modified microorganism for production of indigo. In particular, the present disclosure relates to a novel technology for engineering an E.coli with a de-regulated chorismate pathway to produce tryptophan without any feedback inhibitions and extending the pathway to convert tryptophan to indigo in situ by using simple carbon sources and without the need to provide tryptophan in the culture medium from an external source. BACKGROUND OF THE DISCLOSURE

[0002] Enteric bacteria, such as E. coli, have been extensively researched for their capability to accumulate indole through the activity of enzymes like tryptophanase. Tryptophanase is a reliable source for catalyzing the degradation of tryptophan to produce indole, alongside other byproducts. However, despite their ability to thrive on simple media, these bacteria lack the necessary enzymatic machinery to convert indole to indigo.

[0003] In the available methods to produce indigo in the literature, various studies have been described related to the production of Bio-indigo through microbial fermentation process. A novel flavin- containing monooxygenase from Methylophaga sp. strain SK1 was published in 2003 (Biochemical and Biophysical Research Communications 306, 930–936). The monooxygenase of this reference was reported to be isolated, cloned, and expressed in Escherichia coli. Similar studies were conducted by different groups, describing different cloning approaches and fermentation processes in Enzyme and Microbial Technology 42 (2008) 617–623, as well as in another publication on Enzyme and Microbial Technology. There are other several reports available to support an alternate oxygenase isolated from a marine naphthalene-degrading strain from Pseudomonas sp. J26, which is involved in indigo production (Journal of Basic Microbiology 2010, 50, 290–293). A few reports on flavin-containing monooxygenase from other organisms, such as Corynebacterium glutamicum, are also available (Biochemical Engineering Journal). However, none of these oxygenases have been reported to efficiently convert tryptophan into indigo. Additionally, the process requires tryptophan feeding, as producing it is economically and environmentally unsustainable.

[0004] Further, while other researchers have studied the feedback mechanism in the chorismate pathway and deregulating of the pre-chorismate pathway, there are no reports of their success.

[0005] In addition, none of the identified organisms have been used for large-scale microbial production of indigo due to economic factors such as the availability of indole and the nutrient balance in growth media.

[0006] As a consequence, the field is still lacking an effective methodology concerning the advantageous microbiological production of indigo, particularly in E.coli, despite knowledge of the existence of certain microorganisms capable of synthesizing and accumulating indole, as well as certain other organisms capable of employing indoles as a substrate for indigo production.

[0007] In conclusion, while substantial advancement has been accomplished toward comprehending microbial indigo production, particularly through observation of distinct species' ability to produce blue pigments, large-scale synthesis remains a challenge. Economic and technical limitations persist in preventing the widespread implementation of microbial methods to increase indigo production.

[0008] Given the environmental challenges associated with chemical synthesis and the continued importance of indigo in industry, there arises a pressing need for a scalable, cost-effective, sustainable, and environmentally friendly method for its production with low carbon footprint. This disclosure endeavors to meet this need by presenting a biological approach to indigo synthesis. SUMMARY OF THE DISCLOSURE

[0009] The present disclosure relates to a genetically modified microorganism comprising heterologous genes integrated into genome of the microorganism, said genes configured for: i. converting tryptophan into indole; ii. converting indole into indoxyl; and iii production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate.

[0010] The present disclosure also relates to a method for preparing the genetically modified microorganism as described above, comprising: i. obtaining gene constructs comprising genes for: (a) converting tryptophan into indole; (b) converting indole into indoxyl; and (c) production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate.ii. cloning the gene constructs into plasmids or expression vectors; iii. introducing the plasmids into the cell of native microorganism; and iv. integrating the expression cassette of said genes into the genome of the native microorganism.

[0011] The present disclosure also relates to a method for production of indigo in a host microorganism, said method comprising cultivating the genetically modified microorganism as described above, under conditions facilitating production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate, conversion of tryptophan into indole and conversion of indole into indoxyl, thereby obtaining the indigo. BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS

[0012] Figure 1 shows the two-step conversion of L-tryptophan to Indigo, in accordance with the present disclosure.

[0013] Figure 2 shows the biosynthetic pathways, regulations, and transport systems of aromatic amino acids in E.coli., and the dotted lines and the dashed lines indicate feedback inhibition and repression, respectively, in accordance with the present disclosure.

[0014] Figure 3 shows the design of the gene construct for TRP- Linker- FMO with a solubility tag under the T7 promoter, in accordance with the present disclosure.

[0015] Figure 4 shows the design of the gene construct for TRP- Linker- FMO with a solubility tag under the moderate strength promoter, in accordance with the present disclosure.

[0016] Figure 5 shows the vector map of TRP- Linker- FMO with a solubility tag under moderate strength promoter, in accordance with the present disclosure.

[0017] Figure 6 shows the vector map of FMO with a solubility tag under a moderate strength promoter, in accordance with the present disclosure.

[0018] Figure 7 shows the vector map of TRP with a solubility tag under a moderate strength promoter, in accordance with the present disclosure.

[0019] Figure 8 shows the agarose gel showing gene amplification by PCR: TRP, FMO, and TRP- linker-FMO constructs with and without solubility tag, in accordance with the present disclosure.

[0020] Figure 9 shows the SDS-PAGE analysis of shake flask IPTG induction, in accordance with the present disclosure.

[0021] Figure 10 shows the SDS-PAGE analysis of TRP-linker-FMO with solubility tag, in accordance with the present disclosure.

[0022] Figure 11 shows the shake flask level induction cell pellet of clone TRP-linker-FMO with solubility tag. The samples are labeled as C2- clone 2, C4- clone 4, A. uninduced, B. induced, in accordance with the present disclosure.

[0023] Figure 12 shows the induced cell pellet in a microcentrifuge tube after extracting it with organic solvent. The samples are labeled as C2 B- clone 2 induced, C4 B- clone 4 induced, in accordance with the present disclosure.

[0024] Figure 13 shows the bio-indigo organic solvent extracted from the induced cell pellet. The samples are labeled as C2 B- clone 2 induced, C4 B- clone 4 induced, in accordance with the present disclosure.

[0025] Figure 14 shows the crude bio-indigo obtained by drying the cell biomass, which was induced, in accordance with the present disclosure.

[0026] Figure 15 shows the purified bio-indigo obtained after extraction and drying, in accordance with the present disclosure.

[0027] Figure 16a depicts the pFB-TrpR KO_trpE_aroF_Donor Plasmid, in accordance with the present disclosure; Figure 16b depicts the pFB-TrpR KO_trpE_aroF_knockout fragment, in accordance with the present disclosure.

[0028] Figure 17a depicts the pFB-PykA KO-AntrpC-tktA-Donor Plasmid, in accordance with the present disclosure; Figure 17b depicts the pFB-PykA KO-AntrpC-tktA-knockout fragment, in accordance with the present disclosure.

[0029] Figure 18a depicts the pFB-PykF KO-TRP-L-FMO_Donor Plasmid, in accordance with the present disclosure; Figure 18b depicts the pFB-PykF KO-TRP-L-FMO_knockout fragment, in accordance with the present disclosure.

[0030] Figure 19 depicts the HPLC data showing indole and tryptophan production by the genetically modified microorganism of the present disclosure. DETAILED DESCRIPTION OF THE DISCLOSURE

[0031] Several microorganisms produce aromatic precursors and aromatic compounds through the condensation reaction of phosphoenolpyruvate (PEP) and erythrose-4-phosphate (E4P) to create 3- deoxy-D-arabino-heptulosonate-7-phosphate (DAHP). This condensation reaction, which leads to the formation of DAHP, is considered the initial committed step in the biosynthetic pathway referred to as the chorismate pathway. Furthermore, this pathway allows microbial cells to generate various cyclic metabolites, pre-aromatic metabolites, and aromatic metabolites. These include aromatic amino acids and other aromatic and cyclic molecules. The ability of microorganisms to carry out this condensation reaction and subsequently utilize the common aromatic pathway enables the synthesis of a diverse range of essential biomolecules crucial for cell functioning and metabolism.

[0032] The present disclosure accordingly provides a gene construct comprising at least one gene coding for an enzyme involved in: (i) converting tryptophan into indole; (ii) converting indole into indoxyl; (iii) production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; or any combination of enzymes involved in i. to iii.

[0033] In some embodiments, the enzyme that converts tryptophan into indole is tryptophanase encoded by a TRP gene.

[0034] Thus, in some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting tryptophan into indole.

[0035] In some embodiments, the enzyme that converts indole into indoxyl is selected from a group comprising flavin-containing monooxygenase encoded by a FMO gene or naphthalene dioxygenase encoded by a NDO gene.

[0036] Thus, in some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting converts indole into indoxyl.

[0037] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting indole into indoxyl selected from a group comprising flavin-containing monooxygenase encoded by a FMO gene or naphthalene dioxygenase encoded by a NDO gene.

[0038] In some embodiments, the flavin-containing monooxygenase is selected from a group comprising Methylophaga flavin-containing monooxygenase encoded by MaFMO gene, N. lacisaponensis flavin-containing monooxygenase encoded by NiFMO gene, and C. glutamicum flavin- containing monooxygenase encoded by CgFMO gene.

[0039] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting indole into indoxyl, wherein the enzyme is flavin- containing monooxygenase selected from a group comprising Methylophaga flavin-containing monooxygenase encoded by MaFMO gene, N. lacisaponensis flavin-containing monooxygenase encoded by NiFMO gene, and C. glutamicum flavin-containing monooxygenase encoded by CgFMO gene.

[0040] In some embodiments, the naphthalene dioxygenase is selected from a group comprising Commamonas sp. MQ naphthalene dioxygenase encoded by CoNDO gene, Pseudomonas putida naphthalene dioxygenase encoded by PpNDO gene, and Cupriavidus sp. SHE indole oxygenase encoded by CuIndOx gene.

[0041] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting indole into indoxyl, wherein the enzyme is naphthalene dioxygenase selected from a group comprising Commamonas sp. MQ naphthalene dioxygenase encoded by CoNDO gene, Pseudomonas putida naphthalene dioxygenase encoded by PpNDO gene, and Cupriavidus sp. SHE indole oxygenase encoded by CuIndOx gene.

[0042] In some embodiments, the present disclosure provides a gene construct comprising TRP gene and FMO / NDO gene.

[0043] In some embodiments, the present disclosure provides a gene construct comprising TRP gene and FMO gene

[0044] In some embodiments, the enzyme involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate is selected from one or more of: i. enzyme converting phosphoenolpyruvate and erythrose 4-phosphate into 3-deoxy-D- arabino-heptulosonate 7-phosphate (DAHP); ii. enzyme converting DAHP into 3-dehydroquinate; iii. enzyme converting 3-dehydroquinate into 3-dehydroshikimate; iv. enzyme converting 3-dehydroshikimate into shikimate; v. enzyme converting shikimate into shikimate-3-phosphate; vi. enzyme converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate; vii. enzyme converting 5-enolpyrubylshikimate-3-phosphate into chorismate; and viii. enzyme converting chorismate into anthranilate.

[0045] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting phosphoenolpyruvate and erythrose 4-phosphate into 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP).

[0046] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting DAHP into 3-dehydroquinate.

[0047] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting 3-dehydroquinate into 3-dehydroshikimate.

[0048] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting 3-dehydroshikimate into shikimate.

[0049] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting shikimate into shikimate-3-phosphate.

[0050] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting shikimate-3-phosphate into 5-enolpyruvylshikimate- 3-phosphate.

[0051] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting 5-enolpyrubylshikimate-3-phosphate into chorismate.

[0052] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting chorismate into anthranilate.

[0053] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting anthranilate into phosphoribosyl anthranilate.

[0054] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting phosphoribosyl anthranilate into 1-(o- carboxyphenylamino)-1-deoxyribulose-5-phosphate.

[0055] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting 1-(o-carboxyphenylamino)-1-deoxyribulose-5- phosphate into tryptophan.

[0056] In some embodiments, the present disclosure provides a gene construct comprising at least one gene coding for an enzyme involved in converting tryptophan into indole and any or all of the one or more genes coding for an enzyme involved in converting phosphoenolpyruvate and erythrose 4- phosphate into 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP); converting DAHP into 3- dehydroquinate; enzyme converting 3-dehydroquinate into 3-dehydroshikimate; converting 3- dehydroshikimate into shikimate; converting shikimate into shikimate-3-phosphate; converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate; converting 5-enolpyrubylshikimate- 3-phosphate into chorismate; and converting chorismate into anthranilate; converting anthranilate into phosphoribosyl anthranilate; converting phosphoribosyl anthranilate into 1-(o-carboxyphenylamino)-1- deoxyribulose-5-phosphate; and converting 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate into tryptophan.

[0057] In some embodiments, the present disclosure provides a gene construct comprising any or all of the one or more genes coding for an enzyme involved in converting phosphoenolpyruvate and erythrose 4-phosphate into 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP); converting DAHP into 3- dehydroquinate; enzyme converting 3-dehydroquinate into 3-dehydroshikimate; converting 3- dehydroshikimate into shikimate; converting shikimate into shikimate-3-phosphate; converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate; converting 5-enolpyrubylshikimate- 3-phosphate into chorismate; and converting chorismate into anthranilate; converting anthranilate into phosphoribosyl anthranilate; converting phosphoribosyl anthranilate into 1-(o-carboxyphenylamino)-1- deoxyribulose-5-phosphate; and converting 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate into tryptophan.

[0058] In some embodiments, the one or more genes involved in the conversion of phosphoenolpyruvate and erythrose 4-phosphate to tryptophan is present in two separate gene constructs.

[0059] In some embodiments, the enzyme that converts phosphoenolpyruvate or erythrose 4-phosphate into 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) is DAHP synthase encoded by aroG, aroH or aroF gene.

[0060] In some embodiments, the enzyme that converts DAHP into 3-dehydroquinate is DAHP synthase encoded by aroB gene.

[0061] In some embodiments, the enzyme that converts 3-dehydroquinate into 3-dehydroshikimate is DAHP synthase encoded by aroD gene.

[0062] In some embodiments, the enzyme that converts 3-dehydroshikimate into shikimate is DAHP synthase encoded by aroE gene.

[0063] In some embodiments, the enzyme that converts shikimate into shikimate-3-phosphate is DAHP synthase encoded by aroK and aroL genes.

[0064] In some embodiments, the enzyme that converts shikimate-3-phosphate into 5- enolpyruvylshikimate-3-phosphate is DAHP synthase encoded by aroA gene.

[0065] In some embodiments, the enzyme that converts 5-enolpyrubylshikimate-3-phosphate into chorismate is DAHP synthase encoded by aroC gene.

[0066] In some embodiments, the enzyme that converts chorismate into anthranilate is anthranilate (ANTA) synthase encoded by trpE, trpG or trpD gene.

[0067] In some embodiments, the enzyme that converts anthranilate into phosphoribosyl anthranilate is anthranilate phosphoribosyltransferase encoded by trpG or trpD gene.

[0068] In some embodiments, the enzyme that converts phosphoribosyl anthranilate into 1-(o- carboxyphenylamino)-1-deoxyribulose-5-phosphate is N-(5'-phosphoribosyl)anthranilate isomerase encoded by trpC or trp F gene.

[0069] In some embodiments, the enzymes that convert 1-(o-carboxyphenylamino)-1-deoxyribulose-5- phosphate into tryptophan are phosphoribosylanthranilate isomerase and anthranilate phosphoribosyltransferase encoded by trpC or trp F gene, respectively.

[0070] In some embodiments, the gene construct comprising genes for converting phosphoenolpyruvate and erythrose 4-phosphate into tryptophan further comprises at least one gene coding for an enzyme transketolase encoded by tktA gene, involved in the production of the erythrose 4-phosphate.

[0071] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting tryptophan into indole and at least one gene selected from the group of aroG, aroH or aroF gene coding for an enzyme converting phosphoenolpyruvate or erythrose 4-phosphate into 3-deoxy-D- arabino-heptulosonate 7-phosphate (DAHP).

[0072] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting tryptophan into indole and aroB gene coding for an enzyme converting DAHP into 3- dehydroquinate is DAHP synthase.

[0073] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting tryptophan into indole and aroD gene coding for an enzyme converting 3-dehydroquinate into 3-dehydroshikimate.

[0074] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting tryptophan into indole and aroE gene coding for an enzyme converting 3-dehydroshikimate into shikimate.

[0075] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting tryptophan into indole and at least one gene selected from aroK and aroL genes coding for an enzyme converting shikimate into shikimate-3-phosphate.

[0076] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting tryptophan into indole and aroA gene coding for an enzyme converting shikimate-3- phosphate into 5-enolpyruvylshikimate-3-phosphate.

[0077] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting tryptophan into indole and aroC gene coding for an enzyme converting 5- enolpyrubylshikimate-3-phosphate into chorismate.

[0078] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting tryptophan into indole and at least one gene selected from the group of trpE, trpG or trpD gene coding for an enzyme converting chorismate into anthranilate is anthranilate (ANTA) synthase.

[0079] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting tryptophan into indole and tktA gene coding for an enzyme transketolase, involved in the production of the erythrose 4-phosphate.

[0080] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting indole into indoxyl and at least one gene selected from the group of aroG, aroH or aroF gene coding for an enzyme converting phosphoenolpyruvate or erythrose 4-phosphate into 3-deoxy-D- arabino-heptulosonate 7-phosphate (DAHP).

[0081] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting indole into indoxyl and aroB gene coding for an enzyme converting DAHP into 3- dehydroquinate is DAHP synthase.

[0082] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting indole into indoxyl and aroD gene coding for an enzyme converting 3-dehydroquinate into 3-dehydroshikimate.

[0083] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting indole into indoxyl and aroE gene coding for an enzyme converting 3-dehydroshikimate into shikimate.

[0084] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting indole into indoxyl and at least one gene selected from aroK and aroL genes coding for an enzyme converting shikimate into shikimate-3-phosphate.

[0085] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting indole into indoxyl and aroA gene coding for an enzyme converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate.

[0086] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting indole into indoxyl and aroC gene coding for an enzyme converting 5-enolpyrubylshikimate- 3-phosphate into chorismate.

[0087] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting indole into indoxyl and at least one gene selected from the group of trpE, trpG or trpD gene coding for an enzyme converting chorismate into anthranilate is anthranilate (ANTA) synthase.

[0088] In some embodiments, the gene construct comprises at least one gene coding for an enzyme converting indole into indoxyl and tktA gene coding for an enzyme transketolase, involved in the production of the erythrose 4-phosphate.

[0089] In some embodiments, where a gene construct comprises at least one gene coding for an enzyme involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate, the gene construct also comprises at least one gene involved in converting tryptophan into indole and / or at least one gene involved in converting indole into indoxyl.

[0090] In some embodiments, the gene construct comprises trpE and aroF genes.

[0091] In some embodiments, the gene construct comprises trpC and tktA genes.

[0092] In some embodiments, any or all of the one or more genes included in the gene construct are operably linked to a promoter.

[0093] In some embodiments, the promoter is selected from a group comprising a T7 promoter, a Tac promoter and a Trc promoter.

[0094] In some embodiments, the TRP gene and the FMO / NDO gene in the gene construct are operably linked to a single T7 or Tac promoter to form a fusion gene.

[0095] In some emodiments, the gene(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate and for producing erthrose-4-phosphate are operably linked to Trc promoter.

[0096] In some embodiments, any or all of the one or more genes included in the gene construct are operably linked to a moderate promoter.

[0097] In some embodiments, the TRP and the FMO / NDO fusion gene(s) is operably linked to a solubility tag / signal peptide.

[0098] In some embodiments, the solubility tag / signal peptide is selected from a group comprising, but not limited to, PelB signal sequence, maltose binding protein (MBP) signal sequence, 6X-his signal sequence, GST signal sequence, and thioredoxin tag sequence.

[0099] In some embodiments, the PelB signal sequence channels the nascent peptide to periplasmic region, the MBP tag (maltose binding protein) sequence makes the protein soluble, and the 6X-his, GST or thioredoxin tag sequence increase the solubility or redox potential in the cytosolic region for better folding of the peptides.

[0100] In some embodiments, the signal peptide is 6X-his tag signal sequence, which helps in case the expressed protein is required to be purified, analyzed & verified.

[0101] In some embodiments, the signal peptide is thioredoxin tag sequence.

[0102] In some embodiments the TRP gene and the FMO / NDO gene are connected by a linker sequence.

[0103] In some embodiments, the linker sequence comprises single or multiple repeats of SGSAAG.

[0104] In some embodiments, the TRP gene and the FMO / NDO fusion gene is included between NdeI & EcoRI restriction endonuclease sites within the construct.

[0105] In some embodiments, the TRP gene and the FMO / NDO fusion gene is included between NdeI & EcoRI restriction endonuclease sites along with a linker sequence within the construct.

[0106] In some embodiments, the TRP gene and the FMO / NDO fusion gene is included between NdeI & EcoRI restriction endonuclease sites along with a linker sequence and NcoI site within the construct.

[0107] In some embodiments, the gene constructs of the present disclosure further comprises at least one gene coding for a chaperone.

[0108] In some embodiments, the gene coding for a chaperone is selected from a group comprising foldases, PDI, and chaperonins.

[0109] In some embodiments, the chaperones ensure the efficient folding of the resulting peptide by forming proper secondary and tertiary structures in the protein.

[0110] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase and, FMO gene coding for flavin-containing monooxygenase or NDO gene naphthalene dioxygenase, with or without pykF gene.

[0111] In some embodiments, the gene construct comprises at least one gene selected from a group comprising aroF, aroG and aroH; along with trpE gene with or without trpR gene; and tktA gene.

[0112] In some embodiments, the gene construct comprises trpE and aroF genes, with or without trpR gene.

[0113] In some embodiments, the gene construct comprises trpC and tktA genes, with or without pykA gene.

[0114] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroF gene coding for DAHP synthase.

[0115] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and, aroG gene coding for DAHP synthase.

[0116] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroH gene coding for DAHP synthase.

[0117] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroB gene coding for an enzyme converting DAHP into 3-dehydroquinate is DAHP synthase.

[0118] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroD gene coding for an enzyme converting 3- dehydroquinate into 3-dehydroshikimate.

[0119] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroE gene coding for an enzyme converting 3- dehydroshikimate into shikimate.

[0120] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and at least one gene selected from aroK and aroL genes coding for an enzyme converting shikimate into shikimate-3-phosphate.

[0121] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroA gene coding for an enzyme converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate.

[0122] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroC gene coding for an enzyme converting 5- enolpyrubylshikimate-3-phosphate into chorismite.

[0123] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and at least one gene selected from the group of trpE, trpG or trpD gene coding for an enzyme converting chorismate into anthranilate is anthranilate (ANTA) synthase.

[0124] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and tktA gene coding for an enzyme transketolase, involved in the production of the erythrose 4-phosphate.

[0125] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase, and aroF gene coding for DAHP synthase.

[0126] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroG gene coding for DAHP synthase.

[0127] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroH gene coding for DAHP synthase.

[0128] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroB gene coding for an enzyme converting DAHP into 3-dehydroquinate is DAHP synthase.

[0129] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroD gene coding for an enzyme converting 3- dehydroquinate into 3-dehydroshikimate.

[0130] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroE gene coding for an enzyme converting 3- dehydroshikimate into shikimate.

[0131] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and at least one gene selected from aroK and aroL genes coding for an enzyme converting shikimate into shikimate-3-phosphate.

[0132] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroA gene coding for an enzyme converting shikimate-3- phosphate into 5-enolpyruvylshikimate-3-phosphate.

[0133] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroC gene coding for an enzyme converting 5- enolpyrubylshikimate-3-phosphate into chorismite.

[0134] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and at least one gene selected from the group of trpE, trpG or trpD gene coding for an enzyme converting chorismate into anthranilate is anthranilate (ANTA) synthase.

[0135] In some embodiments, the gene construct comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and tktA gene coding for an enzyme transketolase, involved in the production of the erythrose 4-phosphate.

[0136] In some embodiments of the present disclosure, the nucleotide sequence of the gene encoding any of the enzymes herein has about 80% to 100% similarity to the corresponding wild type sequence of the said genes.

[0137] In some embodiments of the present disclosure, the nucleotide sequence of the gene encoding any of the enzymes herein has about 80% to 100% similarity to the corresponding wild type sequenceof the said genes, and are therefore mutated at certain positions compared to the wild type gene. For example, the aroF gene is an aroFΔI11 mutated gene, or the trpE gene is a trpE S40F gene.

[0138] The present disclosure further provides a biologically functional plasmid or expression vector comprising the gene construct as described above.

[0139] In some embodiments, the plasmid is a pFB or any pFB series vector.

[0140] In some embodiments, the biologically functional plasmid is selected from a group comprising pFB-Sol Tag TRP-Lnkr-FMO, pFB-Sol Tag -FMO, pFB- -FMO, pFB- PykA Knock Out (KO)-trpC- tktA, pFB-TrpR KO_trpE_aroF and pFB-PykF KO-TRP-L-FMO.

[0141] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase and FMO gene coding for flavin-containing monooxygenase.

[0142] In some embodiments, the biologically functional plasmid or expression vector comprises trpC gene and tktA gene.

[0143] In some embodiments, the biologically functional plasmid or expression vector comprises trpE gene and aroF gene.

[0144] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase and FMO gene coding for flavin-containing monooxygenase, along with the linker linked to the solubility tag and the promoter.

[0145] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase, and aroF gene coding for DAHP synthase along with the linker linked to the solubility tag and the promoter.

[0146] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and, aroG gene coding for DAHP synthase along with the linker linked to the solubility tag and the promoter.

[0147] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroH gene coding for DAHP synthase along with the linker linked to the solubility tag and the promoter.

[0148] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroB gene coding for an enzyme converting DAHP into 3-dehydroquinate is DAHP synthase along with the linker linked to the solubility tag and the promoter.

[0149] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroD gene coding for an enzyme converting 3-dehydroquinate into 3-dehydroshikimate along with the linker linked to the solubility tag and the promoter.

[0150] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroE gene coding for an enzyme converting 3-dehydroshikimate into shikimate along with the linker linked to the solubility tag and the promoter.

[0151] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and at least one gene selected from aroK and aroL genes coding for an enzyme converting shikimate into shikimate-3- phosphate along with the linker linked to the solubility tag and the promoter.

[0152] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroA genecoding for an enzyme converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate along with the linker linked to the solubility tag and the promoter.

[0153] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroC gene coding for an enzyme converting 5-enolpyrubylshikimate-3-phosphate into chorismite along with the linker linked to the solubility tag and the promoter.

[0154] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and at least one gene selected from the group of trpE, trpG or trpD gene coding for an enzyme converting chorismate into anthranilate is anthranilate (ANTA) synthase along with the linker linked to the solubility tag and the promoter.

[0155] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and tktA gene coding for an enzyme transketolase, involved in the production of the erythrose 4-phosphate along with the linker linked to the solubility tag and the promoter.

[0156] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase, and aroF gene coding for DAHP synthase along with the linker linked to the solubility tag and the promoter.

[0157] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase, and aroG gene coding for DAHP synthase along with the linker linked to the solubility tag and the promoter.

[0158] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase, and aroH gene coding for DAHP synthase along with the linker linked to the solubility tag and the promoter.

[0159] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroB gene coding for an enzyme converting DAHP into 3-dehydroquinate is DAHP synthase along with the linker linked to the solubility tag and the promoter.

[0160] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroD gene coding for an enzyme converting 3-dehydroquinate into 3-dehydroshikimate along with the linker linked to the solubility tag and the promoter.

[0161] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroE gene coding for an enzyme converting 3-dehydroshikimate into shikimate along with the linker linked to the solubility tag and the promoter.

[0162] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and at least one gene selected from aroK and aroL genes coding for an enzyme converting shikimate into shikimate-3- phosphate along with the linker linked to the solubility tag and the promoter.

[0163] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroA gene coding for an enzyme converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate along with the linker linked to the solubility tag and the promoter.

[0164] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroC gene coding for an enzyme converting 5-enolpyrubylshikimate-3-phosphate into chorismite along with the linker linked to the solubility tag and the promoter.

[0165] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and at least one gene selected from the group of trpE, trpG or trpD gene coding for an enzyme converting chorismate into anthranilate is anthranilate (ANTA) synthase along with the linker linked to the solubility tag and the promoter.

[0166] In some embodiments, the biologically functional plasmid or expression vector comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and tktA gene coding for an enzyme transketolase, involved in the production of the erythrose 4-phosphate along with the linker linked to the solubility tag and the promoter.

[0167] In some embodiments of the present disclosure, the nucleotide sequence of the gene encoding any of the enzymes herein has about 80% to 100% similarity to the corresponding wild type sequence of the said genes.

[0168] In some embodiments of the present disclosure, the nucleotide sequence of the gene encoding any of the enzymes herein has about 80% to 100% similarity to the corresponding wild type sequence of the said genes, and are therefore mutated at certain positions compared to the wild type gene. For example, the aroF gene is an aroFΔI11 mutated gene, or the trpE gene is a trpE S40F gene.

[0169] The present disclosure further provides a genetically modified microorganism comprising heterologous genes integrated into genome of the microorganism, said genes configured for: a) converting tryptophan into indole; b) converting indole into indoxyl; and c) production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate.

[0170] In some embodiments, the gene for converting tryptophan into indole is TRP gene which encodes tryptophanase.

[0171] In some embodiments, the gene for converting indole into indoxyl is selected from FMO gene and NDO gene, or a combination thereof; wherein the FMO gene encodes enzyme flavin-containing monooxygenase and the NDO gene encodes enzyme naphthalene dioxygenase.

[0172] In some embodiments, the gene for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate is a wild-type or mutated gene selected from at least one of: a) gene selected from a group comprising aroG, aroH and aroF, or any combination thereof, which encodes DAHP synthase for converting phosphoenolpyruvate and erythrose 4- phosphate into 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP); b) aroB gene which encodes DAHP synthase for converting DAHP into 3-dehydroquinate; c) aroD gene which encodes DAHP synthase for converting 3-dehydroquinate into 3- dehydroshikimate; d) aroE gene which encodes DAHP synthase for converting 3-dehydroshikimate into shikimate; e) gene selected from a group comprising aroK gene, aroL gene, or a combination thereof, which encode DAHP synthase for converting shikimate into shikimate-3-phosphate; f) aroA gene which encodes DAHP synthase for converting shikimate-3-phosphate into 5- enolpyruvylshikimate-3-phosphate; g) aroC gene which encodes DAHP synthase for converting 5-enolpyrubylshikimate-3- phosphate into chorismate; and h) gene selected from a group comprising trpE, trpG and trpD, or any combination thereof, which encodes anthranilate synthase for converting chorismate into anthranilate; i) gene selected from a group comprising trpG and trpD or a combination thereof, which encodes anthranilate phosphoribosyltransferase for converting anthranilate into phosphoribosyl anthranilate; j) gene selected from a group comprising trpC and trp F or a combination thereof, which encodes N-(5'-phosphoribosyl)anthranilate isomerase for converting phosphoribosyl anthranilate into 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate; and k) gene selected from a group comprising trpC and trp F or a combination thereof, which encodes phosphoribosylanthranilate isomerase and anthranilate phosphoribosyltransferase respectively, for converting 1-(o-carboxyphenylamino)-1- deoxyribulose-5-phosphate into tryptophan; or any combination of the genes involved in (a) to (k).

[0173] In some embodiments, the microorganism further comprises tktA gene which encodes enzyme transketolase for production of the erythrose 4-phosphate.

[0174] In some embodiments, the gene(s) is operably linked to a promoter.

[0175] In some embodiments, the promoter is selected from a group comprising T7 promoter, Tac promoter and Trc promoter.

[0176] In some embodiments, the TRP gene and the FMO / NDO gene are operably linked to a single T7 or Tac promoter to form a fusion gene.

[0177] In some embodiments, the TRP gene and the FMO / NDO gene are connected by a linker sequence.

[0178] In some embodiments, the linker sequence comprises single or multiple repeats of SGSAAG.

[0179] In some embodiments, the gene(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate are operably linked to Trc promoter.

[0180] In some embodiments, the TRP and the FMO / NDO fusion gene(s) is operably linked to a solubility tag / signal peptide.

[0181] In some embodiments, the solubility tag / signal peptide is selected from a group comprising PelB signal sequence, maltose binding protein signal sequence, 6X-his signal sequence, GST signal sequence, and thioredoxin tag sequence.

[0182] In some embodiments, an expression cassette comprising the TRP and FMO / NDO fusion gene is integrated at pykF target site of the microorganism’s genome.

[0183] In some embodiments, the microorganism expresses TRP and FMO / NDO as a fusion protein.

[0184] In some embodiments, the gene(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate are integrated as expression cassette at target sites trpR and pykA of the microorganism’s genome.

[0185] In some embodiments, the expression cassette comprising trpE and aroF genes are integrated at target site trpR of the microorganism’s genome; and wherein the expression cassette comprising trpC and tktA genes are integrated at target site pykA of the microorganism’s genome.

[0186] In some embodiments, one or more native genes in the genetically modified microorganism are knocked-down for enhancing the production of tryptophan, indole and / or indoxyl.

[0187] In some embodiments, one or more native genes in the genetically modified microorganism are knocked-down, wherein said genes are selected from tryptophan operon regulator, tyrosine aminotransferase, tryptophanaspartate aminotransferase, tryptophan repressor protein and combinations thereof.

[0188] In some embodiments, one or more native genes in the genetically modified microorganism are knocked-out to stop conversion of phospho-enol-pyruvate (PEP) to pyruvate and channelize the metabolic flux towards DAHP.

[0189] In some embodiments, one or more native genes in the genetically modified microorganism are knocked-out, wherein said genes are selected from pykA and pykF coding for pyruvate kinase.

[0190] The genetically modified microorganism as claimed in any one of claims 1-17, wherein the microorganism comprises knockout or downregulation of a gene selected from a group comprising tryptophan operon regulator, tyrosine aminotransferase, aspartate aminotransferase, tryptophan repressor protein (trpR), pykA, and pykF, or any combination thereof.

[0191] In some embodiments, the microorganism comprises knockout or downregulation of genes trpR, pykA, and pykF.

[0192] In some embodiments, the genetically modified microorganism comprises the gene encoding the enzyme that converts tryptophan into indole, that is tryptophanase, encoded by a TRP gene.

[0193] In some embodiments, the genetically modified microorganism comprises the gene that codes for enzyme that converts indole into indoxyl and is selected from a group comprising flavin-containing monooxygenase encoded by an FMO gene or naphthalene dioxygenase encoded by an NDO gene.

[0194] In some embodiments, the genetically modified microorganism comprises the gene that codes for enzyme that converts tryptophan into indole, that is tryptophanase encoded by a TRP gene and the gene that codes for enzyme that converts indole into indoxyl selected from a group comprising flavin- containing monooxygenase encoded by an FMO gene or naphthalene dioxygenase encoded by an NDO gene.

[0195] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroF gene coding for DAHP synthase.

[0196] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and, aroG gene coding for DAHP synthase.

[0197] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroH gene coding for DAHP synthase.

[0198] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroB gene coding for an enzyme converting DAHP into 3-dehydroquinate is DAHP synthase.

[0199] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroD gene coding for an enzyme converting 3-dehydroquinate into 3-dehydroshikimate.

[0200] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroE gene coding for an enzyme converting 3-dehydroshikimate into shikimate.

[0201] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and at least one gene selected from aroK and aroL genes coding for an enzyme converting shikimate into shikimate-3-phosphate.

[0202] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroA gene coding for an enzyme converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate.

[0203] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and aroC gene coding for an enzyme converting 5-enolpyrubylshikimate-3-phosphate into chorismite.

[0204] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and at least one gene selected from the group of trpE, trpG or trpD gene coding for an enzyme converting chorismate into anthranilate is anthranilate (ANTA) synthase.

[0205] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, FMO gene coding for flavin-containing monooxygenase and tktA gene coding for an enzyme transketolase, involved in the production of the erythrose 4-phosphate.

[0206] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase, and aroF gene coding for DAHP synthase.

[0207] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroG gene coding for DAHP synthase.

[0208] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroH gene coding for DAHP synthase.

[0209] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroB gene coding for an enzyme converting DAHP into 3-dehydroquinate is DAHP synthase.

[0210] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroD gene coding for an enzyme converting 3-dehydroquinate into 3-dehydroshikimate.

[0211] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroE gene coding for an enzyme converting 3-dehydroshikimate into shikimate.

[0212] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and at least one gene selected from aroK and aroL genes coding for an enzyme converting shikimate into shikimate-3-phosphate.

[0213] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroA gene coding for an enzyme converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate.

[0214] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and aroC gene coding for an enzyme converting 5-enolpyrubylshikimate-3-phosphate into chorismite.

[0215] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and at least one gene selected from the group of trpE, trpG or trpD gene coding for an enzyme converting chorismate into anthranilate is anthranilate (ANTA) synthase.

[0216] In some embodiments, the genetically modified microorganism comprises TRP gene coding for tryptophanase, NDO gene coding for naphthalene dioxygenase and tktA gene coding for an enzyme transketolase, involved in the production of the erythrose 4-phosphate.

[0217] In some embodiments, the genetically modified microorganism comprises: at least one gene selected from aroF, aroG and aroH for overexpression of DAHP synthase; at least one gene selected from trpE, trpG and trpD for overexpression of anthranilate synthase; at least one gene selected from aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate; and at least one gene knock-out selected from pykA and pykF to stop conversion of phospho-enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. In some embodiments, along with the aforementioned genes, the genetically modified microorganism comprises the TRP gene encoding tryptophanase; one of FMO gene encoding flavin- containing monooxygenase or NDO gene encoding naphthalene dioxygenase; and at least one solubility tag.

[0218] In some embodiments, the genetically modified microorganism comprises: aroF for overexpression of DAHP synthase; trpE for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate; and at least one gene knock-out selected from pykA and pykF to stop conversion of Phospho-enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. In someembodiments, along with the aforementioned genes, the genetically modified microorganism comprises the TRP gene encoding tryptophanase; one of FMO gene encoding flavin-containing monooxygenase or NDO gene encoding naphthalene dioxygenase; and at least one solubility tag.

[0219] In some embodiments, the genetically modified microorganism comprises: aroF for overexpression of DAHP synthase, trpG for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate; and at least one gene knock-out selected from pykA and pykF stop conversion of Phospho- enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. In some embodiments, along with the aforementioned genes, the genetically modified microorganism comprises the TRP gene encoding tryptophanase; one of FMO gene encoding flavin-containing monooxygenase or NDO gene encoding naphthalene dioxygenase; and at least one solubility tag.

[0220] In some embodiments, the genetically modified microorganism comprises: aroF for overexpression of DAHP synthase; trpD for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate ; and at least one gene knock-out selected from pykA and pykF to stop conversion of Phospho-enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. In some embodiments, along with the aforementioned genes, the genetically modified microorganism comprises the TRP gene encoding tryptophanase; one of FMO gene encoding flavin-containing monooxygenase or NDO gene encoding naphthalene dioxygenase; and at least one solubility tag.

[0221] In some embodiments, the genetically modified microorganism comprises: aroG for overexpression of DAHP synthase; trpE for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate; at least one gene knock-out from pykA and pykF to stop conversion of Phospho-enol- pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. In some embodiments, along with the aforementioned genes, the genetically modified microorganism comprises the TRP geneencoding tryptophanase; one of FMO gene encoding flavin-containing monooxygenase or NDO gene encoding naphthalene dioxygenase; and at least one solubility tag.

[0222] In some embodiments, the genetically modified microorganism comprises: aroG for overexpression of DAHP synthase; trpG for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate; at least one gene knock-out selected from pykA and pykF to stop conversion of Phospho- enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. In some embodiments, along with the aforementioned genes, the genetically modified microorganism comprises the TRP gene encoding tryptophanase; one of FMO gene encoding flavin-containing monooxygenase or NDO gene encoding naphthalene dioxygenase; and at least one solubility tag.

[0223] In some embodiments, the genetically modified microorganism comprises: aroG for overexpression of DAHP synthase; trpD for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate; at least one gene knock-out from pykA and pykF to stop conversion of Phospho-enol- pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. In some embodiments, along with the aforementioned genes, the genetically modified microorganism comprises the TRP gene encoding tryptophanase; one of FMO gene encoding flavin-containing monooxygenase or NDO gene encoding naphthalene dioxygenase; and at least one solubility tag.

[0224] In some embodiments, the genetically modified microorganism comprises: aroH for overexpression of DAHP synthase; trpE for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate; and at least one gene knock-out from pykA and pykFto stop conversion of Phospho-enol- pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. In some embodiments, along with the aforementioned genes, the genetically modified microorganism comprises the TRP geneencoding tryptophanase; one of FMO gene encoding flavin-containing monooxygenase or NDO gene encoding naphthalene dioxygenase; and at least one solubility tag.

[0225] In some embodiments, the genetically modified microorganism comprises: aroH for overexpression of DAHP synthase, trpG for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate; at least one gene knock-out from pykA and pykF to stop conversion of Phospho-enol- pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. In some embodiments, along with the aforementioned genes, the genetically modified microorganism comprises the TRP gene encoding tryptophanase; one of FMO gene encoding flavin-containing monooxygenase or NDO gene encoding naphthalene dioxygenase; and at least one solubility tag.

[0226] In some embodiments, the genetically modified microorganism comprises: aroH for overexpression of DAHP synthase; trpD for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate; and at least one gene knock-out from pykA and pykF to stop conversion of Phospho-enol- pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. In some embodiments, along with the aforementioned genes, the genetically modified microorganism comprises the TRP gene encoding tryptophanase; one of FMO gene encoding flavin-containing monooxygenase or NDO gene encoding naphthalene dioxygenase; and at least one solubility tag.

[0227] In some embodiments, the genetically modified microorganism comprises: aroF for overexpression of DAHP synthase; trpE for overexpression of Anthranilate synthase; tktA to boost erythrose 4-phosphate; TrpC for expression of phosphoribosylanthranilate isomerase; gene knock-outs for pykA and pykF to stop conversion of Phospho-enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP, gene knock-out for trpR; TRP gene for overexpression of tryptophanase; FMO gene for overexpression of flavin-containing monooxygenase; and at least one solubility tag.

[0228] In some embodiments of the present disclosure, the nucleotide sequence of the gene encoding any of the enzymes herein has about 80% to 100% similarity to the corresponding wild type sequence of the said genes.

[0229] In some embodiments of the present disclosure, the nucleotide sequence of the gene encoding any of the enzymes herein has about 80% to 100% similarity to the corresponding wild type sequence of the said genes, and are therefore mutated at certain positions compared to the wild type gene. For example, the aroF gene is an aroFΔI11 mutated gene, or the trpE gene is a trpE S40F gene. \

[0230] In some embodiments, the genetically modified microorganism is Escherichia coli or any Enterobacter species.

[0231] In some embodiments, the strain of the E. coli isBL21 (DE3) or DH5α.

[0232] In some embodiments, the present disclosure also provides a method of preparing the genetically modified microorganism as described above, said method comprising conventional steps of recombinant DNA technology.

[0233] In some embodiments, the method of preparing the genetically modified microorganism as described above comprises cloning, episomal expression and genomic integration through by conventional route.

[0234] In some embodiments, the method comprises: a) obtaining gene constructs comprising genes for: 1. converting tryptophan into indole; 2. converting indole into indoxyl; and 3. production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate. b) cloning the gene constructs into plasmids or expression vectors; c) introducing the plasmids into the cell of native microorganism; and d) integrating the expression cassette of said genes into the genome of the native microorganism.

[0235] In some embodiments, genes for converting tryptophan into indole and indole into indoxyl are present in a single gene construct.

[0236] In some embodiments, the genes for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate are present in two gene constructs.

[0237] In some embodiments, the gene for converting tryptophan into indole is TRP gene which encodes enzyme tryptophanase.

[0238] In some embodiments, the gene for converting indole into indoxyl is FMO gene which encodes enzyme flavin-containing monooxygenase and / or NDO gene which encodes enzyme naphthalene dioxygenase.

[0239] In some embodiments, the gene for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate is a wild-type or mutated gene selected from at least one of: a) gene selected from a group comprising aroG, aroH and aroF, or any combination thereof, which encodes DAHP synthase for converting phosphoenolpyruvate and erythrose 4- phosphate into 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP); b) aroB gene which encodes DAHP synthase for converting DAHP into 3-dehydroquinate; c) aroD gene which encodes DAHP synthase for converting 3-dehydroquinate into 3- dehydroshikimate; d) aroE gene which encodes DAHP synthase for converting 3-dehydroshikimate into shikimate; e) gene selected from a group comprising aroK gene, aroL gene, or a combination thereof, which encode DAHP synthase for converting shikimate into shikimate-3-phosphate; f) aroA gene which encodes DAHP synthase for converting shikimate-3-phosphate into 5- enolpyruvylshikimate-3-phosphate; g) aroC gene which encodes DAHP synthase for converting 5-enolpyrubylshikimate-3- phosphate into chorismate; and h) gene selected from a group comprising trpE, trpG and trpD, or any combination thereof, which encodes anthranilate synthase for converting chorismate into anthranilate;i) gene selected from a group comprising trpG and trpD or a combination thereof, which encodes anthranilate phosphoribosyltransferase for converting anthranilate into phosphoribosyl anthranilate; j) gene selected from a group comprising trpC and trp F or a combination thereof, which encodes N-(5'-phosphoribosyl)anthranilate isomerase for converting phosphoribosyl anthranilate into 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate; and k) gene selected from a group comprising trpC and trp F or a combination thereof, which encodes phosphoribosylanthranilate isomerase and anthranilate phosphoribosyltransferase respectively, for converting 1-(o-carboxyphenylamino)-1- deoxyribulose-5-phosphate into tryptophan; or any combination of the genes involved in (a) to (k).

[0240] In some embodiments, the gene construct(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate further comprises tktA gene which encodes enzyme transketolase for production of the erythrose 4-phosphate.

[0241] In some embodiments, the gene construct(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate comprises knockout or downregulation of a gene selected from a group comprising tryptophan operon regulator, tyrosine aminotransferase, aspartate aminotransferase, tryptophan repressor protein (trpR), pykA, and pykF, or any combination thereof.

[0242] In some embodiments, the gene(s) is operably linked to a promoter.

[0243] In some embodiments, the promoter is selected from a group comprising T7 promoter, Tac promoter and Trc promoter.

[0244] In some embodiments, the TRP gene and the FMO / NDO gene are operably linked to a single T7 promoter or Tac promoter to form a fusion gene.

[0245] In some embodiments, the gene(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate are operably linked to Trc promoter.

[0246] In some embodiments, the TRP-FMO fusion gene(s) is operably linked to a solubility tag / signal peptide.

[0247] In some embodiments, the solubility tag / signal peptide is selected from a group comprising PelB signal sequence, maltose binding protein signal sequence, 6X-his signal sequence, GST signal sequence, and thioredoxin tag sequence.

[0248] In some embodiments, the plasmid is pFB; and wherein each construct is cloned into a separate plasmid.

[0249] In some embodiments, the plasmids are introduced into the cell of the native microorganism by a method selected from a group comprising transformation, transduction and transfection.

[0250] In some embodiments, the method comprises integrating- e) an expression cassette comprising TRP gene and FMO gene at pykF target site of the genome; f) a gene construct comprising aroFΔI11 mutated gene and trpE S40F mutated gene at trpR target site of the genome; and g) a gene construct comprising tktA gene and trpC gene at pykA target site of the genome.

[0251] In some embodiments, the method of preparing the genetically modified microorganism as described above, comprises use of Crispr-Cas system for performing one of more steps of the method.

[0252] It is to be understood that a person skilled in the art is well aware of all such techniques and technologies for preparing a gene construct, integrating the gene construct into a plasmid or expression vector, and thereafter, transforming a host cell with such a vector, to create a genetically modified host cell, such as E.coli, as described in this disclosure.

[0253] The present disclosure further provides a method for the production of indigo in a host microorganism, the method comprising cultivating the genetically modified microorganism under conditions facilitating conversion of tryptophan into indole, or indole into indoxyl, or enhancedproduction of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; or any combination thereof.

[0254] In some embodiments, the method for the production of indigo comprises cultivating the genetically modified microorganism as described herein under conditions facilitating production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate, conversion of tryptophan into indole and conversion of indole into indoxyl, thereby obtaining the indigo.

[0255] In some embodiments, the production of indigo by the said microorganism is enhanced when compared to the wild-type microorganism.

[0256] In some embodiments, the host microorganism comprises genes involved in the gene construct, that are required for the production of indigo.

[0257] In some embodiments, the host microorganism is Escherichia coli or any Enterobacter species.

[0258] In some embodiments, the method comprises: (a) preparing a genetically modified microorganism by the method described herein; (b) culturing the genetically modified microorganism in a medium containing glucose or glycerol optionally alongwith an antibiotic; (c) inducing the expression of the gene(s); and (d) extracting and recovering indigo from the biomass.

[0259] In some embodiments, the expression of the gene(s) is induced by including an inducer in the culture medium.

[0260] In some embodiments, the inducer is selected from a group comprising Isopropyl β-D-1- thiogalactopyranoside (IPTG), a combination of half-strength glucose and half-strength lactose, or a combination thereof.

[0261] In some embodiments, the indigo is extracted using a solvent.

[0262] In some embodiments, the solvent is selected from a group comprising ethyl acetate, acetone, butanol, isoamyl alcohol, hexanol, octanol and DMSO or any combination thereof.

[0263] In some embodiments, the method of the present disclosure comprises the following steps: a. transforming a microorganism with the gene construct as described above, to prepare the genetically modified microorganism; b. culturing the genetically modified microorganism in a media comprising glucose or glycerol as a carbon source and an antibiotic; c. allowing the microorganism to grow overnight in a shaker incubator; d. inoculating a medium with the overnight grown culture and subjecting to further culturing starting with OD of about 0.2 till the OD reaches about 1.2 – 1.4; e. including an inducer into the culture medium and further incubating the culture till the final OD ranging from about 3.0-4.0 is reached; f. centrifuging the culture, discarding the supernatant, and collecting biomass containing cell pellet; g. solvent extracting indigo from the cell pellet by solvent selected from a group comprising ethyl acetate, acetone, butanol, isoamyl alcohol, hexanol, octanol and DMSO or any combination thereof; and h. drying the solvent comprising the extracted indigo by speed vac or spray dryer to obtain crude indigo.

[0264] In some embodiments, the microorganism is cultured overnight at about 25-40° C such as about 25-30° C., about 30-35° C., about 30-40° C., about 28 C., about 32° C., about 37° C., about 40° C., but it is not limited thereto.

[0265] In some embodiments, the cell culture grown overnight in the shaker incubator is centrifuged at about 200 rpm.

[0266] In some embodiments, the inducer is IPTG.

[0267] In some embodiments, the further incubation of the culture described in step e. above is carried out for a time period of about 24-48 hours.

[0268] In some embodiments, the centrifuging of the culture on step f. above is carried out at about 10,000 rpm for about 10 minutes at a temperature of about 4℃.

[0269] In some embodiments, the solvent employed for the solvent extraction of indigo is at a volume equivalent to the induced cell pellet, and where the solvent containing the pellet is subjected to vortexing and incubation at a temperature of about 30℃ to about 70℃ for about 30 to about 60 minutes.

[0270] In some embodiments, post the incubation of the cell pellet in the solvent, the solvent containing the pellet is centrifuged at about 10,000 rpm.

[0271] In some embodiments, the indigo is extracted into the solvent.

[0272] In some embodiments, the concentration of the carbon source glucose or glycerol in the culture medium ranges from about 10 to 40 g / L.

[0273] In some embodiments, the solvent extraction of the indigo is carried out by centrifugation at 10000 rpm for 30-70 minutes at 30-80°C.

[0274] While the present disclosure is susceptible to various modifications and alternative forms, specific aspects thereof have been shown by way of examples (and drawings) described in detail below. However, it should be understood that it is not intended to limit the disclosure to the particular forms disclosed, but on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and the scope of the disclosure as defined by the appended claims. The present disclosure is therefore further described with reference to the following examples, which are only illustrative in nature and should not be construed to limit the scope of the present disclosure in any manner.EXAMPLES Methods and Materials: Example (1)- Genetic Modification in Bacterial Strains

[0275] Escherichia coli, K12 origin strain was used as a source strain for genetic modification to prepare the modified base strain coded as FBB-BI-01 for deregulated chorismate pathway as shown in Figure- 2. The details of the gene expression is also provided as below in Table 1: Gene Details Modification Overexpress under highly controlled inducible Tryptophanase (TRP) moderate promoter Methylophaga Flavin-containing Overexpress under highly controlled inducible monooxygenase (MaFMO) moderate promoter DAHP synthase (aroFΔI11 Express under moderate constitutive promoter mutated) Anthranilate synthase (trpE S40F Overexpress under highly controlled inducible mutated) moderate promoter Pyruvate kinase II (pykA) Express under moderate constitutive promoter Trp repressor protein (trpR) Gene ORF knockout Transketolase (tktA) Express under moderate constitutive promoter Example (2) Preparation of gene construct:

[0276] The FMO gene from various sources, as listed in but not limited to Table 1, was cloned in the pET vector system under the T7 promoter. This was done according to the cloning procedures and construct designs delineated in Figure- 3, using the NdeI & EcoRI restriction endonuclease sites. Similarly, the TRP gene from E. coli source was amplified from genomic DNA by PCR and cloned between the NdeI & EcoRI restriction sites. The gene construct, TRP::FMO, was cloned between these sites with a linker sequence and an NcoI site between the TRP and FMO genes. Table 2- Details of genes involved in Indigo conversion and chorismate pathwayAmino Gene Details Nucleotides in bp acids Tryptophanase (TRP) 1416 471 Methylophaga Flavin-containing monooxygenase 1371 457 (MaFMO) N. lacisaponensis Flavin-containing monooxygenase 1365 454 (NiFMO) C. glutamicum Flavin-containing monooxygenase 1413 470 (CgFMO) Commamonas sp. MQ Naphthalene Dioxygenase 1923 640 (CoNDO) Pseudomonas putida Naphthalene Dioxygenase 1350 449 (PpNDO) Cupriavidus sp. SHE Indole oxygenase (CuIndOx) 1752 583 DAHP synthase (aroG wild type) 1053 350 DAHP synthase (aroH wild type) 1047 348 DAHP synthase (aroF wild type) 1071 356 DAHP synthase (aroFΔI11 mutated) 1068 355 Anthranilate synthase (trpE wild type) 1563 520 Anthranilate synthase (trpE S40F mutated) 1563 520 Pyruvate kinase II (pykA) 1443 480 Trp repressor protein (trpR) 327 108 Transketolase (tktA) 1995 664

[0277] Furthermore, the individual genes TRP and FMO genes along with the gene construct cloned between the said sites as TRP::FMO with a linker sequence with NcoI site between TRP and FMO genes were cloned in the low or moderate strength promoter vector system as per the cloning strategies and design of constructs mentioned in Figure- 4. Example (3) Preparation of vector and transformation:

[0278] The gene constructs obtained from the above were cloned with and without solubility tags to compare the expression levels and functionality of the fusion protein. Some exemplary vector maps are pFBB-Sol Tag TRP-Lnkr-FMO, pFBB-Sol Tag -FMO and pFBB-Sol Tag -TRP as shown in Figures 5, 6 & 7 respectively. The E. coli K12 modified strain coded as FBB-BI-01 was taken, and individual and gene constructs as given in example (2) were transformed with and without solubility tags to compare the expression levels and functionality of the fusion protein. Example (4)- Gene amplification of gene construct with and without solubility tag:

[0279] The clones were obtained through bacterial transformation by selecting kanamycin antibiotic at 50ug / mL or ampicillin at 100ug / mL. All the genes individually and with the combinations of tags were amplified and identified by running the PCR mix sample on 1.0% agarose gel. The obtained bands were then compared with the DNA marker for size reference, and the expected band sizes were indicated as shown in Figure 8. Example (5)- Expression of the gene construct in the vector system:

[0280] The FBB-BI-01 strain comprising an episomal LacZ machinery encoded as FBB-BI-01-LZ, was required to express the ORF of the gene by the addition of IPTG. IPTG is an unnatural inducer that mimics lactose in the natural system and triggers the Lac operon. This Lac operon ultimately triggers the production of T7 RNA polymerase, which translates the genes cloned downstream of the T7 promoter. Shake-flask cultures of induced and uninduced conditions were compared based on the color of the sample, and it was observed that the induced culture exhibited blue color formation.

[0281] The gene construct as shown in Figure 3 was expressed in the pET vector system in the host FBB-BI-01-LZ using IPTG as an inducer at concentrations ranging from 10uM to 1000uM. The fusion clone with a linker showed a protein band matching a size of 100 kDa in the induced sample. Nocorresponding band was observed in the uninduced sample. Further, the gene construct of Figure- 3 was expressed in the pET vector system in the host FBB-BI-01-LZ with additional in vivo co-expression of chaperones for the proper folding of the nascent peptide. The culture was induced by IPTG at concentrations ranging from 10uM to 1000uM.

[0282] With the other expression induction system, the gene constructs featuring individual genes as well as the fusion clone with a linker were also experimented. The FMO with a solubility tag showed a clear band in 10% SDS-PAGE, whereas the FMO without a solubility tag did not show any distinct band. A similar observation was depicted in the fusion clone with a solubility tag. However, the TRP gene with and without a tag showed no difference in the intensity of the band. In other words, TRP gene alone does not require tag for expression, whereas FMO alone or in combination with other genes require thioredoxin A tag for its expression. Example (6)- Characterization / selection of induced and uninduced clones:

[0283] All the E.coli clones obtained were patched onto LB agar plates containing appropriate concentrations of the antibiotic. The patches were then inoculated into Terrific broth with antibiotics and grown overnight in a shaker incubator at 37°C & 200 rpm. The overnight-grown inoculum was utilized to extend inoculation into 100mL of LB broth with antibiotics with the starting OD of 0.2 in a shaker incubator at 37O C temperature & 200 rpm. After reaching an OD of 1.2 – 1.4, 10-1000uM, IPTG was added aseptically and incubated for additional 24-48 hours. Once the final OD reaches up to in the range of 3.0-4.0, the sample was centrifuged at 10,000 rpm using a table-top centrifuge for 10 mins at 40°C. The supernatant was discarded, and the cell pellet biomass was collected and stored at - 20°C in the freezer until further use. The induced sample appeared as deep blue colored and uninduced as light greenish blue broth due to leaky expression.

[0284] All clones generated from FBB-BI-01-LZ and other induction systems with additional TRP and FMO overexpression, as described in Example- 5, were patched onto LB agar plates containing the appropriate antibiotic concentration. The patches were then inoculated into the Terrific broth with antibiotics and grew overnight in a shaker incubator at 37°C and 200 rpm. The overnight-grown inoculum was then utilized to inoculate 100mL of antibiotic-containing LB broth with a starting OD of 0.2 in a shaker incubator set to 37°C and 200 rpm. After reaching an OD of 1.2 - 1.4, 10-1000uM IPTGwas added aseptically and incubated for an additional 24-48 hours. Once the final OD reached 3.0-5.0, the sample was centrifuged at 10,000 rpm in a table-top centrifuge for 10 minutes at 4°C. The supernatant was discarded, and the cell pellet biomass was collected and stored at -20°C for further use.

[0285] Next, the FBB-BI-01 host with additional machinery compatible with other induction systems was transformed with TRP:linker:FMO constructs under various promoter systems, and patched onto LB agar plates containing appropriate conc. of antibiotic. The patches were further inoculated into terrific broth with antibiotics and grown overnight in a shaker incubator at 37℃ temperature & 200 rpm. The overnight grown inoculum was used to further inoculate into 100mL of LB broth with antibiotic with the starting OD of 0.2 in a shaker incubator at 37°C & 200 rpm. After reaching the OD of 1.2 – 1.4, an appropriate concentration of inducer was added aseptically and further incubated for another 24- 72 hours. Once the final OD reached the range of 7.0-12.0, the sample was centrifuged at 10,000 rpm using a table-top centrifuge for 10 mins at 4°C. The supernatant was discarded, and the cell pellet biomass was collected and stored at -20°C for further use.

[0286] As described in Example 5, the samples of selected induced and uninduced clones were collected and centrifuged to generate the cell pellets. The induced clone pellet appeared as deep blue colored whereas the uninduced clone pellets appeared as light blue colored. Afterward, 10mg of the wet cell pellet was taken and samples were prepared for SDS-PAGE analysis. The cell pellets were dissolved into 160ul of TBS buffer and 40ul of Laemmli buffer which contains an electrophoretic dye for denaturation of the proteins and at the same time monitoring the front of running gel. The dissolved pellets containing the Laemmli buffer were mixed well and incubated at 95°C for 10 mins with intermittent tapping of the samples. Now the 10% SDS-PAGE gels were prepared, and the samples were loaded to run in the gel electrophoresis chamber containing buffer for 60 minutes at 100 volts setting. The gels after electrophoretic separation were taken out and kept in CBB (Coomassie brilliant blue) staining dye which imparts a blue color to the protein bands. As shown in Figures- 9 and 10, the recombinant proteins were separated accurately and the same are identified by the protein marker with different reference sizes from the clones obtained from the methods explained in the current example. Example (7)- Culturing of the induced samples:

[0287] The induced sample of the engineered FBB-BI-01 strain, which is capable of producing significantly higher amounts of L-Tryptophan, was transformed with the gene construct as shown in Figure- 5 (e.g. with a solubility tag version). The result of this transformation was exhibited in the form of a light blue intensity color in the broth, while the induced samples of the clone with the tag displayed a high intensity of deep blue color in the broth. The uninduced samples displayed a light crème color, demonstrating tight regulation of the moderate promoter system. Additionally, the pellets of both induced and uninduced samples from the fusion clone with a tag are shown in Figures 11 and 12. Example (8)- Extraction of Indigo from the induced samples:

[0288] The induced cell pellets were subjected to bio-indigo extraction using various kinds of solvents, including ethyl acetate, acetone, butanol, isoamyl alcohol, hexanol, octanol, DMSO, and others. An equivalent volume of solvent was added to the induced cell pellet and resuspended by vortexing and incubating the extraction sample at temperature ranges of 30, 40, 50, 60, and 70°C and for 30- 60 minutes. The sample was centrifuged at 10,000 rpm. The process was repeated until the pellet sample appeared cream-colored. Figure 13 shows a colorless pellet after extraction by using ethyl acetate.

[0289] The bio-indigo was extracted using various solvents as shown in Figure 13, and then dried using a speed vacuum. The broth containing the induced cell mass was either dried using a speed vacuum or a spray dryer. The crude bio-indigo obtained from drying the cell biomass and dried solvent-extracted samples are shown in Figures 14 and 15, respectively. Example (9) Preparation of Genetically Modified E. coli for production of indigo:KO_trpE_aroF_Donor Plasmid:

[0290] pFB vector backbone was taken which contained RSF ori, origin of replication and Kanamycin antibiotic resistance marker.

[0291] The gene cassettes & DNA fragments were cloned in the order given in Table 3 below using the primer sequences indicated. All the fragments were cloned using the restriction endonuclease sites by traditional cloning method which involves amplification of sequence by PCR, restriction endonuclease digestion, ligation followed by transformation into E. coli DH5α cloning strain (Figure 16).TABLE 3 S.no Gene cassette / DNA Tag Primers used for cloning Sites used fragment for Promoter-terminator cloning 1 Trc promoter-Lac NA trcProm_AscI_Fwd AscI- operator-DAHP synthase 5’ TAATGGCGCGCCCGGTTCTGGCAAATATTC 3’ BamHI (Ec.aroFΔI11 mutated)- rrnBt_BamHI_Rev rrnB T1 terminator 5’ CGCAGGGATCCTGTAGAAACGCAAAAAGGC 3’ 2 Trc promoter-Lac NA trcProm_NotI_Fwd NotI-AsisI operator-Anthranilate 5’ synthase (Ec.trpE S40F AAATATGCGGCCGCGGTTCTGGCAAATATTCTG3’ mutated) - rrnB T2 rrnbt_AsiSI_Rev terminator 5’CTTAGGCGATCGCAAGAGTTTGTAGAAACGC3’ 3 NA trpR_RH_SacI_Fwd SacI- Trp repressor protein 5’GCTAGAGCTCGGAAACGAATATCAACATTGGC BamHI (trpR) right arm 3’ (upstream) fragment trpR_RH_BamHI_Rev 5’ TCGAGGATCCGCCATCGCTGCTGAATAGG 3’ 4 NA trpR_LH_AfeI_Fwd AfeI-SpeI Trp repressor protein 5’ TTGAAGCGCT GGGACTCGCGTGCGTATTG 3’ (trpR) left arm trpR_LH_SpeI_Rev (downstream) fragment 5’ ATTCACTAGTTCGGCTACTTTGCCGTTGC 3’ Generation of pFB-PykA KO-AntrpC-tktA-knockout fragment_Donor Plasmid: 5

[0292] pFB vector backbone was taken which contained p15A ori, origin of replication and Chlorampehnicol antibiotic resistance marker.

[0293] The gene cassettes & DNA fragments were cloned in the order given in Table 4 below using the primer sequences indicated. All the fragments were cloned using the restriction endonuclease sites by traditional cloning method which involves amplification of sequence by PCR, restriction endonuclease digestion, ligation followed by transformation into E. coli DH5α cloning strain (Figure 5 17).TABLE 4 S.no Gene cassette / DNA Tag Primers used for cloning Sites used fragment for cloning Promoter-terminator 1 NA trcProm_NotI_Fwd NotI-AsisI 5’ Trc promoter-Lac AAATATGCGGCCGCGGTTCTGGCAAATATTCTG operator-Transketolase 3’ I(Ec.tktA)-rrnB T1 rrnbt_AsiSI_Rev terminator 5’ CTTAGGCGATCGCAAGAGTTTGTAGAAACGC 3’ 2 Trc promoter-Lac NA trcProm_AscI_Fwd AscI- operator-Tryptophanase C 5’ TAATGGCGCGCCCGGTTCTGGCAAATATTC 3’ BamHI (An.TrpC) - rrnB T2 rrnbt_BamHI_Rev terminator 5’ CGCAGGGATCCAAGAGTTTGTAGAAACGC 3’ 3 NA PykA_RH_SacI_Fwd SacI- 5’TAGTGAGCTCCTGGAAGTTCAGGGCATGAAAG BamHI Pyruvate kinase A (PykA) 3’ right arm (upstream) PykA_RH_BamHI_Rev fragment 5’CATTGGATCCGCTACGTCCATGACTTCTGCAC 3’ 4 Pyruvate kinase A (PykA) NA PykA_LH_ BstZ17I_Fwd BstZ17I- left arm (downstream) 5’ CTGAGTATACCCGAGCATCAACGTTTCTAAAC SpeI fragment 3’PykA_LH_SpeI_Rev 5’CTACACTAGTTCAAGTTTGCTTCAGAATATTCG 3’ Generation of pFB-PykF KO-TRP-L-FMO_Donor Plasmid: 5

[0294] pFB vector backbone was taken which contained pBR322 ori, origin of replication and Ampicillin antibiotic resistance marker.

[0295] The gene cassettes & DNA fragments were cloned in the order given in Table 5 below using the primer sequences indicated. All the fragments were cloned using the restriction endonuclease sites 10 by traditional cloning method which involves amplification of sequence by PCR, restriction endonuclease digestion, ligation followed by transformation into E. coli DH5α cloning strain (Figure 18). TABLE 5 S.no Gene cassette / DNA Tag Primers used for cloning Sites fragment used for Promoter- cloning terminator 1 Tac promoter-Lac ThioredoxinA Thrx_NdeI_Fwd NdeI- operator-ThrxA- (thrxA) 5’ HindIII Tryptophanase GAGCCATATGGGATCTGATAAAATTATTCATCTG (Ec.Trp)-Linker- 3’ Flavin FMO_HindII_Rev Monooxygenase 5’ ATATAAGCTTTCACGCTTCCTTCGCCAC 3’ (Ma.FMO)-rrnB T1 terminatorNA pYKF_RH_PmeI_Fwd PmeI- Pyruvate kinase F 5’ TATAGTTTAAACACTCAACGACTCAAAAACAG ApaI (PykF) right arm 3’ (upstream) fragment pYKF_RH_ApaI_Rev 5’ TATAGGGCCCCGCTGTTGCCGATAACAG 3’ NA pYKF_LH_SwaI_Fwd SwaI- Pyruvate kinase F 5’ PmeI (PykF) left arm GCGATATTTAAATAAGTGCTGAACAACGGTGAC (downstream) 3’ fragment pYKF_LH_PmeI_Rev 5’ TCTAGTTTAAACCAGCATCACTGCGTCAG 3’ Genetic Modification in E.coli Strain

[0296] Escherichia coli, BL21 (DE3) origin strain was used as a source strain for genetic modification to prepare the modified base strain coded as FBB-BI-01 for deregulated chorismate pathway as shown in Figure- 2. Integration Event-1: Genomic integration of trpE & aroF expression cassette at TrpR target site.

[0297] pFB-TrpR KO_trpE_aroF_Donor Plasmid was used to amplify the knockout fragment. The 7.5ug of the amplified fragment was used to make RNP mix. RNP mix content:

[0298] The E.coli host was transformed by electroporation using RNP mix as per the standard protocol. RNP Complex Preparation: 1. Mix Cas9 protein and sgRNA in a 1:1.2 molar ratio (Cas9:sgRNA). For 1 μg Cas9 (6 pmol), 7.2 pmol of sgRNA was used. Knockout correction fragment 7.5ug was used along with the sgRNA. 2. Buffer compatible with electroporation was used. 20 mM HEPES (pH 7.5) 150 mM KCl 1 mM DTT10% glycerol 3. Incubate at 37°C for 15 minutes to allow RNP formation. Electroporation protocol: It is an ideal method RNP complex mixture transformation. Mix 20 μL of the RNP complex mixture with 80 μL of electrocompetent cells. Transfer to chilled 2 mm gap electroporation cuvette. Apply pulse by setting up electroporator: 2.5 kV, 5 ms, 200 Ω, 25 μF). Immediately add 950 μL of SOC or LB medium. Recover at 37°C for 2 hours. Spread the recovered cells onto LB agar containing kanamycin antibiotic for selection. The colonies obtained were screened for On-target integration by PCR and a combination of primers from the intergenic & knockout fragment region. The on-target integrant confirmed clone was selected for the next round of knockin- knockout integration event. Integration Event-2: Genomic integration of AntrpC & tktA expression cassette at PykA target site. pFB-PykA KO-AntrpC-tktA_Donor Plasmid was used to amplify the knockout fragment. The 7.5ug of the amplified fragment was used to make RNP mix. RNP mix content: The E.coli host was transformed by electroporation using RNP mix as per the standard protocol. RNP Complex Preparation: 1. Mix Cas9 protein and sgRNA in a 1:1.2 molar ratio (Cas9:sgRNA). For 1 μg Cas9 (6 pmol), 7.2 pmol of sgRNA was used. Knockout correction fragment 7.5ug was used along with the sgRNA. 2. Buffer compatible with electroporation was used. 20 mM HEPES (pH 7.5) 150 mM KCl 1 mM DTT10% glycerol 3. Incubate at 37°C for 15 minutes to allow RNP formation. Electroporation protocol: It is an ideal method RNP complex mixture transformation. Mix 20 μL of the RNP complex mixture with 80 μL of electrocompetent cells. Transfer to chilled 2 mm gap electroporation cuvette. Apply pulse by setting up electroporator: 2.5 kV, 5 ms, 200 Ω, 25 μF). Immediately add 950 μL of SOC or LB medium. Recover at 37°C for 2 hours. Spread the recovered cells onto LB agar containing chloramphenicol antibiotic for selection. The colonies obtained were screened for On-target integration by PCR using a combination of primers from the intergenic & knockout fragment region. The on-target integrant confirmed clone was selected for the next round of knockin- knockout integration event. Integration Event-3: Genomic integration of TRP-L-FMO expression cassette at PykF target site. pFB-PykF KO-TRP-L-FMO_Donor Plasmid was used to amplify the knockout fragment. The 7.5ug of the amplified fragment was used to make RNP mix. RNP mix content: The E.coli host was transformed by electroporation using RNP mix as per the standard protocol. RNP Complex Preparation: 1. Mix Cas9 protein and sgRNA in a 1:1.2 molar ratio (Cas9:sgRNA). For 1 μg Cas9 (6 pmol), 7.2 pmol of sgRNA was used. Knockout correction fragment 7.5ug was used along with the sgRNA. 2. Buffer compatible with electroporation was used. 20 mM HEPES (pH 7.5) 150 mM KCl 1 mM DTT 10% glycerol 3. Incubate at 37°C for 15 minutes to allow RNP formation. Electroporation protocol: It is an ideal method RNP complex mixture transformation.Mix 20 μL of the RNP complex mixture with 80 μL of electrocompetent cells. Transfer to chilled 2 mm gap electroporation cuvette. Apply pulse by setting up electroporator: 2.5 kV, 5 ms, 200 Ω, 25 μF). Immediately add 950 μL of SOC or LB medium. Recover at 37°C for 2 hours. Spread the recovered cells onto LB agar containing ampicillin antibiotic for selection. The colonies obtained were screened for On-target integration by PCR using a combination of primers from the intergenic & knockout fragment region. The on-target integrant confirmed clone was selected for expression study at shakeflask and lab scale fermentor level. Given below in Table 6 are the Intergenic DNA primer sequences used for confirmation of on-target integration: Table 6 TrpR_gDNA_Fwd 5’ CAAAAGTGAAATCACCGGTAG 3’ TrpR_gDNA_Rev 5’ AATGCCCGCCGTTTACTTC 3’ pykA_gDNA_Fwd 5’ CGACAAAGAAAAAGTCGG 3’ pykA_gDNA_Rev 5’ GCTGAAAACTCGCAAACC 3’ pykF_gDNA_Fwd 5’ CCCTGGAACGTTAAATCTTTG 3’ pykF_gDNA_Rev 5’ CAGTTTACGGTTGTCATTG 3’ The details of the expression of the genes used in this example is provided as below in Table 7 below: TABLE 7 Gene Details Modification Overexpress under highly controlled inducible E. coli native Tryptophanase (TRP) moderate promoter Methylophaga Flavin-containing Overexpress under highly controlled inducible monooxygenase (MaFMO) moderate promoter Mutation introduced to make it feedback resistant – DAHP synthase (aroFΔI11 fbr mutated) Express under moderate constitutive promoterMutation introduced to make it feedback resistant – Anthranilate synthase (trpE S40F fbr mutated) Overexpress under highly controlled inducible moderate promoter TrpC Aspergillus niger Express under moderate constitutive promoter Transketolase (tktA) Express under moderate constitutive promoter Pyruvate kinase II (pykA) Gene ORF knockout (disruption) Trp repressor protein (trpR) Gene ORF knockout (disruption) Table 8- Details of genes involved in Indigo conversion and chorismate pathway Amino Gene Details Nucleotides in bp acids Tryptophanase (TRP) 1416 471 Methylophaga sps. Flavin-containing monooxygenase 1371 457 (MaFMO) DAHP synthase (aroF wild type) 1071 356 DAHP synthase (aroFΔI11 mutated) 1068 355 Anthranilate synthase (trpE wild type) 1563 520 Anthranilate synthase (trpE S40F mutated) 1563 520 Transketolase I (tktA) 1995 664 Pyruvate kinase A (pykA) (for knockout) 1443 480 Trp repressor protein (trpR) (for knockout) 327 108 Pyruvate kinase F (pykF) (for knockout) 1413 470 The clones obtained were tested for tryptophan conversion and indole production and the results are provided in Table 9 below:TABLE 9 Tryptophan S.no Clone code Trp (ug / ml) Indole (ug / ml) conversion Flask Induction P S P S % ConversionAroF+TrpE 1 F18 2.79 860.1 14.2 6.2 (AT) 15.00 AroF+TrpE & YES 2 F19 5.80 1253.5 95.2 12.1 TrpC (ATTc) IPTG 21.85 AroF+TrpE & 100uM 3 TrpC+tktA F20 0.53 1340.9 310.2 1.2 (ATTcTk) 23.37 P – Pellet S - Supernatant ND – Not detectable 2ml worth Pellet: extract with DMSO Table 10 AT AroF+TrpE overexpression; TrpR KO ATTc AroF+TrpE & TrpC overexpression; TrpR & PykA KO AroF+TrpE & TrpC+TktA overexpression; TrpR & PykA ATTcTk KO

[0299] Additionally, the genetically modified cell was found to produce indole as per the HPLC data shown in Figure 19. Indole being water insoluble was majorly accumulated in the pellet and tryptophan being water soluble was found in the supernatant. NUMBERED EMBODIMENTS OF THE DISCLOSURE 1. A gene construct comprising at least one gene coding for an enzyme involved in: a) converting tryptophan into indole; b) converting indole into indoxyl; c) production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; ord) any combination of enzymes involved in i. to iii. The gene construct of embodiment 1, wherein the enzyme that converts tryptophan into indole is tryptophanase encoded by a TRP gene. The gene construct of any one of embodiments 1-2, wherein the enzyme that converts indole into indoxyl is selected from a group comprising flavin-containing monooxygenase encoded by a FMO gene or naphthalene dioxygenase encoded by a NDO gene. The gene construct of any one of embodiments 1-3, wherein the flavin-containing monooxygenase is selected from a group comprising Methylophaga flavin-containing monooxygenase encoded by MaFMO gene, N. lacisaponensis flavin-containing monooxygenase encoded by NiFMO gene, and C. glutamicum flavin-containing monooxygenase encoded by CgFMO gene. The gene construct of any one of embodiments 1-3, wherein the naphthalene dioxygenase is selected from a group comprising Commamonas sp. MQ naphthalene dioxygenase encoded by CoNDO gene, Pseudomonas putida naphthalene dioxygenase encoded by PpNDO gene, and Cupriavidus sp. SHE indole oxygenase encoded by CuIndOx gene. The gene construct of any one of embodiments 1-5, wherein the enzyme involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate is selected from one or more of: a) enzyme converting phosphoenolpyruvate and erythrose 4-phosphate into 3-deoxy-D- arabino-heptulosonate 7-phosphate (DAHP); b) enzyme converting DAHP into 3-dehydroquinate; c) enzyme converting 3-dehydroquinate into 3-dehydroshikimate; d) enzyme converting 3-dehydroshikimate into shikimate; e) enzyme converting shikimate into shikimate-3-phosphate; f) enzyme converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate; g) enzyme converting 5-enolpyrubylshikimate-3-phosphate into chorismate; and h) enzyme converting chorismate into anthranilate. The gene construct of any one of embodiments 1-6, wherein the enzyme that converts phosphoenolpyruvate or erythrose 4-phosphate into 3-deoxy-D-arabino-heptulosonate 7- phosphate (DAHP) is DAHP synthase encoded by aroG, aroH or aroF gene.8. The gene construct of any one of embodiments 1-7, wherein the enzyme that converts DAHP into 3-dehydroquinate is DAHP synthase encoded by aroB gene. 9. The gene construct of any one of embodiments 1-8, wherein the enzyme that converts 3- dehydroquinate into 3-dehydroshikimate is DAHP synthase encoded by aroD gene. 10. The gene construct of any one of embodiments 1-9, wherein the enzyme that converts 3- dehydroshikimate into shikimate is DAHP synthase encoded by aroE gene. 11. The gene construct of any one of embodiments 1-10, wherein the enzyme that converts shikimate into shikimate-3-phosphate is DAHP synthase encoded by aroK and aroL genes. 12. The gene construct of any one of embodiments 1-11, wherein the enzyme that converts shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate is DAHP synthase encoded by aroA gene. 13. The gene construct of any one of embodiments 1-12, wherein the enzyme that converts 5- enolpyrubylshikimate-3-phosphate into chorismate is DAHP synthase encoded by aroC gene. 14. The gene construct of any one of embodiments 1-13, wherein the enzyme that converts chorismate into anthranilate is anthranilate synthase encoded by trpE, trpG or trpD gene. 15. The gene construct of any one of embodiments 1-14, further comprising at least one gene coding for an enzyme transketolase encoded by tktA gene, involved in production of the erythrose 4- phosphate. 16. The gene construct of any one of embodiments 1-15, wherein the gene is operably linked to a T7 promoter. 17. The gene construct of any one of embodiments 1-16, wherein the T7 promoter is operably linked to a solubility tag. 18. The gene construct of any one of embodiments 1-17, wherein the gene is operably linked to a moderate promoter. 19. The gene construct of any one of embodiments 1-18, wherein the moderate promoter is operably linked to a solubility tag. 20. The gene construct of any one of embodiments 1-19, wherein the gene is cloned between NdeI & EcoRI restriction endonuclease sites. 21. The gene construct of any one of embodiments 1-20, wherein the gene is cloned between NdeI & EcoRI restriction endonuclease sites along with a linker sequence.22. The gene construct of any one of embodiments 1-21, wherein the gene is cloned between NdeI & EcoRI restriction endonuclease sites along with a linker sequence and NcoI site. 23. The gene construct of any one of embodiments 1-22, wherein the construct further comprises at least one gene coding for a chaperone. 24. The gene construct of embodiment 23, wherein the gene coding for a chaperone is selected from a group comprising foldases, PDI, and chaperonins. 25. The gene construct of any one of embodiments 1-24, wherein the construct further comprises at least one gene coding for a signal peptide. 26. The gene construct of embodiment 25, wherein the signal peptide is selected from a group comprising PelB signal sequence, maltose binding protein signal sequence, 6X-his signal sequence, GST signal sequence, and thioredoxin tag sequence. 27. The gene construct of any one of embodiments 1-26, comprising TRP gene coding for tryptophanase and, FMO gene coding for flavin-containing monooxygenase or NDO gene naphthalene dioxygenase. 28. The gene construct of any one of embodiments 1-27, comprising at least one gene selected from a group comprising aroF, aroG and aroH; along with trpE gene with or without trpR gene; and tktA gene. 29. A biologically functional plasmid or expression vector comprising the gene construct as recited in any one of embodiments 1-28. 30. The biologically functional plasmid of embodiment 29, wherein the plasmid is selected from a group comprising pFBB-Sol Tag TRP-Lnkr-FMO, pFBB-Sol Tag -FMO, pFBB- -FMO or any pFBB series vectors. 31. A genetically modified microorganism comprising the biologically functional plasmid or expression vector of embodiments 29-30 having the gene construct of any of embodiments 1-30, comprising at least one gene coding for an enzyme involved in: a) converting tryptophan into indole; b) converting indole into indoxyl; c) production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; or d) any combination of enzymes involved in i. to iii. 32. The genetically modified microorganism of embodiment 31, wherein the enzyme that converts tryptophan into indole is tryptophanase encoded by a TRP gene.The genetically modified microorganism of any one of embodiments 31-32, wherein the enzyme that converts indole into indoxyl is selected from a group comprising flavin-containing monooxygenase encoded by a FMO gene or naphthalene dioxygenase encoded by a NDO gene. The genetically modified microorganism of any one of embodiments 31-33, wherein the flavin- containing monooxygenase is selected from a group comprising Methylophaga flavin-containing monooxygenase encoded by MaFMO gene, N. lacisaponensis flavin-containing monooxygenase encoded by NiFMO gene, and C. glutamicum flavin-containing monooxygenase encoded by CgFMO gene. The genetically modified microorganism of any one of embodiments 31-34, wherein the naphthalene dioxygenase is selected from a group comprising Commamonas sp. MQ naphthalene dioxygenase encoded by CoNDO gene, Pseudomonas putida naphthalene dioxygenase encoded by PpNDO gene, and Cupriavidus sp. SHE indole oxygenase encoded by CuIndOx gene. The genetically modified microorganism of any one of embodiments 31-35, wherein the enzyme involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate is selected from one or more of: a) enzyme converting phosphoenolpyruvate and erythrose 4-phosphate into 3-deoxy-D- arabino-heptulosonate 7-phosphate (DAHP); b) enzyme converting DAHP into 3-dehydroquinate; c) enzyme converting 3-dehydroquinate into 3-dehydroshikimate; d) enzyme converting 3-dehydroshikimate into shikimate; e) enzyme converting shikimate into shikimate-3-phosphate; f) enzyme converting shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate; g) enzyme converting 5-enolpyrubylshikimate-3-phosphate into chorismate; and h) enzyme converting chorismate into anthranilate. The genetically modified microorganism of any one of embodiments 31-36, wherein the enzyme that converts phosphoenolpyruvate or erythrose 4-phosphate into 3-deoxy-D-arabino- heptulosonate 7-phosphate (DAHP) is DAHP synthase encoded by aroG, aroH or aroF gene. The genetically modified microorganism of any one of embodiments 31-37, wherein the enzyme that converts DAHP into 3-dehydroquinate is DAHP synthase encoded by aroB gene.39. The genetically modified microorganism of any one of embodiments 31-38, wherein the enzyme that converts 3-dehydroquinate into 3-dehydroshikimate is DAHP synthase encoded by aroD gene. 40. The genetically modified microorganism of any one of embodiments 31-39, wherein the enzyme that converts 3-dehydroshikimate into shikimate is DAHP synthase encoded by aroE gene. 41. The genetically modified microorganism of any one of embodiments 31-40, wherein the enzyme that converts shikimate into shikimate-3-phosphate is DAHP synthase encoded by aroK and aroL genes. 42. The genetically modified microorganism of any one of embodiments 31-41, wherein the enzyme that converts shikimate-3-phosphate into 5-enolpyruvylshikimate-3-phosphate is DAHP synthase encoded by aroA gene. 43. The genetically modified microorganism of any one of embodiments 31-42, wherein the enzyme that converts 5-enolpyrubylshikimate-3-phosphate into chorismate is DAHP synthase encoded by aroC gene. 44. The genetically modified microorganism of any one of embodiments 31-43, wherein the enzyme that converts chorismate into anthranilate is anthranilate synthase encoded by trpE, trpG or trpD gene. 45. The genetically modified microorganism of any one of embodiments 31-44, further comprising at least one gene coding for an enzyme transketolase encoded by tktA gene, involved in production of the erythrose 4-phosphate. 46. The genetically modified microorganism of any one of embodiments 31-45 comprising: at least one gene selected from aroF, aroG and aroH for overexpression of DAHP synthase; at least one gene selected from trpE, trpG and trpD for overexpression of anthranilate synthase; at least one gene selected from aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; tktA to boost erythrose 4-phosphate; and at least one gene knock-out selected from pykA and pykF to stop conversion of phospho-enol- pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. 47. The genetically modified microorganism of any one of embodiments 31-46 comprising: aroF for overexpression of DAHP synthase;trpE for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate; tktA to boost erythrose 4-phosphate; and at least one gene knock-out selected from pykA and pykF to stop conversion of Phospho-enol- pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. The genetically modified microorganism of any one of embodiments 31-47 comprising: aroF for overexpression of DAHP synthase, trpG for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate; tktA to boost erythrose 4-phosphate; and at least one gene knock-out selected from pykA and pykF stop conversion of Phospho-enol- pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. The genetically modified microorganism of any one of embodiments 31-48 comprising: aroF for overexpression of DAHP synthase; trpD for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate; tktA to boost erythrose 4-phosphate ; and at least one gene knock-out selected from pykA and pykF to stop conversion of Phospho-enol- pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. The genetically modified microorganism of any one of embodiments 31-49 comprising: aroG for overexpression of DAHP synthase; trpE for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate;tktA to boost erythrose 4-phosphate ; at least one gene knock-out from pykA and pykF to stop conversion of Phospho-enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. The genetically modified microorganism of any one of embodiments 31-50 comprising: aroG for overexpression of DAHP synthase; trpG for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate; tktA to boost erythrose 4-phosphate ; at least one gene knock-out selected from pykA and pykF to stop conversion of Phospho-enol- pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. The genetically modified microorganism of any one of embodiments 31-51 comprising: aroG for overexpression of DAHP synthase ; trpD for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate; tktA to boost erythrose 4-phosphate ; at least one gene knock-out from pykA and pykF to stop conversion of Phospho-enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. The genetically modified microorganism of any one of embodiments 31-52 comprising: aroH for overexpression of DAHP synthase ; trpE for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate; tktA to boost erythrose 4-phosphate ; and at least one gene knock-out from pykA and pykFto stop conversion of Phospho-enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. The genetically modified microorganism of any one of embodiments 31-53 comprising:aroH for overexpression of DAHP synthase, trpG for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate; tktA to boost erythrose 4-phosphate ; at least one gene knock-out from pykA and pykF to stop conversion of Phospho-enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. 55. The genetically modified microorganism of any one of embodiments 31-54comprising: aroH for overexpression of DAHP synthase ; trpD for overexpression of anthranilate synthase; aroB, aroD, aroE, aroK, aroL, aroA, aroC, and combinations thereof for overexpression of the enzymes involved in the production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate; tktA to boost erythrose 4-phosphate; and at least one gene knock-out from pykA and pykF to stop conversion of Phospho-enol-pyruvate (PEP) to pyruvate and channelizing the metabolic flux towards DAHP. 56. The genetically modified microorganism of any one of embodiments 31-55 comprising the gene construct of embodiment 1, wherein the gene construct comprises: an exogenous nucleic acid sequence encoding tryptophanase (TRP), an exogenous nucleic acid sequence encoding flavin-containing monooxygenase (FMO), and at least one solubility tag. 57. The genetically modified microorganism of any one of embodiments 31-56, wherein the gene is operably linked to a T7 promoter. 58. The genetically modified microorganism of embodiment 57, wherein the T7 promoter is operably linked to a solubility tag. 59. The genetically modified microorganism of any one of embodiments 31-58, wherein the gene is operably linked to a moderate promoter. 60. The genetically modified microorganism of embodiment 59, wherein the moderate promoter is operably linked to a solubility tag.61. The genetically modified microorganism of any one of embodiments 31-61, wherein the microorganism is Escherichia coli or any Enterobacter species 62. The genetically modified microorganism of embodiment 61, wherein strain of the E. coli is FBB- BI-01. 63. A method for production of indigo in a host microorganism, the method comprising cultivating the genetically modified microorganism of any one of embodiments 31-62 under conditions facilitating conversion of tryptophan into indole, or indole into indoxyl, or enhanced production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate; or any combination thereof. 64. The method of embodiment 63, wherein the production of indigo by the said microorganism is enhanced when compared to the wild -type microorganism. 65. The method of any one of embodiments 63-64, wherein the host microorganism comprises genes of embodiments 1-21 required for the production of indigo. 66. The method of any one of embodiments 63-65, wherein the host microorganism is Escherichia coli or any Enterobacter species 67. The method of any one of embodiments 63-66, comprising the following steps: (a) transforming a microorganism with the gene construct of any one of embodiments 1 to 30 to prepare the genetically modified microorganism of any one of embodiments 31 to 62; (b) culturing the genetically modified microorganism in a media comprising glucose or glycerol as carbon source and an antibiotic; (c) allowing the microorganism to grow overnight in a shaker incubator; (d) inoculating a medium with the overnight grown culture and subjecting to further culturing starting with OD of about 0.2 till the OD reaches about 1.2 – 1.4; (e) including an inducer into the culture medium and further incubating the culture till the final OD ranging from about 3.0-4.0 is reached; (f) centrifuging the culture, discarding the supernatant, and collecting biomass containing cell pellet; (g) solvent extracting indigo from the cell pellet by solvent selected from a group comprising ethyl acetate, acetone, butanol, isoamyl alcohol, hexanol, octanol and DMSO or any combination thereof; and(h) drying the solvent comprising the extracted indigo by speed vac or spray dryer to obtain crude indigo. 68. The method of any one of embodiments 63-67, wherein in the medium, concentration of the carbon source glucose or glycerol is ranging from about 10 to 40g / L.

[0300] The method of any one of embodiments 63-68, wherein the solvent extraction of the indigo is carried out by centrifugation at 10000 rpm for 30-70 minutes at 30-80°C. Additional embodiments and features of the present disclosure will be apparent to one of ordinary skill in art based on the description provided herein. The embodiments herein provide various features and advantageous details thereof in the description. Descriptions of well-known / conventional methods and techniques are omitted so as to not unnecessarily obscure the embodiments herein.

[0301] The foregoing description of the specific embodiments fully reveals the general nature of the embodiments herein that others can, by applying current knowledge, readily modify and / or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments in this disclosure have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments herein can be practiced with modification within the spirit and scope of the embodiments as described herein.

[0302] Thus, while considerable emphasis has been placed herein on the particular features of this disclosure, it will be appreciated that various modifications can be made, and that many changes can be made in the preferred embodiments without departing from the principles of the disclosure. These and other modifications in the nature of the disclosure or the preferred embodiments will be apparent to those skilled in the art from the disclosure herein, whereby it is to be distinctly understood that the foregoing descriptive matter is to be interpreted merely as illustrative of the disclosure and not as a limitation.

[0303] Throughout this specification, the word “comprise”, or variations such as “comprises” or “comprising” wherever used, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. Similarly, terms such as “include” or “have” or “contain” and all their variations are inclusive and will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0304] The terms "about" or “approximately” are used herein to mean approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical value / range, it modifies that value / range by extending the boundaries above and below the numerical value(s) set forth. In general, the term "about" is used herein to modify a numerical value(s) or a measurable value(s) such as a parameter, an amount, a temporal duration, and the like, above and below the stated value(s) by a variance of + / -20% or less, + / -10% or less, + / -5% or less, + / -1% or less, and + / -0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention, and achieves the desired results and / or advantages as disclosed in the present disclosure. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.

[0305] With respect to the use of substantially any plural and / or singular terms herein, those having skill in the art can translate from the plural to the singular and / or from the singular to the plural as is appropriate to the context and / or application. The various singular / plural permutations may be expressly set forth herein for sake of clarity. As used in this specification and the appended claims, the singular forms “a,” “an” and “the” includes both singular and plural references unless the content clearly dictates otherwise. The use of the expression ‘at least’ or ‘at least one’ suggests the use of one or more elements or ingredients or quantities, as the use may be in the embodiment of the disclosure to achieve one or more of the desired objects or results. As such, the terms “a” (or “an”), “one or more”, and “at least one” can be used interchangeably herein.

[0306] Numerical ranges stated in the form ‘from x to y’ include the values mentioned and those values that lie within the range of the respective measurement accuracy as known to the skilled person. Ifseveral preferred numerical ranges are stated in this form, of course, all the ranges formed by a combination of the different end points are also included.

[0307] As regards the embodiments characterized in this specification, it is intended that each embodiment be read independently as well as in combination with another embodiment. For example, in case of an embodiment 1 reciting 3 alternatives A, B and C, an embodiment 2 reciting 3 alternatives D, E and F and an embodiment 3 reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise.

[0308] Any discussion of documents, acts, materials, devices, articles and the like that has been included in this specification is solely for the purpose of providing a context for the disclosure. It is not to be taken as an admission that any or all of these matters form a part of the prior art base or were common general knowledge in the field relevant to the disclosure as it existed anywhere before the priority date of this application.

[0309] All references, articles, publications, general disclosures etc. cited herein are incorporated by reference in their entireties for all purposes. However, mention of any reference, article, publication etc. cited herein is not, and should not be taken as, an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.

Claims

WE CLAIM 1. A genetically modified microorganism comprising heterologous genes integrated into genome of the microorganism, said genes configured for: a) converting tryptophan into indole; b) converting indole into indoxyl; and c) production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate.

2. The genetically modified microorganism as claimed in claim 1, wherein the gene for converting tryptophan into indole is TRP gene which encodes tryptophanase.

3. The genetically modified microorganism as claimed in claim 1, wherein the gene for converting indole into indoxyl is selected from FMO gene, NDO gene, and a combination thereof; wherein the FMO gene encodes enzyme flavin-containing monooxygenase and the NDO gene encodes enzyme naphthalene dioxygenase.

4. The genetically modified microorganism as claimed in claim 1, wherein the gene for the production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate is a wild-type or mutated gene selected from at least one of: a) gene selected from a group comprising aroG, aroH and aroF, or any combination thereof, which encodes DAHP synthase for converting phosphoenolpyruvate and erythrose 4- phosphate into 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP); b) aroB gene which encodes DAHP synthase for converting DAHP into 3-dehydroquinate; c) aroD gene which encodes DAHP synthase for converting 3-dehydroquinate into 3- dehydroshikimate; d) aroE gene which encodes DAHP synthase for converting 3-dehydroshikimate into shikimate; e) gene selected from a group comprising aroK gene, aroL gene, or a combination thereof, which encode DAHP synthase for converting shikimate into shikimate-3-phosphate; f) aroA gene which encodes DAHP synthase for converting shikimate-3-phosphate into 5- enolpyruvylshikimate-3-phosphate; g) aroC gene which encodes DAHP synthase for converting 5-enolpyrubylshikimate-3- phosphate into chorismate; and h) gene selected from a group comprising trpE, trpG and trpD, or any combination thereof, which encodes anthranilate synthase for converting chorismate into anthranilate;i) gene selected from a group comprising trpG and trpD or a combination thereof, which encodes anthranilate phosphoribosyltransferase for converting anthranilate into phosphoribosyl anthranilate; j) gene selected from a group comprising trpC and trp F or a combination thereof, which encodes N-(5'-phosphoribosyl)anthranilate isomerase for converting phosphoribosyl anthranilate into 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate; and k) gene selected from a group comprising trpC and trp F or a combination thereof, which encodes phosphoribosylanthranilate isomerase and anthranilate phosphoribosyltransferase respectively, for converting 1-(o-carboxyphenylamino)-1- deoxyribulose-5-phosphate into tryptophan; or any combination of the genes of (a) to (k).

5. The genetically modified microorganism as claimed in any one of claims 1-4, wherein the microorganism further comprises tktA gene which encodes enzyme transketolase for production of the erythrose 4-phosphate.

6. The genetically modified microorganism as claimed in any one of the claims 1-5, wherein the gene(s) is operably linked to a promoter selected from a group comprising T7 promoter, Tac promoter and Trc promoter.

7. The genetically modified microorganism as claimed in any one of the claims 1-6, wherein the TRP gene and the FMO / NDO gene are operably linked to a T7 promoter or Tac promoter to form a fusion gene.

8. The genetically modified microorganism as claimed in any one of the claims 1-7, wherein the TRP gene and the FMO / NDO gene are connected by a linker sequence; the linker sequence comprises single or multiple repeats of peptide sequence SGSAAG.

9. The genetically modified microorganism as claimed in any one of claims 1-8, wherein the gene(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate are operably linked to Trc promoter.

10. The genetically modified microorganism as claimed in claim 8, wherein the TRP and the FMO / NDO fusion gene(s) is operably linked to a solubility tag or signal peptide selected from a group comprising PelB signal sequence, maltose binding protein signal sequence, 6X-his signal sequence, GST signal sequence, and thioredoxin tag sequence.

11. The genetically modified microorganism as claimed in any one of claims 1-10, wherein an expression cassette comprising the TRP and FMO / NDO fusion gene is integrated at pykF target site of the microorganism genome.

12. The genetically modified microorganism as claimed in any one of claims 1-11, wherein the microorganism expresses TRP and FMO / NDO as a fusion protein.

13. The genetically modified microorganism as claimed in any one of claims 1-12, wherein the gene(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate are integrated as expression cassette at target sites trpR and pykA of the microorganism’s genome.

14. The genetically modified microorganism as claimed in claim 13, wherein the expression cassette comprising trpE and aroF genes are integrated at target site trpR of the microorganism’s genome; and wherein the expression cassette comprising trpC and tktA genes are integrated at target site pykA of the microorganism’s genome.

15. The genetically modified microorganism as claimed in any one of claims 1-14, wherein the microorganism comprises knockout or downregulation of a gene selected from a group comprising tryptophan operon regulator, tyrosine aminotransferase, aspartate aminotransferase, tryptophan repressor protein (trpR), pykA, and pykF, or any combination thereof.

16. The genetically modified microorganism as claimed in claim 15, wherein the microorganism comprises knockout or downregulation of genes trpR, pykA, and pykF.

17. The genetically modified microorganism as claimed in any one of the claims 1-16, wherein the microorganism is Escherichia coli or any Enterobacter species.

18. The genetically modified microorganism as claimed in any one of the claims 17, wherein strain of the E. coli is BL21 (DE3) or DH5α.

19. A method for preparing the genetically modified microorganism as claimed in any one of the claims 1-18, comprising: a) obtaining gene constructs comprising genes for:

1. converting tryptophan into indole; 2. converting indole into indoxyl; and 3. production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate. b) cloning the gene constructs into plasmids or expression vectors; c) introducing the plasmids into the cell of native microorganism; andd) integrating the expression cassette of said genes into the genome of the native microorganism.

20. The method as claimed in claim 19, wherein genes for converting tryptophan into indole and indole into indoxyl are present in a single gene construct.

21. The method as claimed in claim 19 or 20, wherein the genes for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate are present in two gene constructs.

22. The method as claimed in claim 19, wherein the gene for converting tryptophan into indole is TRP gene which encodes enzyme tryptophanase.

23. The method as claimed in claim 19, wherein the gene for converting indole into indoxyl is FMO gene which encodes enzyme flavin-containing monooxygenase and / or NDO gene which encodes enzyme naphthalene dioxygenase.

24. The method as claimed in claim 19, wherein the gene for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate is a wild-type or mutated gene selected from at least one of: a) gene selected from a group comprising aroG, aroH and aroF, or any combination thereof, which encodes DAHP synthase for converting phosphoenolpyruvate and erythrose 4- phosphate into 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP); b) aroB gene which encodes DAHP synthase for converting DAHP into 3-dehydroquinate; c) aroD gene which encodes DAHP synthase for converting 3-dehydroquinate into 3- dehydroshikimate; d) aroE gene which encodes DAHP synthase for converting 3-dehydroshikimate into shikimate; e) gene selected from a group comprising aroK gene, aroL gene, or a combination thereof, which encode DAHP synthase for converting shikimate into shikimate-3-phosphate; f) aroA gene which encodes DAHP synthase for converting shikimate-3-phosphate into 5- enolpyruvylshikimate-3-phosphate; g) aroC gene which encodes DAHP synthase for converting 5-enolpyrubylshikimate-3- phosphate into chorismate; and h) gene selected from a group comprising trpE, trpG and trpD, or any combination thereof, which encodes anthranilate synthase for converting chorismate into anthranilate;i) gene selected from a group comprising trpG and trpD or a combination thereof, which encodes anthranilate phosphoribosyltransferase for converting anthranilate into phosphoribosyl anthranilate; j) gene selected from a group comprising trpC and trp F or a combination thereof, which encodes N-(5'-phosphoribosyl)anthranilate isomerase for converting phosphoribosyl anthranilate into 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate; and k) gene selected from a group comprising trpC and trp F or a combination thereof, which encode phosphoribosylanthranilate isomerase and anthranilate phosphoribosyltransferase respectively, for converting 1-(o-carboxyphenylamino)-1- deoxyribulose-5-phosphate into tryptophan; or any combination of the genes involved in (a) to (k).

25. The method as claimed in claim 19, wherein the gene construct(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate further comprises tktA gene which encodes enzyme transketolase for production of the erythrose 4-phosphate.

26. The method as claimed in claim 19, wherein the gene construct(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate comprises knockout or downregulation of a gene selected from a group comprising tryptophan operon regulator, tyrosine aminotransferase, aspartate aminotransferase, tryptophan repressor protein (trpR), pykA, and pykF, or any combination thereof.

27. The method as claimed in claim 19, wherein the gene(s) is operably linked to a promoter selected from a group comprising T7 promoter, Tac promoter and Trc promoter.

28. The method as claimed in any one of the claims 19-27, wherein the TRP gene and the FMO / NDO gene are operably linked to a single T7 promoter or Tac promoter to form a fusion gene.

29. The method as claimed in claim 19, wherein the gene(s) for production of tryptophan from phosphoenolpyruvate and erythrose 4-phosphate are operably linked to Trc promoter.

30. The method as claimed in claim 29, wherein the TRP-FMO fusion gene(s) is operably linked to a solubility tag / signal peptide selected from a group comprising PelB signal sequence, maltose binding protein signal sequence, 6X-his signal sequence, GST signal sequence, and thioredoxin tag sequence.

31. The method as claimed in claim 19, wherein the plasmid is pFB; and wherein each construct is cloned into a separate plasmid.

32. The method as claimed in claim 19, wherein the plasmids are introduced into the cell of the native microorganism by a method selected from a group comprising transformation, transduction and transfection.

33. The method as claimed in claim 19, wherein the method comprises integrating- a) an expression cassette comprising TRP gene and FMO gene at pykF target site of the genome; b) a gene construct comprising aroFΔI11 mutated gene and trpE S40F mutated gene at trpR target site of the genome; and c) a gene construct comprising tktA gene and trpC gene at pykA target site of the genome.

34. A method for production of indigo in a host microorganism, said method comprising cultivating the genetically modified microorganism as claimed in any one of the claims 1-21, under conditions facilitating production of tryptophan from phosphoenolpyruvate and erythrose 4- phosphate, conversion of tryptophan into indole and conversion of indole into indoxyl, thereby obtaining the indigo.

35. The method as claimed in claim 34, comprising: (a) culturing the genetically modified microorganism as claimed in any of the claims 22- 38 in a medium containing glucose or glycerol optionally alongwith an antibiotic; (b) inducing the expression of the gene(s); and (c) extracting and recovering indigo from the biomass.

36. The method as claimed in claim 35, wherein the expression of the gene(s) is induced by including an inducer in the culture medium; wherein the inducer is selected from a group comprising Isopropyl β-D-1-thiogalactopyranoside (IPTG), a combination of half-strength glucose and half strength lactose, or a combination thereof.

37. The method as claimed as claimed in claim 34, wherein the indigo is extracted using a solvent selected from a group comprising ethyl acetate, acetone, butanol, isoamyl alcohol, hexanol, octanol and DMSO or any combination thereof.

Images