3-component lipid nanoparticle compositions, uses, and manufacturing methods thereof
Lipid nanoparticle compositions without PEG, incorporating ionizable lipids and sterols with polyglycerol or polyphosphoester stabilizers, address the immunogenicity and stability issues of PEG-based formulations, achieving superior performance in protein expression and stability.
Patent Information
- Application Number
- PCT/EP2025/075508
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-09
- Filing Date
- 2025-09-08
- Publication Date
- 2026-03-12
AI Technical Summary
Existing lipid nanoparticle (LNP) and nucleic acid containing lipid nanoparticle (NALNP) formulations face challenges related to immunogenicity and stability, particularly due to the use of polyethylene glycol (PEG) and PEGylated lipids, which can elicit an undesirable immune response and hinder cell interactions.
Lipid nanoparticle compositions comprising an ionizable lipid, a sterol, and a stabilizer, such as polyglycerol, polyvinylpyrrolidone, or polyphosphoester, are developed, which are substantially free of PEG, enhancing compatibility and safety while maintaining stability and encapsulation efficiency.
The new compositions demonstrate improved compatibility, reduced immunogenicity, and higher potency in protein expression compared to PEG-based formulations, both in vitro and in vivo, with enhanced stability and encapsulation efficiency.
Smart Images

Figure EP2025075508_12032026_PF_FP_ABST
Abstract
Description
3-COMPONENT LIPID NANOPARTICLE COMPOSITIONS, USES, AND MANUFACTURING METHODS THEREOFCROSS REFERENCE TO RELATED APPLICATION
[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 63 / 692,472, filed September 9, 2024, which is incorporated by reference in its entirety herein.BACKGROUND
[0002] Lipid nanoparticle (LNP) formulations and nucleic acid containing lipid nanoparticle (NALNP) formulations are used for a variety of applications, particularly medical applications such as oligonucleotide-based therapeutics, e.g., vaccines, immunogenic cell incorporation, and gene therapy. LNP and NALNP formulations can also be used for antibiotics and vitamins, among other uses.
[0003] However, there is a need for improved LNP and NALNP formulations. The present invention provides for ameliorating at least some of the disadvantages of the prior art. These and other advantages of the present invention will be apparent from the description as set forth below.BRIEF SUMMARY
[0004] In one aspect, the disclosure provides a lipid nanoparticle composition including (a) an ionizable lipid; (b) a sterol; and (c) a stabilizer. In some embodiments, the lipid nanoparticle composition consists essentially of (a) the ionizable lipid; (b) the sterol; and (c) the stabilizer. In some embodiments, the lipid nanoparticle composition is substantially free of polyethylene glycol (PEG) and PEG-R, wherein R is any atom or molecule covalently attached to PEG. In some embodiments, the ionizable lipid is DODMA, DLin-MC3-DMA, DLin-KC2-DMA, BOCHD-C3- DMA, C12-200, PNI 516, PNI 127, PNI 550, PNI 560, PNI 580, PNI 659, PNI 660, PNI 728, PNI 762, PNI 769, or a combination thereof. In some embodiments, the lipid nanoparticle composition is substantially free of a structural lipid. In some embodiments, the sterol comprises cholesterol, beta-sitosterol, 20-alpha-hydroxysterol, phytosterol, derivatives thereof, or a combination thereof.
[0005] In some embodiments, the stabilizer includes the structure of formula (I):wherein Ri is hydrogen, C1-18 substituted or unsubstituted heteroalkyl group, Cuis unsaturated heteroalkyl group, C1-18 heterocyclyl group, C1-18 charged heteroalkyl group, or Cuis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; R3 is hydrogen, a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof; A is a Ci-C50 substituted or unsubstituted heteroalkyl group, a C1-C50 unsaturated heteroalkyl group, or a combination thereof; and m is an integer from 5 to 1000.
[0006] In some embodiments, the stabilizer is SAF06, SAF10, SAFI 5, SAF25, SAF89,SAF92, SAF93, SAF182, SAF183, SAF184, SAF266, SAF292, SAF293, SAF294, SAF295,SAF296, SAF297, SAF321, SAF322, SAF323, SAF324, SAF325, or combinations thereof.
[0007] In some embodiments, the stabilizer includes the structure of formula (II):wherein Y is hydrogen, methyl, C1-C24 substituted or unsubstituted heteroalkyl group, Ci-Cis unsaturated heteroalkyl group, C1-C24 heterocyclyl group, Ci-Cis charged heteroalkyl group, Ci- Cis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 heterocyclyl group, C1-C50charged heteroalkyl group, C1-C50 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 600.
[0008] In some embodiments, the stabilizer is SAF19, SAF97, SAF98, SAF128, or combinations thereof.
[0009] In some embodiments, the stabilizer includes the structure of formula (III):wherein A is S, NH, O, C1-8 substituted or unsubstituted alkyl or heteroalkyl group, a hydrophilic group, a glyceryl group, a heterocyclic group, a phospholipid group, a ceramide group, an ionizable group, a triazole group, or a combination thereof; B is CH2, a triazole group or a Cuis amino oxobutanoate group or a C1-18 substituted or unsubstituted alkyl or heteroalkyl group; C is a C1-50 substituted or unsubstituted heteroalkyl group, C1-50 unsaturated heteroalkyl group, C1-50 heterocyclic group, C1-50 charged heteroalkyl group, or a combination thereof; T is hydrogen, a Cn 18 carbonothioate group, Cuis substituted or unsubstituted alkyl or heteroalkyl group, a Cuis ionizable group, a C1-18 targeting group, a hydrophilic group, an amphiphilic group, or a combination thereof; D is H, C1-5 substituted or unsubstituted alkyl or heteroalkyl group, or hydroxyl group and m is an integer from 15 to 500.
[0010] In some embodiments, the stabilizer is SAF29, SAF29A, SAF29B, SAF29C, SAF30, SAF34, SAF102, SAF102A, SAF102B, SAF103, SAF104, SAF123, SAF124, SAF125, SAF126, SAF127, SAF133, SAF134, SAF135, SAF136, SAF137, SAF138, SAF139, SAF141, SAF149, SAF150, SAF154, SAF167, SAF178, SAF190, SAF191, SAF246, SAF312, SAF327, SAF328, or combinations thereof.
[0011] In some embodiments, the stabilizer includes the structure of formula (IV):wherein R is hydrogen, , a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof; A, B, D, and E are each individually and independently a Ci-is heteroalkyl group; C is a C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 charged heteroalkyl group, C1-C50 heterocyclyl group, or a combination thereof; and x is an integer from 3 to 1000.
[0012] In some embodiments, the stabilizer is SAF41, SAF44, SAF45, SAF54, SAF84, SAF85, SAF86, SAF87, SAF88, SAF130, SAF132, SAF160, SAF164, SAF165, SAF166, SAFI 97, SAFI 97 A, SAF197B, SAF197C, SAF197D, SAF197E, SAFI 98, SAF200, SAF206, SAF207, SAF315, SAF315A, SAF315B, SAF315C, SAF315D, SAF316, SAF318, SAF329, SAF278, or combinations thereof.
[0013] In some embodiments, the stabilizer comprises the structure of formula (V):wherein R is n, iso, sec, neo or tert C1-12 alkyl group; D is H, OH, piperidine, an alkylamine, amide, carboxylate, alkoxy, thiol or a targeting group; A is O, N, S, a triazole, amide, ester, disulfide, phosphate, sugar, or benzyl; B is H or a hydrophobic group comprising methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-24 alkyl with or without heteroatoms N, S, or O; and n is an integer from 5 to 200.
[0014] In some embodiments, the stabilizer is SAF07, SAF11, SAF12, SAF13, SAF20, SAF21, SAF22, SAF23, SAF24, SAF31, SAF32, SAF33, SAF48, SAF90, SAF95, SAF96, or combinations thereof.
[0015] In some embodiments, the stabilizer comprises the structure of formula (VI):wherein A and B are each individually and independently H or a hydrophobic group comprising methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-C24 alkyl with or without heteroatoms N, S, or O; C is H, methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-C12 alkyl; D is H, methyl, ethyl, substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-C12 alkyl, acetyl, C3-C12 acyls, hydrophilic groups, or targeting moieties; E is H, methyl, ethyl, propyl, butyl, methoxy, ethoxy, a carboxylate, thiol, sulfane, alkoxy, alkanol, alkylamine, alkylamide, alkylbenzene, alkylphenol, alkylpyrrolidone, alkylimidazole, alkylindole, or alkylguanidine; and n is an integer from 5 to 1000.
[0016] In some embodiments, the stabilizer is SAF01, SAF02, SAF03, SAF04, SAF05,SAF08, SAF09, SAF16, SAF35, SAF49, SAF50, SAF51, SAF52, SAF62, SAF63, SAF64,SAF65, SAF66, SAF67, SAF68, SAF69, SAF70, SAF71, SAF72, SAF73, SAF74, SAF75,SAF76, SAF77, SAF78, SAF83, SAF100, SAF101, SAF105, SAF106, SAF140, or combinations thereof.
[0017] In some embodiments, the stabilizer has a molecular weight of about 500 Da to about 50,000 Da. In some embodiments, the lipid nanoparticle composition comprises about 10 to about 85 mol% ionizable lipid, about 10 to about 80 mol% sterol, and about 0.1 to about 10 mol% stabilizer. In some embodiments, the lipid nanoparticle composition comprises about 30 to about 70 mol% ionizable lipid, about 20 to about 70 mol% sterol, and about 0.1 to about 10 mol% stabilizer. In some embodiments, the lipid nanoparticle composition comprises about 30 to about 60 mol% ionizable lipid, about 30 to about 70 mol% sterol, and about 0.1 to about 10 mol% stabilizer. In some embodiments, the lipid nanoparticle composition comprises about 20 to about 60 mol% ionizable lipid, about 35 to about 75 mol% sterol, and about 0.1 to about 10 mol% stabilizer. In some embodiments, the lipid nanoparticle composition comprises about 20 to about 40 mol% ionizable lipid, about 55 to about 75 mol% sterol, and about 0.1 to about 10 mol% stabilizer. In some embodiments, the lipid nanoparticle composition comprises about 40 to about60 mol% ionizable lipid, about 35 to about 60 mol% sterol, and about 0.1 to about 10 mol% stabilizer.
[0018] In one aspect, the disclosure provides a lipid nanoparticle including the lipid nanoparticle composition and a nucleic acid. In some embodiments, the nucleic acid is encapsulated by the lipid nanoparticle composition. In some embodiments, the nucleic acid is an antisense oligonucleotide, a siRNA, a miRNA, a self-amplifying RNA (SAM or saRNA), a selfreplicating DNA, an LNA, a DNA, a replicon, an mRNA, a guide RNA, a complex of RNA and RNA-binding protein, a circular RNA, a transposon, a single gene, a vector, a plasmid, a viral particle, an AAV, or a combination thereof. In some embodiments, the nucleic acid is an antigen encoded mRNA for prophylactic or therapeutic vaccine, a nucleic acid for gene therapy, or a nucleic acid for immunogenic cell incorporation, wherein the immunogenic cell is a T cell, natural killer cell, dendritic cell, or tumor-infiltrating leukocyte.
[0019] In some embodiments, the lipid nanoparticle has a diameter of about 15 nm to about 500 nm. In some embodiments, the lipid nanoparticle has a poly dispersity index of about 0.01 to about 0.40. In some embodiments, the lipid nanoparticle has an encapsulation efficiency of about 50% to about 100%.
[0020] In one aspect, the disclosure provides a pharmaceutical composition including the lipid nanoparticle composition and a pharmaceutically acceptable carrier.
[0021] In another aspect, the disclosure provides a method for preparing the lipid nanoparticle or the pharmaceutical composition including forming the lipid nanoparticle composition by combining the ionizable lipid, the sterol, and the stabilizer; preparing the lipid nanoparticle by combining the lipid nanoparticle composition and the nucleic acid using a microfluidic mixer; and purifying the lipid nanoparticle.
[0022] In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined using a flow ratio of about 1 : 1 to about 10: 1 by volume (aqueous phase: organic phase) at a N / P ratio of about 2 to about 20, and a total flow rate of about 2 to about 2000 mL / min. In some embodiments, the aqueous phase includes a low pH buffer. In some embodiments, the aqueous phase includes a citrate or acetate buffer. In some embodiments, the organic phase comprises 1,4-di oxane, tetrahydrofuran, acetone, acetonitrile, dimethyl sulfoxide, dimethylformamide, acids, alcohols, or a combination thereof. In some embodiments, the organicphase is an alcohol and the alcohol includes aqueous or anhydrous alcohol, where the alcohol is a primary, secondary, or tertiary alcohol having from 1 to 12 branched or unbranched carbons.
[0023] In one aspect, the disclosure provides use of the lipid nanoparticle or the pharmaceutical composition for preventing, treating, or ameliorating conditions or diseases including administering the lipid nanoparticle as a vaccine or as a treatment to prevent or reduce the severity of a contagion, administering the lipid nanoparticle as a gene therapeutic, or administering the lipid nanoparticle to an immunogenic cell for the treatment of cancer or an infection.BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Various aspects of the present disclosure will now be described, by way of example only, with reference to the attached Figures, wherein:
[0025] FIG. 1 is a schematic representation that shows the hEPO expression study in mice. In this study, four mice per group were injected with EPO-expressing LNPs containing various stabilizers, as described herein. hEPO expression levels were measured 6 h and 24 h post administration.
[0026] FIGS. 2A-2C are dot plots that demonstrate hEPO expression levels (6 h and 24 h post administration) in C57BL / 6 mice following IV administration of 0.25 mg / kg dose of recombinant human EPO-encoded mRNA-LNPs using a 3 -component composition (40 mol % ionizable lipid (iL), 57.5 mol % cholesterol, 2.5 mol % stabilizer). Two different iLs were tested: PNI 728 (FIG. 2A, 6 h post administration; FIG. 2B, 24h post administration) and PNI 516 (FIG. 2C, 24 h post administration).
[0027] FIGS. 3A and 3B are dot plots that demonstrate hEPO expression levels (6 h (FIG. 3A) and 24 h (FIG. 3B) post administration) in C57BL / 6 mice following IV administration of 0.25 mg / kg dose of recombinant human EPO-encoded mRNA-LNPs using a 3 -component composition with various SAFs as the stabilizer, as described herein.
[0028] FIG. 4 is a schematic representation that shows the SARS-CoV-2 vaccine study in mice. In this study, mice were injected with SARS-CoV-2 expressing LNPs containing either PBS, PEG-DMG, or various SAFs as the stabilizer, as described herein, and SARS-CoV-2 antigen specific IgG levels were measured 21 and 42 days after IM administration.
[0029] FIGS. 5A and 5B are dot plots that demonstrate SARS-CoV-2 spike protein specific IgG expression in C57BL / 6 mice on day 21 (FIG. 5A) and day 42 (FIG. 5B) following IM administration of 1 pg / mouse dose of SARS-CoV-2 spike protein encoded saRNA-LNPs formed based on a 3-component composition (40 mol % iL, 57.5 mol % cholesterol, 2.5 mol % stabilizer). PNI 516 was used as the ionizable lipid in this example.
[0030] FIGS. 6A and 6B are dot plots that demonstrate SARS-CoV-2 spike protein specific IgG expression in C57BL / 6 mice on day 21 (FIG. 6A) and day 42 (FIG. 6A) following IM administration of 1 pg / mouse dose of SARS-CoV-2 spike protein encoded saRNA-LNPs formed based on a 3-component composition (40 mol % iL, 57.5 mol % cholesterol, 2.5 mol % stabilizer). PNI 516 was used as the ionizable lipid in this example.
[0031] FIGS. 7A and 7B are dot plots that demonstrate hEPO expression levels (6 h (FIG. 7A) and 24 h (FIG. 7B) post administration) in C57BL / 6 mice following IV administration of 0.25 mg / kg dose of recombinant human EPO-encoded mRNA-LNPs using a 3-component composition (40 mol % iL, 57.5 mol % cholesterol, 2.5 mol % stabilizer). PNI 516 was used as the ionizable lipid in this example. The stabilizers that outperformed PEG-DMG in vivo in the 3-component composition included SAF25, SAF93, and SAF128.
[0032] FIGS. 8A and 8B are dot plots that demonstrate SARS-CoV-2 spike protein specific IgG expression in C57BL / 6 mice on day 21 (FIG. 8A) and day 42 (FIG. 8B) following IM administration of 1 pg / mouse dose of SARS-CoV-2 spike protein encoded saRNA-LNPs formed based on a 3-component composition (40 mol % iL, 57.5 mol % cholesterol, 2.5 mol % stabilizer). PNI 516 was used as the ionizable lipid in this example. The stabilizers that outperformed PEG- DMG in vivo in the 3-component composition included SAF29, SAFI 02, SAFI 03, SAFI 23, SAF124, SAF127, SAF133, SAF134, SAF135, and SAF141.
[0033] FIGS. 9A-9D are dot plots that demonstrate hEPO expression levels (6 h and 24 h post administration) in C57BL / 6 mice following IV administration of 0.25 mg / kg dose of recombinant human EPO-encoded mRNA-LNPs using 3-component compositions (40 mol % iL, 57.5 mol % cholesterol, 2.5 mol % stabilizer). Two different iLs were tested (PNI 728 (FIG. 9A (6 h), FIG. 9C (24 h)) and PNI 516 (FIG. 9B (6 h), FIG. 9D (24 h)).
[0034] FIGS. 10A and 10B are dot plots that demonstrate SARS-CoV-2 spike protein specific IgG expression in C57BL / 6 mice on day 21 (FIG. 10A) and day 42 (FIG. 10B) following IM administration of 1 pg / mouse dose of SARS-CoV-2 spike protein encoded saRNA-LNPs formedbased on a 3-component composition (40 mol % iL, 57.5 mol % cholesterol, 2.5 mol % stabilizer). PNI 516 was used as the ionizable lipid in this example. The stabilizers that outperformed PEG- DMG in vivo in the 3-component composition included SAFI 30 and SAFI 65.
[0035] FIGS. 11A and 11B are dot plots that demonstrate hEPO expression levels (6 h (FIG. 11 A) and 24 h (FIG. 11B) post administration) in C57BL / 6 mice following IV administration of 0.25 mg / kg dose of recombinant human EPO-encoded mRNA-LNPs using a 3-component composition (40 mol% iL, 57.5 mol% cholesterol, 2.5 mol% stabilizer). PNI 516 was used as the ionizable lipid in this example. The stabilizers that outperformed PEG-DMG in vivo in the 3- component composition included SAF130.
[0036] FIGS. 12A - 12F are curves illustrating the in vitro potency of LNPs (lipid composition: 60% PNI762, 35% Choi, 5% stabilizer), payload: enhanced green fluorescent protein (eGFP) mRNA). The cell lines tested include Jurkat, BHK and HepG2. The non-PEG stabilizer (e.g., SAF266, SAF293 and SAF295) outperformed PEG-lipid (e.g., PEG-DMG) in vitro.
[0037] FIGS. 13A and 13B are bar graphs illustrating the Ex vivo activity using primary T cells. Transfection efficiency% (left) mean fluorescence intensity (MFI) (right) for LNPs based on 60% PNI762, 35% Choi, 5% stabilizer and enhanced green fluorescent protein (eGFP) mRNA 24 h post treatment analyzed by flow cytometry. It was demonstrated that among non-PEG stabilizers tested, SAF246 and SAF266 were clearly shown to outperform PEG-lipids (e.g., BrijSlO and PEG- DMG) ex vivo. Other non-PEG stabilizers e.g., SAF293 and 295 match PEG-lipids.
[0038] FIG. 14 is a dot plot illustrating the in vivo gene editing using LNPs formed based on 40% PNI769, 57.5% cholesterol and 2.5% SAF297 and Transthyretin guide RNA (TTR gRNA) and Cas9 mRNA. It showed some TTR gene KO using SAF297.DETAILED DESCRIPTION
[0039] I. Introduction
[0040] The disclosure provides stabilizers and lipid nanoparticle (LNP) compositions including the stabilizers, as well as methods for preparing the lipid nanoparticles. These lipid nanoparticle (LNP) compositions may be configured to encapsulate nucleic acids. The lipid nanoparticle compositions for encapsulating nucleic acids comprise an ionizable lipid, a sterol, and a polyglycerol, a polyvinylpyrrolidone, a polyphosphoester, a polysarcosine and a polyoxazoline stabilizer as described herein. Advantageously, in contrast with LNP compositionsincluding polyethylene glycol (PEG) or PEGylated lipid (polyethylene glycol (PEG)-lipid conjugate) component, LNP and NALNP compositions including a polyglycerol, a polyvinylpyrrolidone, or a polyphosphoester stabilizer in accordance with the disclosure are substantially free of PEG and PEGylated lipids. The inventors discovered that the inventive stabilizers allow for LNPs that have higher compatibility and safety and lower immunogenicity when compared to PEG or PEGylated lipid based products, and outperform the PEG or PEGylated lipid based products both ex vivo and in vivo. In some cases, the PEGylated lipid is PEG-R, where R is any atom or molecule. In some cases, R is DMG, DPG, DSG, DSPE, DMPE, DOPE, or DPPE. In some cases, the PEGylated lipid includes DMG-PEG, DPG-PEG, DSG-PEG, DSPE-PEG, DMPE-PEG, DOPE-PEG, or DPPE-PEG.
[0041] Conventionally, lipid nanoparticle compositions are thought to require a structural lipid to support formation and proper function of a lipid nanoparticle. However, the inventors discovered lipid nanoparticle compositions that are substantially free of any structural lipids. In some embodiments, the LNPs of the instant disclosure may include sterol in a molar amount between 35 mol% and 70 mol% of the lipid nanoparticle composition. In some embodiments, the LNPs of the instant disclosure may include sterol in a molar amount of 50% or greater of the lipid nanoparticle composition. The 3-component LNPs of the instant disclosure were found to have better CQAs (critical quality attributes) and perform better in several ex vivo and in vivo experiments compared to 4-component LNPs that include a structural lipid.
[0042] The resulting encapsulated LNP formulations may be used in a variety of applications, particularly applications such as oligonucleotide-based therapeutics, e.g., vaccines, immunogenic cell incorporation, cell therapy, and gene therapy. The 3-component compositions surprisingly and unexpectedly provide benefits including more potent protein expression when compared to structural lipid based LNPs, and 4-component based LNPs.
[0043] To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below.
[0044] II. Definitions
[0045] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods described herein belong. Any reference to standard methods refers to the most recent available version of the method at the time of filing of this disclosure unless otherwise indicated.
[0046] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
[0047] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
[0048] The words “preferred” and “preferably” refer to embodiments of the invention that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful and is not intended to exclude other embodiments from the scope of the invention.
[0049] The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Such terms will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
[0050] The singular form “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. These articles refer to one or to more than one (i.e., to at least one). The use of the term “at least one” followed by a list of one or more items (for example, “at least one of A and B”) is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context. As used herein, the term “or” is generally employed in its usual sense including “and / or” unless the content clearly dictates otherwise. The term “and / or” means any one or more of the items in the list joined by “and / or”. As an example, “x and / or y” means any element of the three-element set {(x), (y), (x, y)}. In other words, “x and / or y” means “one or both of x and y”. As another example, “x, y, and / or z” means any element of the sevenelement set {(x), (y), (z), (x, y), (x, z), (y, z), (x, y, z)}. In other words, “x, y and / or z” means “one or more of x, y and z”.
[0051] Where ranges are given, endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.). Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range,unless the context clearly dictates otherwise. Herein, “up to” a number (for example, up to 50) includes the number (for example, 50). The term “in the range” or “within a range” (and similar statements) includes the endpoints of the stated range.
[0052] Reference throughout this specification to “one aspect (or embodiment),” “an aspect (or embodiment),” “certain aspects (or embodiments),” or “some aspects (or embodiments),” etc., means that a particular feature, configuration, composition, or characteristic described in connection with the aspect is included in at least one aspect of the disclosure. Thus, the appearances of such phrases in various places throughout this specification are not necessarily referring to the same embodiment of the disclosure. Furthermore, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more aspects.
[0053] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” As used herein in connection with a measured quantity, the term “about” refers to that variation in the measured quantity as would be expected by the skilled artisan making the measurement and exercising a level of care commensurate with the objective of the measurement and the precision of the measuring equipment used. The term “about” as used in connection with a numerical value throughout the specification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art. In general, such interval of accuracy is + / -10%. Thus, “about” can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %, 0.5%, 0.1 %, 0.05%, 0.01 %, or 0.001 % greater or less than the stated value. Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0054] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.
[0055] The term “exemplary” means serving as a non-limiting example, instance, or illustration. As utilized herein, the terms “e.g.,” and “for example” set off lists of one or more non-limiting aspects, examples, instances, or illustrations.
[0056] As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. Biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena. For example, “substantially” may refer to being within at least about 20%, alternatively at least about 10%, alternatively at least about 5% of a characteristic or property of interest.
[0057] The term “administering” as used herein refers to the physical introduction of an agent to a subject, such as a lipid nanoparticle disclosed herein, using any of the various methods and delivery systems known to those skilled in the art. Exemplary routes of administration for the formulations disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal, or other parenteral routes of administration, for example by injection or infusion. The phrase “parenteral administration” means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, as well as in vivo electroporation. In some embodiments, the formulation is administered via a non-parenteral route, e.g., orally. Other non-parenteral routes include a topical, epidermal or mucosal route of administration, for example, intranasally, vaginally, rectally, sublingually or topically. Administering can also be performed, for example, once, a plurality of times, and / or over one or more extended periods.
[0058] The term “cancer” refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream. A “cancer” or “cancer tissue” can include a tumor.
[0059] The term “in vitro” refers to events occurring in an artificial environment, e.g., in a test tube, reaction vessel, cell culture, etc., rather than within a multi-cellular organism. The term “in vitro cell” refers to any cell which is cultured ex vivo. In particular, an in vitro cell can include a T cell. The term “ / / / vivo” refers to events that occur within a multi-cellular organism, such as a human or a non -human animal.
[0060] The term “nucleic acid” refers to any polymeric chain of nucleotides. A nucleic acid may be DNA, RNA, or a combination thereof. In some embodiments, a nucleic acid comprises one or more natural nucleic acid residues. In some embodiments, a nucleic acid comprises of one or more nucleic acid analogs. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55,60,65, 70, 75,80, 85,90,95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long (e.g., 20 to 100, 20 to 500, 20 to 1000, 20 to 2000, or 20 to 5000 or more residues). In some embodiments, a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide.
[0061] The term “pharmaceutically acceptable” refers to a molecule or composition that, when administered to a recipient, is not deleterious to the recipient thereof, or that any deleterious effect is outweighed by a benefit to the recipient thereof. With respect to a carrier, diluent, or excipient used to formulate a composition as disclosed herein, a pharmaceutically acceptable carrier, diluent, or excipient must be compatible with the other ingredients of the composition and not deleterious to the recipient thereof, or any deleterious effect must be outweighed by a benefit to the recipient. The term “pharmaceutically acceptable carrier” means a pharmaceutically- acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting an agent from one portion of the body to another (e.g., from one organ to another). Each carrier present in a pharmaceutical composition must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the patient, or any deleterious effect must be outweighed by a benefit to the recipient.Some examples of materials which may serve as pharmaceutically acceptable carriers comprise: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.
[0062] Treatment” or “treating” of a subject refers to any type of intervention or process performed on, or the administration of an active agent to, the subject with the objective of reversing, alleviating, ameliorating, inhibiting, slowing down or preventing the onset, progression, development, severity or recurrence of a symptom, complication or condition, or biochemical indicia associated with a disease. In one embodiment, “treatment” or “treating” includes a partial remission. In another embodiment, “treatment” or “treating” includes a complete remission. In some embodiments, treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and / or condition and / or of a subject who exhibits only early signs of the disease, disorder, and / or condition. In some embodiments, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and / or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and / or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and / or condition.
[0063] A “disease”, as used herein, is a state of health of a subject wherein the subject cannot maintain homeostasis, and wherein if the disease is not ameliorated, the subject’s health continues to deteriorate. In contrast, a “disorder” is a state of health in which the subject is able to maintain homeostasis, but in which the subject's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease inthe subject’s state of health. A disease or disorder is “alleviated” if the severity of a sign or symptom of the disease or disorder, the frequency with which such a sign or symptom is experienced by a subject, or both, is reduced.
[0064] As used herein, the terms “subject”, “individual”, and “patient” are interchangeable, and relate to vertebrates, preferably mammals. For example, mammals in the context of the disclosure are humans, non-human primates, domesticated animals such as dogs, cats, sheep, cattle, goats, pigs, horses, etc., laboratory animals such as mice, rats, rabbits, guinea pigs, etc., as well as animals in captivity such as animals in zoos. The term “animal” as used herein includes humans. The term “subject” may also include a patient, i.e., an animal, having a disease. In exemplary aspects, a subject, individual, or patient refers to a human (e.g., a man, a woman, or a child).
[0065] As used herein, the term “preventing a disease” in a subject means, for example, to stop the development of one or more clinical symptoms of a disease or disorder in a subject before they occur or are detectable. Preferably, the disease or disorder does not develop at all, i.e., no symptoms of the disease or disorder are detectable. In some aspects, it can also mean delaying or slowing of the development of one or more symptoms of the disease or disorder. Alternatively, or in addition, it can mean decreasing the severity of one or more subsequently developed symptoms.
[0066] The invention is defined in the claims. However, below is a non-exhaustive listing of non-limiting exemplary aspects. Any one or more of the features of these aspects may be combined with any one or more features of another example, embodiment, or aspect described herein.
[0067] III. Stabilizers
[0068] Lipid nanoparticles including liposomes, cubosomes, hexosomes, solid lipid nanoparticles, and nanostructured lipid carriers can require steric stabilizers to maintain colloidal stability in an aqueous medium and improve pharmacokinetics and biodistribution profiles. One indication of colloidal stability is the polydispersion index (PDI), which needs to be sufficiently low such that aggregation of the nanoparticles does not occur. A high PDI would indicate a decrease in the stability and viability of the nanoparticles over time.
[0069] Currently, polyethylene glycol (PEG)-lipid conjugates are the most commonly employed stabilizers in lipid nanoparticles. However, this PEGylated class of stabilizers can elicit an undesirable immunogenic response and impede cell interactions with nanoparticles containing a PEG layer. Surprisingly, the class of stabilizers having a polyglycerol, polyvinylpyrrolidone, orpolyphosphoester group was discovered to have favorable profiles (e.g., size, poly dispersion index values, and encapsulation efficiency) as described herein without eliciting the same immunogenic response and without impeding cell interactions compared to PEGylated stabilizers.
[0070] Poly lycerol Stabilizers
[0071] The polyglycerol stabilizers have the general structure of either formula (I) or formula (II):wherein Ri is hydrogen, Ci-is substituted or unsubstituted heteroalkyl group, Cuis unsaturated heteroalkyl group, Ci-is heterocyclyl group, Ci-is charged heteroalkyl group, or Cuis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; R3 is hydrogen, a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof; A is a Ci- C50 substituted or unsubstituted heteroalkyl group, a C1-C50 unsaturated heteroalkyl group, or a combination thereof; and m is an integer from 5 to 1000; orwherein Y is hydrogen, methyl, C1-24 substituted or unsubstituted heteroalkyl group, C1-18 unsaturated heteroalkyl group, C1-24 heterocyclyl group, C1-18 charged heteroalkyl group, C1-18 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 heterocyclyl group, C1-C50charged heteroalkyl group, C1-C50 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 600.
[0072] Polyglycerol stabilizers can be synthesized using techniques such as those, for example, disclosed in U.S. Pat. Appl. No. 63 / 537,969, which is incorporated by reference in its entirety herein.
[0073] Polyvinylpyrrolidone Stabilizers
[0074] The polyvinylpyrrolidone stabilizers have the general structure of formula (III):wherein A is S, NH, O, C1-8 substituted or unsubstituted alkyl or heteroalkyl group, a hydrophilic group, a glyceryl group, a heterocyclic group, a phospholipid group, a ceramide group, an ionizable group, a triazole group (e.g., a heterocyclic 5-membered ring with a molecular formula (C2H3N3)), or a combination thereof; B is CH2, a triazole group or a Cuis amino oxobutanoate group or a Ci- 18 substituted or unsubstituted alkyl or heteroalkyl group; C is a C1-50 substituted or unsubstituted heteroalkyl group, C1-50 unsaturated heteroalkyl group, C1-50 heterocyclic group, C1-50 charged heteroalkyl group, or a combination thereof; T is hydrogen, a Cuis carbonothioate group, Cuis substituted or unsubstituted alkyl or heteroalkyl group, a C1-18 ionizable group, a Cuis targeting group, a hydrophilic group, an amphiphilic group, or a combination thereof; D is H, C1-5 substituted or unsubstituted alkyl or heteroalkyl group, or hydroxyl group and m is an integer from 15 to 500.
[0075] In some embodiments, C is a C1-45 substituted or unsubstituted heteroalkyl group, C1-45 unsaturated heteroalkyl group, C1-45 heterocyclyl group, C1-45 charged heteroalkyl group, or a combination thereof. In some embodiments, C is a C1-40 substituted or unsubstituted heteroalkyl group, Ci-40 unsaturated heteroalkyl group, C1-40 heterocyclyl group, C1-40 charged heteroalkyl group, or a combination thereof. In some embodiments, C is a C1-35 substituted or unsubstituted heteroalkyl group, C1-35 unsaturated heteroalkyl group, C1-35 heterocyclyl group, C1-35 charged heteroalkyl group, or a combination thereof. In some embodiments, C is a C1-30 substituted or unsubstituted heteroalkyl group, C1-30 unsaturated heteroalkyl group, C1-30 heterocyclyl group, Cn30 charged heteroalkyl group, or a combination thereof. In some embodiments, C is a C1-25 substituted or unsubstituted heteroalkyl group, C1-25 unsaturated heteroalkyl group, C1-25 heterocyclyl group, C1-25 charged heteroalkyl group, or a combination thereof. In some embodiments, C is a C1-20 substituted or unsubstituted heteroalkyl group, C1-20 unsaturated heteroalkyl group, C1-20 heterocyclyl group, C1-20 charged heteroalkyl group, or a combination thereof. In some embodiments, C is a C1-15 substituted or unsubstituted heteroalkyl group, C1-15 unsaturated heteroalkyl group, C1-15 heterocyclyl group, C1-15 charged heteroalkyl group, or a combination thereof. In some embodiments, C is a C1-10 substituted or unsubstituted heteroalkyl group, Ci-10 unsaturated heteroalkyl group, C1-10 heterocyclyl group, C1-10 charged heteroalkyl group, or a combination thereof.
[0076] In some embodiments, A is sulfur or a triazole group; B is CH , triazole group, or a C3- Ce amino oxobutanoate group; C is a C31 substituted or unsubstituted heteroalkyl group, C31 unsaturated heteroalkyl group, C31 heterocyclyl group, C31 charged heteroalkyl group, or a combination thereof; T is hydrogen, a C1-C5 carbonothioate group, a C1-C5 ionizable group, a Ci- C5 targeting group, a hydrophilic group, an amphiphilic group, or a combination thereof; and m is an integer from 15 to 400.
[0077] Polyvinylpyrrolidone stabilizers can be synthesized using techniques such as those, for example, disclosed in U.S. Pat. Appl. No. 63 / 537,974, which is incorporated by reference in its entirety herein.
[0078] Polyphosphoester Stabilizers
[0079] The polyphosphoester stabilizers have the general structure of formula (IV):wherein R is , hydrogen, a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof; A, B, D, and E are each individually and independently a Ci-is heteroalkyl group; C is a C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 charged heteroalkyl group, C1-C50 heterocyclyl group, or a combination thereof; and x is an integer from 3 to 1000.
[0080] Polyphosphoester stabilizers can be synthesized using techniques such as those, for example, disclosed in U.S. Pat. Appl. No. 63 / 537,966, which is incorporated by reference in its entirety herein.
[0081] Polyoxazoline Stabilizers
[0082] The polyphosphoester stabilizers have the general structure of formula (V):wherein R is n, iso, sec, neo or tert C1-12 alkyl group; D is H, OH, piperidine, an alkylamine, amide, carboxylate, alkoxy, thiol or a targeting group; A is O, N, S, a triazole, amide, ester, disulfide, phosphate, sugar, or benzyl; B is H or a hydrophobic group comprising methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-24 alkyl with or without heteroatoms N, S, or O; and n is an integer from 5 to 200.
[0083] Polysarcosine Stabilizers
[0084] The polyphosphoester stabilizers have the general structure of formula (VI):wherein A and B are each individually and independently H or a hydrophobic group comprising methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-C24 alkyl with or without heteroatoms N, S, or O; C is H, methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-C12 alkyl; D is H,methyl, ethyl, substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-C12 alkyl, acetyl, C3-C12 acyls, hydrophilic groups, or targeting moieties; E is H, methyl, ethyl, propyl, butyl, methoxy, ethoxy, a carboxylate, thiol, sulfane, alkoxy, alkanol, alkylamine, alkylamide, alkylbenzene, alkylphenol, alkylpyrrolidone, alkylimidazole, alkylindole, or alkylguanidine; and n is an integer from 5 to 1000.
[0085] IV. Lipid Nanoparticle Compositions
[0086] Conventionally, lipid nanoparticles include a structural lipid to impart critical quality attribute (CQA) values important for stability of the nanoparticle and delivery of the nucleic acid cargo. Surprisingly, the inventors discovered that lipid nanoparticles of the instant disclosure, while being substantially free of any structural lipids, can still impart CQA values that enable the stability of the nanoparticle and delivery of the nucleic acid cargo in various applications.
[0087] Polyglycerol Stabilizer LNP Compositions
[0088] In an aspect of the disclosure, the lipid nanoparticle composition comprises (a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (I):wherein Ri is hydrogen, Ci-is substituted or unsubstituted heteroalkyl group, Cuis unsaturated heteroalkyl group, Ci-is heterocyclyl group, Ci-is charged heteroalkyl group, or Cuis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; R3 is hydrogen, a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof; A is a Ci- C50 substituted or unsubstituted heteroalkyl group, a C1-C50 unsaturated heteroalkyl group, or a combination thereof; and m is an integer from 5 to 1000.
[0089] In some embodiments, Ri is hydrogen, C1-5 substituted or unsubstituted heteroalkyl group, C1-5 unsaturated heteroalkyl group, C1-5 heterocyclyl group, C1-5 charged heteroalkyl group, C1-5 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and m is an integer from 5 to 80. In some embodiments, A is a C33 substituted or unsubstituted heteroalkyl group, a C33 unsaturated heteroalkyl group, or a combination thereof.
[0090] In some embodiments, A iswherein s and t are each independently an integer from 12 to 20.
[0091] In some embodiments, A is
[0092] In some embodiments, R3 includes hydrogen, peptide (e.g., RGD peptides targeting integrins, cell -penetrating peptides such as TAT, transferrin receptor-binding peptides), antibody or fragments thereof (e.g., scFv, Fab, nanobodies), sugars (e.g., glucose, sucrose, fructose, galactose, mannose, sialic acid, lactose, fucose), oligosaccharide (e.g., hyaluronic acid, dextran, chitosan, and derivatives thereof), aminoglycoside, sterol (e.g., cholesterol and derivatives thereof), phenyl boronic acid, folic acid or other vitamin (e.g., biotin), small molecule (e.g., anisamide targeting sigma receptors, ligands for GPCRs), lipids (e.g., GM1 ganglioside, phosphatidylserine), or a combination thereof.
[0093] In an aspect of the disclosure, the lipid nanoparticle composition consists essentially of: (a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (I):(I).
[0094] In another aspect, the disclosure provides a lipid nanoparticle composition comprising:(a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (II):wherein Y is hydrogen, methyl, C1-24 substituted or unsubstituted heteroalkyl group, C1-18 unsaturated heteroalkyl group, C1-24 heterocyclyl group, C1-18 charged heteroalkyl group, C1-18 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 heterocyclyl group, C1-C50 charged heteroalkyl group, C1-C50 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 600.
[0095] In some embodiments, Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, Ci- Css substituted or unsubstituted heteroalkyl group, C1-C35 unsaturated heteroalkyl group, C1-C35 heterocyclyl group, C1-C35 charged heteroalkyl group, C1-C35 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 90. In some embodiments, Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C35 substituted or unsubstituted heteroalkyl group, C35 unsaturated heteroalkyl group, C35 heterocyclyl group, C35 charged heteroalkyl group, C35 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof.
[0096] In some embodiments, one or more of Xi, X2, X3, X4, X5 and Xe isindependently an integer from 12 to 20.
[0097] In an aspect of the disclosure, the lipid nanoparticle composition consists essentially of: (a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (II):
[0098] In some embodiments, one or more of Xi, X2, X3, X4, X5 and Xe iswherein s and t are each independently an integer from 12 to 20.
[0099] Polyvinylpyrrolidone Stabilizer LNP Compositions
[0100] In an aspect of the disclosure, the lipid nanoparticle composition comprises (a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (III):wherein A is S, NH, O, C1-8 substituted or unsubstituted alkyl or heteroalkyl group, a hydrophilic group, a glyceryl group, a heterocyclic group, a phospholipid group, a ceramide group, an ionizable group, a triazole group (e.g., a heterocyclic 5-membered ring with a molecular formula (C2H3N3)), or a combination thereof; B is CH2, a triazole group or a Cuis amino oxobutanoate group or a Ci- 18 substituted or unsubstituted alkyl or heteroalkyl group; C is a C1-50 substituted or unsubstituted heteroalkyl group, C1-50 unsaturated heteroalkyl group, C1-50 heterocyclic group, C1-50 chargedheteroalkyl group, or a combination thereof; T is hydrogen, a Ci-is carbonothioate group, Cuis substituted or unsubstituted alkyl or heteroalkyl group, a Ci-is ionizable group, a Cuis targeting group, a hydrophilic group, an amphiphilic group, or a combination thereof; D is H, C1-5 substituted or unsubstituted alkyl or heteroalkyl group, or hydroxyl group and m is an integer from 15 to 500.
[0101] In some embodiments, A is sulfur or a triazole group; B is CH2, triazole group, or a C3- Ce amino oxobutanoate group; T is hydrogen, a C1-C5 carbonothioate group, a C1-C5 ionizable group, a C1-C5 targeting group, a hydrophilic group, an amphiphilic group, or a combination thereof; and m is an integer from 15 to 400.
[0102] In some embodiments, T is hydrogen, a methyl, a peptide, an antibody, a sugar, an oligosaccharide, an aminoglycoside, a sterol,wherein Y is O or S and R is an alkyl with 1-4 carbons, phenyl boronic acid, or a combination thereof.
[0103] In some embodiments, A is sulfur or a triazole group.
[0104] In some embodiments,
[0105] In some embodiments, C iswherein s and t are each independently an integer from 12 to 20.
[0107] In an aspect of the disclosure, the lipid nanoparticle composition consists essentially of (a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (III):
[0108] Polyphosphoester Stabilizer LNP Compositions
[0109] In another aspect of the disclosure, the lipid nanoparticle composition comprises (a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (IV):whereinhydrogen, a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof; A, B, D, and E are each individually and independently a Ci-is heteroalkyl group; C is a C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 charged heteroalkyl group, C1-C50 heterocyclyl group, or a combination thereof; and x is an integer from 3 to 1000.
[0110] In some embodiments, A, B, D, and E are each individually and independently a C1-4 heteroalkyl group; C is a C1-C35 substituted or unsubstituted heteroalkyl group, C1-C35 unsaturated heteroalkyl group, C1-C35 charged heteroalkyl group, C1-C35 heterocyclyl group, or a combination thereof; and x is an integer from 3 to 130. In some embodiments, C is a C32 substituted or unsubstituted heteroalkyl group, C32 unsaturated heteroalkyl group, C32 charged heteroalkyl group, C32 heterocyclyl group, or a combination thereof. In some embodiments, C is a C30 substituted orunsubstituted heteroalkyl group, C30 unsaturated heteroalkyl group, C30 charged heteroalkyl group, C30 heterocyclyl group, or a combination thereof.
[0111] In some embodiments, C is free of an aryl, heteroaryl, or arylalkyl group.
[0112] In some embodiments, C iswherein s and t are each independently an integer from 12 to 20.
[0113] In some embodiments, C is
[0114] In some embodiments, R is hydrogen,peptide, an antibody, a sugar, an oligosaccharide, an aminoglycoside, a sterol, phenyl boronic acid, or a combination thereof.
[0115] In some embodiments, B iswherein m and n are each independently an integer from 1 to 10.
[0116] In some embodiments, A is -NH-(CH2)P-O-(CH2)q-H, wherein p and q are each independently an integer from 1 to 4.
[0117] In an aspect of the disclosure, the lipid nanoparticle composition consists essentially of(a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (IV):(IV).
[0118] Polyoxazoline Stabilizer LNP Compositions
[0119] In another aspect of the disclosure, the lipid nanoparticle composition comprises (a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (V):wherein R is n, iso, sec, neo or tert C1-12 alkyl group; D is H, OH, piperidine, an alkylamine, amide, carboxylate, alkoxy, thiol or a targeting group; A is O, N, S, a triazole, amide, ester, disulfide, phosphate, sugar, or benzyl; B is H or a hydrophobic group comprising methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-24 alkyl with or without heteroatoms N, S, or O; and n is an integer from 5 to 200.
[0120] In an aspect of the disclosure, the lipid nanoparticle composition consists essentially of (a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (V):
[0121] Polysarcosine Stabilizer LNP Compositions
[0122] In another aspect of the disclosure, the lipid nanoparticle composition comprises (a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (VI):wherein A and B are each individually and independently H or a hydrophobic group comprising methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-C24 alkyl with or without heteroatoms N, S, or O; C is H, methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-C12 alkyl; D is H, methyl, ethyl, substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-C12 alkyl, acetyl, C3-C12 acyls, hydrophilic groups, or targeting moieties; E is H, methyl, ethyl, propyl, butyl, methoxy, ethoxy, a carboxylate, thiol, sulfane, alkoxy, alkanol, alkylamine, alkylamide, alkylbenzene, alkylphenol, alkylpyrrolidone, alkylimidazole, alkylindole, or alkylguanidine; and n is an integer from 5 to 1000.
[0123] In an aspect of the disclosure, the lipid nanoparticle composition consists essentially of (a) an ionizable lipid; (b) one or more sterols; and (c) a stabilizer of formula (VI):
[0124] “Consisting essentially of’ is meant to include any elements listed after the phrase, and may include other additional elements limited to those that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of’ indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present depending upon whether or not they materially affect the activity or action of the listed elements.
[0125] As used herein, the term “targeting ligand” can be in the form of a moiety capable of specifically binding to a molecule on the surface of a target cell, such as a cell within a target tissue of interest. In certain embodiments, the targeting ligand is a peptide (e.g., RGD peptides targeting integrins, cell-penetrating peptides such as TAT, transferrin receptor-binding peptides), antibody or fragments thereof (e.g., scFv, Fab, nanobodies), sugars (e.g., glucose, sucrose, fructose, galactose, mannose, sialic acid, lactose, fucose), oligosaccharide (e.g., hyaluronic acid, dextran, chitosan, and derivatives thereof), aminoglycoside, sterol (e.g., cholesterol and derivatives thereof), phenyl boronic acid, folic acid or other vitamin (e.g., biotin), small molecule (e.g., anisamide targeting sigma receptors, ligands for GPCRs), lipids (e.g., GM1 ganglioside, phosphatidylserine), or a combination thereof.
[0126] In some embodiments of the disclosure, the hydrophilic group can be in the form of a molecule with a water soluble portion that can either carry a formal charge, ionic, or can be neutral, non-ionic. The hydrophillic group may include one or more functional groups (e.g., hydroxyl, amino, carboxyl, acidic, basic) that can interact with water through hydrogen bonding and / or ionic interactions.
[0127] In some embodiments of the disclosure, the ionizable group can be in the form of a molecule which, either by its intrinsic chemical nature, or as a function of the medium and / or of the pH of the medium in which it is present, may be in ionic form.
[0128] In some embodiments of the disclosure, the amphiphilic group can be in the form of a molecule that possesses both hydrophilic and hydrophobic properties. Hydrophobic properties are characterized by their tendency to repel water and typically are comprised of non-polar groups (e.g., branched or unbranched alkyl chains).
[0129] As used herein, the term “alkyl group” or “alkyl” can be in the form of a branched, straight-chained (linear), or cyclic hydrocarbon group, having the specified number of carbon atoms, usually from 1 to about 18 or from 1 to about 50 carbon atoms. Exemplary alkyls include, but are not limited to, methyl, ethyl, n- propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, iso-amyl, hexyl, octyl cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclooctyl, and the like. In some embodiments, the alkyl may be substituted. Substituted alkyls are alkyls in which at least one hydrogen atom of the alkyl has been substituted with at least a non-hydrogen group, such as a hydrocarbyl group, a heteroatom, or a heteroatom containing group, such as halogen (such as Br, Cl, F or I) or at least one functional group such as -NR*2, -OR*, -SeR*, -TeR*, -PR*2, -ASR*2, -SbR*2, -SR*, -BR*2, -SiR*, -SiR*3, -GeR*, -GeR*3, -SnR*, -SnR*3, -PbR*3, and the like, where each R* is independently a hydrocarbyl or halocarbyl radical, and two or more R* may join together to form a substituted or unsubstituted saturated, partially unsaturated or aromatic cyclic or polycyclic ring structure, or where at least one heteroatom has been inserted within a hydrocarbyl ring.
[0130] The term “branched alkyl” means that the alkyl group contains a tertiary or quaternary carbon (a tertiary carbon is a carbon atom hound to three other carbon atoms. A quaternary carbon is a carbon atom bound to four other carbon atoms). For example, 3,5,5 trimethylhexylphenyl is an alkyl group (hexyl) having three methyl branches (hence, one tertiary and one quaternarycarbon) and thus is a branched alkyl bound to a phenyl group. Unless otherwise indicated a branched alkyl includes all isomers thereof.
[0131] As used herein, the term “heteroalkyl group” or “heteroalkyl” can be in the form of an alkyl group described herein further in which one or more of the carbon atoms (and any associated hydrogen atoms) are each independently replaced with the same or different heteroatom or heteroatomic group.
[0132] For example, heteroalkyl may include 1, 2, 3, 4, 5, or 6 heteroatomic groups, e.g., 1 heteroatomic group. Heteroatoms include, but are not limited to, N, P, O, S, etc, and combinations thereof. Heteroatomic groups include, but are not limited to, -NR-, -O-, -S-, -PH-, -P(=O)2-, - S(=O)-, -S(=O)2-, and the like, where R is H, alkyl, aryl, cycloalkyl, heteroalkyl, heteroaryl or cycloheteroalkyl. In some embodiments, heteroatomic groups include carbon with functional groups such as -C(=O)-, -C(=O)O-, -C(=O)N-, -OC(=O)O-, -NC(=O)O-, -NC(=O)N-.The term “heteroalkyl” may also include, but are not limited to, heterocycloalkyl (a cyclic heteroalkyl group), alkyl-heterocycloalkyl (a linear or branched aliphatic group attached to a cyclic heteroalkyl group), and the like. Heteroalkyl groups may include, but are not limited to, -O(R)-, -S(R)-, - NR1R2R3. where R is H, alkyl, aryl, arylalkyl, cycloalkyl, heteroalkyl, heteroaryl or cycloheteroalkyl, and Ri, R2, and R3 are each independently H, alkyl, aryl, arylalkyl, cycloalkyl, heteroalkyl, heteroaryl or cycloheteroalkyl. In some embodiments, heteroalkyl groups include, but are not limited to, -OCH3, -CH2OCH3, -SCH3, - CH2SCH3, -NRCH3, -CH2NRCH3, and the like, where R is hydrogen, alkyl, aryl, arylalkyl, heteroalkyl, or heteroaryl, each of which may be optionally substituted. A heteroalkyl group comprises from 1 to about 10 carbon and hetero atoms, e.g., from 1 to 6 carbon and hetero atoms.
[0133] As used herein, the term “cycloalkyl group” or “cycloalkyl” is a subset of “alkyl” and may be in the form of a saturated partially saturated cyclic group of from 3 to about 10 carbon atoms and no ring heteroatoms and having a single ring or multiple rings including fused, bridged, and spiro ring systems, having the specified number of carbon atoms, usually from 1 to about 18 or from 1 to about 35 carbon atoms. For multiple ring systems having aromatic and non-aromatic rings that have no ring heteroatoms, the term “cycloalkyl” applies when the point of attachment is at a non- aromatic carbon atom e.g., 5, 6, 7, 8,-tetrahydronaphthalene-5-yl). The term “cycloalkyl” includes cycloalkenyl groups. Examples of cycloalkyl groups include, for instance, adamantyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and cyclohexenyl.
[0134] As used herein, the term “heterocyclyl group” can be in the form of a cycloalkyl group, described herein, containing from 1 to about 6 heteroatoms chosen from N, O, S, or combinations thereof with remaining ring atoms being about 3 carbon to about 8 carbon atoms. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl. A heterocyclic ring is a ring having a heteroatom in the ring structure as opposed to a heteroatom substituted ring where a hydrogen on a ring atom is replaced with a heteroatom. For example, tetrahydrofuran is a heterocyclic ring and 4-N,N-dimethylamino-phenyl is a heteroatom substituted ring.
[0135] Substituted heterocyclic means a heterocyclic group where at least one hydrogen atom of the heterocyclic radical has been substituted with at least a non-hydrogen group, such as a hydrocarbyl group, a heteroatom, or a heteroatom containing group, such as halogen (such as Br, Cl, F or I) or at least one functional group such as -NR*2, -OR*, -SeR*, -TeR*, -PR*2, -ASR*2, -SbR*2, -SR*, -BR*2, -SiR*, -SiR*3, -GeR*, -GeR*3, -SnR*, -SnR*3, -PbR*3, and the like, where each R* is independently a hydrocarbyl or halocarbyl radical.
[0136] As used herein, the term “ceramide” can be in the form of a family of lipid molecules composed of a sphingosine and a fatty acid. Generally, the long-chain sphingoid base is linked to a fatty acid via an amide bond.
[0137] Any suitable ionizable lipid can be present in the lipid nanoparticle composition and lipid nanoparticle. An ionizable lipid is a lipid that is cationic or becomes ionizable (protonated) as the pH is lowered below the pKa of the ionizable group of the lipid, but is more neutral at higher pH values. At pH values below the pKa, the lipid is able to associate with negatively charged nucleic acids (e.g., oligonucleotides). Ionizable lipid includes lipids that assume a positive charge on pH decrease from physiological pH, or lipids that carry a net positive charge at a selective pH.
[0138] The ionizable lipid can be present in the lipid nanoparticle composition or lipid nanoparticle in any suitable amount or concentration. In some embodiments, the ionizable lipid is present at a concentration of about 10 to about 88 mol%, e.g., about 10 mol%, about 15 mol%, about 20 mol%, about 25 mol%, about 30 mol%, about 35 mol%, about 40 mol%, about 45 mol%, about 50 mol%, about 55 mol%, about 60 mol%, about 65 mol%, or about 70 mol%, about 75 mol%, about 80 mol%, about 85 mol%, or a concentration within a range defined by any two of the foregoing values. In some cases, the ionizable lipid is present at a concentration of more than about 10 mol%, more than about 12 mol%, more than about 14 mol%, more than about 16 mol%, more than about 18 mol%, more than about 20 mol%, more than about 22 mol%, more than about24 mol%, more than about 26 mol%, more than about 28 mol%, or more than about 30 mol%. In some cases, the ionizable lipid is present at a concentration of less than about 88 mol%, less than about 86 mol%, less than about 84 mol%, less than about 82 mol%, less than about 80 mol%, less than about 78 mol%, less than about 76 mol%, less than about 74 mol%, less than about 72 mol%, less than about 70 mol%, less than about 68 mol%, less than about 66 mol%, less than about 64 mol%, less than about 62 mol%, less than about 60 mol%, less than about 58 mol%, less than about 56 mol%, less than about 54 mol%, less than about 52 mol%, or less than about 50 mol%.
[0139] In some embodiments, the lipid nanoparticle composition or lipid nanoparticle comprise one or more ionizable lipids, e.g., two or more ionizable lipids, three or more ionizable lipids, or four or more ionizable lipids. In some embodiments, the ionizable lipid is DODMA (1,2- dioleyloxy-3-dimethylaminopropane), DLin-MC3-DMA (O-(Z,Z,Z,Z-heptatriaconta-6,9,26,29- tetraen-19-yl)-4-(N,N-dimethylamino)), DLin-KC2-DMA (2-dilinoleyl-4-dimethylaminoethyl- [ 1 ,3]-di oxolane), BOCHD-C3-DMA (4-(dimethylamino)-,9-(2-octylcyclopropyl)-l-[8-(2 octylcyclopropyl) octyl]nonyl ester), C12-200 (l,l'-[[2-[4-[2-[[2-[Z>z (2- hydroxydodecyl)amino]ethyl](2-hydroxydodecyl)amino]ethyl]-l-piperazinyl]ethyl]imino]Z>A-2- dodecanol), PNI 516 3-(2-((l,17-bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)-2-oxoethyl)-2- (pent-2-en-l-yl)cyclopentyl 4-(dimethylamino)butanoate, PNI 127 (2R,3S,4R)-2-(((l,4- dimethylpiperidine-4-carbonyl)oxy)methyl)tetrahydrofuran-3,4-diyl (9E,9'E, 12E, 12'E)- bis(octadeca-9,12-di enoate), PNI 550 3-(2-((l,17-bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)- 2-oxoethyl)cyclopentyl 4-(dimethylamino)butanoate, PNI 580 (2S,3R,4R)-2-(((4-(dimethylamino)butanoyl) oxy)methyl)tetrahydrofuran-3,4-diyl bis(2-hexyldecanoate), PNI 659 ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4-(dimethylamino)butanoate, PNI 660 ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2- yl)methyl l,4-dimethylpiperidine-4-carboxylate , PNI 728 ((2R,3R,4S)-3,4-bis((2- hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 2-(dimethylamino)ethyl)carbamate, PNI 762 ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl (2-(diethylamino)ethyl)carbamate, PNI 769 ((2R,3R,4S)-3,4-bis((2- octyldodecyl)oxy)tetrahydrofuran-2-yl)methyl (2-(dimethylamino)ethyl)carbamate, or a combination thereof. In some embodiments, the ionizable lipid is PNI 516, PNI 127, PNI 550, PNI 560, PNI 580, PNI 659, PNI 660, PNI 728, PNI 762, PNI 769, or a combination thereof. Additional ionizable lipids that may be used in the lipid nanoparticle compositions are disclosedin PCT Publication Nos. WO20252589 and W02021000041, which are incorporated herein by reference in their entirety.
[0140] In some embodiments, the lipid nanoparticle composition is substantially free of a structural lipid, e.g., diacylphosphatidylcholines, diacylphosphatidylethanolamines, diacylphosphatidylglycerols, ceramides, sphingomyelins, dihydrosphingomyelins, cephalins, cerebrosides, or a combination thereof. In some embodiments, the lipid nanoparticle composition is substantially free of a structural lipid, e.g., distearoylphosphatidylcholine, dioleoylphosphatidylcholine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylethanolamine, palmitoyloleoylphosphatidylcholine, 1 -stearoyl -2-oleoyl-sn-gly cero- 3 -phosphocholine, palmitoyloleoyl-phosphatidylethanolamine, di oleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane- 1 -carboxylate, dipalmitoyl phosphatidyl ethanolamine, dimyristoylphosphoethanolamine, distearoylphosphatidylethanolamine, l,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-methyl, 1,2- dipalmitoyl-sn-glycero-3-phosphoethanolamine-N,N-dimethyl, l,2-dielaidoyl-sn-glycero-3- phosphoethanolamine, 1 -stearoyl -2-oleoyl -phosphatidy ethanol amine, 1,2-dielaidoyl-sn-glycero- 3-phophoethanolamine, distearoylphosphatidylcholine, dioleoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, palmitoyloleyolphosphatidylglycerol, cardiolipin, phosphatidylinositol, diacylphosphatidylserine, diacylphosphatidic acid, monosialoganglioside GM1, distearoylphosphatidylcholine, or combinations thereof.
[0141] In some embodiments, the lipid nanoparticle composition comprises a sterol. Any suitable sterol can be present in the lipid nanoparticle composition. In some embodiments, the lipid nanoparticle composition comprises one or more sterols, e.g., two or more sterols, three or more sterols, or four or more sterols. In some embodiments, the sterol is cholesterol, beta-sitosterol, 20- alpha-hydroxysterol, phytosterol, or a combination thereof. In some embodiments the sterol is cholesterol.
[0142] The sterol can be present in the lipid nanoparticle composition in any suitable amount. In some embodiments the sterol is present in the lipid nanoparticle composition a concentration of about 10 to about 80 mol%, e.g., about 8 mol%, about 9 mol%, about 10 mol%, about 11 mol%, about 12 mol%, about 13 mol%, about 14 mol%, about 15 mol%, about 16 mol%, about 17 mol%, about 18 mol%, about 19 mol%, about 20 mol%, about 21 mol%, about 22 mol%, about 23 mol%, about 24 mol%, about 25 mol%, about 26 mol%, about 27 mol%, about 28 mol%, about 29 mol%,about 30 mol%, about 31 mol%, about 32 mol%, about 33 mol%, about 34 mol%, about 35 mol%, about 36 mol%, about 37 mol%, about 38 mol%, about 39 mol%, about 40 mol%, about 41 mol%, about 42 mol%, about 43 mol%, about 44 mol%, about 45 mol%, about 46 mol%, about 47 mol%, about 48 mol%, about 49 mol%, or about 50 mol%, about 51 mol%, about 52 mol%, about 53 mol%, about 54 mol%, about 55 mol%, about 56 mol%, about 57 mol%, about 58 mol%, about 59 mol%, or about 60 mol%, about 61 mol%, about 62 mol%, about 63 mol%, about 64 mol%, about 65 mol%, about 66 mol%, about 67 mol%, about 68 mol%, about 69 mol%, about 70 mol%, about 71 mol%, about 72 mol%, about 73 mol%, about 74 mol%, about 75 mol%, about 76 mol%, about 77 mol%, about 78 mol%, about 79 mol%, or about 80 mol%, or a concentration within a range defined by any two of the aforementioned values. In some cases, the sterol is present at a concentration of more than about 8 mol%, more than about 10 mol%, more than about 12 mol%, more than about 14 mol%, more than about 16 mol%, more than about 18 mol%, or more than about 20 mol%. In some cases, the sterol is present at a concentration of less than about 80 mol%, less than about 78 mol%, less than about 76 mol%, less than about 74 mol%, less than about 72 mol%, less than about 70 mol%, less than about 68 mol%, less than about 66 mol%, less than about 64 mol%, less than about 62 mol%, less than about 60 mol%, less than about 58 mol%, less than about 56 mol%, less than about 54 mol%, less than about 52 mol%, or less than about 50 mol%.
[0143] In some embodiments, the lipid nanoparticle composition comprises one or more stabilizers, e.g., two or more stabilizers, three or more stabilizers, or four or more stabilizers.
[0144] Any suitable stabilizer can be used in the lipid nanoparticle composition. In some embodiments the stabilizer is SAF06, SAF10, SAF15, SAF19, SAF25, SAF89, SAF92, SAF93, SAF97, SAF98, SAF128, SAF182, SAF183, SAF184, SAF29, SAF29A, SAF29B, SAF29C, SAF30, SAF34, SAF102, SAF102A, SAF102B, SAF102C, SAF102D, SAF103, SAF104, SAF123, SAF124, SAF125, SAF126, SAF127, SAF133, SAF134, SAF135, SAF136, SAF137, SAF138, SAF139, SAF141, SAF149, SAF150, SAF154, SAF167, SAF178, SAF190, SAF191, SAF246, SAF312, SAF327, SAF328, SAF41, SAF44, SAF45, SAF54, SAF84, SAF 85, SAF 86, SAF 87, SAF 88, SAF130, SAF132, SAF160, SAF164, SAF165, SAF166, SAF197, SAF197A, SAF197B, SAF197C, SAF197D, SAF197E, SAF198, SAF200, SAF206, SAF207, SAF315, SAF315A, SAF315B, SAF315C, SAF315D, SAF316, SAF318, SAF329, SAF278, SAF246, SAF266, SAF292, SAF293, SAF294, SAF295, SAF296, SAF297, SAF321, SAF322, SAF323, SAF324, SAF325, SAF280, SAF293, SAF297, SAF312, SAF07, SAF11, SAF12, SAF13, SAF20,SAF21, SAF22, SAF23, SAF24, SAF31, SAF32, SAF33, SAF48, SAF90, SAF95, SAF96,SAF01, SAF02, SAFO3, SAF04, SAFO5, SAFO8, SAF09, SAF16, SAF35, SAF49, SAF5O,SAF51, SAF52, SAF62, SAF63, SAF64, SAF65, SAF66, SAF67, SAF68, SAF69, SAF70,SAF71, SAF72, SAF73, SAF74, SAF75, SAF76, SAF77, SAF78, SAF83, SAF1OO, SAF1O1,SAFI 05, SAFI 06, SAFI 40, or a combination thereof. Table 1 provides the structures of selected stabilizers.Table 1
[0145] The stabilizing agentstabilizer can have any suitable molecular weight. In some embodiments, the stabilizer has a molecular weight of about 500 to about 50000 Da, e.g., about 500 Da, about 600 Da, about 700 Da, about 800 Da, about 900 Da, about 1000 Da, about 2000 Da, about 4000 Da, about 6000 Da, about 8000 Da, about 10000 Da, about 12000 Da, about 14000 Da, about 16000 Da, about 18000 Da, about 20000 Da, about 22000 Da, about 24000 Da, about 26000 Da, about 28000 Da, about 30000 Da, about 32000 Da, about 34000 Da, about 36000 Da, about 38000 Da, about 40000 Da, about 42000 Da, about 44000 Da, about 46000 Da, about 48000 Da, or about 50000 Da, or a molecular weight defined by the range of any two of the foregoing values. In some cases, the stabilizer has a molecular weight of less than about 1000 Da. In some cases, the stabilizer has a molecular weight of more than about 1000 Da, about 2000 Da, about 4000 Da, about 6000 Da, about 8000 Da, or about 10000 Da. In some cases, the stabilizer has a molecular weight of less than about 60000 Da, about 58000 Da, about 56000 Da, about 54000 Da, about 52000 Da, about 50000 Da, about 48000 Da, about 46000 Da, about 44000 Da, about 42000 Da, or about 40000 Da.
[0146] The stabilizer can be present in any suitable concentration. In some cases, the stabilizer has a concentration from about 0.1 mol% to about 10 mol%, e.g., about 0.1 mol%, about 0.2 mol%,about 0.3 mol%, about 0.4 mol%, about 0.5 mol%, about 0.6 mol%, about 0.7 mol%, about 0.8 mol%, about 0.9 mol%, about 1 mol%, about 1.2 mol%, about 1.4 mol%, about 1.6 mol%, about1.8 mol%, about 2 mol%, about 2.5 mol%, about 3 mol%, about 3.5 mol%, about 4 mol%, about4.5 mol%, about 5 mol%, about 5.5 mol%, about 6 mol%, about 6.5 mol%, about 7 mol%, about7.5 mol%, about 8 mol%, about 8.5 mol%, about 9 mol%, about 9.5 mol%, about 10 mol%, or a concentration defined by a range of any two of the foregoing values. In some cases, the stabilizer has a concentration of more than about 0.02 mol%, more than about 0.04 mol%, more than about 0.06 mol%, more than about 0.08 mol%, more than about 0.1 mol%, more than about 0.2 mol%, more than about 0.3 mol%, more than about 0.4 mol%, more than about 0.5 mol%, more than about 0.6 mol%, more than about 0.7 mol%, more than about 0.8 mol%, more than about 0.9 mol%, or more than about 1.0 mol%. In some cases, the stabilizer has a concentration of less than about 20 mol%, less than about 18 mol%, less than about 16 mol%, less than about 14 mol%, less than about 12 mol%, less than about 10 mol%, less than about 9 mol%, less than about 8 mol%, less than about 7 mol%, less than about 6 mol%, less than about 5 mol%, less than about 4 mol%, or less than about 3 mol%.
[0147] In some embodiments, the lipid nanoparticle composition comprises about 10 to about 80 mol% ionizable lipid, about 20 to about 70 mol% sterol, and about 0.1 to about 10 mol% stabilizer. In some embodiments, the lipid nanoparticle composition comprises about 10 to about 70 mol% ionizable lipid, about 20 to about 70 mol% sterol, and about 0.1 to about 10 mol% stabilizer. In some embodiments, the lipid nanoparticle composition comprises about 20 to about 60 mol% ionizable lipid, about 25 to about 60 mol% sterol, and about 0.1 to about 10 mol% stabilizer. In some embodiments, the lipid nanoparticle composition comprises about 25 to about 55 mol% ionizable lipid, about 30 to about 60 mol% sterol, and about 0.1 to about 10 mol% stabilizer. In certain embodiments the lipid nanoparticle composition comprises about 47.5 mol% ionizable lipid, about 51 mol% sterol, and about 1.5 mol% stabilizer. In some embodiments, the lipid nanoparticle composition comprises about 40 mol% ionizable lipid, about 57.5 mol% sterol, and about 2.5 mol% stabilizer. In some embodiments, the lipid nanoparticle composition comprises about 40 mol% ionizable lipid, about 58.5 mol% sterol, and about 1.5 mol% stabilizer.
[0148] In some embodiments, the lipid nanoparticle composition is used in the formation of a lipid nanoparticle in embodiments of the methods described herein. In some embodiments, the diameter of the lipid nanoparticle is about 15 nm to about 500 nm, e.g., about 15 nm, about 25 nm,about 50 nm, about 75 nm, about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, or about 500 nm, or a diameter defined by a range of any two of the foregoing values. Such diameters can be useful for improving the tissue targeting and biodistribution of the lipid nanoparticles. In some cases, the diameter of the lipid nanoparticle is more than about 10 nm, more than about 15 nm, more than about 20 nm, more than about 25 nm, more than about 30 nm, more than about 35 nm, more than about 40 nm, or more than about 45 nm. In some cases, the diameter of the lipid nanoparticle is less than about 700 nm, less than about 675 nm, less than about 650 nm, less than about 625 nm, less than about 600 nm, less than about 575 nm, less than about 550 nm, less than about 525 nm, less than about 500 nm, less than about 475 nm, less than about 450 nm, less than about 425 nm, less than about 400 nm, less than about 375 nm, less than about 350 nm, less than about 325 nm, or less than about 300 nm.
[0149] Embodiments of the lipid nanoparticle described herein can have any suitable poly dispersity index. In some embodiments, the lipid nanoparticle has a poly dispersity index of from about 0.01 to about 0.40, e.g., about 0.01, about 0.02, about 0.03, about 0.04, about 0.05, about 0.06, about 0.07, about 0.08, about 0.09, about 0.10, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, about 0.20, about 0.21, about 0.22, about 0.23, about 0.24, about 0.25, about 0.26, about 0.27, about 0.28, about 0.29, about 0.30, about 0.31, about 0.32, about 0.33, about 0.34, about 0.35, about 0.36, about 0.37, about 0.38, about 0.39, or about 0.40, or poly dispersity index defined by a range of any two of the foregoing values.
[0150] Embodiments of the lipid nanoparticle described herein can have any suitable encapsulation efficiency. Encapsulation efficiency refers to the percentage of nucleic acid that is successfully entrapped into the lipid nanoparticle. In some embodiments, the lipid nanoparticle has an encapsulation efficiency from about 50% to about 100%, e.g., about 50%, about 52%, about54%, about 56%, about 58%, about 60%, about 62%, about 64%, about 66%, about 68%, about70%, about 72%, about 74%, about 76%, about 78%, about 80%, about 82%, about 84%, about86%, about 88%, about 90%, about 92%, about 94%, about 96%, about 98%, or about 100%, or an encapsulation efficiency defined by a range of any two of the foregoing values.
[0151] The disclosure also provides a method for preparing embodiments of the lipid nanoparticle as described herein comprising (a) forming the lipid nanoparticle composition by combining amounts of ionizable lipid, sterol, and stabilizer; (b) preparing the lipid nanoparticle by combining the lipid nanoparticle composition and the nucleic acid using a microfluidic mixer; and optionally (c) purifying the lipid nanoparticle.
[0152] Any suitable method of mixing can be used to combine the amounts of ionizable lipid, sterol, stabilizer, and nucleic acid. In some embodiments, the ionizable lipid, sterol, and stabilizer are combined by mixing. In some embodiments, the mixing is done using a microfluidic mixer. In some embodiments, the amounts of ionizable lipid, sterol, and stabilizer are as described herein. In some embodiments, the ionizable lipid, sterol, stabilizer, and nucleic acid are combined by standard T-tube mixing techniques, turbulent mixing, titration mixing, agitation promoting ordered self-assembly, or passive mixing of all the elements with self-assembly of elements into nanoparticles. A variety of methods have been developed to formulate lipid nanoparticles containing genetic drugs.
[0153] In some embodiments, microfluidic mixing devices, which can involve mixing two or more types of fluids together uniformly in a microfluidic chip, such as the NanoAssemblr® Spark™, NanoAssemblr® Ignite™, NanoAssemblr® Blaze™, NanoAssemblr® GMP system, and NanoAssemblr® commercial formulation system are used. In some embodiments, the lipid nanoparticles formed by using a microfluidic mixing device has an encapsulation efficiency from about 90 to about 100%.
[0154] Any suitable method can be used to combine the lipid nanoparticle composition and the nucleic acid. In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined by mixing. In some embodiments, the mixing is done using a microfluidic mixer. In some embodiments, the microfluidic mixer comprises a first and second stream of reagents, which feed into the microfluidic mixer, and lipid nanoparticles are collected from an outlet of the microfluidic mixer.
[0155] In some embodiments, the first stream includes a payload in a first solvent. In some embodiments, the payload may include a nucleic acid. In some cases, the payload may include a therapeutic agent. The combination of the payload in a first solvent can be described as the aqueous phase. Any suitable first solvent can be used. Suitable first solvents include solvents in which the payload is soluble and that are miscible with the second solvent. In someembodiments, the first solvent comprises aqueous buffers. In some embodiments, the aqueous buffer is a low pH buffer. In some embodiments, the low pH buffer is a citrate or acetate buffer.
[0156] In some embodiments, the second stream includes embodiments of the lipid nanoparticle composition as described herein in a second solvent. The combination of the lipid nanoparticle composition and the second solvent can be described as the organic phase. Any suitable second solvent can be used. Suitable second solvents include solvents in which the ionizable lipids according to embodiments of the invention are soluble, and that are miscible with the first solvent. In some embodiments, the second solvent comprises one or more solvents, two or more solvents, three or more solvents, or four or more solvents. In some embodiments, the second solvent comprises 1,4-di oxane, tetrahydrofuran, acetone, acetonitrile, dimethyl sulfoxide, dimethylformamide, acids, alcohols, or a combination thereof. In some embodiments, the second solvent comprises aqueous or anhydrous alcohols. In some cases, the alcohol is a primary, secondary, or tertiary alcohol having from 1 to 12 branched or unbranched carbons (e.g., methanol, ethanol, n-propanol, isopropanol, n-butanol, 2-methyl 1 -propanol, 2-butanol, 2-methylpropan-2- ol), or combinations thereof.
[0157] In some embodiments, a suitable device for mixing includes one or more microchannels (i.e., a channel having its greatest dimension less than 1 millimeter). In some embodiments, the microchannel has a diameter from about 20 to about 300 pm. In some embodiments, at least one region of the microchannel has a principal flow direction and one or more surfaces having at least one groove or protrusion defined therein, the groove or protrusion having an orientation that forms an angle with the principal direction (e.g., a staggered herringbone mixer) or a bifurcating toroidal flow mixer. To achieve maximal mixing rates, it is advantageous to avoid undue fluidic resistance prior to the mixing region. In some embodiments, a device has non-microfluidic channels having dimensions greater than 1000 pm, to deliver the fluids to a single mixing channel.
[0158] Any suitable flow ratio can be used to combine the lipid nanoparticle composition and the nucleic acid. In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined using a flow ratio of about 1 : 1 (or 1) to about 10: 1 (or 10) (aqueous phase: organic phase) by volume, e.g., about 1, about 2, about 3, about 4, about 5, about 6, or about 7, about 8, about 9, about 10, or a flow ratio defined by a range of any two of the aforementioned values. In some cases, the flow ratio is more than about 0.5. In some cases, the flow ratio is less than about 20, less than about 18, less than about 16, less than about 14, less than about 12, less than about10, or less than about 8. Any suitable N / P ratio can be used to combine the lipid nanoparticle composition and the nucleic acid. The N / P ratio is the ratio of positively-chargeable polymer amine (N = nitrogen) groups to negatively-charged nucleic acid phosphate (P) groups. In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined at a N / P ratio from about 2 to about 20, e.g., about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20, or at an N / P ratio defined by a range of any two of the aforementioned values. In some case, the N / P ratio is more than about 1, more than about 2, more than about 3, more than about 4, more than about 5, more than about 6, more than about 7, more than about 8, or more than about 9. In some case, the N / P ratio is less than about 40, less than about 38, less than about 36, less than about 34, less than about 32, less than about 30, less than about 28, less than about 26, less than about 24, less than about 22, less than about 20, less than about 18, less than about 16 , less than about 14, less than about 12, or less than about 10. Any suitable total flow rate can be used to combine the lipid nanoparticle composition and the nucleic acid. In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined with a total flow rate of the organic phase and aqueous phase from about 2 to about 2000 mL / min, e.g., about 2 mL / min, about 4 mL / min, about 6 mL / min, about 8 mL / min, about 10 mL / min, about 20 mL / min, about 40 mL / min, about 60 mL / min, about 80 mL / min, or about 100 mL / min, about 120 mL / min, about 140 mL / min, about 160 mL / min, about 180 mL / min, about 200 mL / min, about 220 mL / min, about 240 mL / min, about 260 mL / min, about 280 mL / min, about 300 mL / min, about 350 mL / min, about 400 mL / min, about 450 mL / min, or about 500 mL / min, about 550 mL / min, about 600 mL / min, about 650 mL / min, about 700 mL / min, about 750 mL / min, about 800 mL / min, about 850 mL / min, or about 900 mL / min, about 950 mL / min, about 1000 mL / min, about 1100 mL / min, about 1200 mL / min, about 1300 mL / min, about 1400 mL / min, about 1500 mL / min, about 1600 mL / min, about1700 mL / min, about 1800 mL / min, about 1900 mL / min, about 2000 mL / min, or a total flow rate defined by a range of any two of the foregoing values. In some cases, the total flow rate is more than about 1 mL / min, 2 mL / min, 4 mL / min, 6 mL / min, 8 mL / min, 10 mL / min, 20 mL / min, or 40 mL / min. In some case, the total flow rate is less than about 3000 mL / min, less than about 2800 mL / min, less than about 2600 mL / min, less than about 2400 mL / min, less than about 2200 mL / min, less than about 2100 mL / min, less than about 2000 mL / min, less than about 1800 mL / min, less than about 1600 mL / min, less than about 1500 mL / min, less than about 1400mL / min, less than about 1200 mL / min, less than about 1000 mL / min, or less than about 800 mL / min, In some embodiments, the lipid nanoparticle composition and the nucleic acid are combined using a flow ratio from about 1: 1 (or 1) to about 10: 1 (or 10) by volume (aqueous phase: organic phase) at a N / P ratio from about 2 to about 20, and a total flow rate from about 2 to about 2000 mL / min. In some embodiments, the flow rate is 3 (aqueous phase: organic phase) to optimize for a particular payload or molar ratio of lipid components.
[0159] Any suitable method of purifying the lipid nanoparticles may be used. In some embodiments, the purifying is done using dialysis in a buffer (e.g., PBS, pH 7), a filter or a centrifuge (e.g., Amicon™ centrifugal filters, Millipore, USA), or a tangential flow filtration systems. In some embodiments, the method includes concentrating the lipid nanoparticles to a predetermined target dose.
[0160] V. Methods of Use
[0161] In some embodiments, a payload is encapsulated by an exemplary lipid nanoparticle composition. Any suitable payload can be present in the lipid nanoparticle composition. The payload may include a nucleic acid. In some cases, the payload may include a therapeutic agent. The nucleic acid may be a substance intended to have a direct effect in the diagnosis, cure, mitigation, treatment or prevention of disease, or to have direct effect in restoring, correcting or modifying physiological functions, or to act as a research reagent. Exemplary nucleic acids include any oligonucleotide or polynucleotide whose delivery into a cell causes a desirable effect. The nucleic acid can be single-stranded DNA or RNA, or double-stranded DNA or RNA, or DNA- RNA hybrids, or combinations thereof. In some embodiments, the lipid nanoparticle comprises one or more nucleic acids, two or more nucleic acids, three or more nucleic acids, or four or more nucleic acids. Including more than one nucleic acid may be beneficial in some embodiments e.g., gene editing). In some embodiments, the nucleic acid is an antisense oligonucleotide, a siRNA, a miRNA, a self-amplifying RNA (samRNA or saRNA), a self-replicating DNA, a circRNA, an LNA, a DNA, a replicon, an mRNA, a guide RNA, a transposon, a single gene, a vector, a plasmid, a viral particle, an AAV, a complex of RNA and RNA-binding protein(s), or a combination thereof. In some embodiments, the nucleic acid is an antigen encoded mRNA.
[0162] In some embodiments, the lipid nanoparticle composition is a therapeutic composition, such as an mRNA-based therapeutic composition. The therapeutic composition may optionally include one or more therapeutically acceptable carriers, diluents, or excipients such as salts,buffering agents, preservatives, antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes, emollients, emulsifiers, fillers, film formers or coatings, flavors, fragrances, glidants, lubricants, sorbents, suspending or dispersing agents, sweeteners, waters of hydration, and / or other therapeutic agents. As used herein, the term “excipient” means any pharmaceutically acceptable additive, carrier, diluent, adjuvant, or other ingredient, other than the active pharmaceutical ingredient (API) (and typically in addition to components of the delivery vehicle compositions), suitably selected with respect to the intended form of administration, and consistent with conventional pharmaceutical practices. The disclosed compounds can be administered to a subject or patient in a therapeutically effective amount. The complexes can be administered alone or as part of a pharmaceutically acceptable composition or formulation. In addition, the compositions can be administered all at once, as for example, by a bolus injection, multiple times, or delivered substantially uniformly over a period of time. It is also noted that the dose of the compound can be varied over time.
[0163] In some embodiments, the lipid nanoparticle composition may encapsulate an antigen encoded mRNA and be used as a vaccine. In some embodiments, the antigen encoded mRNA is for a prophylactic or therapeutic vaccine. A vaccine may be referred to as a substance used to stimulate the production of antibodies and provide immunity against one or several diseases, prepared from the causative agent of a disease, its products, or a synthetic substitute. The vaccine may further comprise one or more immunologic adjuvants. As used herein, the term “immunologic adjuvant” refers to a compound or a mixture of compounds that acts to accelerate, prolong, enhance or modify immune responses when used in conjugation with an immunogen (e.g., neoantigens). Adjuvant may be non-immunogenic when administered to a host alone, but that augments the host's immune response to another antigen when administered conjointly with that antigen. Specifically, the terms “adjuvant” and “immunologic adjuvant” are used interchangeably in the present disclosure. Adjuvant-mediated enhancement and / or extension of the duration of the immune response can be assessed by any method known in the art including without limitation one or more of the following: (i) an increase in the number of antibodies produced in response to immunization with the adjuvant / antigen combination versus those produced in response to immunization with the antigen alone; (ii) an increase in the number of T cells recognizing the antigen or the adjuvant; and (iii) an increase in the level of one or more cytokines. Adjuvants may be aluminum based adjuvants including but not limiting to aluminum hydroxide and aluminumphosphate; saponins such as steroid saponins and triterpenoid saponins; bacterial flagellin and some cytokines such as GM-CSF. Adjuvants selection may depend on antigens, vaccines, and routes of administrations.
[0164] In some aspects, adjuvants improve the adaptive immune response to a vaccine antigen by modulating innate immunity or facilitating transport and presentation. Adjuvants act directly or indirectly on antigen presenting cells (APCs) including dendritic cells (DCs). Adjuvants may be ligands for toll-like receptors (TLRs) and can directly affect DCs to alter the strength, potency, speed, duration, bias, breadth, and scope of adaptive immunity. In other instances, adjuvants may signal via proinflammatory pathways and promote immune cell infiltration, antigen presentation, and effector cell maturation. This class of adjuvants includes mineral salts, oil emulsions, nanoparticles, and polyelectrolytes and comprises colloids and molecular assemblies exhibiting complex, heterogeneous structures. In one example, the composition further comprises pidotimod as an adjuvant. In another example, the composition further comprises CpG as an adjuvant.
[0165] In some cases, the lipid nanoparticle composition is used in gene therapy. Gene therapy is a medical technique that produces a therapeutic effect through the manipulation of gene expression or through altering the biological properties of cells. In some cases, a gene encoding a therapeutic protein for incorporation into the host’s DNA or a mRNA encoding the therapeutic protein is administered to treat a disease, where the disease is the result of a missing protein and / or missing activity of the protein. In some cases, a new gene or mRNA is supplied, which may enhance a cell’s function without modifying the genes that cause the disease. In other cases, an antisense oligonucleotide (ASO) or small interfering RNA (siRNA) is used as a therapeutic to silence the activity of a variant protein causing a disease.
[0166] Gene therapy can be performed on a somatic cell level or a germline cell level. Gene therapy can be performed ex vivo or in vivo. Gene therapy can be employed by various gene editing techniques (e.g., CRISPR, homologous recombination, zinc finger nucleases, TALEN). In some cases, the lipid nanoparticle composition used in gene therapy includes the elements necessary to perform gene editing (e.g., includes a CRISPR protein or CRISPR protein encoding mRNA, sgRNA, template RNA). In some cases, the elements are provided together in the same LNP. In other cases, the elements are provided separately in one or more LNPs.
[0167] In some cases, the nucleic acid is for incorporation into an immunogenic cell. In some cases, the immunogenic cell includes a T cell, natural killer cell, dendritic cell, or tumor-infiltratingleukocyte. In some embodiments, the immunogenic cell can be engineered to express a receptor to a specific antigen or neoantigen, engineered to enhance the immunogenic response or the immunogenic cell, and engineered to decrease proteins associated with an adverse response such as neurotoxicity (e.g., reduction of cytokines to ameliorate the effects of cytokine release syndrome). In some embodiments, the lipid nanoparticle is in an anhydrous form. In some embodiments, the lipid nanoparticle is in an anhydrous form consisting of a lyophilized cake. In some embodiments, the lipid nanoparticle is in a reconstituted form. In a reconstituted form, a lyophilized lipid nanoparticle may have a pharmaceutically acceptable carrier added to the lyophilized lipid nanoparticle.
[0168] In some embodiments, the lipid nanoparticle and the pharmaceutically acceptable carrier are a pharmaceutical composition. Examples of pharmaceutically acceptable carrier are provided herein.ABBREVIATIONS
[0169] A5 saRNA SARS Cov2: Self-amplified RNA encoding viral replicase genes in addition to the SARS Cov2 antigen gene(s)
[0170] Cas9 mRNA: Cas9 messenger RNA from Trilink Biotechnologies (San Diego, CA; L- 7606-1000 CleanCap Cas9 mRNA, Img)
[0171] Choi: cholesterol
[0172] EE: encapsulation efficiency
[0173] eGFP-mRNA: Enhanced green fluorescent protein mRNA derived from Aequorea Victoria
[0174] FLuc-mRNA: Firefly luciferase protein mRNA
[0175] hEPO: Human erythropoietin
[0176] hEPO-mRNA: Human erythropoietin protein mRNA
[0177] iL: Ionizable Lipid
[0178] IM: intramuscular administration
[0179] IV: intravenous administration
[0180] LNP: lipid nanoparticles
[0181] MFI: Median Fluorescence Intensity
[0182] N / P: nitrogen to phosphorous ratio
[0183] NALNP: nucleic acid containing lipid nanoparticles
[0184] NAT : Nucleic Acid Therapeutic
[0185] PBS: Phosphate buffered saline
[0186] PCSK9 gRNA: PCSK9 gene guide RNA
[0187] PDI: poly dispersity index
[0188] PNI 127: (2R,3S,4R)-2-(((l,4-dimethylpiperidine-4- carbonyl)oxy)methyl)tetrahydrofuran-3,4-diyl (9E,9'E, 12E, 12'E)-bis(octadeca-9, 12-di enoate)
[0189] PNI 516: 3-(2-((l,17-bis(2-octylcyclopropyl) heptadecan-9-yl) oxy)-2-oxoethyl)-2-(pent-2-en- 1 -yl)cyclopentyl 4-(dimethylamino)butanoate
[0190] PNI 550: 3-(2-((l,17-bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)-2- oxoethyl)cyclopentyl 4-(dimethylamino)butanoate
[0191] PNI 560: 3-(2-((l,17-bis(2-octylcyclopropyl)heptadecan-9-yl)oxy)-2-oxoethyl)-2-(pent-2-en- 1 -yl)cyclopentyl 1 ,4-dimethylpiperidine-4-carboxylate
[0192] PNI 580: (2S,3R,4R)-2-(((4-(dimethylamino)butanoyl) oxy)methyl)tetrahydrofuran-3 ,4-diyl bis(2-hexyldecanoate)
[0193] PNI 659: ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 4-(dimethylamino)butanoate
[0194] PNI 660: ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 1,4- dimethylpiperidine-4-carboxylate
[0195] PNI 728: ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl 2-(dimethylamino)ethyl)carbamate
[0196] PNI 762: ((2R,3R,4S)-3,4-bis((2-hexyldecyl)oxy)tetrahydrofuran-2-yl)methyl (2-(diethylamino)ethyl)carbamate
[0197] PNI 769: ((2R,3R,4S)-3,4-bis((2-octyldodecyl)oxy)tetrahydrofuran-2-yl)methyl (2-(dimethylamino)ethyl)carbamate
[0198] RT : room temperature
[0199] SARS-CoV-2: severe acute respiratory syndrome coronavirus 2
[0200] TCR sgRNA: T cell receptor single guide RNA
[0201] TTR sgRNA: Transthyretin single guide RNA from Integrated DNA Technologies (Coralville, IA) according to sequence (CCCAUACUCCUACAGCACCA)
[0202] The following examples further illustrate the invention but should not be construed in any way as limiting its scope.EXAMPLE 1
[0203] This example demonstrates an illustrative manner of preparing the lipid nanoparticles (LNP).
[0204] Components of the lipid nanoparticle composition including ionizable lipid, sterol, and stabilizer were mixed together in different molar ratios. Lipid nanoparticle compositions were prepared in ethanol by combining amounts of lipids from individual lipid stocks in ethanol. LNPs were then prepared by running the lipid nanoparticle composition and nucleic acid through the NanoAssemblr® Ignite™ microfluidic mixer.
[0205] Lipid nanoparticles (LNPs) formulations were produced by mixing the lipid nanoparticle composition (e.g., 40 mol% iL / 57.5 mol% Choi / 2.5 mol% Stabilizer; lipid nanoparticle composition: 25 mM), with the nucleic acid solution solution (100 mM acetate buffer; pH 4) using a microfluidic mixer such as the one from the NanoAssemblr® platform at an aqueous:organic solution ratio of 3: 1 volume. The formulations were diluted with 25x PBS followed by storing at 4 °C for 30 min. To purify LNPs, formulations were centrifuged utilizing UF Amicon™ tubes at 2200 x g for 45 min. EPO mRNA LNPs were stored at 4 °C until further use. A5 saRNA LNPs were mixed with a cryopreservation buffer and kept at -80 °C until further use. Particles were concentrated to a desired target dose.EXAMPLE 2
[0206] This example demonstrates illustrative methods used for measuring the size, poly dispersity index (PDI) and encapsulation efficiency (EE) of the lipid nanoparticles (LNPs).
[0207] Size and PDI of the LNPs was measured by Dynamic Light Scattering (DLS) using a ZetaSizer™ Nano ZS™ (Malvern Instruments). He / Ne laser of 633 nm wavelength was used as the light source. Data were measured from the scattered intensity data conducted in backscattering detection mode (measurement angle = 173°). Measurements were an average of 10 runs of two cycles each per sample. Z -Average size was reported as the particle size and is defined as the harmonic intensity averaged particle diameter. Encapsulation efficiency (EE) of the LNPs was measured by Quant-iT™ RiboGreen® RNA reagent.
[0208] Size, PDI, and EE of lipid nanoparticles with polyglycerol (PG), polyvinylpyrrolidone (PVP), and polyphosphoester (PE) based stabilizers and different nucleic acid payloads were measured and provided in Tables 2.
[0209] Table 2. Physiochemical properties and encapsulation efficiency (EE%) of LNPs formulated by varying different stabilizers for GFP mRNA or TTR sgRNA / Cas9mRNA nucleic acid payloads.Table 2Table 3. Lipid Nanoparticle Compositions
[0210] Critical quality attributes of various LNPs formed based on polyvinylpyrrolidonebased stabilizers. It was shown that PEG-lipids have demonstrated functionality within a narrow molar percentage range, typically between 1.5-2.5%. Formulations containing either low (<1.5%) or high (>2.5%) levels of PEG-lipids such as Brij S10 or PEG-DMG resulted in suboptimal LNP characteristics, including reduced encapsulation efficiency (55-85%) and non-ideal particle sizes (<60 nm or >100 nm). In contrast, non-PEG stabilizers like SAF278 and SAF293 enabled theformation of robust LNPs with desirable critical quality attributes (CQAs) even at higher molar ratios (e.g., 5%) as shown in Table 4.Table 4EXAMPLE 3
[0211] This example demonstrates an illustrative procedure used for the erythropoietin (EPO) expression evaluation of EPO-expressing LNPs in vivo.LNPs were intravenously injected into mice (6-week old female C57BL6 mice) at a single dose of 0.25 mg / kg. The sera samples were collected 6 h and 24 h post-injection via the tail nick method. For serum preparation, after collection of the whole blood, the blood was allowed to clot by leaving the collection tube at room temperature for 15-30 minutes. The clot was removed by centrifuging the tubes at 1000-2000 x g for 10 min at 4 °C. The clear golden-yellow color supernatant was carefully removed and transferred to a sterile screw-capped clear polypropylene tube on ice. The serum is then stored at -80 °C until further use. The terminal blood collection was performed 24 h post injection. The Erythropoietin (EPO) protein level in sera samples was determined using the Ella kit (ProteinSimple, Catalog # SPCKB-PS-000487). See FIGS. 1, 2A-2C, 3A-3B, 7A-7B, 9A- 9D, and 11A-11B.EXAMPLE 4
[0212] This example demonstrates an illustrative procedure used for the SARS-CoV-2 expression evaluation of SARS-CoV-2 expressing A5 saRNA-LNPs in vivo.LNPs were intramuscularly injected into groups of four mice (N =4, 6-week old male BALB / c mice) at a prime dose of 0.05 mg / kg (1 pg / 50 pL / 20-g mouse) on Day 0 and a booster dose of 0.05 mg / kg (1 pg / 50 pL / 20-g mouse) on Day 28 (7 days after the first sera collection). The sera samples were collected on Day-21 and Day-42 post-prime injection. For serum preparation, after collection of the whole blood, the blood was allowed to clot by leaving the collection tube at room temperature for 15-30 minutes. The clot was removed by centrifuging the tubes at 1000-2000 x g for 10 min at 4 °C. The clear golden -yellow color supernatant was carefully removed and transferred to a sterile screw-capped clear polypropylene tube on ice. The serum was then stored at - 80 °C until further use. The SARS-CoV-2 antigen specific IgG level in sera was determined using enzyme-linked immunoassay (ELISA) assay. See FIGS. 4, 5A-5B, 6A-6B, 8A-8B, and 10A-10B
[0213] Table 5 shows the CQAs for several 3 -component LNP compositions with various payloads.Table 4Example 5
[0214] This example demonstrates an illustrative synthetic pathway to access the lipid initiator, which is needed for the synthesis of the stabilizing polyoxazoline agents.
[0216] 2000 mLtwo neckRBF (round bottom flask) charged with (2,2-dimethyl-l,3-dioxolan- 4-yl) methanol (1) (50.0 g, 0.378 mol, 1.0 eq) in THF (1000 mL) under argon atmosphere, 60% NaH (20.0 g, 0.833 mol, 2.2 eq) was added at 0 °C, stirred for 30 miniutes, bromomethyl) benzene (2) (77.72 g, 0.454 mol, 1.2 eq) was added drop wise at the same temperature and then the reaction mixture was stirred at room temperature for 16 h. The Reaction completion was monitored by TLC. Afterwards, the reaction mixture was diluted with aq NH4CI (500 mL) and extracted with EtOAc (2 x 600 mL), washed with brine solution (80 mL) and the organic layer was dried over Na2SO4 and solvent was evaporated on rotary evaporator to afford the desired compound 3 (90 g, Crude) as a crude. The crude desired product (yellow liquid) was confirmed by 'H NMR. 'H NMR (CDCI3) 400 MHz: 5 ppm: 1.36 (s, 3H,), 1.42 (s, 3H), 3.45-3.576(m, 4H), 3.72-3.76 (m, 1H), 4.041-4.07 (m, 1H), 4.30 (t, 1H, J= 6 Hz), 4.57 (d, 2H, J= 6.4 Hz), 7.29-7.33 (m, 5H).
[0217] Synthesis of compound 4: AcOH : H2O [4:1] OHHCW0Bnrt, 16 h4
[0218] 250 mL two neck RBF charged with 4-((benzyloxy)methyl)-2,2-dimethyl-l,3- dioxolane (3) (45.0 g, 202.44 mmol, 1.0 eq) to this water (62 mL) and then AcOH (250 mL) was added and stirred at room temperature for 16 h. The reaction completion was monitored by TLC.Afterwards, the reaction mixture was concentrated on the rotary-evaporator to afford the crudecompound. The Crude compound was purified by CombiFlash using 2.0% MeOH in DCM as eluent to obtain compound 4 (30.0 g, yield 81.32%) as a brown liquid. The desired product was analysed and confirmed by 'H NMR. 'H NMR (CDC13) 400 MHz: 5 ppm: 3.56- 3.65 (m, 3H) 3.69- 3.72 (dd, 1H, Ji = 11.4 Hz, J2= 3.6Hz), 3.88-3.91 (m, 1H), 4.55 (br s, 2H), 7.30-7.36 (m, 5H).
[0219] Synthesis of compound 54 110 °C, 12 h
[0220] 1000 mL two neck RBF charged with 3-(benzyloxy) propane- 1,2-diol (4) (30.0 g,164.83 mmol, 1.0 eq) and dissolved in 450 mL of toluene under argon atmosphere at room temperature. Then, potassium t-butoxide (74.0 g, 659 mmol, 4.0 eq) and bromotetradecane (137.0 g, 494.0 mmol, 3.0 eq) was added and then reaction mixture was kept at 110 °C and stirred for 12 h. Reaction progress was monitored by TLC. After completion, the reaction mixture was cooled to RT, concentrated, and solvent evaporated under reduced vacuum. To this, 100 mL of water and 100 mL of ethyl acetate was added and separated organic layer again extracted with ethyl acetate (2x 250 mL), Organic layer was dried over anhydrous Na2SO4 and concentrated under reduced pressure. The crude compound was purified by flash column chromatography by eluting with 14% EtOAc in hexane to get compound 5 (60.0 g) (yield 63.8%) as off-white solid. The desired product was analysed and confirmed by 'H NMR. *HNMR (CDCI3) 400 MHz: 5 ppm: 0.88 (t, 6H, J= 6.8 Hz) 1.18-1.31 (m, 46H), 1.51-1.58(m, 4H), 3.42 (t, 2 H, J= 6.4 Hz), 3.50-3.59 (m, 6 H), 4.55 (s, 2 H), 7.28-7.34 (m, 5 H).
[0221] Synthesis of compound 6
[0222] 500 mL paar vessel was charged with (((2,3-bis(tetradecyloxy)propoxy) methyl) benzene) (20 g, 34.782 mmol, 1.0 eq) in 250 mL of ethanol in paar vessel 4.5 g of 10% Pd / C was added, and the paar shaker was hydrogenated with 45 PSI pressure for 5 h. The reaction progress was monitored by TLC. After completion, the reaction mixture was filtered through celite bed washed with 200 mL of ethanol and the filtrate was concentrated under reduced pressure to get compound 6 (15.0 g, yield 91%) as brown liquid. The obtained desired product was confirmed by'H NMR. ‘HNMR (CDCh) 400 MHz: 5 ppm: 0.88 (t, 6H, J= 6.8 Hz) 1.18-1.31 (m, 46H), 1.51- 1.60(m, 4H), 3.42 (m, 1H), 3.43-3.59 (m, 6H), 3.61-3.63 (m, 3H).
[0223] Synthesis of compound 7:
[0224] 250 mL 2 neck RBF was charged with 2,3-bis(tetradecyloxy)propan-l-ol (6) (2.0 g,4.124 mmol, 1 eq) in DCM (60 mL), triethylamine (2.3 mL, 16.499 mmol, 4.0 eq.) was added followed by mesyl chloride (0.5 mL, 6.187 mmol, 1.5 eq) were added at 0 °C, then reaction mixture was stirred at room temperature for 16 h. the progress of the reaction was monitored by TLC. The reaction mixture was cooled to 0 °C, quenched with aq NaHCCh solution and extracted with EtOAc (2 x 100 mL), the organic layer was washed with water and brine solution and then evaporated organic layer on the rotary evaporator to get desired compound 7 (1.8 g, Crude) as brown liquid, which was confirmed by 'H NMR. 'H NMR (400 MHz, CDCI3) 8 ppm 0.86 (t, .7=6,8 Hz, 6 H) 1.16-1.38 (s, 42 H) 1.40 (t, .7=7.34 Hz, 4 H) 1.52 - 1.59 (m, 5 H) 3.02 - 3.04 (m, 2 H) 3.08 - 3.15 (m, 2 H) 3.39 - 3.68 (m, 6 H) 4.22 - 4.26 (m, 1 H) 4.36 - 4.40 (m, 2 H).
[0225] Synthesis of compound 8
[0226] A 250 mL two neck round bottom flask was charged with 2,3-bis(tetradecyloxy)propyl methanesulfonate (5.7 g, 10.12 mmol) in DMF (100.0 mL), sodium azide (0.724 g, 11.13 mmol) was added atRT, then reaction mixture was stirred at 80 °C for 16 h. The completion of the reaction was monitored by TLC. The reaction mixture was cooled to 0 °C, quenched with ice cold water and extracted with EtOAc (2 x 200 mL), organic layer was washed with water and brine solution then evaporated on the rotary evaporator to afford the crude compound. This crude mixture was purified using Combi-Flash column chromatography using 5% EtOAc in hexanes as eluents to obtain 4.0 g (yield 77 %) of desired compound 3 as light brown color liquid.1H NMR (CDC13) 400 MHz: 5 ppm: 0.87 (t, 6H, J = 7.2 Hz), 1.18 (s, 2H), 1.20-1.38 (m, 48 H), 1.50-1.60 (m, 6H), 3.28-3.36 (m, 2H), 3.42 (t, 3H, J = 6.8 Hz), 3.46-3.62 (m, 4H).Example 6
[0227] This example demonstrates an illustrative synthetic pathway to access stabilizers SAF20.SAF20
[0228] 2-ethyl-4,5-dihydrooxazole (13 eq.) was added to a stirred solution of (10) (200 mg) in acetonitrile for 16 h followed by adding piperidine and continued stirring for 4 h at RT. Afterwards, potassium carbonate dissolved in acetonitrile was added to the reaction mixture and stirred for 16 h at RT. After the removal of piperidine, the resulting polymer was diluted with DCM and washed with sodium bicarbonate.
[0229] To a stirred solution of R1 (1300 mg, 1.334 mmol) and l-(3-azido-2- (tetradecyloxy)propoxy)tetradecane (8) (1088 mg, 2.134 mmol) in ethanol (10 mL), purged argon gas for 10 minutes, CuSO4 (64 mg, 0.400 mmol) and Sodium ascorbate (159 mg, 0.800 mmol) were added then stirred at 60 °C for 16 h under argon. Progress of the reaction was monitored by 1H NMR. The reaction mixture was cooled to RT and concentrated on the rotavapor. Residue was diluted with DCM, filtered to remove inorganic salts and the filtrate was evaporated on the rotavapor to get the crude compound. Crude was washed with n-hexane (2 x 10 mL) followed by diethyl ether (3 x 5 mL) and dried under vacuo to afford title compound as brown solid. The desired product was formed and confirmed by 1H NMR and GPC. Yield: 900 mg.Example 7
[0230] This example demonstrates an illustrative synthetic pathway to access the monomer, which is needed for the synthesis of the stabilizers.
[0231] Synthesis of 3-methyloxazolidine-2, 5-dione:
[0232] 250 mL RBF was charged with N-(tert-butoxycarbonyl)-N-methylglycine (1) (5.0 g,26.427 mmol) in 125 mL of DCM under argon atmosphere at 0 °C was added phosphorous (III) chloride (2.77 mL, 31.712 mmol) the reaction mixture was stirred at same temperature for 2 h. Progress of the reaction was monitored by TLC. After completion, the reaction mixture was concentrated under reduced pressure below 30 °C, then this crude compound dissolved in DCM and filtered, the filtrate was concentrated under reduced pressure below 30 °C. The crude compound was recrystallized with DCM (10 mL) and n-hexane (40 mL) three times to afford compound 2 (1.4 g, yield 46%) as white solid and which was confirmed by 1H NMR. 1H NMR (400 Hz, CDC13) 5 ppm 3.05 (s, 3 H), 4.13 (s, 2 H).Example 8
[0233] This example demonstrates an illustrative synthetic pathway to access stabilizers
[0234] Step -1 : Synthesis of ditetradecylamine:
[0235] 25 mL two neck round bottom flask was charged with tetradecan- 1 -amine (1) (5.0 g,23.429 mmol, leq) in 10 mL of DMSO under argon atmosphere at room temperature was added 1 -bromotetradecane (6.496 g, 23.429 mmol, leq) followed by potassium carbonate (3.233 g, 23.429 mmol, 1 eq) the reaction mixture was allowed to cool to 80 °C and stirred for 24 h and progress of the reaction was monitored by TLC. The reaction mixture was cooled to roomtemperature, then to this was added 100 mL of chloroform and stirred for 10 minutes, then it was decanted again to this was added 2x 100 mL of chloroform and decanted the chloroform again. The organic layer was dried over anhydrous Na2SO4 and concentrated under reduced pressure. The crude compound was purified by CombiFlash column chromatography, product eluted at 2.5 % of methanol in DCM. The desired compound 3 (4.0 g, yield 41.66%) was obtained as off-white solid which was confirmed by 'H NMR. 'H NMR (400 MHz, CDCh) 8 ppm: 0.81 (t, .7=6.80 Hz, 6 H) 1.05 - 1.30 (m, 44 H) 1.32 - 1.52 (m, 4 H) 2.31 - 2.35 (t, .7=7.6 Hz, 1 H) 2.51 - 2.53 (m, 6 H). Step 2: Polymerisation:
[0236] 100 mL 2 neck RBF was charged with 3-methyloxazolidine-2, 5-dione (5) (1.687 g,14.669 mmol, 15 eq) dissolved in dry THF (25 mL) and then at 50 °C ditetradecylamine (0.400 g, 0.977 mmol, 1.0 eq) was added in THF (20 mL) under argon atmosphere. Then, the reaction mixture was stirred at same temperature for 16 h. Progress of the reaction was monitored by TLC. The reaction mixture was cooled to room temperature and concentrated under reduced pressure and then crude polymer was washed with cold diethyl ether and concentrated under reduced pressure. The desired compound 6 (1.1 g, yield 45.26%) was obtained as off-white gummy solid which was confirmed by1H NMR & GPC. As per 1H NMR analysis 28 repeating monomer units was calculated. 'HNMR (400 MHz, CD3OD) 5 ppm 0.90 (t, .7=6.4 Hz, 6 H) 1.29- 1.40 (m, 44 H) 1.51 - 1.66 (m, 3 H) 2.47 - 2.62 (m, 2 H) 2.62 - 2.67 (m, 2 H) 2.93 - 3.01 (m, 86 H) 4.10 - 4.35 (m, 57 H), GPC (100%).
[0237] Step 3: Acylation:
[0238] 25 mL 2 neck RBF was charged with comp 6 (1.0 g, 0.401 mmol, leq) in N, N- dimethylformamide (8 mL) at 0 °C and then diisopropylethylamine (0.35 mL, 2.007 mmol, 5eq) was added and stirred for 30 minutes at RT. Then, to this acetic anhydride (0.12 mL, 1.204 mmol, 3 eq) was added and stirred at RT for 16 h. Progress of the reaction was monitored by TLC. The reaction mixture was cooled to 0 °C and added cold diethyl ether (25 mL), solid was formed then filtered followed by washing with n-hexane (20 mL) and decanted. The crude compound was further purified by dissolving minimal volume of DCM and then precipitated in diethyl ether and this was repeated three times. Then, it was concentrated under reduced pressure to obtain the desired compound 7 (0.375 g, 75.91%) as off-white gummy solid, which was confirmed by 'H NMR & GPC. As per 'HNMR analysis 38 monomer repeating units was calculated. 'HNMR (400 MHz, CD3OD) 5 ppm 0.90 (t, .7=6.4 Hz, 6 H) 1.29 - 1.34 (m, 52 H) 1.35 - 1.38 (m, 4 H) 1.98 -2.13 (m, 4 H) 2.91 - 3.06 (m, 138 H) 4.09 - 4.41 (m, 76 H), GPC (100%). HRMS-mass observed in the range 800-2000 Da with monomer mass fragment peaks.Example 9
[0239] This example demonstrates an illustrative synthetic pathway to access stabilizers
[0240] Step-1 : Synthesis of 4-((benzyloxy)methyl)-2,2-dimethyl-l,3-dioxolane:
[0241] 2000 mL two neck RBF charged with (2,2-dimethyl-l,3-dioxolan-4-yl) methanol (1)(50.0 g, 0.378 mol, 1.0 eq) in THF (1000 mL) under argon atmosphere, 60% NaH (20.0 g, 0.833 mol, 2.2 eq) was added at 0 °C, stirred for 30 miniutes, bromomethyl) benzene (2) (77.72 g, 0.454 mol, 1.2 eq) was added drop wise at the same temperature and then stirred the reaction mixture at room temperature for 16 h. The Reaction completion was monitored by TLC. Afterwards, reactionmixture was diluted with aq NH4CI (500 mL) and extracted with EtOAc (2 x 600 mL), washed with brine solution (80 mL) and the organic layer was dried over ISfeSCU and solvent was evaporated on rotary evaporator to afford the desired compound 3 (90 g, Crude) as a crude. The crude desired product (yellow liquid) was confirmed byJH NMR.JH NMR (CDCI3) 400 MHz: 5 ppm: 1.36 (s, 3H,), 1.42 (s, 3H), 3.45-3.576(m, 4H), 3.72-3.76 (m, 1H), 4.041-4.07 (m, 1H), 4.30 (t, 1H, J= 6 Hz), 4.57 (d, 2H, J= 6.4 Hz), 7.29-7.33 (m, 5H).
[0242] Step-2: for synthesis of 3 -(benzyloxy) propane- 1 ,2-diol :
[0243] 250 mL two neck RBF was charged with 4-((benzyloxy)methyl)-2,2-dimethyl-l,3- dioxolane (3) (45.0 g, 202.44 mmol, 1.0 eq) to this water (62 mL) and then AcOH (250 mL) was added and stirred at room temperature for 16 h. The reaction completion was monitored by TLC. Afterwards, the reaction mixture was concentrated on the rotary-evaporator to afford the crude compound. The Crude compound was purified by CombiFlash using 2.0% MeOH in DCM as eluent to obtain compound 4 (30.0 g, yield, 81.32%) as a brown liquid. The desired product was analysed and confirmed by 'H NMR. 'H NMR (CDCI3) 400 MHz: 5 ppm: 3.56- 3.65 (m, 3H) 3.69- 3.72 (dd, 1H, Ji = 11.4 Hz, J2= 3.6Hz), 3.88-3.91 (m, 1H), 4.55 (br s, 2H), 7.30-7.36 (m, 5H).
[0244] Step-3: synthesis of ((2,3-bis(tetradecyloxy)propoxy) methyl) benzene:C H,
[0245] 1000 mL two neck RBF charged with 3-(benzyloxy) propane- 1,2-diol (4) (30.0 g,164.83mmol, 1.0 eq) and dissolved in 450 mL of toluene under argon atmosphere at room temperature. Then, potassium t-butoxide (74.0 g, 659 mmol, 4.0 eq) and bromotetradecane (137.0 g, 494.0 mmol, 3.0 eq) was added and then reaction mixture was kept at 110 °C and stirred for 12 h. Reaction progress was monitored by TLC. After completion, reaction mixture was cooled to RT, concentrated, and solvent evaporated under reduced vacuum. To this, 100 mL of water and 100 mL of ethyl acetate was added and separated organic layer again extracted with ethyl acetate (2x 250 mL), Organic layer was dried over anhydrous Na2SO4 and concentrated under reduced pressure. The crude compound was purified by flash column chromatography by eluting with 14%EtOAc in hexane to get compound 5 (60.0 g) (yield, 63.8%) as off-white solid. The desired product was analysed and confirmed by 'H NMR. ’H NMR (CDCh) 400 MHz: 5 ppm: 0.88 (t, 6H, J= 6.8 Hz) 1.18-1.31 (m, 46H), 1.51-1.58(m, 4H), 3.42 (t, 2 H, J= 6.4 Hz), 3.50-3.59 (m, 6 H), 4.55 (s, 2 H), 7.28-7.34 (m, 5 H).
[0246] Step 4: synthesis of (((2,3-bis(tetradecyloxy)propoxy) methyl) benzene):
[0247] 500 mL paar vessel was charged with (((2,3-bis(tetradecyloxy)propoxy) methyl) benzene) (20 g, 34.782 mmol, 1.0 eq) in 250 mL of ethanol in paar vessel 4.5 g of 10% Pd / C was added, and the paar shaker was hydrogenated with 45 PSI pressure for 5 h. The reaction progress was monitored by TLC. After completion, the reaction mixture was filtered through celite bed washed with 200 mL of ethanol and the filtrate was concentrated under reduced pressure to get compound 6 (15.0 g, yield 91%) as brown liquid. The obtained desired product was confirmed by 'H NMR. ‘HNMR (CDCh) 400 MHz: 5 ppm: 0.88 (t, 6H, J= 6.8 Hz) 1.18-1.31 (m, 46H), 1.51- 1.60(m, 4H), 3.42 (m, 1H), 3.43-3.59 (m, 6H), 3.61-3.63 (m, 3H).
[0248] Step 5: Synthesis of 2,3-bis(tetradecyloxy)propyl methanesulfonate:C14H29O MsCl, EtgN |H29^QC^O^J^OH - r IT 0 JL OMs6 DCM, 0°C, rt, 16 hL14H2 ^7
[0249] 250 mL 2 neck RBF was charged with 2,3-bis(tetradecyloxy)propan-l-ol (6) (2.0 g,4.124 mmol, 1 eq) in DCM (60 mL), triethylamine (2.3 mL, 16.499 mmol, 4.0 eq.) was added followed by mesyl chloride (0.5 mL, 6.187 mmol, 1.5 eq) were added at 0 °C, then reaction mixture was stirred at room temperature for 16 h. the progress of the reaction was monitored by TLC. The reaction mixture was cooled to 0 °C, quenched with aq NaHCCh solution and extracted with EtOAc (2 x 100 mL), the organic layer was washed with water and brine solution and then evaporated organic layer on the rotary evaporator to get desired compound 7 (1.8 g, Crude,) as brown liquid, which was confirmed by 'H NMR. 'H NMR (400 MHz, CDCh) 5 ppm 0.86 (t, .7=6.8 Hz, 6 H) 1.16-1.38 (s, 42 H) 1.40 (t, .7=7.34 Hz, 4 H) 1.52 - 1.59 (m, 5 H) 3.02 - 3.04 (m, 2 H) 3.08 - 3.15 (m, 2 H) 3.39 - 3.68 (m, 6 H) 4.22 - 4.26 (m, 1 H) 4.36 - 4.40 (m, 2 H).
[0250] Step 6: Synthesis of 2-(2,3-bis(tetradecyloxy)propyl)isoindoline-l, 3-dione:
[0251] 100 mL 2 neck RB flask was charged with 2,3-Bis(tetradecyloxy)propyl methane sulfonate (7) (1.8 g, 3.202 mmol, 1 eq) in DMF (34 mL) and then at room temperature, potassium pthalimide (1.542 g, 8.325 mmol, 2.6 eq.) was added and the reaction mixture was allowed to 70 °C stirring for 16 h. The reaction progress was monitored by TLC. The reaction mixture was cooled to room temperature and quenched with 70 mL of ice-cold water, then it was extracted with ethyl acetate (50 mL x 3), the combined organic layer and washed with 100 mL of ice-water and also washed with fully saturated brine solution dried over anhydrous Na2SO4, then evaporated on the rota vapour to afford the crude. The crude compound was purified by CombiFlash column chromatography, and the product was eluted by 8% ethyl acetate in hexane to get the desire compound 8 (0.990 g, 49.5%) as brown solid. The obtained desired product was confirmed byJH NMR.1HNMR (400 MHz, CDC13) 8 ppm 0.86 (t, J=5.6 Hz, 6 H) 1.11 - 1.29 (m, 44 H) 1.38 - 1.50 (m, 4 H) 3.39 - 3.49 (m, 4 H) 3.56 - 3.61 (m, 1 H) 3.74 - 3.86 (m, 3 H) 7.67 - 7.73 (m, 2 H) 7.82 - 7.86 (m, 2 H).
[0252] Step 7: Synthesis of 2, 3-bis(tetradecyloxy)propan-l-amine:
[0253] 100 mL two neck RBF was charged with 2-(2,3-bis(tetradecyloxy)propyl) isoindoline-1, 3-dione (9) (0.990 g, 1.615 mmol, 1 eq) in EtOH (24 mL) at room temperature, was added hydrazine hydrate (0.75 mL, 24.225 mmol, 15 eq) then reaction mixture was allowed to 800C and stirred for 16 h. Reaction was monitored by TLC. After completion, reaction mixture was cooled to RT filtered and the obtained solid was washed twice with ethanol (12 mL). The filtrate was collected and distilled to remove the ethanol. The residue was dissolved in 100 mL DCM, the insoluble substances (white solid) was filtered again washed once with DCM (50 mL), the organic phases was combined and washed with DM water fallowed by brine solution, dried over anhydrous Na2SO4 and concentrated under reduced pressure, a light oil like crude product was obtained. The crude compound was purified by CombiFlash column chromatography, product eluted at 4% MeOH in DCM to get the desired compound 10 (0.675 g, 86.42%) as color less liquid, which wasconfirmed by 'H NMR. 'H NMR (400 MHz, DMSO-76) 8 ppm 0.86 (t, 7=6.8 Hz, 6 H) 1.19-1.40 (m, 47 H) 1.53 - 1.58 (m, 4 H) 2.79- 2.95 (m, 2 H) 3.31 - 3.33 (m, 6 H) 3.57 - 3.63 (m, 1 H).
[0254] Step 8: Synthesis of benzyl (2-((2,3-bis(tetradecyloxy)propyl)amino)-2-oxoethyl)carbamate:
[0255] 50 mL two neck RBF was charged with 2,3-bis(tetradecyloxy)propan-l-amine (10)(0.525 g, 1.085 mmol, 1 eq) and ((benzyloxy)carbonyl) glycine (11) (0.249 g, 1.193 mmol, 1.1 eq) DCM (10 mL) at 0 °C was added EDC.HC1 (0.415 g, 2.170 mmol, 2.0 eq.) fallowed by HOBt(0.219 g, 1.627 mmol, 1.5 eq) and then reaction mixture was stirred for 16 h. Reaction progress was monitored by TLC. After then, to the reaction mixture water (25 mL) was added and extracted with DCM (2x 40 mL). The combined organic layer washed with brine solution and dried over anhydrous sodium sulphate and concentrated under reduced pressure. The crude compound was purified by CombiFlash product eluted by 30% EtOAc in hexane to get desired compound 12 (0.540 g, 73.77%) afford as colorless gummy solid, which was confirmed by *H NMR. 'HNMR (400 MHz, CDC13) 6 ppm 0.86 (t, 7=6.0 Hz, 6 H) 1.15-1.40 (m, 43 H) 1.50 - 1.57 (m, 5 H) 3.31 - 3.59 (m, 9 H) 3.85 (br d, 7=5.20 Hz, 2 H) 5.09 - 5.15 (m, 2 H) 5.37 (br s, 1 H) 6.35 (br s, 1 H) 7.30- 7.36 (m, 5 H)
[0256] Step 9: Synthesis of 2-amino-N-(2,3-bis(tetradecyloxy)propyl)acetamide:3 h, 45 psi
[0257] 50 mL two neck RBF was charged with benzyl (2-((2,3-bis(tetradecyloxy)propyl) amino)-2-oxoethyl) carbamate (12) (0.540 g, 0.801mmol, 1.0 eq.) in 20 mL of ethanol was added and 0.080 g of 10% Pd / C, added and hydrogenated with hydrogen bladder with 45 psi for 3 h. Progress of the reaction was monitored by TLC. The reaction mixture was filtered through celite bed washed with methanol; the filtrate was concentrated under reduced pressure. The crude compound was purified by CombiFlash column chromatography and the product eluted at 6%MeOH in DCM to obtain desired compound 13 (0.300 g, 69.28%) as off-white solid, which was confirmed by 'H NMR. *H NMR (400 MHz, CDC13) 8 ppm: 0.86 (t, .7=6,0 Hz, 6 H) 1.15-1.40 (m, 46 H) 1.51 - 1.58 (m, 4 H) 3.27 - 3.38 (m, 3 H) 3.41 - 3.61 (m, 8 H).
[0258] Step 10: Polymerization:
[0259] 25 mL two neck RBF was charged with 2-amino-N-(2,3- bis(tetradecyloxy)propyl)acetamide (13) (0.300 g, 0.554 mmol, 1.0 eq.) in dry THF (8 mL) at 50 °C was added 3-methyloxazolidine-2, 5-dione (0.636 g, 5.545 mmol, 10 eq) in THF (2 mL) under argon atmosphere the reaction mixture was stirred at same temperature for 16 h. Reaction progress was monitored by TLC. After completion, the reaction mixture was cooled to RT and concentrated under reduced pressure. Then, reaction mixture was precipitated in cold diethyl ether and this was repeated three times to get compound 14 (0.500 g, 72%) as colorless gummy solid, which was confirmed by 'H NMR, as per 'H NMR analysis 10 repeating monomer units was calculated. 'H NMR (400 MHz, CDCI3) 6 ppm: 0.86 (t, J=6.0 Hz, 6 H) 1.24-1.54 (m, 39 H) 2.06 (m, 11 H) 2.42 (m, 2 H) 2.91 - 3.08 (m, 29 H) 3.34 - 3.53 (m, 9 H) 3.90 - 4.27 (m, 20 H).
[0260] Step 11 : Acylation:
[0261] 25 mL two neck RBF was charged with comp 14 (0.500 g, 0.399 mmol, 1.0 eq) in N,N-dimethylformamide (6 mL) at 0 °C was added diisopropylethylamine (0.34 mL, 1.998 mmol, 5.0 eq) and stirred for 30 minutes. To this reaction mixture acetic anhydride (0.12 mL, 1.199 mmol, 3.0 eq) was added and reaction mixture was stirred at RT for 16 h. Reaction progress was monitored by TLC. After completion, the reaction mixture was cooled to 0 °C and solvent evaporated under reduced pressure. Then, the reaction mixture was precipitated in cold diethyl ether (20 mL) and this was repeated three times to get solid. This solid was further washed with n- hexane (20 mL) and decanted to get the desired compound 15 (0.275 g) as colorless gummy solid, which was analysed by1H NMR and confirmed, as per1H NMR analysis 14 monomer repeatingunits was calculated. 'H NMR (400 MHz, Methanol -d^) 8 ppm 0.78 - 0.81 (t, .7=6.4 Hz, 6 H) 1.25- 1.34 (m, 48 H) 1.49 - 1.57 (m, 4 H) 1.95 - 1.99 (m, 2 H) 2.11 (m, 2 H) 2.76 - 3.11 (m, 45 H) 3.34- 3.46 (m, 8 H) 3.76 - 3.88 (m, 2 H) 4.02 - 4.22 (m, 14 H) 4.29 - 4.42 (m, 14 H), HPLC (71.39%).Example 10
[0262] This example demonstrates an illustrative synthetic pathway to access stabilizers
[0263] Step 1 : Synthesis of 3 -((tert-butoxy carbonyl) amino) propane- 1,2-diyl di tetradecanoate:
[0264] 100 mL RBF was charged with tert-butyl (2,3 -dihydroxypropyl) carbamate (2) (1.0 g,5.22 mmol, 1.0 eq.) in DCM (40.0 mL) and then at RT N, N'-Diisopropylcarbodiimide (DIC) (1.510 g, 12.01 mmol, 2.3 eq.), followed by DMAP (0.127 g, 1.03 mmol, 0.2 eq.) was added and reaction mixture was stirred at RT. Then, to reaction mixture tetra decanoicacid (1) (2.740 g, 12.01 mmol, 2.3 eq.) was added. Then, the reaction mixture was stirred at RT for 24 h. The completion of the reaction was monitored by TLC. After completion, the reaction mixture was diluted with DCM, filtered through filter paper. Then filtrate residue was purified by CombiFlash chromatography using 40% EtOAc in hexanes as eluents to get the desired compound 3 (2.9 g; 90.9%) as gummy solid, which was confirmed by 'H NMR and HPLC (79.10%). 'H NMR (400 MHz, CDC13) 6 ppm: 0.86 - 0.89 (t, J=6.8 Hz, 6 H) 1.18 - 1.27 (br s, 42 H) 1.41 (s, 9 H) 1.58 - 1.63 (m, 6 H) 2.29 - 2.35 (m, 4 H) 3.31 - 3.38 (m, 2 H), 4.10-4.14 (m, 1H), 4.25-4.29 (dd, .77=12 Hz, J2=4 Hz, 1H), 4.73(m, 1H), 5.08-5.12 (q, .7=4.8 Hz, 1H).
[0265] Step 2: Synthesis of 3 -aminopropane- 1,2-diyl di tetradecanoate:
[0266] 100 mL two neck RBF was charged with 3 -((tert-butoxy carbonyl) amino) propane- 1,2- diyl ditetradecanoate (3) (2.7 g, 4.41 mmol, 1.0 eq.) in DCM (40.0 mL) and cooled this solution using an icebath. Then, TFA (5 mL, 64.9 mmol, 14.71 eq.) was added drop by drop. Then, the reaction mixture was stirred at room temperature for 5 h. The completion of the reaction was monitored by TLC. After completion of the reaction the sovent was evaporated under reduced pressure and washed with ether to precipitate white solid. The residue washed three time to remove complete removal of residual TFA to obtain desired compound 4 (1.75 g; 77.7%) afforded as a white solid, which was confirmed byJH NMR and HPLC-ELSD (96.41% purity).JH NMR (400 MHz, CDC13) 8 ppm: 0.83 - 0.86 (t, J=7.2 Hz, 6 H) 1.15 - 1.30 (br s, 41 H) 1.49 (s, 4 H) 2.25 - 2.36 (m, 4 H) 3.00 - 3.06 (m, 1 H), 3.13-3.17 (dd, J2= 3.2 Hz, Jl=13.2 Hz, 1H), 5.16-5.21 (m, 1H) 7.95(s, 3H).
[0267] Step 3: Polymerisation:
[0268] 50 mL Schlenk tube was charged with 3-methyloxazolidine-2, 5-dione (5) (0.500 g,4.068 mmol, 33 eq) in dry THF (7 mL) and then at 50 °C, 3 -aminopropane- 1,2-diyl ditetradecanoate (4) (0.063 g, 0.124 mmol, 1.0 eq.) dissolved in dry THF (1 mL) was added under argon atmosphere and the reaction mixture was stirred at same temperature for 16 h. Reaction progress was monitored by TLC. After completion, the reaction mixture was cooled to RT and concentrated under reduced pressure. Then crude compound was precipitated in cold diethyl ether and concentrated under reduced pressure to obtain desired compound (0.300 g, yield: 79.78%) as colorless gummy solid, which was confirmed by 'H NMR as per 'H NMR analysis 35 repeating monomer units was calculated.1H NMR (400 MHz, CDCI3) 6 ppm: 0.86 - 0.89 (t, .7=6.4 Hz, 6 H) 1.18 - 1.38 (m, 40 H) 1.56 - 1.6 (m, 4 H) 2.21 - 2.37 (m, 8 H) 2.53 - 2.83 (m, 10 H) 2.90 - 3.08 (m, 104 H) 3.96 - 4.30 (m, 72 H).
[0269] Step 4: Acylation:
[0270] 25 mL two neck RBF was charged with comp 6 (0.300 g, 0.098 mmol, l.Oeq.) in N,N-dimethylformamide (2.0 mL) and then at 0 °C diisopropylethylamine (0.08 mL, 0.490 mmol, 5.0 eq.) was added and stirred for 30 minutes at RT. Then, to this reaction mixture, acetic anhydride(0.03 mL, 0.294 mmol, 3.0 eq.) was added and stirred for 16 h. Reaction progress was monitored by TLC. After completion, the reaction mixture was cooled to 0 °C and solvent evaporated under reduced pressure. This crude reaction mixture was precipitated in cold diethyl ether (2 mL) to form solid and then filtered and followed by washing with n-hexane (22 mL). This crude solid was further purified by dissolving in minimum volume DCM and then precipitated in diethyl ether. This solid was further purified by dialysis (M. Wt cut-off 1000 KDa) against water for 4 h and then aqueous solution lyophilised for 48 h to obtain desired compound 7 (0.090 g; yield: 29.60%) as off white solid, which was confirmed byJH NMR and GPC (100 %)) as perJH NMR analysis 22 repeating monomer units was calculated.JH NMR (400 MHz, CDCh) 8 ppm: 0.86 - 0.89 (t, .7=6.4 Hz, 6 H) 1.23 - 1.39 (m, 41 H) 1.55 - 1.63 (m, 4 H) 1.99 - 2.09 (m, 14 H) 2.12 - 2.27 (m, 14 H) 2.28 - 2.33 (m, 7 H) 2.92 - 3.09 (m, 64 H) 3.30 - 3.46 (m, 2 H) 3.95 - 4.27 (m, 45 H) 4.28 - 4.37 (m, 2 H) 5.02 - 5.08 (m, 1 H) GPC (100%). HRMS mass observed in the range 1400-2200 Da with monomer mass difference.
[0271] Table 6 List of chemicals and sources used for synthesisExample 11
[0272] In vitro studies (GFP expression)
[0273] BHK, Jurkat and U937 cells were cultured and seeded (96 well-plate, 0.1 mL / well, 12,000 cell / well). Afterwards, cells were treated with the GFP mRNA loaded LNPs for 24 h followed by analysis by fluorescence microscopy. In vitro potency of LNPs (lipid composition: 60% PNI762, 35% Choi, 5% stabilizer), payload: enhanced green fluorescent protein (eGFP) mRNA). The cell lines tested include Jurkat (FIGS. 12A-12B), BHK (FIGS. 12C-12D), and HepG2 (FIGS. 12E-12F). The non-PEG stabilizer (e.g., SAF266, SAF293 and SAF295) outperformed PEG-lipid (e.g., PEG-DMG) in vitro.Example 12
[0274] T cell GFP expression studies (ex vivo)
[0275] Cryopreserved primary human pan T cells were thawed, activated using CD3 / CD28 / CD2 T cell activator and cultured (96 well-plate, 0.2 mL / well, 0.125 million cell / well) for 3 days in the incubator (37 °C, 95% humidity and 5% CO2). Afterwards, cells were treated with the GFP mRNA loaded LNPs (4 pg / well) for 24 h followed by staining and flow cytometry analysis. For cell staining, cells were stained with FVS660 dye (BD Biosciences) according to the manufacturer’s protocols. The data were interpreted using CytExpert software and the transfection efficiency (TE) % and mean fluorescence intensity (MFI) of the LNP samples were calculated. Ex vivo activity using primary T cells. Transfection efficiency% (FIG. 13A) mean fluorescence intensity (MFI) (FIG. 13B) for LNPs based on 60% PNI762, 35% Choi, 5% stabilizer and enhanced green fluorescent protein (eGFP) mRNA 24 h post treatment analyzed by flow cytometry. It was demonstrated that among non-PEG stabilizers tested, SAF246 and SAF266 were clearly shown to outperform PEG-lipids (e.g., BrijSlO and PEG-DMG) ex vivo. Other non-PEG stabilizers e.g., SAF293 and 295 match PEG-lipids. Dosing was 3 pg or 1 pg per million cells.
[0276] In vivo gene editing
[0277] An in vivo gene editing study was performed to assess the gene knock out (KO) efficiency of the LNPs formed based on non-PEG stabilizers. Mice were administered a single intravenous dose of 1 mg / kg (1 mpk) total RNA in a 200 pL injection volume. Sera samples were collected at 6 hours and 7 days post-injection. TTR protein levels in serum were quantified using ELISA. Gene editing efficiency was determined by comparing TTR concentrations in treated animals to those in control mice injected with phosphate-buffered saline (PBS) and calculating the percentage of TTR knockdown. In vivo gene editing using LNPs formed based on 40% PNI769, 57.5% cholesterol and 2.5% SAF297 and Transthyretin guide RNA (TTR gRNA) and Cas9 mRNA showed some TTR gene KO using SAF297 (FIG 14).
[0278] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0279] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodimentsmay become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
Claims
CLAIM(S):
1. A lipid nanoparticle composition comprising: (a) an ionizable lipid; (b) a sterol; and (c) a stabilizer.
2. The lipid nanoparticle composition of claim 1 consisting essentially of: (a) the ionizable lipid; (b) the sterol; and (c) the stabilizer.
3. The lipid nanoparticle composition of claim 1 or 2, wherein the lipid nanoparticle composition is substantially free of polyethylene glycol (PEG) and PEG-R, wherein R is any atom or molecule covalently attached to PEG.
4. The lipid nanoparticle composition of any one of claims 1-3, wherein the ionizable lipid is DODMA, DLin-MC3-DMA, DLin-KC2-DMA, B0CHD-C3-DMA, C12-200, PNI 516, PNI 127, PNI 550, PNI 560, PNI 580, PNI 659, PNI 660, PNI 728, PNI 762, PNI 769, or a combination thereof.
5. The lipid nanoparticle composition of any one of claims 1-4, wherein the lipid nanoparticle composition is substantially free of a structural lipid.
6. The lipid nanoparticle composition of any one of claims 1-5, wherein the sterol comprises cholesterol, beta-sitosterol, 20-alpha-hydroxysterol, phytosterol, derivatives thereof, or a combination thereof.
7. The lipid nanoparticle composition of any one of claims 1-6, wherein the stabilizer comprises the structure of formula (I):wherein Ri is hydrogen, Cuis substituted or unsubstituted heteroalkyl group, Ci-i8 unsaturated heteroalkyl group, Cuis heterocyclyl group, Ci-i8 charged heteroalkyl group, or Ci-i8 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; R3 is hydrogen, a targeting ligand, a hydrophilic group, an amphiphilic group, or a combination thereof;A is a C1-C50 substituted or unsubstituted heteroalkyl group, a C1-C50 unsaturated heteroalkyl group, or a combination thereof; and m is an integer from 5 to 1000.
8. The lipid nanoparticle composition of claim 7, wherein A iswherein s and t are each independently an integer from 12 to 20.
9. The lipid nanoparticle composition of claim 7, wherein the stabilizer is SAF06, SAF10, SAF15, SAF25, SAF89, SAF92, SAF93, SAF182, SAF183, SAF184, SAF266, SAF292, SAF293, SAF294, SAF295, SAF296, SAF297, SAF321, SAF322, SAF323, SAF324, SAF325, or combinations thereof.
10. The lipid nanoparticle composition of any one of claims 1-6, wherein the stabilizer comprises the structure of formula (II):wherein Y is hydrogen, methyl, C1-C24 substituted or unsubstituted heteroalkyl group, Ci- Cis unsaturated heteroalkyl group, C1-C24 heterocyclyl group, Ci-Cis charged heteroalkyl group, Ci-Cis heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; Xi, X2, X3, X4, X5 and Xe are each independently hydrogen, C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 heterocyclyl group, C1-C50charged heteroalkyl group, C1-C50 heteroalkyl group having an oxygen, sulfur, or nitrogen atom, or a combination thereof; and p, q and r are each independently an integer from 2 to 600.
11. The lipid nanoparticle composition of claim 10, wherein Xi, X2, X3, X4, X5 and Xe are each independently hydrogen,wherein s and t are each independently an integer from 12 to 20.
12. The lipid nanoparticle composition of claim 10, wherein the stabilizer is SAF19, SAF97, SAF98, SAF128, or combinations thereof.
13. The lipid nanoparticle composition of any one of claims 1-6, wherein the stabilizer comprises the structure of formula (III):wherein A is S, NH, O, Cns substituted or unsubstituted alkyl or heteroalkyl group, a hydrophilic group, a glyceryl group, a heterocyclic group, a phospholipid group, a ceramide group, an ionizable group, a triazole group, or a combination thereof; B is CH2, a triazole group or a Ci- is amino oxobutanoate group or a Cuis substituted or unsubstituted alkyl or heteroalkyl group; C is a Ci-50 substituted or unsubstituted heteroalkyl group, C1-50 unsaturated heteroalkyl group, C1-50 heterocyclic group, C1-50 charged heteroalkyl group, or a combination thereof; T is hydrogen, a Ci- 18 carbonothioate group, Cuis substituted or unsubstituted alkyl or heteroalkyl group, a Cuis ionizable group, a Cuis targeting group, a hydrophilic group, an amphiphilic group, or a combination thereof; D is H, C1-5 substituted or unsubstituted alkyl or heteroalkyl group, or hydroxyl group and m is an integer from 15 to 500.P2023-3770-I / I / O14. The lipid nanoparticle composition of claim 13, wherein T is hydrogen, methyl,wherein Y is O or S and R is an alkyl with 1-4 carbons, a peptide, an antibody, a sugar, an oligosaccharide, an aminoglycoside, a sterol, phenyl boronic acid, or a combination thereof.
15. The lipid nanoparticle composition of claim 13 or 14, wherein Ais sulfur, a triazole group, or an ester (-C(=O)O-); B is CH2, triazole group, or a C3-C6 amino oxobutanoate group; T is hydrogen, a C1-C5 carbonothioate group, a C1-C5 ionizable group, a C1-C5 targeting group, a hydrophilic group, an amphiphilic group, or a combination thereof; and m is an integer from 15 to 400.
16. The lipid nanoparticle composition of any of claims 13-15, wherein Ais sulfur or a tri azole group.
17. The lipid nanoparticle composition of any of claims 13-15, wherein A comprises an ester (-C(=O)O-).
18. The lipid nanoparticle composition of any of claims 13-16, wherein C isu •+u wherein s and t are each independently an integer from 12 to 20.
19. The lipid nanoparticle composition of any one of claims 13-18, wherein the stabilizer is SAF29, SAF29A, SAF29B, SAF29C, SAF30, SAF34, SAF102, SAF102A, SAF102B, SAF102C, SAF102D, SAF103, SAF104, SAF123, SAF124, SAF125, SAF126, SAF127, SAF133, SAF134, SAF135, SAF136, SAF137, SAF138, SAF139, SAF141, SAF149, SAF150, SAF154, SAF167, SAF178, SAF190, SAF191, SAF246, SAF312, SAF327, SAF328,or combinations thereof.
20. The lipid nanoparticle composition of any one of claims 1-6, wherein the stabilizer comprises the structure of formula (IV):wherein R is hydrogen, a targeting ligand, a hydrophilic group, anamphiphilic group, or a combination thereof; A, B, D, and E are each individually and independently a Cuis heteroalkyl group; C is a C1-C50 substituted or unsubstituted heteroalkyl group, C1-C50 unsaturated heteroalkyl group, C1-C50 charged heteroalkyl group, C1-C50 heterocyclyl group, or a combination thereof; and x is an integer from 3 to 1000.
21. The lipid nanoparticle composition of claim 20, wherein A comprises an amidate structure according to:wherein p and q are independently integers from 1 to 4.
22. The lipid nanoparticle composition of claim 20 or 21, wherein A is -NH-(CH2)P-O- (CH2)q-H, wherein p and q are each individually and independently 1-4.
23. The lipid nanoparticle composition of any one of claims 20-22, wherein B is, m and n are each independently an integer from 1 to 10.
24. The lipid nanoparticle composition of any one of claims 20-23, wherein C iswherein s and t are each independently an integer from 12 to 20.
25. The lipid nanoparticle composition of any one of claims 20-24, wherein the stabilizer is SAF41, SAF44, SAF45, SAF54, SAF84, SAF 85, SAF 86, SAF 87, SAF 88, SAF130, SAFI 32, SAF 160, SAF 164, SAF 165, SAF 166, SAF 197, SAF197A, SAF197B, SAF197C, SAF197D, SAF197E, SAF198, SAF200, SAF206, SAF207, SAF315, SAF315A, SAF315B, SAF315C, SAF315D, SAF316, SAF318, SAF329, SAF278, or combinations thereof26. The lipid nanoparticle composition of any one of claims 1-6, wherein the stabilizer comprises the structure of formula (V):wherein R is n, iso, sec, neo or tert C1-12 alkyl group; D is H, OH, piperidine, an alkylamine, amide, carboxylate, alkoxy, thiol or a targeting group; A is O, N, S, a triazole, amide, ester, disulfide, phosphate, sugar, or benzyl; B is H or a hydrophobic group comprising methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-24 alkyl with or without heteroatoms N, S, or O; and n is an integer from 5 to 200.
27. The lipid nanoparticle composition of claim 26, wherein the stabilizer is SAF07, SAF11, SAF12, SAF13, SAF20, SAF21, SAF22, SAF23, SAF24, SAF31, SAF32, SAF33, SAF48, SAF90, SAF95, SAF96, or combinations thereof.
28. The lipid nanoparticle composition of any one of claims 1-6, wherein the stabilizer comprises the structure of formula (VI):wherein A and B are each individually and independently H or a hydrophobic group comprising methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and nonbranched or branched C3-C24 alkyl with or without heteroatoms N, S, or O; C is H, methyl, ethyl or substituted or unsubstituted and saturated or unsaturated and non-branched or branched C3-C 12alkyl; D is H, methyl, ethyl, substituted or unsubstituted and saturated or unsaturated and nonbranched or branched C3-C12 alkyl, acetyl, C3-C12 acyls, hydrophilic groups, or targeting moieties; E is H, methyl, ethyl, propyl, butyl, methoxy, ethoxy, a carboxylate, thiol, sulfane, alkoxy, alkanol, alkylamine, alkylamide, alkylbenzene, alkylphenol, alkylpyrrolidone, alkylimidazole, alkylindole, or alkylguanidine; and n is an integer from 5 to 1000.
29. The lipid nanoparticle composition of claim 28, wherein the stabilizer is SAF01, SAF02, SAF03, SAF04, SAF05, SAF08, SAF09, SAF16, SAF35, SAF49, SAF50, SAF51, SAF52, SAF62, SAF63, SAF64, SAF65, SAF66, SAF67, SAF68, SAF69, SAF70, SAF71, SAF72, SAF73, SAF74, SAF75, SAF76, SAF77, SAF78, SAF83, SAF100, SAF101, SAF105, SAFI 06, SAFI 40, or combinations thereof.
30. The lipid nanoparticle composition of any one of claims 1-29, wherein the stabilizer has a molecular weight of about 500 Da to about 50,000 Da.
31. The lipid nanoparticle composition of any one of claims 1-30, wherein the lipid nanoparticle composition comprises about 10 to about 90 mol% ionizable lipid, about 10 to about 80 mol% sterol, and about 0.1 to about 10 mol% stabilizer.
32. A lipid nanoparticle comprising the lipid nanoparticle composition of any one of claims 1-31 and a nucleic acid.
33. The lipid nanoparticle of claim 32, wherein the nucleic acid is encapsulated by the lipid nanoparticle composition.
34. The lipid nanoparticle of claim 32 or 33, wherein the nucleic acid is an antisense oligonucleotide, a siRNA, a miRNA, a self-amplifying RNA (SAM or saRNA), a self-replicating DNA, an LNA, a DNA, a replicon, an mRNA, a guide RNA, a transposon, a single gene, a vector, a plasmid, a viral particle, an AAV, a complex of RNA and RNA-binding protein, a circular RNA, or a combination thereof.
35. The lipid nanoparticle of any one of claims 32-34, wherein the nucleic acid is an antigen encoded mRNA for prophylactic or therapeutic vaccine, a nucleic acid for gene therapy, or a nucleic acid for immunogenic cell incorporation, wherein the immunogenic cell is a T cell, natural killer cell, dendritic cell, or tumor-infiltrating leukocyte.
36. The lipid nanoparticle of any one of claims 32-35, wherein the lipid nanoparticle has a diameter of about 15 nm to about 500 nm.
37. The lipid nanoparticle of any one of claims 32-36, wherein the lipid nanoparticle has a poly dispersity index of about 0.01 to about 0.40.
38. The lipid nanoparticle of any one of claims 32-37, wherein the lipid nanoparticle has an encapsulation efficiency of about 50% to about 100%.
39. A pharmaceutical composition comprising the lipid nanoparticle composition of any one of claims 32-38 and a pharmaceutically acceptable carrier.
40. A method for preparing the lipid nanoparticle of any one of claims 32-38 or the pharmaceutical composition of claim 39, the method comprising:(i) forming the lipid nanoparticle composition by combining the ionizable lipid, the sterol, and the stabilizer;(ii) preparing the lipid nanoparticle by combining the lipid nanoparticle composition and the nucleic acid using a microfluidic mixer; and(iii) purifying the lipid nanoparticle.
41. The method of claim 40, wherein the lipid nanoparticle composition and the nucleic acid are combined using a flow ratio of about 1 : 1 to about 10: 1 by volume (aqueous phase: organic phase) at a N / P ratio of about 2 to about 20, and a total flow rate of about 2 to about 2000 mL / min.
42. The method of claim 41, wherein the aqueous phase comprises a low pH buffer.
43. The method of claims 41 or 42, wherein the aqueous phase comprises a citrate or acetate buffer.
44. The method of any one of claims 41-43, wherein the organic phase comprises 1,4- dioxane, tetrahydrofuran, acetone, acetonitrile, dimethyl sulfoxide, dimethylformamide, acids, alcohols, or a combination thereof.
45. The method of any one of claims 41-44, wherein the organic phase is an alcohol and the alcohol comprises aqueous or anhydrous alcohol, wherein the alcohol is a primary, secondary, or tertiary alcohol having from 1 to 12 branched or unbranched carbons.
46. Use of the lipid nanoparticle of any one of claims 32-38 or the pharmaceutical composition of claim 39 for preventing, treating, or ameliorating conditions or diseases comprising administering the lipid nanoparticle as a vaccine or as a treatment to prevent or reduce the severity of a contagion, administering the lipid nanoparticle as a gene therapeutic, or administering the lipid nanoparticle to an immunogenic cell for the treatment of cancer or an infection.
Citation Information
Patent Citations
Method for Ranking Library Hits from Gas Chromatography - Mass Spectrometry
US62635379P0
Ionizable lipids for nucleic acid delivery
WO2020252589A1
Ionizable lipids for nucleic acid delivery
WO2021000041A1
Compositions for transfecting resistant cell types
WO2019210394A1
RNA particles comprising polysarcosine
WO2020069718A1