Antibody oligonucleotide conjugates comprising an antisense polynucleotide agent conjugated to a CD33 antibody and methods of use thereof

Conjugating antisense polynucleotides with CD33 antibodies addresses low microglial uptake of ASOs, improving therapeutic efficacy in neurodegenerative diseases by enhancing targeted gene modulation in microglia.

WO2026055461A1PCT designated stage Publication Date: 2026-03-12APERTURE THERAPEUTICS INC
View PDF 177 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/045099
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-05
Filing Date
2025-09-05
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

Current therapies for neurodegenerative diseases like ALS and FTD face challenges in effectively targeting microglia due to low uptake and fast clearance of small molecular ASOs, leading to off-target effects and limited therapeutic efficacy.

Method used

Conjugation of antisense polynucleotides with CD33 antibodies, specifically single-chain variable fragments (scFv), to enhance delivery to microglia, utilizing linkers and modified nucleotides for targeted gene modulation.

Benefits of technology

Enhanced microglial delivery and inhibition of target gene expression, reducing neuroinflammation and disease progression in neurodegenerative disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000027_0001
    Figure IMGF000027_0001
  • Figure IMGF000062_0001
    Figure IMGF000062_0001
  • Figure IMGF000063_0001
    Figure IMGF000063_0001
Patent Text Reader

Abstract

The present disclosure relates to antibody oligonucleotide conjugates (AOCs) comprising an antisense polynucleotide agent conjugated to a CD33 antibody, methods of use thereof, and methods of producing.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Atorney Docket No. 138777-00120

[0002] ANTIBODY OLIGONUCLEOTIDE CONJUGATES COMPRISING AN ANTISENSE POLYNUCLEOTIDE AGENT CONJUGATED TO A CD33 ANTIBODY AND METHODS OF USE THEREOF

[0003] RELATED APPLICATIONS

[0004] The instant application claims priority to U.S. Provisional Application No. 63 / 690,860, filed on September 5, 2024. The entire contents of the foregoing application are expressly incorporated by reference herein.

[0005] BACKGROUND

[0006] Drug discovery for severe neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), is facing a transformational change with the advancement of chemically modified antisense oligonucleotides (ASOs) that allow precise targeting of genetic targets on a transcript level (Roberts et al., Nat. Rev. Drug Discov. 19, 673-694, 2020; Romano and Bucci, Neural Regen. Res., 19, 1027-1035, 2024; and Bennet et al., Annu. Rev. Pharmacol. Toxicol, 61: 831-852, 2021). The first generation of therapeutic ASOs was successfully developed to reduce expression of broadly expressed genes whose rare mutations result in a higher propensity for toxic protein aggregation (e.g., SOD1, FUS). But these mutations are found only in a small subset of familial disease cases and depletion of protein aggregates in the symptomatic patients results in a limited effect on the disease progression.

[0007] Neurodegenerative diseases are highly variable with significant range in the age at onset, progression rate, and survival driven partly by genetic factors. There is a need to develop ALS and FTD therapeutics by modulating function of genes whose hypomorphic genetic variants demonstrate strong association with delayed disease onset, slower disease progression, and longer survival. Several genetic disease modifiers have been identified and experimentally validated, and ASOs have been designed that efficiently modulate their expression in vitro. Consistent with the field that increasingly recognizes the causal role of immune response and inflammation in age-related neurodegenerative diseases, many of these genetically supported drug targets were found to be unique to microglia, the immune cells of the central nervous system (CNS).

[0008] Microglia have become a significant cell-type of interest in treatment of neurodegeneration with more than 70 ongoing programs developing drugs for targets like TREM2, CSF1R, or complement factors to curb pathologic neuroinflammation. However, microglia represent only -10% of all cells that take up the ASOs in the CNS. Moreover, the small molecular size of ASOs leads to their fast clearance from the cerebrospinal fluid. Therefore, minority of the drug will make it to the cells where it can be effective, and non-targeted cells like neurons, astrocytes, or oligodendrocytes must withstand any unnecessary off-target effects. A generalizable technology increasing ASO uptake by microglia would be beneficial for development of targeted therapeutics.

[0009] 1

[0010] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0011] SUMMARY

[0012] As described in more detail below, the fact that the developmental origin of microglia is from the myeloid cell lineage in the bone marrow was leveraged herein, leading to overlapping gene expression profdes with some normal and cancerous immune cells, including the expression of the CD33 receptor. The instant application provides enhanced microglial delivery of ASOs by their conjugation with single-chain CD33 antibodies.

[0013] In one aspect, the present disclosure provides an antibody oligonucleotide conjugate (AOC) comprising an antisense polynucleotide agent conjugated to an anti-CD33 antibody, e.g., scFv.

[0014] In one embodiment, the antisense polynucleotide agent comprises about 4 to about 50 contiguous nucleotides. In one embodiment, substantially all of the nucleotides of the antisense polynucleotide agent are modified nucleotides. In one embodiment, all of the nucleotides of the antisense polynucleotide agent are modified nucleotides. In one embodiment, the antisense polynucleotide agent is 18 to 30 nucleotides in length, 10 to 24 nucleotides in length, 18 to 24 nucleotides in length, 20 nucleotides in length, or 14 nucleotides in length.

[0015] In one embodiment, the antisense polynucleotide agent is capable of binding to a Metastasis Lung Cancer Associated Transcript 1 (MALAT1) or Superoxide Dismutase 1 (SOD1) target sequence. In one embodiment, the MALAT1 target sequence is a non-coding MALAT1 ribonucleic acid (RNA) sequence. In one embodiment, the antisense polynucleotide agent comprises a sequence of GCCAGGCTGGTTATGACTCA (SEQ ID NO: 8). In one embodiment, the sequence GCCAGGCTGGTTATGACTCA (SEQ ID NO: 8) comprises modified nucleotides. In one embodiment, the sequence GCCAGGCTGGTTATGACTCA (SEQ ID NO: 8) comprises

[0016] / 52MOErG / * / i2MOErC / / i2MOErC / / i2MOErA / / i2MOErG / G* C*T*G*G*T*T*A*T*G* / i2MOEr A / / i 2MOErC / / i2MOErT / * / i2MOErC / * / 32MOErA / .

[0017] In some embodiments, the antisense polynucleotide agent is capable of binding to a target selected from the group consisting of MALAT1, SOD1, CSF1R (colony stimulating factor 1 receptor), NLRP3 (NLR family pyrin domain containing protein 3), MMP9 (matrix metalloproteinase-9), TREM2 (triggering receptor expressed on myeloid cells 2), FN1 (fibronectin 1), CHIT1 (chitotriosidase), and CHI3L1 (chitinase -3 -like protein 1).

[0018] In one embodiment, the CD33 antibody is a single-chain variable fragment (scFv). In one embodiment, the scFv comprises an amino acid linker connecting the heavy and light chain variable domains, wherein the amino acid linker comprises the amino acid sequence of CPPC (SEQ ID NO: 9). In one embodiment, the CD33 antibody is gemtuzumab or an scFv fragment thereof, lintuzumab or an scFv fragment thereof, vadastuximab or an scFv fragment thereof, AVE9633 or an scFv fragment thereof, IMGN779 or an scFv fragment thereof, or hu-MY9-6 or an scFv fragment thereof.

[0019] In one embodiment, the antisense polynucleotide agent is conjugated to the CD33 antibody via a linker. In one embodiment, the linker comprises a cysteine, lysine, glutamine and / or unnatural

[0020] 2

[0021] MEl\57477843.v2 Atorney Docket No. 138777-00120 amino acid. In one embodiment, the linker is a cleavable linker. In one embodiment, the linker is a hydrazone linker or valine -citrulline dipeptide linker. In one embodiment, the linker comprises polyethylene glycol (PEG). In one embodiment, the linker does not comprise PEG.

[0022] In one embodiment, the AOC is capable of accumulating in the microglia of a subject to which the AOC is administered.

[0023] In one aspect, disclosed herein is a pharmaceutical composition comprising the AOC of any one of the previous claims and a pharmaceutically acceptable carrier. In one embodiment, the pharmaceutical composition is for use in treating a neurodegenerative disease or disorder. In one embodiment, the neurodegenerative disease or disorder is an age-related degeneration or disease where chronic or acute neuroinflammation occurs as a pathology. In one embodiment, the neurodegenerative disease or disorder is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Parkinson’s disease, Alzheimer’s disease, multiple sclerosis, Charcot-Marie-Tooth disease, Huntington’s disease, chemotherapy-induced peripheral neuropathy, Guillian-Barre syndrome, neuromyelitis optic spectrum disorder, acute disseminated encephalomyelitis, myasthenia gravis, cerebral vasculitis, HIV-associated neurocognitive disorders, prion diseases, Hashimoto encephalopathy, or Rasmussen’s encephalitis.

[0024] In one aspect, disclosed herein is a method of inhibiting expression of a target sequence in a cell, the method comprising (a) contacting the cell with an AOC disclosed herein or a pharmaceutical composition disclosed herein; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain antisense inhibition of the target sequence, thereby inhibiting expression of the target sequence in the cell. In one embodiment, the cell is within a subject. In one embodiment, the cell is a microglial cell.

[0025] In one aspect, disclosed herein is a method of method of treating a subject that would benefit from reduction of expression of a target sequence, the method comprising administering to the subject a therapeutically effective amount of an AOC disclosed herein or a pharmaceutical composition disclosed herein, thereby treating the subject. In one embodiment, the subject has a neurodegenerative disease or disorder.

[0026] In one aspect, disclosed herein is method of preventing at least one symptom of a neurodegenerative disease or disorder in a subject that would benefit from reduction of expression of a target sequence, the method comprising administering to the subject a therapeutically effective amount of an AOC disclosed herein or a pharmaceutical composition disclosed herein, thereby preventing at least one symptom of the neurodegenerative disease or disorder in the subject.

[0027] In one embodiment, the neurodegenerative disease or disorder is an age-related degeneration or disease where chronic or acute neuroinflammation occurs as a pathology. In one embodiment, the neurodegenerative disease or disorder is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Parkinson’s disease, Alzheimer’s disease, multiple sclerosis, Charcot-Marie-Tooth disease, Huntington’s disease, chemotherapy-induced peripheral neuropathy, Guillian-Barre

[0028] 3

[0029] MEl\57477843.v2 Atorney Docket No. 138777-00120 syndrome, neuromyelitis optic spectrum disorder, acute disseminated encephalomyelitis, myasthenia gravis, cerebral vasculitis, HIV-associated neurocognitive disorders, prion diseases, Hashimoto encephalopathy, or Rasmussen’s encephalitis.

[0030] In one embodiment, the subject is a human.

[0031] In one embodiment, target sequence expression is inhibited by at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In another embodiment, RNA splicing through sequence-dependent binding to of the AOC to target RNA transcript(s) occurs at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%.

[0032] In one aspect, disclosed herein is a method of producing an AOC disclosed herein, the method comprising conjugating the antisense polynucleotide agent with the CD33 antibody. In one embodiment, the conjugation is maleimide-thiol conjugation, direct conjugation using unnatural amino acids, non-specific NHS-ester based heterobifimctional linker conjugation, or conjugation using a microbial transglutaminase. In one embodiment, one antisense polynucleotide agent is conjugated to one CD33 antibody. In another embodiment, 1-4 antisense polynucleotide agents are conjugated to one CD33 antibody. In one embodiment, 2 antisense polynucleotide agents are conjugated to one CD33 antibody. In another embodiment, 3 antisense polynucleotide agents are conjugated to one CD33 antibody. In another embodiment, 4 antisense polynucleotide agents are conjugated to one CD33 antibody.

[0033] BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1: CD33 cell surface protein expression is completely depleted upon CD33 knockout in U937 cells. Paraformaldehyde -fixed U937 wild-type and CD33 KO cells were stained with CD33 antibody (gemtuzumab) conjugated to FITC fluorescent dye. The relative fluorescent intensity (FI, y axis) was measured using flow cytometry and ploted forward scater / cell size (FSC, x axis).

[0035] Figure 2: Measuring uptake and potency of MALAT1 ASO: A) U937 cells were treated with 5 pM MALAT1 ASO conjugated to Ato488 fluorescent dye, and the uptake was measured using flow cytometry at timepoints ranging from 30 min to 3 days. B) U937 cells were treated with IpM MALAT1 ASO - Ato488 and the uptake was measured using live fluorescence imaging on IncuCyte. Non-treated cells (NTC) were used as a control. C) iPSC-derived microglia were treated with IpM - 25 pM MALAT1 ASO for 2 days and the dose -dependent decrease in RNA transcript level was measured by qPCR.

[0036] Figure 3: Measuring uptake and potency of MALAT1 ASO: Lintuzumab scFv was conjugated to fluorophore and fluorescent-ASO (APRTX AOC). These along with the free ASO were tested for binding selectivity to CD33 protein on live WT and KO U937 cells using flow cytometry.

[0037] Figure 4 provides gel electrophoresis data demonstrating successful conjugation of an scFv to the fluorescent label Ato488 using thiol-maleimide chemistry. 2 pg of scFv Ato488 (lane 4) was ran

[0038] 4

[0039] MEl\57477843.v2 Atorney Docket No. 138777-00120 in lx MOPS buffer at 200V for 50 mins along with denatured scFv Ato488 (lane 2), HIM3 / 4-FITC (an anti-CD33 IgG labeled with fluorescein Isothiocyanate (FITC), lane 3), and P67.6-FITC (an anti- CD33 IgG labeled with FITC, lane 1). The scFv and antibody bands were imaged in the 488 nm channel. Colorimetric imaging was used for the ladder and then superimposed.

[0040] Figure 5 shows that scFvs retain selectivity to target CD33 receptors after conjugation to ASO. Live U937 WT and CD33 KO cells were stained with antibodies conjugated to a fluorophore (an anti-CD33 IgG (P67.6) and scFv) or ASO-fluorophore (scFv-ASO) on ice. Cells were also incubated with fluorescent ASO on ice as a control. The fluorescence was measured using flow cytometry and reported as median intensity normalized to WT (%) over time.

[0041] Figure 6 shows that scFv-ASO gets selectively taken up into cells expressing CD33. U937 WT and CD33 KO cells were treated with scFv-ASO (final cone. 1 pM) for 72 hours at 37 °C. Cells were fixed using 4% PFA and then imaged for uptake reported as GFP integrated density (a.u.).

[0042] Figure 7 shows that scFv-ASO gets selectively taken up into cells expressing CD33. U937 WT and CD33 KO cells were treated with scFv-ASO (final cone. 1 pM) for 72 hours at 37 °C. Cells were fixed using 4% PFA and then imaged for uptake reported as GFP positive cells (%) over time.

[0043] Figure 8 shows that scFv-ASO conjugates retain the potency of unconjugated ASO. Differentiated U937 WT cells (n=3) were treated with scFv, ASO and scFv-ASO IpM for 24 hours at 37°C. Cells were then lysed and the expression of target RNA was analyzed using qPCR. The data points were referenced to peptidylprolyl Isomerase B (PPIB) gene. Target RNA expression is reported as Log2 (fold change).

[0044] DETAILED DESCRIPTION

[0045] The present disclosure provides antisense oligonucleotides conjugated to CD33 antibodies, e.g., single-chain antibodies; compositions and kits comprising the same; and methods of use.

[0046] I. Definitions

[0047] In order that the present disclosure may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this disclosure.

[0048] The articles “a” and “an” are used herein to refer to one or to more than one (i. e. , to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.

[0049] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".

[0050] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise. For example, “sense strand or antisense strand” is understood as “sense strand or antisense strand or sense strand and antisense strand.”

[0051] 5

[0052] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0053] The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.

[0054] The term “at least”, “no less than”, or “or more” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 19 nucleotides of a 21 nucleotide nucleic acid molecule” means that 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.

[0055] As used herein, “no more than” or “or less” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1, or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range. As used herein, ranges include both the upper and lower limit.

[0056] As used herein, methods of detection can include determination that the amount of analyte present is below the level of detection of the method.

[0057] In the event of a conflict between an indicated target site and the nucleotide sequence for a sense or antisense strand, the indicated sequence takes precedence.

[0058] In the event of a conflict between a sequence and its indicated site on a transcript or other sequence, the nucleotide sequence recited in the specification takes precedence.

[0059] As used herein, an antibody oligonucleotide conjugate (“AOC”) is a molecule comprising an antisense polynucleotide agent (also referred to herein as an antisense oligonucleotide, or “ASO”) conjugated to an antibody, e.g., anti-CD33 antibody, e.g., anti-CD33 scFv. In one embodiment, AOCs are capable of decreasing or increasing the expression and / or activity of a target sequence. In one embodiment, AOCs are capable of RNA splicing modulation via the antisense oligonucleotide.

[0060] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a gene, including mRNA that is a product of RNA processing of a primary transcription product. In one embodiment, the target sequence is a nucleic acid molecule to which an antisense polynucleotide agent of the disclosure specifically hybridizes.

[0061] The target sequence may be from about 19-36 nucleotides in length, e.g., about 19-30 nucleotides in length. For example, the target sequence can be about 19-30 nucleotides, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20- 25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In certain embodiments, the target sequence is 19-23 nucleotides in length,

[0062] 6

[0063] MEl\57477843.v2 Atorney Docket No. 138777-00120 optionally 21-23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.

[0064] As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

[0065] “G,” “C,” “A,” “T,” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of oligonucleotides featured in the disclosure by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the disclosure.

[0066] In general, the majority of nucleotides of an oligonucleotide of the disclosure are ribonucleotides, but as described in detail herein, can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide or a modified nucleotide. In addition, as used in this specification, an “antisense polynucleotide agent” may include ribonucleotides with chemical modifications; an antisense polynucleotide agent may include substantial modifications at multiple nucleotides. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified intemucleotide linkage, or modified nucleobase, or any combination thereof. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to intemucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the disclosure include all types of modifications disclosed herein or known in the art. Any such modifications, are encompassed by “antisense polynucleotide agent” for the purposes of this specification and claims.

[0067] In certain embodiments of the instant disclosure, inclusion of a deoxy-nucleotide if present within an antisense polynucleotide agent can be considered to constitute a modified nucleotide.

[0068] As used herein, the term “region of complementarity” refers to the region of an antisense polynucleotide agent that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, or 3 nucleotides of the 5’- or 3 ’-end.

[0069] 7

[0070] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0071] Thus, an antisense polynucleotide agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, an antisense polynucleotide agent as described herein contains no more than 3 mismatches (i.e., 3, 2, 1, or 0 mismatches). In one embodiment, an antisense polynucleotide agent as described herein contains no more than 2 mismatches. In one embodiment, an antisense polynucleotide agent as described herein contains no more than 1 mismatch. In one embodiment, an antisense polynucleotide agent as described herein contains 0 mismatches. The methods described herein or methods known in the art can be used to determine whether an antisense polynucleotide agent containing a mismatch to a target sequence is effective in inhibiting the expression of a gene. Consideration of the efficacy of an antisense polynucleotide agent with mismatches in inhibiting expression of a gene is important, especially if the particular region of complementarity in a gene is known to have polymorphic sequence variation within the population.

[0072] As used herein, “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0073] As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.

[0074] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

[0075] Complementary sequences as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or

[0076] 8

[0077] MEl\57477843.v2 Atorney Docket No. 138777-00120 more, but generally not more than 5, 4, 3, or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression, in vitro or in vivo. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogsteen base pairing.

[0078] The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between two oligonucletoides or polynucleotides, such as between an antisense polynucleotide sequence and a target sequence, as will be understood from the context of their use.

[0079] As used herein, a polynucleotide that is “substantially complementary to at least part of’ a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding a gene). For example, a polynucleotide is complementary to at least a part of an mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding a gene.

[0080] Accordingly, in some embodiments, the antisense polynucleotides disclosed herein are fully complementary to the target sequence. In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target sequence and comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs disclosed herein, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.

[0081] In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the sense strand nucleotide sequences disclosed herein, or a fragment of any one of the sense strand nucleotide sequences disclosed herein, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary.

[0082] The terms “polynucleotide agent, ’’antisense polynucleotide agent”, “antisense polynucleotide”, “antisense oligonucleotide”, “ASO”, “antisense compound”, and “agent” as used interchangeably herein, refer to an agent comprising a single-stranded oligonucleotide that contains RNA as that term is defined herein, and which targets nucleic acid molecules of a target sequence. The antisense polynucleotide agents specifically bind to the target nucleic acid molecules via hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) and interfere with the normal function of the targeted nucleic acid (e.g., by an antisense mechanism of

[0083] 9

[0084] MEl\57477843.v2 Atorney Docket No. 138777-00120 action). This interference with or modulation of the function of a target nucleic acid by the polynucleotide agents of the present disclosure is referred to as “antisense inhibition.”

[0085] The functions of the target nucleic acid molecule to be interfered with may include functions such as, for example, translocation of the RNAto the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.

[0086] In some embodiments, antisense inhibition refers to “inhibiting the expression” of target nucleic acid levels or target protein levels in a cell, e.g., a cell within a subject, such as a mammalian subject, in the presence of the antisense polynucleotide agent complementary to a target nucleic acid as compared to target nucleic acid levels or target protein levels in the absence of the antisense polynucleotide agent. For example, the antisense polynucleotide agents of the disclosure can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355.

[0087] The term “antibody” is used herein in its broadest sense and includes certain types of immunoglobulin molecules comprising one or more antigen-binding domains that specifically bind to an antigen or epitope. The term antibody as used herein refers to a molecule comprising at least complementarity-determining region (CDR) 1, CDR2, and CDR3 of a single domain antibody (sdAb), wherein the molecule is capable of binding to an antigen. The term antibody also refers to molecules comprising at least CDR1, CDR2, and CDR3 of a heavy chain and CDR1, CDR2, and CDR3 of a light chain, wherein the molecule is capable of binding to an antigen. The term antibody also includes fragments that are capable of binding an antigen, such as Fv, single-chain Fv (scFv), Fab, Fab’, and (Fab’)2. The term antibody also includes chimeric antibodies, humanized antibodies, and antibodies of various species such as mouse, human, cynomolgus monkey, llama, camel, etc. The term also includes multivalent antibodies such as bivalent or tetravalent antibodies. A multivalent antibody includes, e.g., a single polypeptide chain comprising multiple antigen binding (CDR-containing) domains, as well as two or more polypeptide chains, each containing one or more antigen binding domains, such two or more polypeptide chains being associated with one another, e.g., through a hinge region capable of forming disulfide bond(s) or any other covalent or noncovalent interaction.

[0088] The term “heavy chain variable region” as used herein refers to a region comprising heavy chain CDR1, framework (FR) 2, CDR2, FR3, and CDR3. In some embodiments, a heavy chain variable region also comprises at least a portion of an FR1 and / or at least a portion of an FR4. In some embodiments, a heavy chain CDR1 corresponds to Kabat residues 26 to 35; a heavy chain CDR2 corresponds to Kabat residues 50 to 65; and a heavy chain CDR3 corresponds to Kabat residues 95 to 102. See, e.g., Kabat Sequences of Proteins of Immunological Interest (1987 and 1991, NIH, Bethesda, Md.); and Figure 1. In some embodiments, a heavy chain CDR1 corresponds to Kabat residues 31 to 35; a heavy chain CDR2 corresponds to Kabat residues 50 to 65; and a heavy chain CDR3 corresponds to Kabat residues 95 to 102. See id.

[0089] The term “heavy chain constant region” as used herein refers to a region comprising at least three heavy chain constant domains, CHI, CH2, and CH3. Nonlimiting exemplary heavy chain

[0090] 10

[0091] MEl\57477843.v2 Atorney Docket No. 138777-00120 constant regions include y, 5, and a. Nonlimiting exemplary heavy chain constant regions also include a and p. Each heavy constant region corresponds to an antibody isotype. For example, an antibody comprising a y constant region is an IgG antibody, an antibody comprising a 5 constant region is an IgD antibody, and an antibody comprising an a constant region is an IgA antibody. Further, an antibody comprising a p constant region is an IgM antibody, and an antibody comprising an 8 constant region is an IgE antibody. Certain isotypes can be further subdivided into subclasses. For example, IgG antibodies include, but are not limited to, IgGl (comprising a y 1 constant region), IgG2 (comprising a y2 constant region), IgG3 (comprising a y3 constant region), and IgG4 (comprising a y4 constant region) antibodies; IgA antibodies include, but are not limited to, IgAl (comprising an al constant region) and IgA2 (comprising an a2 constant region) antibodies; and IgM antibodies include, but are not limited to, IgMl and IgM2.

[0092] The term “heavy chain” (abbreviated HC) as used herein refers to a polypeptide comprising at least a heavy chain variable region, with or without a leader sequence. In some embodiments, a heavy chain comprises at least a portion of a heavy chain constant region. The term “full-length heavy chain” as used herein refers to a polypeptide comprising a heavy chain variable region and a heavy chain constant region, with or without a leader sequence.

[0093] The term “light chain variable region” as used herein refers to a region comprising light chain CDR1, framework (FR)2, CDR2, FR3, and CDR3. In some embodiments, a light chain variable region also comprises an FR1 and / or an FR4. In some embodiments, a light chain CDR1 corresponds to Kabat residues 24 to 34; a light chain CDR2 corresponds to Kabat residues 50 to 56; and a light chain CDR3 corresponds to Kabat residues 89 to 97. See, e.g., Kabat Sequences of Proteins of Immunological Interest (1987 and 1991, NIH, Bethesda, Md.).

[0094] The term “light chain constant region” as used herein refers to a region comprising a light chain constant domain, CL. Nonlimiting exemplary light chain constant regions include X and K.

[0095] The term “light chain” (abbreviate LC) as used herein refers to a polypeptide comprising at least a light chain variable region, with or without a leader sequence. In some embodiments, a light chain comprises at least a portion of a light chain constant region. The term “full-length light chain” as used herein refers to a polypeptide comprising a light chain variable region and a light chain constant region, with or without a leader sequence.

[0096] An “isolated antibody”, as used herein, is intended to refer to an antibody that is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds CD33 is substantially free of antibodies that specifically bind antigens other than CD33). An isolated antibody that specifically binds CD33 may, however, have cross-reactivity to other antigens, such as CD33 molecules from other species. Moreover, an isolated antibody may be substantially free of other cellular material and / or chemicals.

[0097] A “chimeric antibody” as used herein refers to an antibody comprising at least one variable region from a first species (such as mouse, rat, cynomolgus monkey, etc.) and at least one constant region from a second species (such as human, cynomolgus monkey, etc.). In some embodiments, a chimeric antibody comprises at least one mouse variable region and at least one human constant

[0098] 11

[0099] MEl\57477843.v2 Atorney Docket No. 138777-00120 region. In some embodiments, a chimeric antibody comprises at least one cynomolgus variable region and at least one human constant region. In some embodiments, a chimeric antibody comprises at least one rat variable region and at least one mouse constant region. In some embodiments, all of the variable regions of a chimeric antibody are from a first species and all of the constant regions of the chimeric antibody are from a second species.

[0100] A “humanized antibody” as used herein refers to an antibody in which at least one amino acid in a framework region of a non-human variable region has been replaced with the corresponding amino acid from a human variable region. In some embodiments, a humanized antibody comprises at least one human constant region or fragment thereof. In some embodiments, a humanized antibody is a sdAb, a Fab, an scFv, a (Fab’)2, etc. The humanized antibody can be selected from any class of immunoglobulins, including IgM, IgG, IgD, IgA and IgE, and any isotype, including without limitation IgGl, IgG2, IgG3 and IgG4. The humanized antibody may comprise sequences from more than one class or isotype, and particular constant domains may be selected to optimize desired effector functions using techniques well-known in the art.

[0101] A “human antibody” as used herein refers to antibodies produced in humans, antibodies produced in non-human animals that comprise human immunoglobulin genes, such as XenoMouse®, and antibodies selected using in vitro methods, such as phage display, wherein the antibody repertoire is based on a human immunoglobulin sequences.

[0102] The terms “an antibody, or antigen binding fragment thereof, that specifically binds CD33,” or “an anti- CD33 antibody or antigen binding fragment thereof,” used interchangeably herein, refer to an antibody, or antigen binding fragment thereof, that specifically binds to CD33, e.g., human CD33. An antibody “which binds” an antigen of interest, i.e., CD33, is one capable of binding that antigen with sufficient affinity such that the antibody is useful in targeting a cell expressing the antigen. In certain embodiments, the antibody specifically binds to human CD33. Unless otherwise indicated, the term “anti-CD33 antibody” is meant to refer to an antibody which binds to wild type CD33, a variant, or an isoform of CD33.

[0103] In one embodiment, the phrase “specifically binds to CD33” or “specific binding to CD33”, as used herein, refers to the ability of an anti- CD33 antibody to interact with CD33 with a dissociation constant (KD) of about 2,000 nM or less, about 1,000 nM or less, about 500 nM or less, about 200 nM or less, about 100 nM or less, about 75 nM or less, about 25 nM or less, about 21 nM or less, about 12 nM or less, about 11 nM or less, about 10 nM or less, about 9 nM or less, about 8 nM or less, about 7 nM or less, about 6 nM or less, about 5 nM or less, about 4 nM or less, about 3 nM or less, about 2 nM or less, about 1 nM or less, about 0.5 nM or less, about 0.3 nM or less, about 0. 1 nM or less, about 0.01 nM or less, or about 0.001 nM or less. In another embodiment, the phrase “specifically binds to CD33” or “specific binding to CD33”, as used herein, refers to the ability of an anti- CD33 antibody to interact with CD33 with a dissociation constant (KD) of between about 1 pM (0.001 nM) to 2,000 nM, between about 500 pM (0.5 nM) to 1,000 nM, between about 500 pM (0.5 nM) to 500 nM, between about 1 nM) to 200 nM, between about 1 nM to 100 nM, between about 1

[0104] 12

[0105] MEl\57477843.v2 Atorney Docket No. 138777-00120 nM to 50 nM, between about 1 nM to 20 nM, or between about 1 nM to 5 nM. In one embodiment, KD is determined by surface plasmon resonance or by any other method known in the art.

[0106] The terms “Kabat numbering,” “Kabat definitions,” and “Kabat labeling” are used interchangeably herein. These terms, which are recognized in the art, refer to a system of numbering amino acid residues which are more variable (i.e., hypervariable) than other amino acid residues in the heavy and light chain variable regions of an antibody, or an antigen binding portion thereof (Kabat et al. (1971) Ann. NY Acad, Sci. 190:382-391 and, Kabat, E.A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242). For the heavy chain variable region, the hypervariable region ranges from amino acid positions 31 to 35 for CDR1, amino acid positions 50 to 65 for CDR2, and amino acid positions 95 to 102 for CDR3. For the light chain variable region, the hypervariable region ranges from amino acid positions 24 to 34 for CDR1, amino acid positions 50 to 56 for CDR2, and amino acid positions 89 to 97 for CDR3.

[0107] As used herein, the term “CDR” refers to the complementarity determining region within antibody variable sequences. There are three CDRs in each of the variable regions of the heavy chain (HC) and the light chain (LC), which are designated CDR1, CDR2 and CDR3 (or specifically HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3), for each of the variable regions. The term “CDR set” as used herein refers to a group of three CDRs that occur in a single variable region capable of binding the antigen. The exact boundaries of these CDRs have been defined differently according to different systems. The system described by Kabat (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991)) not only provides an unambiguous residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries defining the three CDRs. These CDRs may be referred to as Kabat CDRs. Chothia and coworkers (Chothia &Lesk, J. Mol. Biol. 196:901-917 (1987) and Chothia et al., Nature 342:877-883 (1989)) found that certain sub- portions within Kabat CDRs adopt nearly identical peptide backbone conformations, despite having great diversity at the level of amino acid sequence. These sub-portions were designated as LI, L2 and L3 or Hl, H2 and H3 where the “L” and the “H” designates the light chain and the heavy chains regions, respectively. These regions may be referred to as Chothia CDRs, which have boundaries that overlap with Kabat CDRs. Other boundaries defining CDRs overlapping with the Kabat CDRs have been described by Padlan (FASEB J. 9: 133-139 (1995)) and MacCallum (J Mol Biol 262(5):732-45 (1996)). Still other CDR boundary definitions may not strictly follow one of the above systems, but will nonetheless overlap with the Kabat CDRs, although they may be shortened or lengthened in light of prediction or experimental findings that particular residues or groups of residues or even entire CDRs do not significantly impact antigen binding. The methods used herein may utilize CDRs defined according to any of these systems, although preferred embodiments use Kabat or Chothia defined CDRs.

[0108] As used herein, the term “framework” or “framework sequence” refers to the remaining sequences of a variable region minus the CDRs. Because the exact definition of a CDR sequence can be determined by different systems, the meaning of a framework sequence is subject to

[0109] 13

[0110] MEl\57477843.v2 Atorney Docket No. 138777-00120 correspondingly different interpretations. The six CDRs (CDR-L1, CDR-L2, and CDR-L3 of light chain and CDR-H1, CDR-H2, and CDR-H3 of heavy chain) also divide the framework regions on the light chain and the heavy chain into four sub-regions (FR1, FR2, FR3 and FR4) on each chain, in which CDR1 is positioned between FR1 and FR2, CDR2 between FR2 and FR3, and CDR3 between FR3 and FR4. Without specifying the particular sub-regions as FR1, FR2, FR3 or FR4, a framework region, as referred by others, represents the combined FR's within the variable region of a single, naturally occurring immunoglobulin chain. As used herein, a FR represents one of the four subregions, and FRs represents two or more of the four sub- regions constituting a framework region.

[0111] The framework and CDR regions of a humanized antibody need not correspond precisely to the parental sequences, e.g., the donor antibody CDR or the consensus framework may be mutagenized by substitution, insertion and / or deletion of at least one amino acid residue so that the CDR or framework residue at that site does not correspond to either the donor antibody or the consensus framework. In a preferred embodiment, such mutations, however, will not be extensive. Usually, at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% of the humanized antibody residues will correspond to those of the parental FR and CDR sequences. As used herein, the term “consensus framework” refers to the framework region in the consensus immunoglobulin sequence. As used herein, the term “consensus immunoglobulin sequence” refers to the sequence formed from the most frequently occurring amino acids (or nucleotides) in a family of related immunoglobulin sequences (See e.g., Winnaker, From Genes to Clones (Verlagsgesellschaft, Weinheim, Germany 1987). In a family of immunoglobulins, each position in the consensus sequence is occupied by the amino acid occurring most frequently at that position in the family. If two amino acids occur equally frequently, either can be included in the consensus sequence.

[0112] The term “epitope” refers to a region of an antigen that is bound by an antibody, or an antibody fragment. In certain embodiments, epitope determinants include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl, or sulfonyl, and, in certain embodiments, may have specific three dimensional structural characteristics, and / or specific charge characteristics. In certain embodiments, an antibody is said to specifically bind an antigen when it preferentially recognizes its target antigen in a complex mixture of proteins and / or macromolecules.

[0113] The term “surface plasmon resonance”, as used herein, refers to an optical phenomenon that allows for the analysis of real-time biospecific interactions by detection of alterations in protein concentrations within a biosensor matrix, for example using the BIAcore system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, NJ). For further descriptions, see Jonsson, U., et al. (1993) Ann. Biol. Clin. 51: 19-26; Jonsson, U., et al. (1991) Biotechniques 11:620-627; Johnsson, B., et al. (1995) J. Mol. Recognit. 8: 125-131; and Johnnson, B., et al. (1991) Anal. Biochem. 198:268- 277.

[0114] The term “ kon” or “ ka”, as used herein, is intended to refer to the on rate constant for association of an antibody to the antigen to form the antibody / antigen complex.

[0115] 14

[0116] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0117] The term “kOfr” or “ kd”, as used herein, is intended to refer to the off rate constant for dissociation of an antibody from the antibody / antigen complex.

[0118] The term “KD”, as used herein, is intended to refer to the equilibrium dissociation constant of a particular antibody-antigen interaction. KD is calculated by ka / kd. In one embodiment, the antibodies of the disclosure have a KD of about 2,000 nM or less, about 1,000 nM or less, about 500 nM or less, about 200 nM or less, about 100 nM or less, about 75 nM or less, about 25 nM or less, about 21 nM or less, about 12 nM or less, about 11 nM or less, about 10 nM or less, about 9 nM or less, about 8 nM or less, about 7 nM or less, about 6 nM or less, about 5 nM or less, about 4 nM or less, about 3 nM or less, about 2 nM or less, about 1 nM or less, about 0.5 nM or less, about 0.3 nM or less, about 0.1 nM or less, about 0.01 nM or less, or about 0.001 nM or less.

[0119] The phrase “contacting a cell with an antibody oligonucleotide conjugate (“AOC”), as used herein, includes contacting a cell by any possible means. Contacting a cell with an AOC includes contacting a cell in vitro with the antibody oligonucleotide conjugate (“AOC”) or contacting a cell in vivo with the AOC. The contacting may be done directly or indirectly. Thus, for example, the AOC may be put into physical contact with the cell by the individual performing the method, or alternatively, the AOC may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

[0120] Contacting a cell in vitro may be done, for example, by incubating the cell with the AOC. Contacting a cell in vivo may be done, for example, by injecting the AOC into or near the tissue where the cell is located, or by injecting the AOC into another area, e.g., the bloodstream or the subcutaneous space, such that the AOC will subsequently reach the tissue where the cell to be contacted is located. For example, the AOC will subsequently target microglial cells. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an AOC and subsequently transplanted into a subject.

[0121] In certain embodiments, contacting a cell with an antibody oligonucleotide conjugate (“AOC”) includes “introducing” or “delivering the antibody oligonucleotide conjugate (“AOC”) into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an antisense polynucleotide agent can occur through unaided diffusion or active cellular processes, or by auxiliary agents or devices. Introducing an antibody oligonucleotide conjugate (“AOC”) into a cell may be in vitro or in vivo. For example, for in vivo introduction, an antibody oligonucleotide conjugate (“AOC”) can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or are known in the art.

[0122] The term “lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule. LNPs are described in, for example, U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.

[0123] As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig,

[0124] 15

[0125] MEl\57477843.v2 Atorney Docket No. 138777-00120 a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, or a mouse), or a bird that expresses the target gene, either endogenously or heterologously. In an embodiment, the subject is a human, such as a human being treated or assessed for a disease or disorder that would benefit from reduction in target gene expression and / or activity; a human at risk for a disease or disorder that would benefit from reduction in target gene expression and / or activity; a human having a disease or disorder that would benefit from reduction in target gene expression and / or activity; or human being treated for a disease or disorder that would benefit from reduction in target gene expression and / or activity as described herein. In some embodiments, the subject is a female human. In other embodiments, the subject is a male human. In one embodiment, the subject is an adult subject. In another embodiment, the subject is a pediatric subject.

[0126] As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result, such as reducing at least one sign or symptom of a target-gene associated disorder in a subject. Treatment also includes a reduction of one or more sign or symptoms associated with unwanted target gene expression and / or activity; diminishing the extent of unwanted target gene activation or stabilization; amelioration or palliation of unwanted target gene activation or stabilization. “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment.

[0127] The term “lower” in the context of the level of target gene in a subject or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, 15%, 20%, 25%, 30%, %, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In certain embodiments, a decrease is at least 20%. In certain embodiments, the decrease is at least 50% in a disease marker, e.g., protein or gene expression level. “Lower” in the context of the level of target gene in a subject is a decrease to a level accepted as within the range of normal for an individual without such disorder. In certain embodiments, “lower” is the decrease in the difference between the level of a marker or symptom for a subject suffering from a disease and a level accepted within the range of normal for an individual. The term “lower” can also be used in association with normalizing a symptom of a disease or condition, i. e. decreasing the difference between a level in a subject suffering from a target gene-associated disorder towards or to a level in a normal subject not suffering from a target gene-associated disorder. As used herein, if a disease is associated with an elevated value for a symptom, “normal” is considered to be the upper limit of normal. If a disease is associated with a decreased value for a symptom, “normal” is considered to be the lower limit of normal.

[0128] As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, may be treated or ameliorated by a reduction in expression and / or activity of target gene, refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a symptom of a target gene-associated disorder, e.g., neurodegenerative disease or disorder. The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention.

[0129] 16

[0130] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0131] Additional diseases or conditions related to disorders that would be apparent to the skilled artisan and are within the scope of this disclosure.

[0132] "Therapeutically effective amount," as used herein, is intended to include the amount of an antibody oligonucleotide conjugate (“AOC”) that, when administered to a subject having a target gene-associated disorder, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating, or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the antibody oligonucleotide conjugate (“AOC”), how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.

[0133] “Prophylactically effective amount,” as used herein, is intended to include the amount of an antibody oligonucleotide conjugate (“AOC”) that, when administered to a subject having a target gene-associated disorder, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The "prophylactically effective amount" may vary depending on the antibody oligonucleotide conjugate (“AOC”), how the antibody oligonucleotide conjugate (“AOC”) is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0134] A "therapeutically-effective amount" or “prophylactically effective amount” also includes an amount of an antibody oligonucleotide conjugate (“AOC”) that produces some desired effect at a reasonable benefit / risk ratio applicable to any treatment. The antibody oligonucleotide conjugate (“AOC”) employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment.

[0135] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0136] The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically- acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Such carriers are known in the art. Pharmaceutically acceptable carriers include carriers for administration by injection.

[0137] The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of

[0138] 17

[0139] MEl\57477843.v2 Atorney Docket No. 138777-00120 biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs, or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In some embodiments, a “sample derived from a subject” refers to urine obtained from the subject. A “sample derived from a subject” can refer to blood or blood derived serum or plasma from the subject.

[0140] II. Antibody Oligonucleotide Conjugates (“AOCs”) of the Disclosure

[0141] The present disclosure provides antibody oligonucleotide conjugates (AOCs) comprising an antisense polynucleotide agent conjugated to anti-CD33 antibodies for use in modulating the expression and / or activity of target gene(s). In some embodiments, the AOCs and compositions of the disclosure are for use in treating a subject, e.g., a mammal, such as a human susceptible to developing a target gene-associated disorder, e.g., neurodegenerative diseases, e.g., amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).

[0142] In one embodiment, the AOC of the disclosure comprises an antisense polynucleotide agent targeting a target sequence conjugated to an anti-CD33 antibody, e.g., scFv.

[0143] A. Antisense Polynucleotide Agents

[0144] In one embodiment, the antibody oligonucleotide conjugate (AOC) of the disclosure comprises an antisense polynucleotide agent, also referred to herein as an “antisense oligonucleotide” or “ASO,” conjugated to an anti-CD33 antibody.

[0145] Accordingly, the present disclosure provides antisense polynucleotide agents and compositions comprising such agents, which target a gene and inhibit the expression of a target gene. In one embodiment, the antisense polynucleotide agents inhibit the expression of a gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having a target gene-associated disease, e.g., a neurodegenerative disease or disorder. In some embodiments, the target gene is selected from the group consisting of CSF1R, NLRP3, MMP9, TREM2, FN1, CHIT1, and CHI3L1.

[0146] The antisense polynucleotide agents of the disclosure include a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of a gene. The region of complementarity may be about 50 nucleotides or less in length (e.g., 22-12, 20-14, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides or less in length). Upon contact with a cell expressing the target gene, the antisense polynucleotide agent inhibits the expression of the target gene (e.g., a human, a primate, a non-primate, or a bird target gene) by at least 20% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, western bloting, or flow cytometric techniques. In

[0147] 18

[0148] MEl\57477843.v2 Atorney Docket No. 138777-00120 preferred embodiments, the inhibition of expression is determined at a 10 nM concentration using the cell line, delivery method.

[0149] The region of complementarity between an antisense polynucleotide agent and a target sequence may be substantially complementary (e.g., there is a sufficient degree of complementarity between the antisense polynucleotide agent and a target nucleic acid to so that they specifically hybridize and induce a desired effect), but is generally fully complementary to the target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of a gene.

[0150] Accordingly, in one aspect, an antisense polynucleotide agent of the disclosure specifically hybridizes to a target nucleic acid molecule, such as the mRNA of a target gene, and comprises a contiguous nucleotide sequence which corresponds to the reverse complement of a nucleotide sequence of any sequence disclosed herein.

[0151] In some embodiments, the antisense polynucleotide agents of the disclosure may be substantially complementary to the target sequence. For example, an antisense polynucleotide agent that is substantially complementary to the target sequence may include a contiguous nucleotide sequence comprising no more than 5 mismatches (e.g., no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches) when hybridizing to a target sequence, such as to the corresponding region of a nucleic acid which encodes a mammalian mRNA. In some embodiments, the contiguous nucleotide sequence comprises no more than a single mismatch when hybridizing to the target sequence, such as the corresponding region of a nucleic acid which encodes a mammalian mRNA.

[0152] In some embodiments, the antisense polynucleotide agents of the disclosure that are substantially complementary to the target sequence comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any sequence disclosed herein, or a fragment of any sequence disclosed herein, such as at least 85%, 90%, 95%, or 100% complementary.

[0153] In some embodiments, an antisense polynucleotide agent comprises a contiguous nucleotide sequence which is fully complementary over its entire length to the equivalent region of the nucleotide sequence disclosed herein (or a fragment of any sequence disclosed herein).

[0154] An antisense polynucleotide agent may comprise a contiguous nucleotide sequence of about 4 to 50 nucleotides in length, or any subrange falling within that range, e.g., about 8-49, 8-48, 8-47, 8-

[0155] 46, 8-45, 8-44, 8-43, 8-42, 8-41, 8-40, 8-39, 8-38, 8-37, 8-36, 8-35, 8-34, 8-33, 8-32, 8-31, 8-30, 8-29, 8-28, 8-27, 8-26, 8-25, 8-24, 8-23, 8-22, 8-21, 8-20, 8-19, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8- 11, 8-10, 8-9, 10-49, 10-48, 10-47, 10-46, 10-45, 10-44, 10-43, 10-42, 10-41, 10-40, 10-39, 10-38, 10- 37, 10-36, 10-35, 10-34, 10-33, 10-32, 10-31, 10-30, 10-29, 10-28, 10-27, 10-26, 10-25, 10-24, 10-23,

[0156] 10-22, 10-21, 10-20, 10-19, 10-18, 10-17, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11,11-49, 11-48, 11-

[0157] 47, 11-46, 11-45, 11-44, 11-43, 11-42, 11-41, 11-40, 11-39, 11-38, 11-37, 11-36, 11-35, 11-34, 11-33,

[0158] 11-32, 11-31, 11-30, 11-29, 11-28, 11-27, 11-26, 11-25, 11-24, 11-23, 11-22, 11-21, 11-20, 11-19, 11- 18, 11-17, 11-16, 11-15, 11-14, 11-13, 11-12, 12-49, 12-48, 12-47, 12-46, 12-45, 12-44, 12-43, 12-42,

[0159] 19

[0160] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0161] 12-41, 12-40, 12-39, 12-38, 12-37, 12-36, 12-35, 12-34, 12-33, 12-32, 12-31, 12-30, 12-29, 12-28, 12-

[0162] 27, 12-26, 12-25, 12-24, 12-23, 12-22, 12-21, 12-20, 12-19, 12-18, 12-17, 12-16, 12-15, 12-14, 12-13,

[0163] 13-49, 13-48, 13-47, 13-46, 13-45, 13-44, 13-43, 13-42, 13-41, 13-40, 13-39, 13-38, 13-37, 13-36, 13- 35, 13-34, 13-33, 13-32, 13-31, 13-30, 13-29, 13-28, 13-27, 13-26, 13-25, 13-24, 13-23, 13-22, 13-21,

[0164] 13-20, 13-19, 13-18, 13-17, 13-16, 13-15, 13-14, 14-49, 14-48, 14-47, 14-46, 14-45, 14-44, 14-43, 14- 42, 14-41, 14-40, 14-39, 14-38, 14-37, 14-36, 14-35, 14-34, 14-33, 14-32, 14-31, 14-30, 14-29, 14-28,

[0165] 14-27, 14-26, 14-25, 14-24, 14-23, 14-22, 14-21, 14-20, 14-19, 14-18, 14-17, 14-16, 14-15, 15-49, 15- 48, 15-47, 15-46, 15-45, 15-44, 15-43, 15-42, 15-41, 15-40, 15-39, 15-38, 15-37, 15-36, 15-35, 15-34,

[0166] 15-33, 15-32, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15- 19, 15-18, 15-17, 15-16,16-49, 16-48, 16-47, 16-46, 16-45, 16-44, 16-43, 16-42, 16-41, 16-40, 16-39,

[0167] 16-38, 16-37, 16-36, 16-35, 16-34, 16-33, 16-32, 16-31, 16-30, 16-29, 16-28, 16-27, 16-26, 16-25, 16- 24, 16-23, 16-22, 16-21, 16-20, 16-19, 16-18, 16-17, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43,

[0168] 17-42, 17-41, 17-40, 17-39, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-32, 17-31, 17-30, 17-29, 17-

[0169] 28, 17-27, 17-26, 17-25, 17-24, 17-23, 17-22, 17-21, 17-20, 17-19, 17-18, 18-49, 18-48, 18-47, 18-46,

[0170] 18-45, 18-44, 18-43, 18-42, 18-41, 18-40, 18-39, 18-38, 18-37, 18-36, 18-35, 18-34, 18-33, 18-32, 18-

[0171] 31, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-49, 19-48, 19-47,

[0172] 19-46, 19-45, 19-44, 19-43, 19-42, 19-41, 19-40, 19-39, 19-38, 19-37, 19-36, 19-35, 19-34, 19-33, 19-

[0173] 32, 19-31, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-49, 20-48,

[0174] 20-47, 20-46, 20-45, 20-44, 20-43, 20-42, 20-41, 20-40, 20-39, 20-38, 20-37, 20-36, 20-35, 20-34, 20-

[0175] 33, 20-32, 20-31, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-49, 21-48,

[0176] 21-47, 21-46, 21-45, 21-44, 21-43, 21-42, 21-41, 21-40, 21-39, 21-38, 21-37, 21-36, 21-35, 21-34, 21-

[0177] 33, 21-32, 21-31, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, 21-22, 22-49, 22-48, 22-47,

[0178] 22-46, 22-45, 22-44, 22-43, 22-42, 22-41, 22-40, 22-39, 22-38, 22-37, 22-36, 22-35, 22-34, 22-33, 22- 32, 22-31, 22-30, 22-29, 22-28, 22-27, 22-26, 22-25, 22-24, 22-23, 23-49, 23-48, 23-47, 23-46, 23-45,

[0179] 23-44, 23-43, 23-42, 23-41, 23-40, 23-39, 23-38, 23-37, 23-36, 23-35, 23-34, 23-33, 23-32, 23-31, 23- 30, 23-29, 23-28, 23-27, 23-26, 23-25, 23-24, 24-49, 24-48, 24-47, 24-46, 24-45, 24-44, 24-43, 24-42,

[0180] 24-41, 24-40, 24-39, 24-38, 24-37, 24-36, 24-35, 24-34, 24-33, 24-32, 24-31, 24-30, 24-29, 24-28, 24- 27, 24-26, 24-25, 25-49, 25-48, 25-47, 25-46, 25-45, 25-44, 25-43, 25-42, 25-41, 25-40, 25-39, 25-38,

[0181] 25-37, 25-36, 25-35, 25-34, 25-33, 25-32, 25-31, 25-30, 25-29, 25-28, 25-27, 25-26,26-49, 26-48, 26- 47, 26-46, 26-45, 26-44, 26-43, 26-42, 26-41, 26-40, 26-39, 26-38, 26-37, 26-36, 26-35, 26-34, 26-33,

[0182] 26-32, 26-31, 26-30, 26-29, 26-28, 26-27, 27-49, 27-48, 27-47, 27-46, 27-45, 27-44, 27-43, 27-42, 27- 41, 27-40, 27-39, 27-38, 27-37, 27-36, 27-35, 27-34, 27-33, 27-32, 27-31, 27-30, 27-29, 27-28, 28-49,

[0183] 28-48, 28-47, 28-46, 28-45, 28-44, 28-43, 28-42, 28-41, 28-40, 28-39, 28-38, 28-37, 28-36, 28-35, 28-

[0184] 34, 28-33, 28-32, 28-31, 28-30, 28-29, 29-49, 29-48, 29-47, 29-46, 29-45, 29-44, 29-43, 29-42, 29-41,

[0185] 29-40, 29-39, 29-38, 29-37, 29-36, 29-35, 29-34, 29-33, 29-32, 29-31, 29-30, 30-49, 30-48, 30-47, 30- 46, 30-45, 30-44, 30-43, 30-42, 30-41, 30-40, 30-39, 30-38, 30-37, 30-36, 30-35, 30-34, 30-33, 30-32, or 30-31 nucleotides in length, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

[0186] 20

[0187] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0188] In some embodiments, an antisense polynucleotide agent may comprise a contiguous nucleotide sequence of no more than 22 nucleotides, e.g., no more than any of 21 nucleotides, 20 nucleotides, 19 nucleotides, no more than 18 nucleotides, 17 nucleotides, 16 nucleotides, than 15 nucleotides, or 14 nucleotides. In other embodiments, the antisense polynucleotide agents of the disclosure are 20 nucleotides in length. In other embodiments, the antisense polynucleotide agents of the disclosure are 14 nucleotides in length. In certain embodiments, the polynucleotide is at least 12 nucleotides in length.

[0189] By virtue of the nature of the nucleotide sequences provided herein, antisense polynucleotide agents of the disclosure may include one of the sequences herein minus only a few nucleotides on one or both ends and yet remain similarly effective as compared to the antisense polynucleotide agents described above. Hence, antisense polynucleotide agents having a sequence of at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19, or 20 contiguous nucleotides derived from one of the sequences herein and differing in their ability to inhibit the expression of a gene by not more than 5, 10, 15, 20, 25, or 30% inhibition from an antisense polynucleotide agent comprising the full sequence, are contemplated to be within the scope of the present disclosure.

[0190] As used herein, an antisense polynucleotide agent is said to target within a particular site of an RNA transcript if the antisense polynucleotide agent promotes antisense inhibition of the target at that site. Such an antisense polynucleotide agent will generally include at least 14 contiguous nucleotides from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in a gene.

[0191] While a target sequence is generally 4-50 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing antisense inhibition of any given target RNA. Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a “window” or “mask” of a given size (as a non-limiting example, 20 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences. By moving the sequence “window” progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an antisense polynucleotide agent, mediate the best inhibition of target gene expression. Thus, while the sequences identified herein represent effective target sequences, it is contemplated that further optimization of antisense inhibition efficiency can be achieved by progressively “walking the window” one nucleotide upstream or downstream of the given sequences to identify sequences with equal or beter inhibition characteristics.

[0192] Further, it is contemplated that for any sequence identified herein, further optimization could be achieved by systematically either adding or removing nucleotides to generate longer or shorter

[0193] 21

[0194] MEl\57477843.v2 Atorney Docket No. 138777-00120 sequences and testing those sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of antisense polynucleotide agents based on those target sequences in an inhibition assay as known in the art or as described herein can lead to further improvements in the efficiency of inhibition. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in length, or other modifications as known in the art or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor.

[0195] B. Modified Oligonucleotides

[0196] In certain embodiments, the antisense polynucleotide agents of the disclosure are unmodified, and do not comprise, e.g., chemical modifications or conjugations known in the art and described herein. In other embodiments, the antisense polynucleotide agents of the disclosure are chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the disclosure, substantially all of the nucleotides of an antisense polynucleotide agent of the disclosure are modified. In other embodiments, all of the nucleotides of an antisense polynucleotide agent, or substantially all of the nucleotides of an antisense polynucleotide agent, are modified, z.e., not more than 5, 4, 3, 2, or 1 unmodified nucleotides are present in an antisense polynucleotide agent.

[0197] The nucleic acids featured in the disclosure can be synthesized or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5 ’-end modifications (phosphorylation, conjugation, inverted linkages) or 3 ’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’-position or ’position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of oligonucleotide compounds useful in the embodiments described herein include, but are not limited to oligonucleotides, e.g., RNAs, containing modified backbones or no natural intemucleoside linkages. Oligonucleotides, e.g., RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides, e.g., RNAs, that do not have a phosphorus atom in their intemucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified oligonucleotide will have a phosphorus atom in its intemucleoside backbone.

[0198] 22

[0199] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0200] Modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. In some embodiments of the disclosure, the oligonucleotides, e.g., antisense polynucleotide agents, of the disclosure are in a free acid form. In other embodiments of the disclosure, the oligonucleotides, e.g., antisense polynucleotide agents, are in a salt form. In one embodiment, the oligonucleotides, e.g., antisense polynucleotide agents, of the disclosure are in a sodium salt form. In certain embodiments, when the oligonucleotides, e.g., antisense polynucleotide agents, of the disclosure are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester and / or phosphorothiotate groups present in the agent. Oligonucleotides in which substantially all of the phosphodiester and / or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and / or phosphorothioate linkages without a sodium counterion. In some embodiments, when the oligonucleotides, e.g., antisense polynucleotide agents, of the disclosure are in the sodium salt form, sodium ions are present in the oligonucleotide as counterions for all of the phosphodiester and / or phosphorothiotate groups present in the agent. In certain embodiments, calcium and / or magnesium ions are present in the agent as counterions for substantially all of the phosphodiester and / or phosphorothiotate groups present in the agent.

[0201] Representative U.S. Patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat RE39464, the entire contents of each of which are hereby incorporated herein by reference.

[0202] Modified oligonucleotide, e.g., RNA, backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH2component parts.

[0203] 23

[0204] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0205] Representative U.S. Patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

[0206] Suitable RNA mimetics are contemplated for use in oligonucleotides, e.g., antisense polynucleotide agents, provided herein, in which both the sugar and the intemucleoside linkage, z.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound in which an RNA mimetic that has been shown to have excellent hybridization properties is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative US patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the oligonucleotides of the disclosure are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0207] Some embodiments featured in the disclosure include oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular — CH2-NH— CH2-, — CH2— N(CH3)-O— CH2— [known as a methylene (methylimino) or MMI backbone], — CH2— O— N CHs)— CH2--, — CH2— N(CH3)--N(CH3)— CH2— and — N(CH3)--CH2— CH2— of the above-referenced U.S. Patent No. 5,489,677, and the amide backbones of the above-referenced U.S. Patent No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Patent No. 5,034,506. The native phosphodiester backbone can be represented as O-P(O)(OH)-OCH2-.

[0208] Modified oligonucleotides can also contain one or more substituted sugar moieties. The oligonucleotides, e.g., antisense polynucleotide agents, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted Ci to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2)nO] mCHs, O(CH2).nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. In other embodiments, modified oligonucleotides include one of the following at the 2' position: Ci to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an

[0209] 24

[0210] MEl\57477843.v2 Atorney Docket No. 138777-00120 oligonucleotide, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O— CH2CH2OCH3, also known as 2'-O-(2- methoxyethyl) or 2'-M0E) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'- dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'- DMAEOE), i.e., 2'-O— CH2--O— CH2— N(CH3)2. Further exemplary modifications include : 5’-Me-2’- F nucleotides, 5’-Me-2’-OMe nucleotides, 5’-Me-2’-deoxynucleotides, (both R and S isomers in these three families); 2 ’-alkoxy alkyl; and 2’-NMA (N-methylacetamide).

[0211] Oligonucleotides, e.g., antisense polynucleotide agents, can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative US patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application,. The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0212] An oligonucleotide, e.g., antisense polynucleotide agent, can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as deoxythimidine (dT), 5 -methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2 -thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5 -trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8- azaadenine, 7-deazaguanine and 7-daazaadenine and 3 -deazaguanine and 3 -deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the disclosure. These include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine. 5 -methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA

[0213] 25

[0214] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0215] Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0216] Representative U.S. Patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Patent Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[0217] In some embodiments, an oligonucleotide, e.g., antisense polynucleotide agent, of the disclosure can also be modified to include one or more bicyclic sugar moieties. A “bicyclic sugar” is a furanosyl ring modified by a ring formed by the bridging of two carbons, whether adjacent or nonadj acent. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a ring formed by bridging two carbons, whether adjacent or non-adj acent, of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring, optionally, via the 2’-acyclic oxygen atom. Thus, in some embodiments an agent of the disclosure may include one or more locked nucleic acids (UNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. In other words, an UNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids has been shown to increase stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439- 447; Mook, OR. et al., (2001) Mol Cane Ther 6(3): 833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31 ( 12): 3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the disclosure include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the disclosure include one or more bicyclic nucleosides comprising a 4' to 2' bridge.

[0218] A locked nucleoside can be represented by the structure (omiting stereochemistry), wherein B is a nucleobase or modified nucleobase and L is the linking group that joins the 2’- carbon to the 4’-carbon of the ribose ring. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to 4'-(CH2) — O-2' (LNA); 4'-(CH2) — S-2'; 4'-(CH2)2 — O-2' (ENA); 4'- CH(CH3) — O-2' (also referred to as “constrained ethyl” or “cEf ’) and 4'-CH(CH2OCH3) — O-2' (and analogs thereof; see, e.g., U.S. Patent No. 7,399,845); 4'-C(CH3)(CH3) — O-2' (and analogs thereof;

[0219] 26

[0220] MEl\57477843.v2 Atorney Docket No. 138777-00120 see e.g., U.S. Patent No. 8,278,283); 4'-CH2 — ^N(OCHs)-2' (and analogs thereof; see e.g., U.S. Patent No. 8,278,425); 4'-CH2— O— N(CH3)-2' (see, e.g., U.S. Patent Publication No. 2004 / 0171570); 4'- CH2— N(R) — O-2', wherein R is H, C1-C12 alkyl, or a nitrogen protecting group (see, e.g., U.S.

[0221] Patent No. 7,427,672); 4'-CH2— C(H)(CH3)-2' (see, e.g., Chatopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2— C(=CH2)-2' (and analogs thereof; see, e.g., U.S. Patent No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0222] Additional representative U.S. Patents and U.S. Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034, 133;7, 084, 125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; and US 2009 / 0012281, the entire contents of each of which are hereby incorporated herein by reference.

[0223] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and P-D-ribofuranose (see WO 99 / 14226).

[0224] A nucleotide of an oligonucleotide, e.g., antisense polynucleotide agent, can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4'- CH(CH3)-O-2' bridge (z.e., E in the preceding structure). In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.”

[0225] An oligonucleotide, e.g., antisense polynucleotide agent, of the disclosure may also include one or more “conformationally restricted nucleotides” (“CRN”). CRN are nucleotide analogs with a linker connecting the C2’and C4’ carbons of ribose or the C3 and -C5' carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

[0226] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, U.S. Patent Publication No. 2013 / 0190383; and PCT publication WO 2013 / 036868, the entire contents of each of which are hereby incorporated herein by reference.

[0227] In some embodiments, an oligonucleotide, e.g., antisense polynucleotide agent, of the disclosure comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomer with bonds between Cl'- C4' have been removed (i.e. the covalent carbon-oxygen-carbon bond between the Cl' and C4' carbons). In another example, the C2'-C3' bond (i.e. the covalent carbon-carbon bond between the C2' and C3' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

[0228] Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Patent No. 8,314,227; and U.S. Patent Publication Nos. 2013 / 0096289;

[0229] 27

[0230] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0231] 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference.

[0232] Potentially stabilizing modifications to the ends of oligonucleotides, e.g., RNA, molecules can include N- (acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4- hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0- deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl- uridine-3"- phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011 / 005861.

[0233] Other modifications of the nucleotides of e.g., an antisense polynucleotide agent, of the disclosure include a 5’ phosphate or 5’ phosphate mimic. Suitable phosphate mimics are disclosed in, for example U.S. Patent Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference.

[0234] C. Linkers

[0235] In some embodiments, the antibody oligonucleotide conjugate (AOC) described herein may comprise an antisense polynucleotide sequence atached to an antibody, e.g., CD33 antibody, e.g., scFv, with various linkers that can be cleavable or non-cleavable.

[0236] The term "linker" or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently ataches two parts of a compound. In one embodiment, a linker is a peptide linker. In one embodiment, the linker is present for site-specific conjugation of the antisense polynucleotide sequence to the antibody. In one embodiment, one antisense polynucleotide sequence is conjugated to one antibody. In another embodiment, 2 antisense polynucleotide sequences are conjugated to one antibody. In another embodiment, 3 antisense polynucleotide sequences are conjugated to one antibody. In another embodiment, 4 antisense polynucleotide sequences are conjugated to one antibody. In one embodiment, 1-4 antisense polynucleotide sequences are conjugated to one antibody.

[0237] In one embodiment, the antisense polynucleotide sequence is conjugated directly to the antibody. In another embodiment, the antisense polynucleotide sequence is conjugated to the antibody using a cathepsin-based cleavable peptide linker (e.g., a valine-citrulline dipeptide linker) or an acid cleavable linker (e.g., hydrazone linker). In one embodiment, polyethylene glycol (PEG) linkers ranging from PEG4 to PEG24 are utilized in order to optimize the distance between the antisense polynucleotide sequence and the antibody. In one embodiment, the linker is PEG1, PEG2, PEG3, PEG4, PEG5, PEG6, PEG7, PEG8, PEG9, PEG10, PEG11, PEG12, PEG13, PEG 14. PEG15, PEG16, PEG17, PEG18, PEG19, PEG20, PEG21, PEG22, PEG23, or PEG24.

[0238] In some embodiments, the linker conjugating the antisense polynucleotide sequence and the antibody does not comprise PEG. In some embodiments, the linker conjugating the antisense polynucleotide sequence and the antibody is a cleavable linker.

[0239] 28

[0240] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0241] In one embodiment, the linker is a peptide-based linker. In one embodiment, the peptide linker is a glycine-based peptide linker. In one embodiment, the peptide linker is an alanine-based peptide linker.

[0242] Other linkers are known in the art. See, for example, Bargh et al., Chem. Society Rev., 2019, 48, 4361-4374, the entire contents of which are expressly incorporated herein by reference.

[0243] In one embodiment, a linker is present between the two chains of an antibody, e.g, scFv. In one embodiment, a linker comprises a cysteine, e.g., CPPC (SEQ ID NO: 9). In one embodiment, a linker comprises a cysteine-maleimide linker.

[0244] In one embodiment, the linker comprises a lysine, e.g., for use in NHS-ester based heterobifunctional linker conjugation to cross-link antisense polynucleotides to CD33 antibodies. In one embodiment, the linker comprises an unnatural amino acid, e.g., for direct conjugation of the antisense polynucleotide to the CD33 antibody. In one embodiment, the linker comprises a glutamate, e.g., in order to take advantage of microbial transglutaminases to install an azide on the CD33 antibody glutamine residue, which would be used as a handle for antisense polynucleotide conjugation.

[0245] Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO2, SO2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic, or substituted aliphatic. In one embodiment, the linker is about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms.

[0246] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In an exemplary embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

[0247] 29

[0248] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0249] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential, or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

[0250] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a selected pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell. For example, disulfide as well as thio-maleimide bonds are prone to cleavage through thiol exchange with other thiols present in the environment, such as glutathione.

[0251] In one embodiment, the linkage group is poly lactic -co-glycolic acid (PLGA). In one embodiment, the linker is a hydrazone linker.

[0252] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

[0253] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

[0254] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In certain embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0255] 30

[0256] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0257] D. CD33 Antibodies of the Disclosure

[0258] In some embodiments, the AOC of the disclosure comprises an antibody, or antigen-binding fragment thereof, that specifically binds CD33, e.g., a monoclonal anti-CD33 antibody, or antigenbinding fragment thereof. In one embodiment, the antibody is a single-chain variable fragment (scFv).

[0259] CD33 antibodies are well-known to those of ordinary skill in the art. For example, the CD33 antibody may be gemtuzumab, or an scFv fragment thereof; lintuzumab or an scFv fragment thereof; vadastuximab, or an scFv fragment thereof; hu-MY9-6, or an scFv fragment thereof; AVE9633, or an scFv fragment thereof, or IMGN779, or an scFv fragment thereof.

[0260] The antibody can be identified, screened for (e.g., using phage display), or characterized for their physical / chemical properties and / or biological activities by various assays known in the art (see, for example, Antibodies: A Laboratory Manual, Second edition, Greenfield, ed., 2014). Binding specificity of an antibody for its antigen can be tested by known methods in the art such as ELISA, Western blot, or surface plasmon resonance.

[0261] In some embodiments, the anti-CD33 antibody or antigen-binding fragment thereof is a humanized antibody or antigen-binding fragment thereof. Humanized antibodies may be useful as therapeutic molecules because humanized antibodies may reduce or eliminate the human immune response to non-human antibodies (such as the human anti-mouse antibody response), which can result in an immune response to an antibody therapeutic, and decreased effectiveness of the therapeutic.

[0262] In some embodiments, the anti-CD33 antibody or antigen-binding fragment thereof is a chimeric antibody or antigen-binding fragment thereof. In some embodiments, an anti-CD33 antibody or antigen-binding fragment thereof comprises at least one non-human variable region and at least one human constant region. In some such embodiments, all of the variable regions of an anti-CD33 antibody are non-human variable regions, and all of the constant regions of an anti-CD33 antibody are human constant regions. In some embodiments, one or more variable regions of a chimeric antibody are mouse variable regions. The human constant region of a chimeric antibody need not be of the same isotype as the non-human constant region, if any, it replaces. Chimeric antibodies are discussed, e.g., in U.S. Patent No. 4,816,567; and Morrison et al. Proc. Natl. Acad. Sci. USA 81: 6851-55 (1984).

[0263] In some embodiments, the anti-CD33 antibody or antigen-binding fragment thereof is a human antibody or antigen-binding fragment thereof.

[0264] In some embodiments, the antibody, e.g., the anti-CD33 antibody or antigen-binding fragment thereof, is a monoclonal anti-CD33 antibody or antigen-binding fragment thereof.

[0265] The antibody of the present disclosure can be produced using any methods known in the art. For example, the antibodies, and antigen-binding fragments thereof, can be produced using recombinant DNA methods. Expression vector(s) encoding the heavy and light chains is (are) transfected into a host cell by standard techniques. The various forms of the term “transfection” are intended to encompass a wide variety of techniques commonly used for the introduction of exogenous 31

[0266] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0267] DNA into a prokaryotic or eukaryotic host cell, e.g., electroporation, calcium -phosphate precipitation, DEAE-dextran transfection and the like.

[0268] Host cells may be a prokaryotic or eukaryotic cell. The polynucleotide or vector which is present in the host cell may either be integrated into the genome of the host cell or it may be maintained extrachromosomally. The host cell can be any prokaryotic or eukaryotic cell, such as a bacterial, insect, fungal, plant, animal or human cell. In some embodiments, fungal cells are, for example, those of the genus Saccharomyces, in particular those of the species S. cerevisiae. The term "prokaryotic" includes all bacteria which can be transformed or transfected with a DNA or RNA molecules for the expression of an antibody or the corresponding immunoglobulin chains. Prokaryotic hosts may include gram negative as well as gram positive bacteria such as, for example, E. coli, S. typhimurium, Serratia marcescens and Bacillus subtilis. The term "eukaryotic" includes yeast, higher plants, insects and vertebrate cells, e.g., mammalian cells, such as NSO and CHO cells. Depending upon the host employed in a recombinant production procedure, the antibodies or immunoglobulin chains encoded by the polynucleotide may be glycosylated or may be non-glycosylated. Antibodies or the corresponding immunoglobulin chains may also include an initial methionine amino acid residue. Although it is possible to express antibodies in either prokaryotic or eukaryotic host cells, expression of antibodies in eukaryotic cells is preferable, and most preferable in mammalian host cells, because such eukaryotic cells (and in particular mammalian cells) are more likely than prokaryotic cells to assemble and secrete a properly folded and immunologically active antibody.

[0269] In some embodiments, once a vector has been incorporated into an appropriate host, the host may be maintained under conditions suitable for high level expression of the nucleotide sequences, and, as desired, the collection and purification of the immunoglobulin light chains, heavy chains, light / heavy chain dimers or intact antibodies, antigen binding fragments thereof or other immunoglobulin forms may follow; see, Beychok, Cells of Immunoglobulin Synthesis, Academic Press, N.Y., (1979). Thus, polynucleotides or vectors are introduced into the cells which in turn produce the antibody or antigen binding fragments thereof. Furthermore, transgenic animals, preferably mammals, comprising the aforementioned host cells may be used for the large scale production of the antibody or antibody fragments thereof.

[0270] The transformed host cells can be grown in fermenters and cultured using any suitable techniques to achieve optimal cell growth. Once expressed, the whole antibodies, their dimers, individual light and heavy chains, other immunoglobulin forms, or antigen binding fragments thereof, can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like; see, Scopes, "Protein Purification", Springer Verlag, N.Y. (1982). The antibody or antigen binding fragments thereof can then be isolated from the growth medium, cellular lysates, or cellular membrane fractions. The isolation and purification of the, e.g., microbially expressed antibodies or antigen binding fragments thereof may be by any conventional means such as, for example, preparative chromatographic separations and immunological separations such as those involving the use of monoclonal or polyclonal antibodies directed, e.g., against the constant region of the antibody.

[0271] 32

[0272] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0273] Aspects of the present disclosure relate to a hybridoma, which provides an indefinitely prolonged source of monoclonal antibodies. As an alternative to obtaining immunoglobulins directly from the culture of hybridomas, immortalized hybridoma cells can be used as a source of rearranged heavy chain and light chain loci for subsequent expression and / or genetic manipulation. Rearranged antibody genes can be reverse transcribed from appropriate mRNAs to produce cDNA. In some embodiments, heavy chain constant region can be exchanged for that of a different isotype or eliminated altogether. The variable regions can be linked to encode single chain Fv regions. Multiple Fv regions can be linked to confer binding ability to more than one target or chimeric heavy and light chain combinations can be employed. Any appropriate method may be used for cloning of antibody variable regions and generation of recombinant antibodies, and antigen-binding portions thereof.

[0274] In some embodiments, an appropriate nucleic acid that encodes variable regions of a heavy and / or light chain is obtained and inserted into an expression vectors which can be transfected into standard recombinant host cells. A variety of such host cells may be used. In some embodiments, mammalian host cells may be advantageous for efficient processing and production. Typical mammalian cell lines useful for this purpose include CHO cells, 293 cells, or NSO cells. The production of the antibody or antigen binding fragment thereof may be undertaken by culturing a modified recombinant host under culture conditions appropriate for the growth of the host cells and the expression of the coding sequences. The antibodies or antigen binding fragments thereof may be recovered by isolating them from the culture. The expression systems may be designed to include signal peptides so that the resulting antibodies are secreted into the medium; however, intracellular production is also possible.

[0275] The present disclosure also includes a polynucleotide encoding at least a variable region of an immunoglobulin chain of the antibodies described herein. In some embodiments, the variable region encoded by the polynucleotide comprises at least one complementarity determining region (CDR) of the VH and / or VL of the variable region of the antibody produced by any one of the above described hybridomas.

[0276] Polynucleotides encoding antibody or antigen binding fragments thereof may be, e.g., DNA, cDNA, RNA or synthetically produced DNA or RNA or a recombinantly produced chimeric nucleic acid molecule comprising any of those polynucleotides either alone or in combination. In some embodiments, a polynucleotide is part of a vector. Such vectors may comprise further genes such as marker genes which allow for the selection of the vector in a suitable host cell and under suitable conditions.

[0277] In some embodiments, a polynucleotide is operatively linked to expression control sequences allowing expression in prokaryotic or eukaryotic cells. Expression of the polynucleotide comprises transcription of the polynucleotide into a translatable mRNA. Regulatory elements ensuring expression in eukaryotic cells, preferably mammalian cells, are well known to those skilled in the art. They may include regulatory sequences that facilitate initiation of transcription and optionally poly-A signals that facilitate termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers, and / or naturally

[0278] 33

[0279] MEl\57477843.v2 Atorney Docket No. 138777-00120 associated or heterologous promoter regions. Possible regulatory elements permiting expression in prokaryotic host cells include, e.g., the PL, Lac, Trp or Tac promoter in E. coli, and examples of regulatory elements permiting expression in eukaryotic host cells are the A0X1 or GALI promoter in yeast or the CMV-promoter, SV40-promoter, RSV-promoter (Rous sarcoma virus), CMV-enhancer, SV40-enhancer or a globin intron in mammalian and other animal cells.

[0280] Beside elements which are responsible for the initiation of transcription such regulatory elements may also include transcription termination signals, such as the SV40-poly-A site or the tk- poly-A site, downstream of the polynucleotide. Furthermore, depending on the expression system employed, leader sequences capable of directing the polypeptide to a cellular compartment or secreting it into the medium may be added to the coding sequence of the polynucleotide and have been described previously. The leader sequence(s) is (are) assembled in appropriate phase with translation, initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein, or a portion thereof, into, for example, the extracellular medium. Optionally, a heterologous polynucleotide sequence can be used that encode a fusion protein including a C- or N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.

[0281] In some embodiments, polynucleotides encoding at least the variable domain of the light and / or heavy chain may encode the variable domains of both immunoglobulin chains or only one. Likewise, a polynucleotide(s) may be under the control of the same promoter or may be separately controlled for expression. Furthermore, some aspects relate to vectors, particularly plasmids, cosmids, viruses and bacteriophages used conventionally in genetic engineering that comprise a polynucleotide encoding a variable domain of an immunoglobulin chain of an antibody or antigen binding fragment thereof; optionally in combination with a polynucleotide that encodes the variable domain of the other immunoglobulin chain of the antibody.

[0282] In some embodiments, expression control sequences are provided as eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells, but control sequences for prokaryotic hosts may also be used. Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the polynucleotides or vector into targeted cell population (e.g., to engineer a cell to express an antibody or antigen binding fragment thereof). A variety of appropriate methods can be used to construct recombinant viral vectors. In some embodiments, polynucleotides and vectors can be reconstituted into liposomes for delivery to target cells. The vectors containing the polynucleotides (e.g., the heavy and / or light variable domain(s) of the immunoglobulin chains encoding sequences and expression control sequences) can be transferred into the host cell by suitable methods, which vary depending on the type of cellular host.

[0283] Monoclonal antibodies, and antigen-binding fragments thereof, may also be produced by generation of hybridomas (see e.g., Kohler and Milstein (1975) Nature, 256: 495-499) in accordance with known methods. Hybridomas formed in this manner are then screened using standard methods, such as enzyme-linked immunosorbent assay (ELISA) and surface plasmon resonance (e.g., OCTET 34

[0284] MEl\57477843.v2 Atorney Docket No. 138777-00120 or BIACORE) analysis, to identify one or more hybridomas that produce an antibody, or an antigenbinding portion thereof, that specifically binds to a specified antigen, e.g., CD33, e.g., wild type CD33, or mutant CD33. Any form of the specified antigen may be used as the immunogen, e.g., recombinant antigen, naturally occurring forms, any variants or fragments thereof, as well as antigenic peptide thereof (e.g., any of the epitopes described herein as a linear epitope or within a scaffold as a conformational epitope). One exemplary method of making antibodies, and antigen-binding portions thereof, includes screening protein expression libraries that express antibodies or fragments thereof (e.g., scFv), e.g., phage or ribosome display libraries. Phage display is described, for example, in Ladner etal., U.S. Pat. No. 5,223,409; Smith (1985) Science 228: 1315-1317; Clackson et al.

[0285] (1991) Nature, 352: 624-628; Marks et al. (1991) J. Mol. Biol., 222: 581-597WO92 / 18619; WO 91 / 17271; WO 92 / 20791; WO 92 / 15679; WO 93 / 01288; WO 92 / 01047; WO 92 / 09690; and WO 90 / 02809.

[0286] In addition to the use of display libraries, the specified antigen (e.g., CD33) can be used to immunize a non-human animal, e.g., a rodent, e.g., a mouse, hamster, or rat. In one embodiment, the non-human animal is a mouse.

[0287] In another embodiment, a monoclonal antibody is obtained from the non-human animal, and then modified, e.g., chimeric, using suitable recombinant DNA techniques. A variety of approaches for making chimeric antibodies have been described. See e.g., Morrison et al., Proc. Natl. Acad. Sci. U.S.A. 81:6851, 1985; Takeda et al., Nature 314:452, 1985, Cabilly et al., U.S. Pat. No. 4,816,567; Boss et al., U.S. Pat. No. 4,816,397.

[0288] For additional antibody production techniques, see Antibodies: A Laboratory Manual, eds. Harlow et al., Cold Spring Harbor Laboratory, 1988. The present disclosure is not necessarily limited to any particular source, method of production, or other special characteristics of an antibody.

[0289] Methods for generating human antibodies in transgenic mice are also known in the art. Any such known methods can be used in the context of the present disclosure to make human antibodies that specifically bind to human CD33.

[0290] In some embodiment, high affinity chimeric antibodies are isolated having a human variable region and a mouse constant region. The antibodies are characterized and selected for desirable characteristics, including affinity, selectivity, epitope, etc. The mouse constant regions are replaced with a desired human constant region to generate the fully human antibody of the disclosure, for example wild-type or modified IgGl or lgG4. While the constant region selected may vary according to specific use, high affinity antigen-binding and target specificity characteristics reside in the variable region.

[0291] III. Pharmaceutical Compositions of the Disclosure

[0292] The present disclosure also includes pharmaceutical compositions and formulations which include the antibody oligonucleotide conjugates (AOCs) of the disclosure. In one embodiment, provided herein are pharmaceutical compositions containing an antibody oligonucleotide conjugate (“AOC”), as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical

[0293] 35

[0294] MEl\57477843.v2 Atorney Docket No. 138777-00120 compositions containing the AOC are useful for preventing or treating a target gene-associated disorder

[0295] Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of the disclosure may be administered in dosages sufficient to inhibit expression of a gene.

[0296] In some embodiments, the pharmaceutical compositions of the disclosure are sterile. In another embodiment, the pharmaceutical compositions of the disclosure are pyrogen free.

[0297] The pharmaceutical compositions of the disclosure may be administered in dosages sufficient to inhibit expression and / or activity of a target gene. In general, a suitable dose of an antibody oligonucleotide conjugate (“AOC”) of the disclosure will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. Typically, a suitable dose of an antibody oligonucleotide conjugate (“AOC”) of the disclosure will be in the range of about 0.1 mg / kg to about 5.0 mg / kg, such as, about 0.3 mg / kg and about 3.0 mg / kg. A repeat-dose regimen may include administration of a therapeutic amount of an antibody oligonucleotide conjugate (“AOC”) on a regular basis, such as every month, once every 3-6 months, or once a year. In certain embodiments, the AOC is administered about once per month to about once per six months.

[0298] After an initial treatment regimen, the treatments can be administered on a less frequent basis. Duration of treatment can be determined based on the severity of disease.

[0299] In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that doses are administered at not more than 1, 2, 3, or 4 month intervals. In some embodiments of the disclosure, a single dose of the pharmaceutical compositions of the disclosure is administered about once per month. In other embodiments of the disclosure, a single dose of the pharmaceutical compositions of the disclosure is administered quarterly (z.e., about every three months). In other embodiments of the disclosure, a single dose of the pharmaceutical compositions of the disclosure is administered twice per year (z.e., about once every six months).

[0300] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to mutations present in the subject, previous treatments, the general health or age of the subject, and other diseases present. Moreover, treatment of a subject with a prophylactically or therapeutically effective amount, as appropriate, of a composition can include a single treatment or a series of treatments.

[0301] The pharmaceutical compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.

[0302] 36

[0303] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0304] The antibody oligonucleotide conjugate (“AOC”) can be delivered in a manner to target a particular tissue or cell, such as the microglia.

[0305] Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable. Coated condoms, gloves and the like can also be useful. Suitable topical formulations include those in which the AOCs featured in the disclosure are in admixture with a topical delivery agent such as lipids, liposomes, faty acids, faty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). AOCs featured in the disclosure can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes. Alternatively, AOCs can be complexed to lipids, in particular to cationic lipids. Suitable faty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1 -monocaprate, l-dodecylazacycloheptan-2-one, an acylcamitine, an acylcholine, or a Cl-20 alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in US 6,747,014, which is incorporated herein by reference.

[0306] In one embodiment, the AOCs of the disclosure, are administered to a cell in a pharmaceutical composition by a topical route of administration.

[0307] In one aspect, the disclosure features a pharmaceutical composition including an antibody oligonucleotide conjugate (“AOC”) in an injectable dosage form. In one embodiment, the injectable dosage form of the pharmaceutical composition includes sterile aqueous solutions or dispersions and sterile powders. In some embodiments the sterile solution can include a diluent such as water; saline solution; fixed oils, polyethylene glycols, glycerin, or propylene glycol.

[0308] The AOCs of the disclosure can be incorporated into pharmaceutical compositions. Such compositions typically include one or more species of AOC and a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration to a cell, e.g., a liver cell. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0309] Pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated

[0310] 37

[0311] MEl\57477843.v2 Atorney Docket No. 138777-00120 from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Formulations include those that target the liver.

[0312] The pharmaceutical formulations of the present disclosure, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers.

[0313] IV. Methods For Inhibiting Target Gene Expression and / or Activity

[0314] The present disclosure also provides methods of inhibiting expression and / or activity of a target gene in a cell. The methods include contacting a cell with an antibody oligonucleotide conjugate (“AOC”), in an amount effective to inhibit expression and / or activity of a target gene in the cell, thereby inhibiting expression and / or activity of the target gene in the cell.

[0315] Contacting of a cell with an antibody oligonucleotide conjugate (“AOC”), may be done in vitro or in vivo. Contacting a cell in vivo with the AOC includes contacting a cell or group of cells within a subject, e.g., a human subject, with the AOC. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is an antibody, e.g., single-chain antibody, that directs the AOC agent to a site of interest.

[0316] The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating”, “suppressing”, and other similar terms, and includes any level of inhibition.

[0317] The phrase “inhibiting expression and / or activity of a gene” is intended to refer to inhibition of expression of any gene (such as, e.g., a mouse gene, a rat gene, a monkey gene, or a human gene) as well as variants or mutants of a gene. Thus, the gene may be a wild-type gene, a mutant gene, or a transgenic gene in the context of a genetically manipulated cell, group of cells, or organism.

[0318] “Inhibiting expression and / or activity of a gene” includes any level of inhibition of a gene, e.g., at least partial suppression of the expression and / or activity of the gene. The expression and / or activity of the gene may be assessed based on the level, or the change in the level, of any variable associated with gene expression, e.g., mRNA level or protein level.

[0319] The expression and / or activity of a gene may also be assessed indirectly based on other variables associated with gene expression.

[0320] Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with gene expression and / or activity compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

[0321] 38

[0322] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0323] In some embodiments of the methods of the disclosure, expression and / or activity of the target gene is inhibited by at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay. In some embodiments, expression and / or activity of the target gene is inhibited by at least 70%. It is further understood that inhibition of gene expression and / or activity in certain tissues, e.g., in microglia, without a significant inhibition of expression in other tissues, e.g., neurons and / or astrocytes, may be desirable.

[0324] Inhibition of the expression and / or activity of the target gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such as microglial cells) in which the target gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an antibody oligonucleotide conjugate (“AOC”) of the disclosure, or by administering an antibody oligonucleotide conjugate (“AOC”) of the disclosure to a subject in which the cells are or were present) such that the expression of a gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an antibody oligonucleotide conjugate (“AOC”) or not treated with an antibody oligonucleotide conjugate (“AOC”) targeted to the gene of interest).

[0325] In one embodiment, direct modulation of gene expression or RNA splicing through sequencedependent binding to of the AOC to target RNA transcript(s) may be assessed.

[0326] In other embodiments, inhibition of the expression and / or activity of the target gene may be assessed in terms of a reduction of a parameter that is functionally linked to target gene expression, e.g., target protein level in microglial cells from a subject. Gene silencing may be determined in any cell expressing the target gene, either endogenous or heterologous from an expression construct, and by any assay known in the art.

[0327] Inhibition of the expression and / or activity of a target protein may be manifested by a reduction in the level of the target protein that is expressed by a cell or group of cells or in a subject sample (e.g., the level of protein in a blood sample derived from a subject). As explained above, for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells, or the change in the level of protein in a subject sample, e.g., blood or serum derived therefrom.

[0328] A control cell, a group of cells, or subject sample that may be used to assess the inhibition of the expression and / or activity of target gene includes a cell, group of cells, or subject sample that has not yet been contacted with an antibody oligonucleotide conjugate (“AOC”) agent of the disclosure. For example, the control cell, group of cells, or subject sample may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an antibody oligonucleotide conjugate (“AOC”) or an appropriately matched population control.

[0329] The level of target mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of target mRNA in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the target gene. RNA may be extracted from cells using RNA

[0330] 39

[0331] MEl\57477843.v2 Atorney Docket No. 138777-00120 extraction techniques including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy™ RNA preparation kits (Qiagen®) or PAXgene™ (PreAnalytix™, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern bloting, in situ hybridization, and microarray analysis.

[0332] In some embodiments, the level of expression is determined using a nucleic acid probe. The term “probe”, as used herein, refers to any molecule that is capable of selectively binding to a specific gene. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[0333] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix® gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of mRNA.

[0334] An alternative method for determining the level of expression of target sequence in a sample involves the process of nucleic acid amplification or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Patent No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88: 189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh et al. (1989) roc. Natl. Acad. Sci. USA 86: 1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio / T chnology 6: 1197), rolling circle replication (Lizardi et al., U.S. Patent No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the disclosure, the level of expression of the target is determined by quantitative Anorogenic RT-PCR (i.e., the TaqMan™ System).

[0335] The expression levels of the target mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Patent Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of the target expression level may also comprise using nucleic acid probes in solution.

[0336] 40

[0337] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0338] In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR).

[0339] The level of the target protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western bloting, radioimmunoassay (RIA), enzyme- linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like.

[0340] In some embodiments, the efficacy of the methods of the disclosure are assessed by a decrease in the target mRNA or protein level.

[0341] In some embodiments of the methods of the disclosure, the antibody oligonucleotide conjugate (“AOC”) is administered to a subject such that the antibody oligonucleotide conjugate (“AOC”) is delivered to a specific site within the subject. The inhibition of expression and / or activity of the target may be assessed using measurements of the level or change in the level of the target mRNA or protein in a sample derived from fluid or tissue from the specific site within the subject.

[0342] As used herein, the terms detecting or determining a level of an analyte are understood to mean performing the steps to determine if a material, e.g., protein, RNA, is present. As used herein, methods of detecting or determining include detection or determination of an analyte level that is below the level of detection for the method used.

[0343] V. Kits

[0344] In certain aspects, the instant disclosure provides kits that include a suitable container containing a pharmaceutical formulation of an antibody oligonucleotide conjugate (“AOC”) of the disclosure.

[0345] Such kits include one or more antibody oligonucleotide conjugate(s) (“AOC”) and instructions for use, e.g., instructions for administering a prophylactically or therapeutically effective amount of AOC(s). The antibody oligonucleotide conjugate (“AOC”) may be in a vial or a pre-filled syringe. The kits may optionally further comprise means for administering the antibody oligonucleotide conjugate (“AOC”) (e.g., an injection device, such as a pre-fdled syringe), or means for measuring the inhibition of the target gene (e.g., means for measuring the inhibition of target gene mRNA, protein, and / or activity). Such means for measuring the inhibition of the target gene may comprise a means for obtaining a sample from a subject. The kits of the disclosure may optionally further comprise means for determining the therapeutically effective or prophylactically effective amount.

[0346] In certain embodiments the individual components of the pharmaceutical formulation may be provided in one container, e.g., a vial or a pre-fdled syringe. Alternatively, it may be desirable to provide the components of the pharmaceutical formulation separately in two or more containers, e.g.,

[0347] 41

[0348] MEl\57477843.v2 Atorney Docket No. 138777-00120 one container for antibody oligonucleotide conjugate (“AOC”) preparation, and at least another for a carrier compound. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition. The kit can also include a delivery device.

[0349] This disclosure is further illustrated by the following examples which should not be construed as limiting. The entire contents of all references, links, patents and published patent applications cited throughout this application, as well as the informal Sequence Listing and Figures, are hereby incorporated herein by reference.

[0350] EXAMPLES

[0351] Example 1.

[0352] Drug discovery for severe neurodegenerative diseases including amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) is facing a transformational change with the advancement of chemically modified antisense oligonucleotides (ASOs) that allow precise targeting of genetic targets on a transcript level1 3. The first generation of therapeutic ASOs was successfully developed to reduce expression of broadly expressed genes whose rare mutations result in a higher propensity for toxic protein aggregation (e.g., SOD I4. FUS7). But these mutations are found only in a small subset of familial disease cases8 10and depletion of protein aggregates in the symptomatic patients results in a limited effect on the disease progression6’7 11.

[0353] The fact that neurodegenerative diseases are highly variable with significant range in the age at onset, progression rate, and survival driven partly by genetic factors is leveraged herein12 13. Best-in- class ALS and FTD therapeutics will be developed by modulating function of genes whose hypomorphic genetic variants demonstrate strong association with delayed disease onset, slower disease progression, and longer survival. Several genetic disease modifiers have been identified and experimentally validated herein, and ASOs that efficiently modulate their expression in vitro have been developed. Consistently with the field that increasingly recognizes the causal role of immune response and inflammation in age-related neurodegenerative diseases14A many of these genetically supported drug targets are unique to microglia, the immune cells of the CNS.

[0354] Microglia have become a significant cell-type of interest in treatment of neurodegeneration with more than 70 ongoing programs developing drugs for targets like TREM2, CSF1R, or complement factors to curb pathologic neuroinflammation20. However, microglia represent only -10% of all cells that take up the ASOs in the CNS21. Moreover, the small molecular size of ASOs leads to their fast clearance from the cerebrospinal fluid22,23. Therefore, minority of the drug will make it to the cells where it can be effective, and non-targeted cells like neurons, astrocytes, or oligodendrocytes must 42

[0355] MEl\57477843.v2 Atorney Docket No. 138777-00120 withstand any unnecessary off-target effects. A generalizable technology increasing ASO uptake by microglia would be beneficial for development of targeted therapeutics.

[0356] The fact that the developmental origin of microglia is from the myeloid cell lineage in the bone marrow24leading to overlapping gene expression profile with some normal and cancerous immune cells25,26including the expression of CD33 receptor was leveraged. In this project, an approach for enhancing microglial delivery of ASOs by their conjugation with single-chain CD33 antibodies derived from antibody-drug conjugates is developed and clinically evaluated for treatment of acute myeloid leukemia.

[0357] Aim 1: Generation of MALAT1 antibody-oligonucleotide conjugates. A set of 3 single-chain antibodies (scFvs) will be produced by connecting the variable domains of clinically validated CD33 antibodies with a peptide linker containing cysteine for site-specific ASO conjugation. The CD33- dependent cell surface binding of the scFvs will be evaluated in WT (CD33+) and CD33 KO U937 cells. All functional scFvs will be selected for maleimide-thiol conjugation with MALAT1 control ASO functionalized with a fluorophore for imaging and a linker of varying composition to optimize the conjugate (AOC) structure. CD33 -dependent cell surface binding of the AOCs will be evaluated in U937 cells. The first aim will produce a library of up to 2 XI AT A TI AOCs.

[0358] Aim 2: Evaluation of toxicity, uptake, and potency to select design for SOD1 and APRTX AOCs. The dose-dependent toxicity MM A TA TI AOCs that can bind CD33 on the cell surface will be measured in monocultures of iPSC-derived microglia, neurons, astrocytes, and in U937 cells using live / apoptotic-cell staining with phase imaging -based cell counting. The initial CD33 -dependent uptake and potency will be measured in WT and CD33 KO U937 cells using live imaging and qPCR. The best performing AOC designs will be used to generate candidate AOCs for SOD1 and APRTX (Aperture’s microglial-specific disease target) whose toxicity, uptake and potency will be subsequently evaluated. The second aim is to identify the top 6-8 AOCs for MAIA T1. SOD1 , and APRTX with uptake and potency greater than ASOs in CD33+ cells.

[0359] Aim 3: Evaluation of AOC selective uptake, selective potency and off-targets. The dosedependent uptake and potency of the candidate AOCs for the three targets will be next measured in monocultures of microglia, neurons, and astrocytes using live imaging and qPCR. Subsequently, the uptake and potency of SOD1 and APRTX AOCs will be measured in tri-cultures of the cell types using live imaging and target protein immunostaining. Unconjugated ASOs at matching molarities will be used as benchmarks to quantify the relative performance of the AOCs. Finally, the potential of AOCs to reduce the off-target effects will be evaluated by RNA-seq profiling of the monocultures treated with the AOCs and ASOs at concentrations achieving 50% of target transcript depletion. Success in the three aims will deliver a generalizable approach for delivery of therapeutic oligonucleotide drugs into microglia. The development will continue in a Phase II study that will evaluate in vivo safety, efficacy, biodistribution, and PK / PD of the selected AOCs as candidate drugs for treatment of ALS.

[0360] 43

[0361] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0362] SIGNIFICANCE AND IMPACT

[0363] Most of the early ASO programs for neurodegenerative diseases rarely targeted mutated genes with broad cell-type expression patern (e.g. SMN, SOD1, FUS)4 7272s. Although the necessity of modulating gene expression in all CNS cell types has not been definitive, the global correction or suppression of the mutant gene expression was predicted to be beneficial. More recently, large genomic studies allowed uncovering the role of non-mutant genes that act as disease modifiers in neurodegeneration by linking genetic variants altering expression or activity of the genes to differential clinical outcomes including disease onset, progression, and patient survival. The genetic evidence of disease modifying effects is a strong indicator of therapeutic efficacy if the activity of the target can be modulated in the correct cell population. Notably, many such genes have restricted celltype expression patern. For example, UNC13A whose genetic variants are disease modifying in ALS has neuronal-specific expression29-30; and CD3331 3\ TREM23fi 3''. or MS4A4A36-40-41that have been discovered as disease modifiers in Alzheimer’s, Parkinson’s, ALS, and FTD are restricted to microglia. Additionally, some genetic disease modifiers whose expression is less restricted can fulfill non-synonymous cell-type specific function which increases the importance of their selective targeting - for example. TBK I42 4in neurons versus glia. Therefore, targeting microglia in neurodegenerative diseases would unleash new levels of drug potency and decrease off-target risk effects, therefore opening new therapeutic avenues.

[0364] ASOs allow direct modulation of gene expression or RNA splicing through sequence-dependent binding to their target RNA transcripts. To reach the molecular target in the CNS, ASOs are typically administered intrathecally by lumbar puncture. Importantly, the majority of the injected drug is rapidly cleared with the flow of the cerebrospinal fluid and enters the lymphatic system. A pool of the retained drug that does enter the extracellular tissue environment can be then non-specifically taken up by neurons, astrocytes, oligodendrocytes and finally microglia that represent only -10% of the cells46. Subsequently, a minor subset ( 1 %-5%) of the drug escapes the intracellular endosomes and enters the intracellular space where it can interact with the target RNA transcript.

[0365] Several novel ASO therapeutics have been developed herein that are capable of modulating expression of microglial-specific genetic disease modifiers. Microglial-specific drug delivery approaches have a significant potential to increase clinical success of new therapeutics for modulation of neuroinflammation in neurodegenerative diseases by improving their pharmacological properties including: (1) Increasing drug potency by selective accumulation of the drug in microglia; (2) Reducing off-target toxicity by reduced accumulation in non-targeted cell types; and (3) Improving biodistribution as a result of increased molecular weight of the drug-vehicle conjugate.

[0366] An outstanding example of a successful cell-type specific delivery approach is galactosamine-N- acetyl (GalNAc) ligand conjugation to ASOs for drug delivery to liver3. GalNAc is a ligand that binds the asialoglycoprotein receptor expressed on hepatocytes. This approach was shown to increase the potency of the conjugated ASOs by 10- to 30- fold in the liver, therefore reducing the necessary drug

[0367] 44

[0368] MEl\57477843.v2 Atorney Docket No. 138777-00120 dosage and greatly limiting the risk of adverse effects in other organs47. An analogous approach is developed herein for microglia by finding a clinically suitable marker whose internalization would not be detrimental to the cells.

[0369] The impact of such technology would catalyze targeting of therapeutics to microglia for treatment of neurodegenerative diseases. The increased potency and off-target toxicity are critical factors to success of therapies and an improved biodistribution and stability would fuel the application of oligonucleotide therapeutics in more prevalent conditions like Parkinson’s disease or Alzheimer’s disease. Moreover, modular microglia targeting via ASO conjugation can be paired with novel approaches for intravenous or intranasal ASO delivery to the CNS, further expanding their application.

[0370] INNOVATION

[0371] 1. Developing antibody-oligonucleotide conjugates for selective microglial uptake.

[0372] In search of a molecular vehicle that would promote uptake of intrathecally delivered drugs by microglia, the overlapping expression profile of microglia with other myeloid lineage cells like monocytes, macrophages and related cancerous cell types was taken advantage of herein. All these cells express a transmembrane receptor CD33 that has been in the spotlight as a specific surface marker for microglia, but also pathologic cells in patients with acute myeloid leukemia (AML)48.

[0373] Multiple CD33 antibodies were developed to target the CD33 positive leukemic cells including lintuzumab, vadastuximab, and the conjugate of CD33 antibody gemtuzumab and cytotoxin ozogamicin. The conjugate (Mylotarg™) was the first FDA-approved antibody-drug conjugate for treatment of AML49. Their mechanism of action involves binding of the antibody to the CD33 receptor on the surface of the cancer cells which leads to its endocytosis with a conjugated toxic drug (e.g. ozogamicin) that can induce cell death.

[0374] The innovation herein lies in the novel use of single-chain CD33 antibodies to deliver non-toxic oligonucleotide therapeutics into microglia to modulate their activity in the central nervous system.

[0375] The prior studies of CD33 antibodies showed that the receptor and the antibody are rapidly internalized in both cancer cells and microglia. Intriguingly, CD33 is a negative regulator of microglial phagocytosis whose expression is upregulated in a number of neurodegenerative diseases and whose inhibition was proposed as a potential therapeutic approach. Genetic CD33 knockout or siRNA mediated depletion leads to decrease of pro-inflammatory phenotype, and it does not have major negative consequences in animal models. Although the conjugates of CD33 antibodies with cytotoxins did show toxicity that has to be mitigated in the AML patients, a clinical trial with the CD33 antibody alone showed no adverse effects - atributing the problematic toxicity primarily to the cytotoxins. Moreover, unlike the full-length immunoglobulins, the scFvs were shown to be internalized without significant induction of CD33 signaling in microglia (Wong, E. et al. HuM195 and its single-chain variable fragment increase A phagocytosis in microglia via elimination of CD33 inhibitory signaling. Mol Psychiatry (2024) doi: 10.1038 / s41380-024-02474-z.).

[0376] 45

[0377] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0378] Thus, by leveraging the previously validated antibodies, a unique opportunity is presented for adoption in treatment of neurodegenerative diseases. Selection of CD33 single-chain antibodies, the design and optimization of the conjugation strategy to effectively deliver functional ASOs, and detailed characterization of the AOCs in their application to microglia is proposed herein.

[0379] 2. Increasing the molecular weight of ASO therapeutics to improve drug biodistribution.

[0380] In the context of intrathecal delivery, conjugation of oligonucleotides with a 2’0 hexadecyl (Cl 6) has been demonstrated to greatly enhance the distribution in rats and NHPs50. This increased therapeutic effect compared to nonconjugated siRNA has been atributed to the molecular weight increase along with the physicochemical properties. A study by Ferguson et al. showed that increasing the valency of the oligonucleotides simply by linking two identical siRNA slows down their clearance into the venous system after an intrathecal injection51. The characteristically large size ~27 kDa for divalent siRNA as opposed to the ~7 kDa for ASOs has been postulated to improve the residence time in the CSF. The same effect has been validated in systemic dosing where conjugation of oligonucleotides to anchors as large 40 kDa has a pronounced effect of ~23-fold reduced renal clearance52. Despite intrathecal administration being substantially beter for CNS delivery than systemic dosing, only about 4% of ASOs accumulate in the CNS. Further, molecular tracers of varying sizes have demonstrated that achieving widespread distribution in the brain requires a macromolecule to remain in the effective size range53of greater than 20 nm and ideally less than 50 nm. The higher rates of peripheral clearance could be due to ASOs being smaller with a hydrodynamic radius of about 1 nm54. Thus conjugation of ASO to an antibody (5-24 nm)55,56would produce a macromolecule in the ideal size range and should help to overcome pharmacokinetic limitations such as rapid clearance and poor retention in the CNS57. Notably, antibodies also have longer half lives in systemic circulation (ti / 2 - weeks) compared to oligonucleotides (ti / 2 - hours)58. In the cerebrospinal fluid where there is low enzymatic activity, the stability conferred by antibody should translate towards the enhancement of the half-life. Taken together, these data suggest that antibody conjugation in the context of intrathecal delivery can improve biodistribution and therapeutic outcomes. The Phase I proposal herein is focused on completion of in vitro studies to allow directly measuring the improvement in tissue / organ-level biodistribution in a subsequent Phase II study.

[0381] APPROACH

[0382] Preliminary studies.

[0383] Generation of CD33 knockout (KO) control cell line: A CD 33 genetic knockout was generated using CRISPR engineering in U937 cells which is an established in vitro cell model with monocyte / microglia-like phenotype (Figure 1). The cell line will be critical for quantifying CD33- dependent binding of the CD33 scFvs and AOCs. As shown in the Figure 1, the fluorescent staining with CD33-FITC conjugated gemtuzumab antibody is completely lost upon the knockout. The

[0384] 46

[0385] MEl\57477843.v2 Atorney Docket No. 138777-00120 gemtuzumab IgG will be used as a positive control and reference in the experiments evaluating the cell surface binding.

[0386] Assays for measurement of control ASO uptake and potency: Multiple assays to measure ASO uptake and potency have been optimized herein. MALA T1 ASO is an established oligonucleotide control targeting a long non-coding RNA, and a wealth of data exists that characterizes its properties in vitro and in vivo alone or as a GalNAc conjugate. Moreover, the gene is broadly expressed in all CNS cell types, allowing quantification of RNA knockdown between cell-types. Using this control ASO, the uptake by cells in vitro and depletion of the transcript in dose-dependent manner was measured (Figure 2). The FDA-approved SOD1 ASO was also used as a control, as it allows measurement of the target protein depletion in addition to RNA. Finally, these studies will be translated to our lead therapeutic oligonucleotide for a microglial specific target (APRTX) for treatment of ALS.

[0387] Aim 1: Generation of MALAT1 antibody-oligonucleotide conjugates.

[0388] Produce and evaluate CD33 single-chain antibodies: Humanized CD33 antibodies gemtuzumab, lintuzumab, vadastuximab were selected to derive single-chain antibodies by connecting the heavy and light chain immunoglobulin variable domains using four amino acid Cys-Pro-Pro-Cys linker. The “stapling” design routinely generates highly stable single-chain antibodies with decreased risk of protein aggregation59, and the linker allows to achieve site-specific conjugation using thiol-maleimide reaction60.

[0389] To evaluate CD33 -dependent cell surface binding, the candidate scFvs will be covalently tagged with maleimide functionalized Alexa Fluor 647 dye that minimizes non-specific binding and uptake effects61. Paraformaldehyde fixed WT and CD33 KO U937 cells will be incubated with the candidate scFvs on ice. The cells will be thoroughly washed before quantification of the binding using flow cytometry. Non-stained WT cells and stained KO cells will be used as negative controls for autofluorescence and non-specific binding, respectively. Fluorophore -conjugated gemtuzumab IgG will be used as a positive control staining reagent (Figure 1). All scFvs specifically binding to the WT cells will be advanced.

[0390] Optimize antibody-oligonucleotide conjugation: The first set of conjugates will be prepared using an ATTO 488 dye labelled MALAT1 ASO with a maleimide handle for direct tethering to the 4 scFvs. The cross-linking conditions will be tested at several nanomolar scale concentrations with a slight excess of the antibody to achieve an antibody-oligonucleotide conjugate ratio of 1: 1 which will be characterized using SDS-PAGE and ion-exchange chromatography. The binding of the AOCs will be evaluated by flow cytometry using U937 cells and controls as described above fortesting of unconjugated scFvs.

[0391] Generate MALAT1 AOC library: The next round of conjugation will be performed to include cleavable linkers and linker extensions to achieve optimal intracellular ASO distribution and half-life, and to avoid steric effects of the scFv on target transcript binding by the ASO.

[0392] 47

[0393] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0394] The acid-labile hydrazone linker which has been used in the FDA-approved drug gemtuzumab ozogamicin6264for cargo release in acidifying endosomes, and a cathepsin cleavable valine-citrulline dipeptide based on its success in the FDA-approved drug brentuximab vedotin62and other applications63will be used. The cleavable linkers will be appended with poly-ethylene glycol (PEG) linkers of varying lengths (PEG4, PEG10, PEG24) to test for optimal ASO release.

[0395] The ATTO 488 MALAT1 ASO will be used to test the combination of cleavable linkers and PEG resulting in up to 24 AOCs (3 scFvs, 2 cleavable linkers, 3 PEG lengths or 1 no PEG). The conjugates will be characterized using SDS-PAGE and ion exchange chromatography. The binding of the functionalized AOCs will be evaluated by flow cytometry using U937 cells and controls as described above for testing of unconjugated scFvs. Candidate linker and scFv combinations that retain CD33 specific binding will be selected.

[0396] Milestone: The first milestone is the optimization of AOC production and generation of candidate MALAT1 AOCs that are specifically binding CD33 expressed on the cell surface.

[0397] Risks and Alternative Strategies: To avoid potential disruption of scFv binding to the receptor, multiple antibodies, linker lengths and cleavage chemistries will be employed. Since AOCs involve crosslinking of a large protein fragment to a highly charged oligonucleotide, elevated non-denaturing temperatures, higher salt, and substrate concentrations will be employed to improve yields, if necessary. In case the 1: 1 conjugation cannot be achieved, ASOs with an amine handle will be functionalized with a commercially available bis-maleimide ester to force the 1: 1 ratio with rapid reactivity and high yields. It is possible that sufficient potency is not achieved with the 1: 1 conjugate. To mitigate this risk, the payload will be doubled to 2 ASOs by reacting the ASOs in excess to the scFvs and then testing both the antibodies with 1 and 2 ASOs.

[0398] Aim 2: Evaluation of toxicity, uptake, and potency to select design for SOD1 and APRTX AOCs.

[0399] Measure toxicity: The efficacy characterization for chemically modified ASOs is typically performed at micromolar concentrations. Toxicity of the MALAT1 AOCs will be evaluated using WT U937 cells, microglia, neurons, and astrocytes at 8 concentrations ranging from lOnM to lOpM. Nontreated cells, cells treated with unconjugated ASOs, and cells treated with scFvs will be used as controls. All cells will be maintained on two 384-well plates as monocultures. The live cell number will be monitored over 3 days using phase-based live imaging on Incucyte and stain the cells for markers of apoptosis using annexin V dye (Sartorius) and caspase 3 / 7 cleavage dye (Sartorius) on day 1 (plate 1) and day 3 (plate 2) after the treatment. This experiment will establish non-toxic doses of the AOCs for quantitative evaluation of potency and uptake.

[0400] Measure uptake and potency: The initial dose-dependent uptake and potency will be measured in WT U937 cells that express all three ASO targets. CD33 KO will be used as a benchmark for CD33 independent activity. The U937 cells grown in suspension will be differentiated using treatment with phorbol 12-myristate 13-acetate and plated on 96-well poly-D-lysine coated plates for adherent

[0401] 48

[0402] MEl\57477843.v2 Atorney Docket No. 138777-00120 culture. 6 non-toxic doses of each AOC including up to 24 AOCs with cleavable linkers and up to 4 AOCs with direct conjugation will be tested; non-treated cells, unconjugated ASOs, and scFvs will be used as controls. The AOC uptake will be quantified for 3 days using live fluorescence imaging on Incucyte, and the target level (potency) will be quantified on day 3 when the cells will be harvested for qPCR. The top 6-8 performing AOC designs will be selected based on CD33 -dependent increase in uptake and potency determined by comparing ratio of the uptake and the target downregulation for the AOCs relative to unconjugated ASOs in WT and CD33 KO cells. It is expected that the AOCs with cleavable linkers will outperform the ASOs as well as AOCs with directly conjugated ASOs.

[0403] Generate SOD1 and APRTX AOC library: The non-toxic AOC designs with best uptake and potency will be used to generate AOCs for the SOD1 and APRTX ASOs. It is expected that the specific sequence of the ASOs will have relatively minor effect on CD33 binding for each AOC design, and the sequence-dependent effect on AOC potency is minimized by the use of cleavable linkers.

[0404] The SOD1 and APRTX AOCs will be first generated for the top 6-8 performing designs whose toxicity, uptake and potency will be evaluated exactly as described for MALAT1 AOCs above. A decision to explore additional designs will be made based on potency comparison to the unconjugated ASOs and the relative MALAT1 AOC performance. The initial inclusion of 6-8 AOC design variants for MALAT 1 , SOD 1 , and APRTX will allow to dissect the impact of the linkers and scFvs on the AOC performance and demonstrate the level of generalizability.

[0405] Milestone: The second milestone is selection of MALAT1, SOD1, and APRTX AOCs that are efficiently taken up by cells and demonstrate CD33 -dependent increase in potency at non-toxic doses.

[0406] Risks and Alternative Strategies: A potential risk is a disruption of the scFv binding to CD33 due to the ASO conjugation. In expectation of this, multiple chemistry strategies, antibodies, linker lengths, and ASO sequences will be employed to avoid this issue. Another potential risk is that all AOCs will show toxicity at lower doses due to introduction of endotoxins. An endotoxin removal step to all AOCs will be introduced to be evaluated in the toxicity, potency, and uptake studies and test the final endotoxin levels.

[0407] Aim 3: Evaluation of AOC selective uptake, selective potency and off-targets.

[0408] Measure selective uptake in monocultures: The kinetics of the MALAT 1, SOD1, and APRTX AOC uptake will be measured in monocultures of iPSC-derived microglia, neurons, and astrocytes. The cells maintained on 384-well plates will be treated with 4 concentrations of the selected AOCs covering at least 10-fold concentration range. The uptake of the labeled AOCs will be quantified using live fluorescence imaging for 3 days with datapoint acquisition frequency ranging from 30 minutes to 2 hours. The total fluorescence normalized to cell surface and median fluorescence intensity will be compared between the unconjugated ASO and AOCs to evaluate the relative uptake selectivity.

[0409] 49

[0410] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0411] Measure selective potency in monocultures: The potency of the target gene knockdown (MALAT1, SOD1, APRTX) will be measured in monocultures of iPSC-derived microglia, neurons, and astrocytes maintained on 96-well plates. The cells will be treated with 4 concentrations of the selected AOCs covering at least 10-fold concentration range. Because the potency might be affected by the stability of the AOCs in culture, the treated cells will be sampled before the treatment and every 3 days after the treatment for 12 days. This will result in 4 timepoints for 4 concentrations in 3 cell types for all targets except for APRTX which will be evaluated only in microglia because it is not expressed in neurons and astrocytes. Non-treated cells and unconjugated ASOs will be used as controls. The expected result is increased potency of the target transcript downregulation with AOC relative to unconjugated ASOs in microglia but not astrocytes or neurons. The top 1-3 AOCs that will show the highest microglial enrichment will be selected for subsequent studies.

[0412] Measure selective uptake and potency in tri-culture: The kinetics of the selected SOD1, and APRTX AOC uptake will be measured in tri-culture of the iPSC-derived cell types maintained on 96- well plates. For this experiment, GFP -expressing microglia, RFP-expressing motor neurons, and non- fluorescent astrocytes will be procedured. The cells will be co-plated and cultured in 6: 1: 1 ratio of neurons: microglia: astrocytes. The cells will be co-cultured for 7 days prior treatment with AOCs and ASOs.

[0413] The AOC and ASO treatment concentrations will be aimed at achieving 75%, 50%, and 25% target depletion in microglia. The relative uptake of AOCs and ASOs labeled with Alexa Fluor 647 will be quantified for 3 days with datapoint acquisition frequency ranging from 30 minutes to 4 hours. The total fluorescence normalized to cell surface and median fluorescence intensity will be compared between the unconjugated ASO and AOCs to evaluate the relative uptake selectivity.

[0414] To evaluate the protein-level potency, the cells treated with AOCs and ASO against SOD 1 and APRTX will be fixed / permeabilized, stained with antibodies against SOD 1 and APRTX, and imaged to measure the relative protein depletion in each of the cell types. It is expected that the relative depletion in microglia versus other cell types will be higher when treated with the candidate AOCs.

[0415] Measure differential gene expression in cell types: The increased selectivity of AOCs is hypothesized to reduce ASO-dependent disruption of gene expression in non-targeted cell types because lower molarity of a drug candidate can achieve potent target downregulation. To evaluate the level of off-target effects for MALAT1 (broadly-expressed) and APRTX (microglia-specific), monocultures of neurons, microglia, and astrocytes will be treated with two concentrations of unconjugated ASOs and AOCs to achieve 50% target downregulation based on prior potency measurements. ScFvs will be used as controls at molarities matching the AOCs. The cells will be harvested for RNA-seq after 3 days of treatment. The experiment will be performed in 3 replicates with control non-treated cells, resulting in up to 18 bulk RNA-seq samples for each cell type - up to 54 samples total. Differential expression will be analyzed using standard DESEQ tools and the comparison between cells treated with an AOC and matching ASO and scFv will be used to evaluate

[0416] 50

[0417] MEl\57477843.v2 Atorney Docket No. 138777-00120 scFv and ASO specific effects. It is expected that the AOCs will achieve 50% of target downregulation at lower molarity and induce lower level of differential expression in non-targeted cell types than ASOs.

[0418] Milestone: The third milestone is relative ranking of AOCs based on their uptake and potency in each of the cell-types with top performers showing increased microglial-selective uptake over unconjugated ASOs.

[0419] Risks and Alternative Strategies: The AOCs are efficiently taken up by non-microglial cell types. We note that similarly to the GalNAc strategy, our approach does directly prevent and ASO uptake by non-targeted cell types. Instead, it is aimed at increasing uptake and potency in the targeted cell types which allows decreasing the dose and indirectly resulting in lower activity in cells that are not being targeted.

[0420] REFERENCES:

[0421] 1. Roberts, T. C., Langer, R. & Wood, M. J. A. Advances in oligonucleotide drug delivery. Nat Rev Drug Discov 19, 673-694 (2020).

[0422] 2. Romano, R. & Bucci, C. Antisense therapy: a potential breakthrough in the treatment of neurodegenerative diseases. Neural Regeneration Research 19, 1027-1035 (2024).

[0423] 3. Bennet, C. F., Kordasiewicz, H. B. & Cleveland, D. W. Antisense Drugs Make Sense for Neurological Diseases. Annu. Rev. Pharmacol. Toxicol. 61, 831-852 (2021).

[0424] 4. McCampbell, A. et al. Antisense oligonucleotides extend survival and reverse decrement in muscle response in ALS models. Journal of Clinical Investigation 128, 3558-3567 (2018).

[0425] 5. Miller, T. et al. Phase 1-2 Trial of Antisense Oligonucleotide Tofersen for SOD1 ALS. New England Journal of Medicine 383, 109-119 (2020).

[0426] 6. Miller, T. M. et al. Trial of Antisense Oligonucleotide Tofersen for SOD1 ALS. New England Journal of Medicine 387, 1099-1110 (2022).

[0427] 7. Korobeynikov, V. A., Lyashchenko, A. K., Blanco-Redondo, B., Jafar-Nejad, P. & Shneider, N. A. Antisense oligonucleotide silencing of FUS expression as a therapeutic approach in amyotrophic lateral sclerosis. Nat Med (2022) doi: 10.1038 / s41591-021-01615-z.

[0428] 8. Mejzini, R. et al. ALS Genetics, Mechanisms, and Therapeutics: Where Are We Now? Front. Neurosci. 13, 1310 (2019).

[0429] 9. Gregory, J. M., Fagegaltier, D., Phatnani, H. & Harms, M. B. Genetics of Amyotrophic Lateral Sclerosis. Curr Genet Med Rep 8, 121-131 (2020).

[0430] 10. Smukowski, S. N. et al. Progress in Amyotrophic Lateral Sclerosis Gene Discovery: Reflecting on Classic Approaches and Leveraging Emerging Technologies. Neurol Genet 8, e669 (2022).

[0431] 11. Osborne, O. M., Naranjo, O., Heckmann, B. L., Dykxhoom, D. & Toborek, M. Anti-amyloid: An antibody to cure Alzheimer’s or an atitude. iScience 26, 107461 (2023).

[0432] 51

[0433] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0434] 12. Baxi, E. G. et al. Answer ALS, a large-scale resource for sporadic and familial ALS combining clinical and multi -omics data from induced pluripotent cell lines. Nat Neurosci (2022) doi: 10.1038 / s41593-021-01006-0.

[0435] 13. Din Abdul Jabbar, M. A. et al. Describing and characterising variability in ALS disease progression. Amyotrophic Lateral Sclerosis and Erontotemporal Degeneration 25, 34-45 (2024).

[0436] 14. Guzman-Martinez, L. et al. Neuroinflammation as a Common feature of Neurodegenerative Disorders. Front. Pharmacol. 10, 1008 (2019).

[0437] 15. Bright, F. et al. Neuroinflammation in frontotemporal dementia. Nat Rev Neurol 15, 540-555 (2019).

[0438] 16. Kwon, H. S. & Koh, S.-H. Neuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes. Transl Neurodegener 9, 42 (2020).

[0439] 17. Muzio, L., Vioti, A. & Martino, G. Microglia in Neuroinflammation and Neurodegeneration: From Understanding to Therapy. Front. Neurosci. 15, 742065 (2021).

[0440] 18. Ransohoff, R. M. How neuroinflammation contributes to neurodegeneration. Science 353, 777-783 (2016).

[0441] 19. Cooper-Knock, J. et al. A data-driven approach links microglia to pathology and prognosis in amyotrophic lateral sclerosis. Acta Neuropathologica Communications 5, 23 (2017).

[0442] 20. Gao, C., Jiang, J., Tan, Y. & Chen, S. Microglia in neurodegenerative diseases: mechanism and potential therapeutic targets. Sig Transduct Target Ther 8, 1-37 (2023).

[0443] 21. Mortberg, M. A. et al. A Single-Cell Map of Antisense Oligonucleotide Activity in the Brain. htp: / / biorxiv.org / lookup / doi / 10.1101 / 2023.02.14.528473 (2023) doi: 10.1101 / 2023.02.14.528473.

[0444] 22. Mazur, C. et al. Brain pharmacology of intrathecal antisense oligonucleotides revealed through multimodal imaging. JCI Insight 4, el29240 (2019).

[0445] 23. Geary, R. S. Antisense oligonucleotide pharmacokinetics and metabolism. Expert Opinion on Drug Metabolism & Toxicology 5, 381-391 (2009).

[0446] 24. Dermitzakis, I. et al. Origin and Emergence of Microglia in the CNS — An Interesting (Hi)story of an Eccentric Cell. CIMB 45, 2609-2628 (2023).

[0447] 25. Cate, B. ten et al. Targeted Elimination of Leukemia Stem Cells; a New Therapeutic Approach in Hemato-Oncology. Current Drug Targets 11, 95-110.

[0448] 26. Ehninger, A. et al. Distribution and levels of cell surface expression of CD33 and CD 123 in acute myeloid leukemia. Blood Cancer Journal 4, e218-e218 (2014).

[0449] 27. Hua, Y, Vickers, T. A., Baker, B. F., Bennet, C. F. & Krainer, A. R. Enhancement of SMN2 Exon 7 Inclusion by Antisense Oligonucleotides Targeting the Exon. PLOS Biology 5, e73 (2007).

[0450] 28. Hua, Y. et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes Dev. 24, 1634-1644 (2010).

[0451] 29. Ma, X. R. et al. TDP-43 represses cryptic exon inclusion in the FTD-ALS gene UNC13A. Nature 1-7 (2022) doi: 10.1038 / s41586-022-04424-7.

[0452] 52

[0453] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0454] 30. Brown, A. -L. et al. TDP-43 loss and ALS-risk SNPs drive mis-splicing and depletion of UNC13A. Nature 1-8 (2022) doi: 10.1038 / s41586-022-04436-3.

[0455] 31. Griciuc, A. et al. Alzheimer’s Disease Risk Gene CD33 Inhibits Microglial Uptake of Amyloid Beta. Neuron 78, 631-643 (2013).

[0456] 32. Walker, D. G. et al. Association of CD33 polymorphism rs3865444 with Alzheimer’s disease pathology and CD33 expression in human cerebral cortex. Neurobiology of Aging 36, 571-582 (2015).

[0457] 33. Estus, S. et al. Evaluation of CD33 as a genetic risk factor for Alzheimer’s disease. Acta Neuropathol 138, 187-199 (2019).

[0458] 34. Naj, A. C. et al. Common variants at MS4A4 / MS4A6E, CD2AP, CD33 and EPHA1 are associated with late-onset Alzheimer’s disease. Nat Genet 43, 436-441 (2011).

[0459] 35. Siokas, V. et al. CD33 rs3865444 as a risk factor for Parkinson’s disease. Neuroscience Leters 748, 135709 (2021).

[0460] 36. Deming, Y. et al. The MS4A gene cluster is a key modulator of soluble TREM2 and Alzheimer’s disease risk. Sci. Transl. Med. 11, eaau2291 (2019).

[0461] 37. Jonsson, T. et al. Variant of TREM2 Associated with the Risk of Alzheimer’s Disease. N Engl J Med 368, 107-116 (2013).

[0462] 38. Griciuc, A. et al. TREM2 Acts Downstream of CD33 in Modulating Microglial Pathology in Alzheimer’s Disease. Neuron 103, 820-835. e7 (2019).

[0463] 39. Hillary, R. F. et al. Genome- and epigenome-wide studies of plasma protein biomarkers for Alzheimer’s disease implicate TBCA and TREM2 in disease risk. Alzheimers Dement (Amst) 14, el2280 (2022).

[0464] 40. You, S.-F. et al. MS4A4A Modifies the Risk of Alzheimer Disease by Regulating Lipid Metabolism and Immune Response in a Unique Microglia State. htp: / / medrxiv.org / lookup / doi / 10.1101 / 2023.02.06.23285545 (2023) doi: 10. 1101 / 2023.02.06.23285545.

[0465] 41. Lopes, K. de P. et al. Genetic analysis of the human microglial transcriptome across brain regions, aging and disease pathologies. Nat Genet 54, 4-17 (2022).

[0466] 42. Borghero, G. et al. TBK1 is associated with ALS and ALS-FTD in Sardinian patients. Neurobiology of Aging 43, 180.el-180.e5 (2016).

[0467] 43. Balka, K. R. et al. TBK1 and IKKa Act Redundantly to Mediate STING-Induced NF-KB Responses in Myeloid Cells. Cell Reports 31, 107492 (2020).

[0468] 44. Brenner, D. et al. Heterozygous Tbkl loss has opposing effects in early and late stages of ALS in mice. Journal of Experimental Medicine 216, 267-278 (2019).

[0469] 45. Gerbino, V. et al. The Loss of TBK1 Kinase Activity in Motor Neurons or in All Cell Types Differentially Impacts ALS Disease Progression in SOD1 Mice. Neuron 106, 789-805. e5 (2020).

[0470] 53

[0471] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0472] 46. Mortberg, M. A. et al. A single-cell map of antisense oligonucleotide activity in the brain. Nucleic Acids Research gkad371 (2023) doi: 10.1093 / nar / gkad371.

[0473] 47. Backstrom, E. et al. Tissue pharmacokinetics of antisense oligonucleotides. Molecular Therapy - Nucleic Acids 35, 102133 (2024).

[0474] 48. Yu, B. & Liu, D. Gemtuzumab ozogamicin and novel antibody-drug conjugates in clinical trials for acute myeloid leukemia. Biomark Res 7, 1-13 (2019).

[0475] 49. Gbadamosi, M., Meshinchi, S. & Lamba, J. K. Gemtuzumab Ozogamicin for Treatment of Newly Diagnosed CD33-Positive Acute Myeloid Leukemia, future Oncol. 14, 3199-3213 (2018).

[0476] 50. Brown, K. M. et al. Expanding RNAi therapeutics to extrahepatic tissues with lipophilic conjugates. Nat Biotechnol 40, 1500-1508 (2022).

[0477] 51. Ferguson, C. M. et al. Comparative route of administration studies using therapeutic siRNAs show widespread gene modulation in Dorset sheep. JCI Insight 6, (2021).

[0478] 52. Godinho, B. M. D. C. et al. PK-modifying anchors significantly alter clearance kinetics, tissue distribution, and efficacy of therapeutics siRNAs. Molecular Therapy - Nucleic Acids 29, 116— 132 (2022).

[0479] 53. Thome, R. G. & Nicholson, C. In vivo diffusion analysis with quantum dots and dextrans predicts the width of brain extracellular space. Proceedings of the National Academy of Sciences 103, 5567-5572 (2006).

[0480] 54. Reidenbach, A. G. et al. Characterization of the Prion Protein Binding Properties of Antisense Oligonucleotides. Biomolecules 10, 1 (2020).

[0481] 55. Pero, J. K., Haas, E. M. & Thompson, N. L. Size Dependence of Protein Diffusion Very Close to Membrane Surfaces: Measurement by Total Internal Reflection with Fluorescence Correlation Spectroscopy. J. Phys. Chem. B 110, 10910-10918 (2006).

[0482] 56. Baek, Y, Singh, N., Arunkumar, A. & Zydney, A. Effects of Histidine and Sucrose on the Biophysical Properties of a Monoclonal Antibody. Pharmaceutical Research 34, (2017).

[0483] 57. Calias, P, Banks, W. A., Begley, D., Scarpa, M. & Dickson, P. Intrathecal delivery of protein therapeutics to the brain: A critical reassessment. Pharmacology & Therapeutics 144, 114-122 (2014).

[0484] 58. Nanna, A. R. et al. Generation and validation of structurally defined antibody-siRNA conjugates. Nucleic Acids Research 48, 5281-5293 (2020).

[0485] 59. Boucher, L. E. et al. “Stapling” scFv for multispecific biotherapeutics of superior properties. mAbs 15, 2195517 (2023).

[0486] 60. Nadkami, D. V. Conjugations to Endogenous Cysteine Residues, in Antibody-Drug Conjugates: Methods and Protocols (ed. Tumey, L. N.) 37-49 (Springer US, New York, NY, 2020). doi: 10. 1007 / 978-l-4939-9929-3_3.

[0487] 61. Hughes, L. D., Rawle, R. J. & Boxer, S. G. Choose Your Label Wisely: Water-Soluble Fluorophores Often Interact with Lipid Bilayers. PLOS ONE 9, e87649 (2014).

[0488] 54

[0489] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0490] 62. Fu, Z., Li, S., Han, S., Shi, C. & Zhang, Y. Antibody drug conjugate: the “biological missile” for targeted cancer therapy. Sig Transduct Target Ther 7, 1-25 (2022).

[0491] 63. Anami, Y. et al. Glutamic acid-valine-citrulline linkers ensure stability and efficacy of antibody-drug conjugates in mice. Nat Commun 9, 2512 (2018).

[0492] 64. Bargh, J. D., Isidro-Llobet, A., Parker, J. S. & Spring, D. R. Cleavable linkers in antibodydrug conjugates. Chem. Soc. Rev. 48, 4361-4374 (2019).

[0493] Example 2.

[0494] In this example, unique expression of CD33 in microglia among CNS cell types (Dermitzakis, I. et al. Origin and Emergence of Microglia in the CNS — An Interesting (Hi)story of an Eccentric Cell. CIMB 45, 2609-2628 (2023); Cate, B. ten et al. Targeted Elimination of Leukemia Stem Cells; a New Therapeutic Approach in Hemato-Oncology. Current Drug Targets 11, 95-110; and Ehninger, A. et al. Distribution and levels of cell surface expression of CD33 and CD 123 in acute myeloid leukemia. Blood Cancer Journal 4, e218-e218 (2014)) for enhancing microglial delivery is leveraged. Herein, it is proposed that conjugation of ASO to single-chain fragment (scFv) of CD33 antibodies to produce antibody oligonucleotide conjugates (AOC) will enable homing of ASOs to microglia - reducing the required dosage and minimizing off-target effects on other cell types.

[0495] Aim 1: Synthesis and evaluation of MALAT1 antibody-oligonucleotide conjugates

[0496] Single-chain antibodies will be conjugated o MAI.A Tl ASO through varying linker chemistries to produce a library of 24 AOCs. Upon confirming CD33 selectivity using WT and CD33 KO U937 cells, MALAT1 AOCs will be screened on iPSC microglia at 1 pM. Transcript downregulation will then be monitored for 3-14 days and compared to MALAT1 ASO using qPCR. Subsequently, AOCs exceeding unconjugated ASO’s performance will be dose-titrated on microglial cells to identify potency enhancement due to scFv conjugation. Finally, 6-8 MALAT1 AOC designs with enhanced delivery and potency will be advanced for SOD1 and APRTX AOC production.

[0497] Aim 2: Evaluation of AOC designs in vitro with SOD1 and APRTX ASOs

[0498] Candidate SOD1 and APRTX AOCs will be evaluated for CD33 specific knockdown along with free ASOs using WT and CD33 KO U937 cells. Briefly, AOCs dose-response will be evaluated across a broad range of concentrations using qPCR and ELISA. Then, AOC configurations that consistently excel in potency and specificity will be revalidated on iPSC monocultures of microglia, neurons, and astrocytes at specific concentrations for 3-7 days. Finally, lead APRTX AOCs will be tested on triculture system to quantify microglial selectivity and neurotoxicity.

[0499] The significance, impact, and innovation of this Example are as described in Example 1.

[0500] APPROACH

[0501] Preliminary studies.

[0502] 55

[0503] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0504] Generation of CD33 knockout (KO) control cell line: A CD 33 genetic knockout was generated using CRISPR engineering in U937 cells which is an established in vitro cell model with monocyte / microglia-like phenotype (Figure 1). The cell line will be critical for quantifying CD33- dependent binding of the scFvs and AOCs. As shown in Figure 1, the fluorescent staining with the FITC conjugated gemtuzumab antibody is completely lost upon the knockout. The gemtuzumab IgG will be used as a positive control and reference in the experiments evaluating the CD33 binding. Assays for control ASO potency measurement: MALAT1 ASO is an established oligonucleotide control targeting a broadly expressed, long non-coding RNA. A wealth of data exists characterizing its properties, and, as demonstrated herein (Figure 2, right graph; Figure 3), its knockdown can be measured in a dose-dependent manner.

[0505] Pilot AOC synthesis and binding: The commercially available CD33 antibody Lintuzumab clone was used to generate a scFv. Then it was conjugated to a fluorescently labelled oligonucleotide, APRTX. The scFv was also conjugated to fluorophore and characterized for conjugation. After the confirmation of conjugation using gel electrophoresis, live WT and KO U937 cells were incubated with scFv-ASO, fluorescent scFv and fluorescent ASO on ice. After thorough washes, the specific binding of scFv to CD33 on cell surface was quantified using flow cytometry. The conjugation of ASO to scFv increased its binding by 7-fold while the scFv binding affinity to the epitope was largely unaltered with ASO attachment (Figure 3).

[0506] Aim 1: Synthesis and evaluation of antibody-oligonucleotide conjugates

[0507] The initial goal of this Example is to produce rational antibody oligonucleotide conjugates (AOCs) that can effectively discriminate and deliver MALAT1 ASO to CD33 expressing microglia cells. To achieve this, scFv clones will be conjugated to a dye and to ASO with varying linkers and evaluated for target knockdown on microglial cells.

[0508] 1.1 Single-chain antibody production: Clones of humanized CD33 antibodies such as gemtuzumab, lintuzumab, vadastuximab will be used to derive single-chain antibodies (scFv). Heavy and light chain variable domains in scFv will be “stapled” using a Cys-Pro-Pro-Cys linker to decrease the risk of protein aggregation (Boucher, L. E. et al. “Stapling” scFv for multispecific biotherapeutics of superior properties. mAbs 15, 2195517 (2023)) while also enabling site-specific conjugation protocols using thiol-maleimide reaction (Nadkami, D. V. Conjugations to Endogenous Cysteine Residues, in Antibody-Drug Conjugates: Methods and Protocols (ed. Tumey, L. N.) 37-49 (Springer US, New York, NY, 2020). doi: 10.1007 / 978-l-4939-9929-3_3). Creative Biolabs (Shirley, NY) will serve as the vendor responsible for planning and producing these scFvs.

[0509] 1.2 AOC library synthesis: Candidate scFvs will initially be covalently tagged with Alexa Fluor 647 which minimizes non-specific binding (Hughes, L. D., Rawle, R. J. & Boxer, S. G. Choose Your Label Wisely: Water-Soluble Fluorophores Often Interact with Lipid Bilayers. PLOS ONE 9, e87649 (2014)). These conjugates will be incubated with WT and CD33 KO U937 cells, followed by washing

[0510] 56

[0511] MEl\57477843.v2 Atorney Docket No. 138777-00120 to assess CD33 -dependent cell surface binding using flow cytometry. Non-stained WT cells will be used as a negative control while gemtuzumab IgG will serve as a benchmark for selectivity (Figure 1). All scFvs with specificity comparable to the IgG will be advanced for ASO conjugation. scFv thiol-maleimide conjugation to MALAT1 ASO will include cleavable linkers and extensions to ensure optimal ASO uptake, half-life and to avoid interference from scFv with RNaseH cleavage. An acid-labile hydrazone linker will be implemented. The acid-labile hydrazone linker has been used in the FDA-approved drug gemtuzumab ozogamicin (Fu, Z., Li, S., Han, S., Shi, C. & Zhang, Y. Antibody drug conjugate: the “biological missile” for targeted cancer therapy. Sig Transduct Target Ther 7, 1-25 (2022); Bargh, J. D., Isidro-Llobet, A., Parker, J. S. & Spring, D. R. Cleavable linkers in antibody-drug conjugates. Chem. Soc. Rev. 48, 4361-4374 (2019)) for cargo release in acidifying endosomes. A cathepsin cleavable valine -citrulline dipeptide will also be used. The cathepsin cleavable valine -citrulline dipeptide was successfully used in the FDA-approved drug brentuximab vedotin (Fu, Z., Li, S., Han, S., Shi, C. & Zhang, Y. Antibody drug conjugate: the “biological missile” for targeted cancer therapy. Sig Transduct Target Ther 7, 1-25 (2022)) and in other applications (Anami, Y. et al. Glutamic acid-valine-citrulline linkers ensure stability and efficacy of antibody-drug conjugates in mice. Nat Commun 9, 2512 (2018)). The cleavable linkers will be extended with poly-ethylene glycol (PEG) linkers of varying lengths (no PEG, PEG4, PEG10, PEG24) for optimal ASO release. These combinations produce up to 24 MALAT1 AOCs (3 scFvs, 2 cleavable linkers, 4 linker lengths) with 2 ASOs per scFv. The conjugates will be characterized using SDS-PAGE and purified using ion exchange chromatography after synthesis. Binding of these functionalized AOCs to CD33 will be evaluated by flow cytometry using U937 cells and controls as described above for testing of unconjugated scFvs. Candidate linker and scFv combinations that retain CD33 specific binding will be selected for further studies.

[0512] 1.3 Measuring activity duration and potency enhancement: To evaluate the amplification of uptake conferred by scFvs, human iPSC microglia (FCDI, WI) will be treated with MALAT1 AOCs at 1 pM to follow the downregulation of mRNA at 3, 7, 10, and 14 day time points using qPCR. Since the potency could be affected by the stability of the AOCs in culture, the treated cells will be sampled before the treatment and every 3 days after the treatment for 12 days. AOC target knockdown across all timepoints will be considered and compared to naked ASO at stoichiometrically equivalent 2 pM to decipher the kinetics of ASO release and engagement. AOCs that exceed MALAT1 ASO performance will be subjected to a dose-response evaluation spanning low nM to high pM concentrations on microglial cells. Top 6-8 AOC designs with increased potency and target downregulation will be advanced for conjugation with APRTX and SOD1 ASOs.

[0513] Milestone: The success criteria for this aim will be the optimization and generation of 6-8 MALAT1 AOC candidates that can efficiently internalize ASO into microglia leveraging their unique CD33 receptor expression.

[0514] 57

[0515] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0516] Alternative Strategies: Multiple antibodies, linker lengths and cleavage chemistries will be employed to avoid potential disruption of scFv binding to the receptor. But if inefficiency while evaluating MALAT1 knockdown is observed, a bis-maleimide linker would be employed to reduce the proposed scFv:ASO ratio of 1:2 to 1: 1 ratio to minimize ASO interference with CD33 internalization. Another potential hurdle is that the cleavable linkers could be inefficient in ASO release to cytosol. In such cases, the linker system can be replaced with other protease- (phenylalanine-lysine, and valine-alanine) and acid-cleavable (poly lactic-co-glycolic acid; PLGA) linkers for efficient release. Differentiated WT U937 cells would also be utilized for initial evaluation if greater than 12 AOCs must be evaluated for dose-response experiment to reduce the reliance on expensive iPSCs. A decision to explore additional designs will be made based on potency comparisons to the unconjugated ASOs.

[0517] Aim 2: Evaluation of AOC designs in vitro with SOD1 and APRTX ASOs

[0518] Once successful AOC blueprints for microglial shutling have been identified, those scFv linker combinations with enhanced delivery and potency will be replicated to synthesize additional SOD1 and APRTX AOCs. This will allow for dissection of the impact of the linkers and scFvs on the AOC performance and demonstration of the level of generalizability. It is expected that the specific sequence of the ASOs will have relatively minor effect on CD33 binding for each AOC design. The sequence-dependent effects on AOC potency are also minimized by the use of linkers of varying lengths. Since APRTX can only be evaluated in microglia screening of APRTX AOCs will be done only after the SOD1 AOCs are verified to be selective and nontoxic to neurons.

[0519] 2.1 Generate SOD1 and APRTX AOC library: The SOD1 and APRTX AOCs will be first generated for the top 6-8 designs whose synthesis and binding evaluation will be done exactly as described for MALAT1 AOCs above. To ensure selectivity and generalizability of AOC designs, the constructs will be screened on WT and CD33 KO U937 cells to measure mRNA and protein using qPCR and ELISA. An endotoxin removal step will be introduced to all AOCs and the final endotoxin levels will be tested before evaluating toxicity and potency.

[0520] 2.2 Measure potency and selectivity: The dose-response and potency enhancement of AOCs compared to unconjugated ASOs will be gauged on differentiated WT U937 cells where AOCs are expected to exceed the ASO activity. In the same experiment, CD33 KO cells will be used to set a baseline non-specific uptake where AOC activities are expected to be in alignment with non-treated and free scFv treated cells. The AOC target potency will be measured on day 3 as U937s can retrodifferentiate after PMA-removal with longer culture periods (Bertram, C. et al. The differentiation / retrodifferentiation program of human U937 leukemia cells is accompanied by changes of VCP / p97. BMC Cell Biol 9, 1-16 (2008)). Both RNA and protein level will be quantified to serve as orthogonal measures of selectivity and potency of SOD1 and APRTX AOCs.

[0521] 58

[0522] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0523] 2.3 SOD1 AOC selectivity evaluation in iPSC monocultures: Following the experiment outline above the SOD1 AOCs will be tested on CD33+ cells (microglia) and compared to CD33- cells (neuron, astrocytes) separately as monocultures maintained on 96-well plates. Non-treated cells and free ASO will be used as controls. SOD1 ASO and AOCs treatment on human iPSCs will be done at concentrations with maximal potency difference and the RNA (qPCR), protein (ELISA) quantification will be done at 3 and 7 days (or aim 1.3 data informed timepoints) to re-validate the previously observed selectivity. The expected result is increased potency of the target transcript downregulation with AOCs relative to unconjugated ASOs in microglia but not astrocytes or neurons. Additionally, conditioned media from neuronal cell group will be used for neurofilament light polypeptide (NF-L) ELISA measurement to quantify neuronal toxicity. AOC candidates with consistent selectivity towards CD33 -dependent uptake and low neuronal toxicity will be selected for APRTX.

[0524] 2.4 APRTXAOC selectivity evaluation in iPSC tricultures: A triculture of RFP -expressing motor neurons (Neuromics), GFP -expressing microglia and non-fluore scent astrocytes (FCDI, WI) will be co-plated and cultured in 6: 1: 1 respective ratio and maintained for 7 days on 96-well plates prior to treatment as recommended by the cell vendor (FCDI, WI). To evaluate the protein-level activity, the cells treated with APRTX AOCs and ASOs for 3 and 7 days. The media from triculture will also be sampled periodically for NF-L measurements. The cells in tri -culture will then be fixed, permeabilized, and stained with antibodies against APRTX to measure the relative protein depletion in microglia with AOC and ASO treatments using immunofluorescence imaging. The integrated fluorescence intensity in microglia will be compared for both the unconjugated ASOs and the AOCs to evaluate selectivity.

[0525] Milestone: The second milestone is the validation of generalizable AOC designs that are efficiently taken up by microglial cells and demonstrate CD33 -dependent activity without neuronal toxicity. Successful completion would yield a ranked list of candidate AOCs based on selectivity and potency with the top 2-3 performers showing strong microglial depletion compared to free ASOs and will be selected for subsequent studies.

[0526] Alternative Strategies: If tri culture maintenance after AOC treatment becomes challenging, testing on monocultures will be reverted to where target engagement will be evaluated only on microglia. It is noted that similarly to the GalNAc strategy, this approach does directly prevent and ASO uptake by non-targeted cell types. Instead, it is aimed at increasing uptake and potency in the targeted cell types which allows decreasing the dose and indirectly resulting in lower activity in cells that are not being targeted.

[0527] Example 3.

[0528] This example provides preliminary data demonstrating successful fluorescent labeling of lintuzumab single chain antibodies (scFvs) and the functionality of scFv-ASO conjugates.

[0529] Conjugation of scFv using thiol-maleimide to Atto488 fluorophore

[0530] 59

[0531] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0532] Lintuzumab scFvs were conjugated using thiol-maleimide crosslinking to the fluorescent label, Ato488. The conjugation reaction was verified using gel electrophoresis (Figure 4). Briefly, 2 pg of scFv Ato488 (lane 4) was ran in lx MOPS buffer at 200V for 50 mins along with denatured scFv Ato488 (lane 2), HIM3 / 4-FITC (an anti-CD33 IgG labeled with fluorescein Isothiocyanate (FITC), lane 3), and P67.6-FITC (an anti-CD33 IgG labeled with FITC, lane 1). The scFv and antibody bands were imaged in the 488 nm channel. Colorimetric imaging was used for the ladder and then superimposed.

[0533] The results are provided in Figure 4. As shown in the figure, the bands around 25 kDa in lanes 2 and 4 demonstrate successful conjugation of scFv to the Ato488 fluorophore.

[0534] Single chain antibodies (scFvs) retain selectivity to target CD33 receptors after conjugation to ASO

[0535] Live U937 WT and CD33 KO cells were stained with the antibodies conjugated to a fluorophore or ASO-fluorophore on ice. The fluorescence was measured using flow cytometry.

[0536] The results are provided in Figure 5 and Figure 3. Figure 5 shows that whereas the ASO can non-specifically bind to the cell surface, the antibodies selectively bind only the cells expressing CD33 and the specificity is carried over upon scFv conjugation to the ASO. As discussed above in Example 2, Figure 3 shows that the specific scFv binding leads to higher level of accumulation on cell surface than the non-specific ASO binding.

[0537] In summary, the scFv-ASO conjugate has a benefit of both increased specificity and more binding. scFv-ASO conjugates get selectively taken up into cells expressing CD33

[0538] U937 WT and CD33 KO cells were treated with scFv-ASO (final cone. 1 pM) for 72 hours at 37 °C. Cells were fixed using 4% PFA and then imaged for uptake.

[0539] The results are provided in Figure 6 and Figure 7 which provide graphs showing GFP integrated density and percent GFP positive cells, respectively. As shown in each figure, WT U937 cells have higher uptake of scFv-ASO than CD33 KO U937 cells. Accordingly, scFv-ASO gets selectively taken up into cells expressing CD33. scFv-ASO conjugates retain the potency of unconjugated ASO

[0540] Differentiated U937 WT cells (n=3) were treated with scFv, ASO, and scFv-ASO IpM for 24 hours at 37°C. Cells were then lysed and the expression of target RNA was analyzed using qPCR. The data points were referenced to the peptidylprolyl Isomerase B (PPIB) gene.

[0541] The results are provided in Figure 8. As shown the figure, scFv-ASO retains potency similar to that of unconjugated ASO at all concentrations while the scFv alone has very minimal effect on the target knockdown.

[0542] 60

[0543] MEl\57477843.v2 Attorney Docket No. 138777-00120

[0544] EQUIVALENTS

[0545] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.

[0546] Informal Sequence Listing

[0547] 61

[0548] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0549] 62

[0550] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0551] 63

[0552] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0553] 64

[0554] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0555] 65

[0556] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0557] 66

[0558] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0559] 67

[0560] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0561] 68

[0562] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0563] 69

[0564] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0565] 70

[0566] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0567] 71

[0568] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0569] 72

[0570] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0571] 73

[0572] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0573] 74

[0574] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0575] 75

[0576] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0577] 76

[0578] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0579] 77

[0580] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0581] 78

[0582] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0583] 79

[0584] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0585] 80

[0586] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0587] 81

[0588] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0589] 82

[0590] MEl\57477843.v2 Atorney Docket No. 138777-00120

[0591] 83

[0592] MEl\57477843.v2 Attorney Docket No. 138777-00120

[0593] Additional Sequences

[0594] MEl\57477843.v2

Claims

1. Atorney Docket No. 138777-00120CLAIMSWe claim:

1. An antibody oligonucleotide conjugate (AOC) comprising an antisense polynucleotide agent conjugated to a cluster of differentiation 33 (CD33) antibody.

2. The AOC of claim 1, wherein the antisense polynucleotide agent comprises about 4 to about 50 contiguous nucleotides.

3. The AOC of any one of the previous claims, wherein substantially all of the nucleotides of the antisense polynucleotide agent are modified nucleotides.

4. The AOC of claim 3, wherein all of the nucleotides of the antisense polynucleotide agent are modified nucleotides.

5. The AOC of any one of the previous claims, wherein the antisense polynucleotide agent is 18 to 30 nucleotides in length, 10 to 24 nucleotides in length, 18 to 24 nucleotides in length, 20 nucleotides in length, or 14 nucleotides in length.

6. The AOC of any one of the previous claims, wherein the antisense polynucleotide agent is capable of binding to a Metastasis Lung Cancer Associated Transcript 1 (MALAT1), Superoxide Dismutase 1 (SOD1), CSF1R, NLRP3, MMP9, TREM2, FN1, CHIT1, or CHI3L1 target sequence.

7. The AOC of claim 6, wherein the MALAT1 target sequence is a non-coding MALAT1 ribonucleic acid (RNA) sequence.

8. The AOC of claim 7, wherein the antisense polynucleotide agent comprises a sequence of GCCAGGCTGGTTATGACTCA (SEQ ID NO: 8).

9. The AOC of claim 8, wherein the sequence GCCAGGCTGGTTATGACTCA (SEQ ID NO: 8) comprises modified nucleotides.

10. The AOC of claim 9, wherein the sequence GCCAGGCTGGTTATGACTCA (SEQ ID NO: 8) comprises / 52MOErG / * / i2MOErC / / i2MOErC / / i2MOEr A / / i2MOErG / G* C*T*G*G*T*T*A*T*G* / i2M OErA / / i2MOErC / / i2MOErT / * / i2MOErC / * / 32MOErA / .

11. The AOC of any one of the previous claims, wherein the CD33 antibody is a single-chain variable fragment (scFv).

12. The AOC of claim 11, wherein the scFv comprises an amino acid linker connecting the heavy and light chain variable domains, wherein the amino acid linker comprises the amino acid sequence of CPPC (SEQ ID NO: 9).

13. The AOC of any one of the previous claims, wherein the CD33 antibody is gemtuzumab or an scFv fragment thereof, lintuzumab or an scFv fragment thereof, vadastuximab or an scFv fragment thereof, AVE9633 or an scFv fragment thereof, IMGN779 or an scFv fragment thereof, or hu-MY 9-6 or an scFv fragment thereof.85MEl\57477843.v2Atorney Docket No. 138777-0012014. The AOC of any one of the previous claims, wherein the antisense polynucleotide agent is conjugated to the CD33 antibody via a linker.

15. The AOC of claim 14, wherein the linker comprises a cysteine, lysine, glutamine and / or unnatural amino acid.

16. The AOC of claim 14 or 15, wherein the linker is a cleavable linker.

17. The AOC of claim 16, wherein the linker is a hydrazone linker or valine -citrulline dipeptide linker.

18. The AOC of any one of claims 14-17, wherein the linker comprises polyethylene glycol (PEG).

19. The AOC of any one of claims 14-17, wherein the linker does not comprise PEG.

20. The AOC of any one of the previous claims, wherein the AOC is capable of accumulating in the microglia of a subject to which the AOC is administered.

21. A pharmaceutical composition comprising the AOC of any one of the previous claims and a pharmaceutically acceptable carrier.

22. The pharmaceutical composition of claim 21 for use in treating a neurodegenerative disease or disorder.

23. The pharmaceutical composition of claim 21, wherein the neurodegenerative disease or disorder is an age-related degeneration or disease where chronic or acute neuroinflammation occurs as a pathology.

24. The pharmaceutical composition of claim 22 or claim 23, wherein the neurodegenerative disease or disorder is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Parkinson’s disease, Alzheimer’s disease, multiple sclerosis, Charcot-Marie-Tooth disease, Huntington’s disease, chemotherapy-induced peripheral neuropathy, Guillian-Barre syndrome, neuromyelitis optic spectrum disorder, acute disseminated encephalomyelitis, myasthenia gravis, cerebral vasculitis, HIV-associated neurocognitive disorders, prion diseases, Hashimoto encephalopathy, or Rasmussen’s encephalitis.

25. A method of inhibiting expression of a target sequence in a cell, the method comprising(a) contacting the cell with the AOC of any one of claims 1-20 or the pharmaceutical composition of any one of claims 21-24; and(b) maintaining the cell produced in step (a) for a time sufficient to obtain antisense inhibition of the target sequence, thereby inhibiting expression of the target sequence in the cell.

26. The method of claim 25, wherein the cell is within a subject.

27. The method of any one of claims 25-26, wherein the cell is a microglial cell.

28. A method of treating a subject that would benefit from reduction of expression of a target sequence, the method comprising administering to the subject a therapeutically effective86MEl\57477843.v2Atorney Docket No. 138777-00120 amount of the AOC of any one of claims 1-20 or the pharmaceutical composition of any one of claims 21-24, thereby treating the subject.

29. The method of claim 28, wherein the subject has a neurodegenerative disease or disorder.

30. A method of preventing at least one symptom of a neurodegenerative disease or disorder in a subject that would benefit from reduction of expression of a target sequence, the method comprising administering to the subject a therapeutically effective amount of the AOC of any one of claims 1-20 or the pharmaceutical composition of any one of claims 21-24, thereby preventing at least one symptom of the neurodegenerative disease or disorder in the subject.

31. The method of claim 29 or claim 30, wherein the neurodegenerative disease or disorder is an age-related degeneration or disease where chronic or acute neuroinflammation occurs as a pathology.

32. The method of any one of claims 29-31, wherein the neurodegenerative disease or disorder is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Parkinson’s disease, Alzheimer’s disease, multiple sclerosis, Charcot-Marie-Tooth disease, Huntington’s disease, chemotherapy-induced peripheral neuropathy, Guillian-Barre syndrome, neuromyelitis optic spectrum disorder, acute disseminated encephalomyelitis, myasthenia gravis, cerebral vasculitis, HIV-associated neurocognitive disorders, prion diseases, Hashimoto encephalopathy, or Rasmussen’s encephalitis.

33. The method of any one of claims 25-32, wherein the subject is a human.

34. The method of any one of claims 25-33, wherein target sequence expression is inhibited by at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%; or wherein RNA splicing through sequencedependent binding to of the AOC to target RNA transcript(s) occurs at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%.

35. A method of producing the AOC of any one of claims 1-20, the method comprising conjugating the antisense polynucleotide agent with the CD33 antibody.

36. The method of claim 35, wherein the conjugation is maleimide -thiol conjugation, direct conjugation using unnatural amino acids, non-specific NHS-ester based heterobifunctional linker conjugation, or conjugation using a microbial transglutaminase.

37. The method of claim 35 or claim 36, wherein one antisense polynucleotide agent is conjugated to one CD33 antibody.

38. The method of claim 35 or claim 36, wherein two antisense polynucleotide agents are conjugated to one CD33 antibody.87MEl\57477843.v2

Citation Information

Patent Citations

  • Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation

    US20040171570A1

  • Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation

    US20080039618A1

  • 6-modified bicyclic nucleic acid analogs

    US20090012281A1

  • UsiRNA Complexes

    US20110313020A1

  • 5' phosphate mimics

    US20120157511A1