Method for constructing chassis cell line used for directed synthesis of anthocyanin and use thereof
By constructing a chassis cell line for the targeted synthesis of anthocyanins and utilizing Agrobacterium rhizogenes-mediated synthesis, efficient targeted synthesis of anthocyanins was achieved, solving the problems of low anthocyanin purity and limited yield, making it suitable for industrial production.
Patent Information
- Application Number
- PCT/CN2024/125964
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-20
- Filing Date
- 2024-10-21
- Publication Date
- 2026-03-26
AI Technical Summary
Currently, anthocyanins are mainly extracted from plant fruits. The yield is affected by plant growth, the quality is inconsistent, the purity is low, and it is difficult to achieve industrial production.
A chassis cell line for the directed synthesis of anthocyanins was constructed. Plant recipient cells were transformed with an anthocyanin synthesis transcription factor overexpression vector via Agrobacterium rhizogenes-mediated transformation to induce hairy roots. Explants were then infected with recombinant Agrobacterium rhizogenes, and specific components were added to the culture medium to induce anthocyanin accumulation.
The targeted synthesis of high-purity anthocyanins was achieved with a short growth cycle and simple cultivation method, making it suitable for industrial production and significantly improving the purity and yield of anthocyanins.
Smart Images

Figure 00000012_0000 
Figure 00000012_0001 
Figure 00000012_0002
Abstract
Description
Construction method and application of chassis cell line for directional synthesis of anthocyanins TECHNICAL FIELD
[0001] The present application belongs to the technical field of cell line construction, and particularly relates to a construction method and application of a chassis cell line for directional synthesis of anthocyanins. BACKGROUND
[0002] Anthocyanins are water-soluble pigments, have many health care functions such as antioxidant and anticancer, and are paid more and more attention in food health care. However, at present, anthocyanins are mainly derived from plant fruit extracts, and their yield is affected by plant growth, and their quality is uneven. The plant extract of anthocyanins is complex, and the European Pharmacopoeia stipulates that the content of anthocyanins is 36% of the total mass to be qualified. Traditional anthocyanins are mainly derived from plant fruits, such as blueberries and black wolfberry, and the extract components are complex and the purity is low.
[0003] SUMMARY
[0004] The purpose of the present application is to provide a construction method and application of a chassis cell line for directional synthesis of anthocyanins, which has a short growth cycle, a simple culture method, can be mass produced in industry, and has high purity, thereby providing technical support for anthocyanin industrialization.
[0005] The present application provides a construction method of a chassis cell line for directional synthesis of anthocyanins, comprising constructing a plant overexpression vector by using an anthocyanin synthesis transcription regulatory factor, transforming a plant receptor cell by a method of Agrobacterium rhizogenes mediation, inducing the transformed cell to generate a hairy root, and the hairy root is the chassis cell line; the plant receptor cell comprises necessary genes for directional synthesis of anthocyanins and / or anthocyanin glycoside derivatives.
[0006] In one specific embodiment of the present application, the basic backbone vector of the plant overexpression vector comprises pBI or pCAMBIA.
[0007] In one specific embodiment of the present application, the anthocyanin synthesis transcription regulatory factor comprises one of MH105054, NM_104541, KP311682 and ON842294.
[0008] In one specific embodiment of the present application, the source of the plant receptor cell of the chassis cell line comprises Antirrhinum majus L.
[0009] In one specific embodiment of the present application, when the stem of Antirrhinum majus L. is used as an explant, the plant overexpression vector constructed is used to transform Agrobacterium rhizogenes, and the recombinant Agrobacterium rhizogenes is obtained.
[0010] After the explants are infected with the bacterial liquid of the recombinant Agrobacterium rhizogenes, the explants are inoculated on a co-culture medium and a debacterialization medium in sequence and cultured in darkness to obtain anthocyanin-accumulating hairy roots;
[0011] The co-culture medium is a MS medium-based medium and further comprises 30 g / L sucrose and 100 mM acetosyringone.
[0012] The debacterialization medium is a MS medium-based medium and further comprises 30 g / L sucrose and 200 mg / L timentin.
[0013] The application further provides a chassis cell line constructed by the above method.
[0014] In one specific embodiment of the application, the method for detecting the chassis cell line comprises detecting the expression amount of a marker gene of Agrobacterium rhizogenes and an anthocyanin synthesis transcriptional regulator.
[0015] In one specific embodiment of the application, the marker gene of Agrobacterium rhizogenes comprises rolA, rolB, rolC and rolD.
[0016] The application further provides an application of the above chassis cell line in the production of anthocyanin.
[0017] In one specific embodiment of the application, the type of anthocyanin comprises cyanidin. Beneficial effects:
[0018] The application obtains a chassis cell line by constructing a plant overexpression vector of a transcription factor, using an Agrobacterium rhizogenes-mediated method and based on a chassis cell hairy root genetic transformation system. The chassis cell line can achieve the effect of overexpression of genes and efficient directional synthesis of cyanidin, and has a high content, which significantly improves the purity of extracted anthocyanin. The chassis cell line has the advantages of a short growth cycle and a simple culture mode, and can be mass-produced for industrialization, thereby providing technical support for the industrialization of anthocyanin. The chassis cell line for directional synthesis of anthocyanin constructed by the application has necessary genes for directional synthesis of anthocyanin and / or anthocyanin glycoside derivatives, overexpresses anthocyanin synthesis transcriptional regulators, and can achieve the purpose of large-scale directional synthesis of anthocyanin. BRIEF DESCRIPTION OF DRAWINGS
[0019] FIG. 1 is a positive identification PCR result graph;
[0020] FIG. 2 is a graph showing the results of anthocyanin accumulation in Antirrhinum majus hairy roots and other species of hairy roots;
[0021] FIG. 3 is an HPLC graph for detecting anthocyanin by using the method of NY / T 2640-2014;
[0022] Figure 4 is a HPLC detection map of different species;
[0023] Figure 5 is a flow chart for directional synthesis of anthocyanidin. DETAILED DESCRIPTION
[0024] The present application provides a method for constructing a chassis cell line for directional synthesis of anthocyanidin, comprising constructing a plant overexpression vector using an anthocyanidin synthesis transcriptional regulator, transforming a plant receptor cell with the plant overexpression vector by Agrobacterium-mediated method, inducing the transformed cell to generate hairy roots, and the hairy roots are the chassis cell line; the plant receptor cell comprises necessary genes for directional synthesis of anthocyanidin and / or anthocyanidin glycoside derivatives.
[0025] The chassis cell line of the present application is obtained by inducing a plant stem cell, which has the characteristics of simple culture and easy genetic modification.
[0026] In one embodiment of the present application, the process shown in Figure 5 is used for directional synthesis of anthocyanidin, wherein CHS (K00660), CHI (K01859), F3H (K00475), DFR (K13082), ANS (K05277), UFGT (EC 2.4.1.91) and F3'H (K05280) are necessary genes for directional synthesis of anthocyanidin. In one embodiment of the present application, the anthocyanidin synthesis transcriptional regulator comprises one of MH105054, NM_104541, KP311682 and ON842294, and in the examples, MH105054 is used as an example for illustration.
[0027] In one embodiment of the present application, the plant receptor cell of the chassis cell line is derived from a plant cell with anthocyanidin synthesis ability, such as Antirrhinum majus L. In the examples of the present application, it is proved that, in addition to the chassis cells of Petunia hybrida, Nicotiana sylvestris and Arabidopsis thaliana, anthocyanidin can be accumulated by overexpressing anthocyanidin synthesis regulatory genes. In one embodiment of the present application, the basic backbone vector of the plant overexpression vector comprises pBI1 or pCAMBIA, and in one example, pCAMBIA is used as an example for illustration.
[0028] In one embodiment of the present application, when the stem of Antirrhinum majus L. is used as an explant, the plant overexpression vector constructed is used to transform Agrobacterium rhizogenes to obtain recombinant Agrobacterium rhizogenes;
[0029] After the explant is infected with the bacterial liquid of the recombinant Agrobacterium rhizogenes, it is inoculated on a co-culture medium and a bacteria-free medium in sequence and cultured in the dark to obtain anthocyanidin-accumulating hairy roots;
[0030] The co-culture medium is a MS medium-based medium, further comprising 30 g / L sucrose and 100 mM acetosyringone.
[0031] The debacterized medium is a MS medium-based medium, further comprising 30 g / L sucrose and 200 mg / L timentin.
[0032] The temperature of the dark culture in the present application is 28℃.
[0033] The present application also provides a chassis cell line constructed by the above-mentioned construction method.
[0034] After the chassis cell line is constructed, the present application further comprises detecting the chassis cell line, and a method for detecting the chassis cell line, comprising detecting the expression amount of Agrobacterium rhizogenes marker genes and anthocyanin synthesis transcriptional regulatory factors. The Agrobacterium rhizogenes marker genes in the present application comprise rolA, rolB, rolC and rolD. In one embodiment, the primer pair for detecting the expression amount of rolA comprises rolA-F with the nucleotide sequence as shown in SEQ ID No. 3 and rolA-R with the nucleotide sequence as shown in SEQ ID No. 4; the primer pair for detecting the expression amount of rolB comprises rolB-F with the nucleotide sequence as shown in SEQ ID No. 5 and rolB-R with the nucleotide sequence as shown in SEQ ID No. 6; the primer pair for detecting the expression amount of rolC comprises rolC-F with the nucleotide sequence as shown in SEQ ID No. 7 and rolC-R with the nucleotide sequence as shown in SEQ ID No. 8; and the primer pair for detecting the expression amount of rolD comprises rolD-F with the nucleotide sequence as shown in SEQ ID No. 9 and rolD-R with the nucleotide sequence as shown in SEQ ID No. 10. In one embodiment of the present application, the anthocyanin synthesis transcriptional regulatory factor is VcMYBA, and the primer pair for detecting the expression amount of VcMYBA comprises VcMYBA-F with the nucleotide sequence as shown in SEQ ID No. 11 and VcMYBA-R with the nucleotide sequence as shown in SEQ ID No. 12.
[0035] The present application also provides the application of the above-mentioned chassis cell line in the production of anthocyanins.
[0036] In one specific embodiment of the present application, the type of anthocyanins comprises cyanidin.
[0037] In order to further illustrate the present application, the construction method and application of a chassis cell line for the directional synthesis of anthocyanins provided by the present application are described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.
[0038] Example 1
[0039] 1. Construction of overexpression vector
[0040] The plant overexpression vector was constructed using the gene MH105054 with the ability to regulate anthocyanin synthesis as a template.
[0041] 1.1 Purpose fragment amplification: The primers were designed using the codon-optimized sequence as a template and the high-fidelity amplification was performed using Antirrhinum majus as the host.
[0042] F (SEQ ID No. 1): atggacatagttccattgggagtgag;
[0043] R (SEQ ID No. 2): ttacagtactgcttgttcatcacctaaaatatcc;
[0044] 50 μL PCR reaction system: 50-100 ng of template, 2 μL of 10 μM upper and lower primers, 25 μL of Mix, and the rest of ddH2O;
[0045] PCR reaction program: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 58℃ annealing for 50 s, 72℃ extension for 1 kb / 5 s, 35 cycles; 72℃ final extension for 5 min; 4℃ keeping.
[0046] 1.2 After the PCR, agarose gel electrophoresis and gel recovery were performed.
[0047] 1.3 Vector linearization: The empty vector (pCAMBIA1301) was cut by restriction enzyme BamH I, 50 μL of cutting system: 1 μg of plasmid, 1 μL of BamH I enzyme, 5 μL of 10×buffer, and the rest of ddH2O.
[0048] After 37℃ constant temperature water bath cutting for 15 min, it was placed on ice and recovered by 1.5% agarose gel electrophoresis.
[0049] 1.4 Gel recovery: The purpose fragment gel recovery was performed according to the instructions.
[0050] 1.5 Purpose fragment homologous recombination: The purpose fragment homologous recombination was performed according to the instructions.
[0051] The calculation of the use amount of the vector fragment:
[0052] The optimal cloning vector use amount was 0.03 pmol, and the optimal insertion fragment use amount was 0.06 pmol (the molar ratio of vector to insertion fragment was 1:2). The DNA mass corresponding to these molar numbers can be roughly calculated by the following formula:
[0053] The optimal cloning vector use amount = [0.02 × the number of base pairs of the cloning vector] ng (0.03 pmol)
[0054] Optimal insert fragment usage = [0.04 x insert fragment base pairs] ng (0.06 pmol)
[0055] For example, when a 2 kb insert fragment is cloned into a 5 kb cloning vector, the optimal usage of the cloning vector should be: 0.02 x 5,000 = 100 ng; the optimal usage of the insert fragment should be: 0.04 x 2,000 = 80 ng.
[0056] Prepare 20 μL system on ice: linearized vector X μL, insert fragment y μL, 5 x buffer 2 μL, enzyme 1 μL, and the rest of ddH2O;
[0057] Gently pipette to mix and centrifuge briefly to collect the reaction solution at the bottom of the tube. React at 37 °C for 30 min; cool down to 4 °C or immediately on ice.
[0058] 1.6 Transform E. coli: Dissolve E. coli competent cells on ice; take 10 μL recombination product and add to 100 μL competent cells, gently mix, stand on ice for 5 min, heat shock at 42 °C for 45 sec, stand on ice for 2 min; add 700 μL LB liquid medium without antibiotics, shake at 37 °C for 30 min; centrifuge at 2000 rpm for 2 min, discard supernatant, resuspend bacterial bodies with the remaining medium, spread on plates containing corresponding antibiotics, and incubate upside down for 14-18 h.
[0059] 1.7 Colony positive clone identification: After overnight culture, use a gun head to pick well-growing colonies for positive clone PCR identification.
[0060] 25 μL PCR reaction system: template trace, 1 μL of 10 μM upper and lower primers each, 12.5 μL of Mix, and the rest of ddH2O.
[0061] PCR reaction program: 98 °C pre-denaturation for 5 min; 98 °C denaturation for 30 s, 58 °C annealing for 50 s, 72 °C extension for 1 kb / 1 min, 35 cycles; 72 °C final extension for 5 min; 4 °C holding.
[0062] After PCR, perform agarose gel electrophoresis, select colonies with clear bands and correct sizes for expansion and sequencing.
[0063] 1.8 Plasmid extraction: Expand the single clone with correct sequencing, and perform plasmid extraction according to the instructions of the Gold Plasmid Extraction Kit.
[0064] 1.9 Transformation of Agrobacterium rhizogenes: Agrobacterium rhizogenes competent cells MSU440 were thawed on ice; 10 μL plasmid was added to 100 μL competent cells, mixed gently, and incubated on ice for 5 min, in liquid nitrogen for 5 min, and at 37 °C for 5 min; 700 μL LB liquid medium without antibiotics was added, and the bacteria were shaken at 28 °C for 2-3 h; the bacteria were centrifuged at 6000 rpm for 6 min, and the supernatant was discarded; the bacteria were resuspended with the remaining medium and spread on a plate containing the corresponding antibiotic, and incubated for 48-72 h.
[0065] 1.10 Identification of Agrobacterium colony positive clones: the method was the same as that for identification of E. coli colony positive clones.
[0066] 2. Induction of anthocyanin-accumulating hairy roots
[0067] The positive Agrobacterium strain was expanded (3 cm-long hairy roots were cut on a clean bench, inoculated into MS + 30 g / L sucrose + 200 mg / L timentin medium, and infected into plant explants, which were then placed on sterile filter paper to absorb the excess bacteria solution, and then placed on co-culture medium (MS medium + 30 g / L sucrose + 100 μΜ acetosyringone) for dark culture for 2 days. The bacteria were removed by washing with sterile water, and the water was absorbed on sterile filter paper, and then the roots were placed on bacteria-removing medium (MS medium + 30 g / L sucrose + 200 mg / L timentin) for induction culture under dark conditions, to obtain anthocyanin-accumulating hairy roots.
[0068] 2.1 Detection of positive strains
[0069] Extraction of DNA: 0.1 g of hairy root material was washed with double-distilled water and the water was absorbed with filter paper. The plant material was cut into 1 cm-long segments, placed in a grinding tube with grinding beads, quickly placed in liquid nitrogen, and ground into fine powder with a tissue grinder. 1 mL of CTAB extraction buffer was added to the grinding tube, and 1% β-mercaptoethanol was added, and the mixture was incubated at 65 °C for 30 min, and inverted every 5 min. After incubation, the mixture was allowed to stand at room temperature for 2-3 min, and centrifuged at 10000 rpm for 5 min. The supernatant was transferred to a clean centrifuge tube, and 1 mL of chloroform was added, and the mixture was vortexed and centrifuged at 13000 rpm for 10 min. 900 μL of the supernatant was transferred to a clean centrifuge tube, and 900 μL of chloroform was added, and the mixture was vortexed for 1 min and centrifuged at 13000 rpm for 10 min. 600 μL of the supernatant was transferred to a clean centrifuge tube, and an equal volume of 8 M LiCl was added, and the mixture was mixed and precipitated at 4 °C for 3 h. The mixture was centrifuged at 13000 rpm for 10 min, and the supernatant was removed and washed with 75% ethanol, and centrifuged at 8000 rpm for 3 min, and the supernatant was removed, and the step was repeated once. The sample was blown dry on a clean bench, and the residual ethanol was removed, and the DNA was resuspended with RNase-ddH2O, and the concentration and purity were determined.
[0070] PCR identification: PCR verification was performed using Agrobacterium rhizogenes marker genes RolA, RolB, RolC, RolD and the target gene. The reaction system and reaction procedure were the same as above.
[0071] rolA-F (SEQ ID No. 3): ATGGAATTAGCCGGACTAAACG;
[0072] rolA-R (SEQ ID No. 4): TTAATCCCGTAGGTTTGTTTCGA;
[0073] rolB-F (SEQ ID No. 5): gcaggcttcatatcaccctcttcac;
[0074] rolB-R (SEQ ID No. 6): caccctcccatgcttgtcg;
[0075] rolC-F (SEQ ID No. 7): ggcggaatttgacctatgtgctc;
[0076] rolC-R (SEQ ID No. 8): ccattccaaatttgcattcgccat;
[0077] rolD-F (SEQ ID No. 9): ggctcgttatttcggcagtagc;
[0078] rolD-R (SEQ ID No. 10): ccaacaggaccttgccaattgc;
[0079] VcMYBA-F (SEQ ID No. 11): CTCTCCAACCCATCCCAAAC;
[0080] VcMYBA-R (SEQ ID No. 12): ACCGTTATCCACCATCATGG.
[0081] The results are shown in Figure 1. RolD is an Agrobacterium rhizogenes marker gene; MYB is the target gene, and actin is the internal reference gene.
[0082] 2.2 Anthocyanin detection: Anthocyanin types and content were detected according to the national standard method (NY / T 2640-2014).
[0083] As shown in Figure 3, cyanidin could be detected in the chassis cells, and the retention time was 19.381.
[0084] As shown in Figure 4, in different extracts of anthocyanin-rich fruits, they all contain a large amount of other substances, and anthocyanins are not detected in some commercially available extracts, so the chassis cells provided by the present application have a significant advantage in content and purity.
[0085] Comparative Example 1
[0086] Using the same method as Example 1, petunia, Sanxi tobacco and Arabidopsis thaliana species were used as chassis cells. As shown in Figure 2, anthocyanins cannot be accumulated by overexpressing anthocyanin synthesis regulatory genes.
[0087] Although the above examples make a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which are within the scope of protection of the present application.
Claims
1. A method for constructing an oriented synthetic anthocyanin production cell line, characterized by, The application relates to a plant overexpression vector constructed by using a cyanidin synthesis transcriptional regulator, a plant receptor cell transformed by the plant overexpression vector through an Agrobacterium rhizogenes-mediated method, and a hairy root generated by the transformed cell, wherein the hairy root is the chassis cell line. The plant receptor cell comprises necessary genes for the directional synthesis of cyanidin and / or a cyanidin glycoside derivative. The basic skeleton vector of the plant overexpression vector comprises pBI or pCAMBIA.
2. The method of claim 1, wherein, The cyanidin synthesis transcriptional regulator comprises one of MH105054, NM_104541, KP311682 and ON842294.
3. The method of claim 1, wherein, The necessary genes for the directional synthesis of cyanidin and / or a cyanidin glycoside derivative comprise CHS, CHI, F3H, DFR, ANS, UFGT and F3'H.
4. The method of claim 1, wherein, The ID of CHS is K00660, the ID of CHI is K01859, the ID of F3H is K00475, the ID of DFR is K13082, the ID of ANS is K05277, the ID of UFGT is EC 2.4.1.91, and the ID of F3'H is K05280.
5. The method of claim 4, wherein, The plant receptor cell is derived from Antirrhinum majus L.
6. The construction method according to claim 1 or 4 or 5, wherein, When the stem of Antirrhinum majus L. is used as an explant, the Agrobacterium rhizogenes-mediated method comprises the following steps: transforming Agrobacterium rhizogenes with the constructed plant overexpression vector to obtain recombinant Agrobacterium rhizogenes; 7. The method of construction according to claim 6, wherein, After the explant is infected with the bacterial liquid of the recombinant Agrobacterium rhizogenes, the explant is inoculated on a co-culture medium and a sterilization medium in sequence and cultured in the dark to obtain cyanidin-accumulating hairy roots; The co-culture medium is an MS medium as a basic medium, and further comprises 30 g / L sucrose and 100 mM acetosyringone; The sterilization medium is an MS medium as a basic medium, and further comprises 30 g / L sucrose and 200 mg / L timentin. The chassis cell line is detected, and the method for detecting the chassis cell line comprises detecting the expression amount of an Agrobacterium rhizogenes marker gene and a cyanidin synthesis transcriptional regulator.
8. The host cell line of claim 1, wherein, The Agrobacterium rhizogenes marker gene comprises rolA, rolB, rolC and rolD.
9. The chassis cell line of claim 8, wherein, The primer pair for detecting the expression amount of rolA comprises rolA-F with the nucleotide sequence shown in SEQ ID No. 3 and rolA-R with the nucleotide sequence shown in SEQ ID No. 4; 10. The chassis cell line of claim 9, wherein, The primer pair for detecting the expression amount of rolB comprises rolB-F with the nucleotide sequence shown in SEQ ID No. 5 and rolB-R with the nucleotide sequence shown in SEQ ID No. 6; The primer pair for detecting the expression amount of rolC comprises rolC-F with the nucleotide sequence shown in SEQ ID No. 7 and rolC-R with the nucleotide sequence shown in SEQ ID No. 8; The primer pair for detecting the expression amount of rolD comprises rolD-F with the nucleotide sequence shown in SEQ ID No. 9 and rolD-R with the nucleotide sequence shown in SEQ ID No.
10. 11. The chassis cell line of claim 10, wherein, The anthocyanin synthesis transcriptional regulatory factor is VcMYBA, and the primer pair for detecting the expression amount of the anthocyanin synthesis transcriptional regulatory factor comprises VcMYBA-F as shown in SEQ ID No. 11 and VcMYBA-R as shown in SEQ ID No.
12.
12. A chassis cell line for directed synthesis of anthocyanin obtained by the construction method according to any one of claims 1-11.
13. Use of the chassis cell line according to claim 12 in the production of anthocyanin.
14. Use according to claim 13, characterized in that, The anthocyanin comprises cyanidin.
15. A method for producing anthocyanins, characterized by, The method comprises the following steps: The Agrobacterium rhizogenes is transformed by using a plant overexpression vector, and a recombinant Agrobacterium rhizogenes is obtained; the plant overexpression vector comprises an anthocyanin synthesis transcriptional regulatory factor; The stem of Antirrhinum majus is used as an explant, the explant is infected by using the bacterial liquid of the recombinant Agrobacterium rhizogenes, and then the explant is inoculated on a co-culture medium and a sterilization medium in turn for dark culture, so that anthocyanin-accumulating hairy roots are obtained; The co-culture medium is an MS medium as a base medium, and further comprises 30 g / L of sucrose and 100 mM of acetosyringone; The sterilization medium is an MS medium as a base medium, and further comprises 30 g / L of sucrose and 200 mg / L of timentin.
16. The production method according to claim 15, wherein The construction method of the plant overexpression vector comprises the following steps: using SEQ ID No. 1 and SEQ ID No. 2 as a primer pair, and using MH105054, NM_104541, KP311682 or ON842294 as a template to amplify, so that an amplification product is obtained; The amplification product is connected to a linearized vector after pCAMBIA1301 is cut by BamH I, so that the plant overexpression vector is obtained.
17. The production method according to claim 16, wherein The amplification program comprises the following steps: pre-denaturation at 98℃ for 3 min; denaturation at 98℃ for 30 s, annealing at 58℃ for 50 s, elongation at 72℃ for 1 kb / 5 s, 35 cycles; final elongation at 72℃ for 5 min; and keeping at 4℃.
Citation Information
Patent Citations
Compositions and methods for modulating pigment production in plants
CN101258245A
Application of Rosea 1 and Delila as selection markers to chrysanthemum transgenic breeding
CN102719450A
Gene cloning, vector construction and application of baical skullcap root anthocyanin transcriptional regulation factors SbMYB75 and SbDEL
CN109943575A
Anthocyanin synthesis regulation transcription factor and application thereof
CN111909249A
MYB transcription factor for regulating and controlling synthesis of plant procyanidine as well as coding gene and application of MYB transcription factor
CN113845578A