Diagnostics and therapeutics targeting SLC13a3

Monoclonal antibodies targeting SLC13A3 inhibit itaconate uptake, addressing tumor resistance to immunotherapy by enhancing ferroptosis sensitivity and improving treatment efficacy.

WO2026064353A1PCT designated stage Publication Date: 2026-03-26BOARD OF RGT THE UNIV OF TEXAS SYST +1
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/046702
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-17
Filing Date
2025-09-17
Publication Date
2026-03-26

AI Technical Summary

Technical Problem

Current cancer immunotherapy, particularly immune checkpoint blockade (ICB), is ineffective for most patients due to tumor metabolic adaptation mechanisms that resist immune stress, and the role of solute carrier family (SLC) members, especially SLC13A3, in transporting oncometabolites like itaconate in the tumor microenvironment (TME) is understudied.

Method used

Development of monoclonal antibodies and antigen-binding fragments targeting SLC13A3 to inhibit its function, preventing itaconate uptake and enhancing tumor ferroptosis sensitivity through blocking the SLC13A3 transporter.

Benefits of technology

Enhances the efficacy of cancer immunotherapy by overcoming ferroptosis resistance in tumors, reducing tumor growth, and increasing tumor immunogenicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025046702_26032026_PF_FP_ABST
    Figure US2025046702_26032026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure is directed to the interplay between tumor associated macrophages (TAMs) and tumor cells in the TME. SLC13A3 is demonstrated as a transporter for itaconate in tumor cells and plays a previously unreported role in tumor resistance to ferroptosis and ICB. Compositions and methods for blocking the function of SLC13A3's tumor protecting function are described.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] DESCRIPTION

[0002] DIAGNOSTICS AND THERAPEUTICS TARGETING SLC13A3

[0003] PRIORITY CLAIM

[0004] This application claims benefit of priority to U.S. Provisional Application Serial No. 63 / 695,710, filed September 17, 2024, the entire contents of which are hereby incorporated.

[0005] STATEMENT REGARDING FEDERAL GRANT SUPPORT

[0006] This invention was made with government support under grant nos. CA248430, CA217648, CA123088, CA099985, CA193136, CA152470 and P30CA46592 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0007] REFERENCE TO A SEQUENCE LISTING

[0008] This application contains a Sequence Listing XML, which has been submitted electronically and is hereby incorporated by reference in its entirety. Said Sequence Listing XML, created on September 16, 2025, is named UTFHP0407WO.xml and is 291,102 bytes in size.

[0009] BACKGROUND

[0010] 1. Field of the Disclosure

[0011] The present disclosure relates generally to the fields of medicine, oncology, and immunology. More particularly, the disclosure relates to the interplay between tumor associated macrophages (TAMs) and tumor cells in the TME, the role played by SLC13A3 as a transporter for itaconate in tumor cells, a previously unreported role in tumor resistance to ferroptosis and ICB. Thus, intervention by blocking the function of SLC13A3’s tumor protecting function with antibodies and small molecules is described.

[0012] 2. Background

[0013] Despite the remarkable clinical efficacy achieved by current cancer immunotherapy, most patients do not respond and / or develop therapeutic resistance to immune checkpoint blockade (ICB) (Zou et al., 2016). It is paramount to understand the immune resistance mechanisms in the tumor microenvironment (TME), thereby identifying new therapeutic targets and developing more effective immunotherapy (Zou et al., 2016; Kalbasi & Ribas,

[0014] 1

[0015] 4932-3873-8280, v. 1 2020; Pitt et al., 2016). Tumors employ metabolic adaptation mechanisms to evade anti-tumor immunity and resist immune stress-mediated by immunotherapy (Zou & Green, 2023; Chapman and Chi, 2022; O’Sullivan et al., 2019; Kao et al., 2022). There are abundant levels of immunosuppressive oncometabolites in the TME (Zou & Green, 2023; Notarangelo et al., 2022; Cheng et al., 2023; Rowe et al. , 2023; Amer & Rathmell, 2023). However, there exists a significant knowledge gap as to how tumor cells utilize these metabolites, whether and which corresponding transporters, such as solute carrier family (SLC) members, are biologically and immunologically implicated in specific metabolite uptake and action in the TME.

[0016] There are more than 400 SLCs that transport diverse metabolic substrates (Zou & Green, 2023). Recent studies have started to elucidate the importance of transporters for glucose (such as SLC2A1 and SLC2A4) (Macintyre et al., 2014; Reinfeld et al., 2021) and amino acids (such as SLC7A11 and SLC43A2) (Wang et al., 2019; Bian et al., 2020) in T cell- mediated tumor immunity (Zou & Green, 2023; Wang & Zou, 2020). However, most SLC family members, including SLC13, are largely understudied in the context of tumor immune responses and immunotherapy. Among 5 members of the SLC13 family, SLC13A1 and SLC13A4 may be transporters for inorganic sulfate, while SLC13A2, SLC 13 A3, and SLC13A5 are thought to serve as dicarboxylate transporters for di- and tri-carboxylates (Bergeron et al., 2013). However, the expression pattern, immunological significance, and potential role of SLC 13 members in transporting oncometabolites, such as itaconate, in the TME, are not defined.

[0017] Itaconate is a metabolite derived from the tricarboxylic acid (TCA) cycle and catalyzed by aconitate decarboxylase 1 (ACOD1), a metabolic enzyme encoded by immune-responsive gene 1 (IRG1, also named ACOD1) (Nair et al. , 2018; Michelucci et al., 2013). During inflammatory responses, IRG1 is upregulated, leading to increased expression of ACOD1. This enzyme catalyzes the conversion of cis-aconitate to itaconate. Endogenous itaconate plays an immunomodulatory role in inflammatory responses, particularly in bacterial infection (O’Neill & Artyomov, 2019). However, it is unknown whether and how tumor cells can uptake extracellular itaconate in the TME and whether itaconate has a direct effect on tumor cell death triggered by ICB.

[0018] Ferroptosis is a form of regulated cell death driven by iron, reactive oxygen species, and lipid peroxidation of cell membrane lipids (Dixon et al., 2012). ICB-activated T-cell- derived IFNy combined with specific fatty acids function as endogenous ferroptosis inducers, inducing tumor cell ferroptosis and contributing to ICB efficacy (Bian et al. , 2020; Liao et al. , 2022; Bell & Zou, 2024). Induction of tumor ferroptosis is a mode of action of cytotoxic CD8+

[0019] 4932-3873-8280, v. 1 2 T cells (CTLs) and an underlying mechanism of ICB (Bian et al. , 2020; Liao et al. , 2022; Bell & Zou, 2024). Given that most patients are not responsive to ICB, it is posited that there may exist endogenous mechanisms (factors) capable of inhibiting tumor ferroptosis in the TME, enabling tumor immune evasion via ferroptosis resistance.

[0020] 4932-3873-8280, v. 1 3 SUMMARY

[0021] Thus, in accordance with the present disclosure, An isolated monoclonal antibody or an antigen-binding fragment thereof comprising a heavy chain (HC) variable region (VH) and a light chain (LC) variable region (VL) comprising clone-paired CDR sequences as set forth in Table 6; and variants thereof wherein one or more of the HC-CDRs and / or LC-CDRs has one, two, or three amino acid substitutions, additions, deletions, or combinations thereof.

[0022] In some embodiments, the isolated monoclonal antibody is a murine, a rodent, a rabbit, a chimeric, humanized, or human antibody. In some embodiments, the antigen-binding fragment is a recombinant ScFv (single chain fragment variable) antibody, Fab fragment, F(ab’)2 fragment, or Fv fragment. In some embodiments, the isolated monoclonal antibody is a human antibody. In some embodiments, the VH and VL chains have amino acid sequences at least 90% or 95% identical to clone-paired sequences of Appendix II. In other embodiments, the VH and VL chains are encoded by nucleic acid sequences at least 80% or 90% identical to clone-paired sequences of Appendix I. In some embodiments, the VH and VL chains have amino acid sequences identical to clone-paired sequences of Appendix II. In other embodiments, the VH and VL chains are encoded by nucleic acid sequences identical to clone- paired sequences of Appendix I.

[0023] In some embodiments, the isolated monoclonal antibody is a humanized antibody, a chimeric antibody, or a bispecific antibody, binding to both SLC13A3 and an E3 ligase (e.g., RNF43, ZNRF3). In some embodiments, the isolated monoclonal antibodies or an antigen binding fragments thereof suppress the activity of SLC13A3. In some embodiments, the isolated monoclonal antibodies or antigen-binding fragments thereof prevent binding of itaconate to SLC13A3. In some embodiments, the isolated monoclonal antibodies or an antigen binding fragments thereof compete for the same epitope with the isolated monoclonal antibody or an antigen-binding fragment thereof described herein.

[0024] In yet another aspect, the present disclosure provides pharmaceutical compositions comprising the isolated monoclonal antibody or an antigen-binding fragment thereof described herein, and a pharmaceutically acceptable carrier.

[0025] In still another aspect, the present disclosure provides isolated nucleic acids that encodes the isolated monoclonal antibody described herein.

[0026] In another aspect, the present disclosure provides vectors comprising the isolated nucleic acid described herein.

[0027] 4932-3873-8280, v. 1 4 In yet another aspect, the present disclosure provides host cells comprising the vector described herein. In some embodiments, the host cell is a mammalian cell. In other embodiments, the host cell is a CHO cell.

[0028] In still another aspect, the present disclosure provides hybridomas or engineered cells encoding and / or producing the isolated monoclonal antibody described herein.

[0029] In yet another aspect, the present disclosure provides process of producing an antibody, comprising culturing the host cell described herein under conditions suitable for expressing the antibody, and recovering the antibody.

[0030] In another aspect, the present disclosure provides chimeric antigen receptor (CAR) proteins comprising an antigen-binding fragment described herein.

[0031] In yet another aspect, the present disclosure provides isolated nucleic acid that encodes a CAR protein described herein.

[0032] In still another aspect, the present disclosure provides vectors comprising the isolated nucleic acid described herein.

[0033] In another aspect, the present disclosure provides engineered cells comprising the isolated nucleic acid described herein. In some embodiments, the cell is a T cell, NK cell, or macrophage.

[0034] In another aspect, the present disclosure provides methods of treating or ameliorating the effect of a cancer in a subject, inhibiting the progression of cancer in a subject, or inhibiting the growth of a cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of the antibody or an antigen-binding fragment thereof described herein or the engineered cell described herein.

[0035] In some embodiments, the methods reduce or eradicate the tumor burden in the subject. In some embodiments, the methods reduce the number of tumor cells and / or slow tumor growth rate. In some embodiments, the methods reduce tumor size. In some embodiments, the methods reduce or prevent tumor metastasis. In some embodiments, the methods eradicate the tumor in the subject.

[0036] In some embodiments, the cancer is a solid cancer. In some embodiments, the solid cancer is selected from the group consisting of adrenal cancer, bile duct carcinoma, bone cancer, brain cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, colorectal cancer, esophageal cancer, eye cancer, gastric cancer, glioblastoma, head and neck cancer, kidney cancer, liver cancer, lung cancer, mesothelioma, melanoma, merkel cell cancer, nasopharyngeal carcinoma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, penile cancer, pinealoma, prostate cancer, renal cell cancer, retinoblastoma, sarcoma, skin

[0037] 4932-3873-8280, v. 1 5 cancer, testicular cancer, thymic carcinoma, thyroid cancer, uterine cancer, and vaginal cancer. In some embodiments, the monocytes, macrophages, dendritic cells, neutrophils and other myeloid cells, myeloid-derived suppressor cells, and tumor-associated macrophages are targeted. In other embodiments, the cancer is a hematologic malignancy. In some embodiments, the hematologic malignancy is selected from the group consisting of acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), B-cell leukemia, chronic lymphoblastic leukemia (CLL), blastic plasmacytoid dendritic cell neoplasm (BPDCN), chronic myelomonocytic leukemia (CMML), chronic myelocytic leukemia (CML), pre-B acute lymphocytic leukemia (Pre-B ALL), diffuse large B-cell lymphoma (DLBCL), extranodal NK / T-cell lymphoma, hairy cell leukemia, heavy chain disease, HHV8-associated primary effusion lymphoma, plasmablastic lymphoma, primary CNS lymphoma, primary mediastinal large B-cell lymphoma, T-cell / histiocyte-rich B-cell lymphoma, Hodgkin’s lymphoma, non- Hodgkin’ s lymphoma, Waldenstrom's macroglobulinemia, multiple myeloma (MM), myelodysplastic syndromes (MDS), myeloproliferative neoplasms, and polycythemia vera.

[0038] In some embodiments, the antibody or an antigen-binding fragment thereof is administered intravenously, intra-arterially, intra-tumorally, or subcutaneously. In some embodiments, the methods further comprise administering to the subject one or more drugs selected from the group consisting of a topoisomerase inhibitor, an anthracycline topoisomerase inhibitor, an anthracycline, a daunorubicin, a nucleoside metabolic inhibitor, a cytarabine, a hypomethylating agent, a low dose cytarabine (LDAC), a combination of daunorubicin and cytarabine, a daunorubicin and cytarabine liposome for injection, Vyxeos®, an azacytidine, Vidaza®, a decitabine, an all-trans-retinoic acid (ATRA), an arsenic, an arsenic trioxide, a histamine dihydrochloride, Ceplene®, an interleukin-2, an aldesleukin, Proleukin®, a gemtuzumab ozogamicin, Mylotarg®, an FLT-3 inhibitor, a midostaurin, Rydapt®, a clofarabine, a farnesyl transferase inhibitor, a decitabine, an IDH1 inhibitor, an ivosidenib, Tibsovo®, an IDH2 inhibitor, an enasidenib, Idhifa®, a smoothened (SMO) inhibitor, a glasdegib, an arginase inhibitor, an IDO inhibitor, an epacadostat, a BCL-2 inhibitor, a venetoclax, Venclexta®, a platinum complex derivative, oxaliplatin, a kinase inhibitor, a tyrosine kinase inhibitor, a PI3 kinase inhibitor, a BTK inhibitor, an ibrutinib, IMBRUVICA®, an acalabrutinib, CALQUENCE®, a zanubrutinib, a PD-1 antibody, a PD-L1 antibody, a CTLA-4 antibody, a LAG3 antibody, an ICOS antibody, a TIGIT antibody, a TIM3 antibody, a CD40 antibody, a 4-1BB antibody, a CD47 antibody, a SIRPla antibody or fusions protein,

[0039] 4932-3873-8280, v. 1 6 a CD70 antibody, and CLL1 antibody, a CD123 antibody, an antagonist of E-selectin, an antibody binding to a tumor antigen, an antibody binding to a T-cell surface marker, an antibody binding to a myeloid cell or NK cell surface marker, an alkylating agent, a nitrosourea agent, an antimetabolite, an antitumor antibiotic, an alkaloid derived from a plant, a hormone therapy medicine, a hormone antagonist, an aromatase inhibitor, and a P-glycoprotein inhibitor.

[0040] In some embodiments, said isolated monoclonal antibody or an antigen binding fragment thereof further comprises an antitumor drug linked thereto. In some embodiments, said antitumor drug is linked to said antibody through a photolabile linker. In some embodiments, said antitumor drug is linked to said antibody through an enzymatically-cleaved linker. In some embodiments, said antitumor drug is a toxin, a radioisotope, a cytokine, or an enzyme.

[0041] In yet another aspect, the present disclosure provides methods of detecting a cancer cell or cancer stem cell in a sample or subject comprising:

[0042] (a) contacting a subject or a sample from the subject with the antibody or an antigen-binding fragment thereof described herein; and

[0043] (b) detecting binding of said antibody to a cancer cell or cancer stem cell in said subject or sample.

[0044] In some embodiments, the sample is a body fluid or biopsy. In some embodiments, the sample is blood, bone marrow, sputum, tears, saliva, mucous, serum, urine or feces. In some embodiments, detection comprises immunohistochemistry, flow cytometry, an immunoassay (including ELISA, RIA, etc.) or Western blot. In some embodiments, the methods further comprise performing steps (a) and (b) a second time and determining a change in detection levels as compared to the first time. In some embodiments, said isolated monoclonal antibody or an antigen binding fragment thereof further comprises a label. In some embodiments, said label is a peptide tag, an enzyme, a magnetic particle, a chromophore, a fluorescent molecule, a chemo-luminescent molecule, or a dye. In some embodiments, said isolated monoclonal antibody or an antigen binding fragment thereof is conjugated to a liposome or nanoparticle.

[0045] In another aspect, the present disclosure provides methods of treating or ameliorating the effect of a cancer in a subject, inhibiting the progression of cancer in a subject, or inhibiting the growth of a cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a compound of the formula:

[0046] 4932-3873-8280, v. 1 7 wherein:

[0047] Ri is amino, cyano, halo, hydroxy, alkylci-s, substituted alkylci-8, alkenylc2-8, substituted alkenylc2-8, cycloalkylc.3-8, substituted cycloalkylo-s, arylc6-i2, substituted arylce-12, aralkylc7-i2, substituted aralkylc7-i2, heteroarylci-8, substituted heteroarylci-8, heterocycloalkylci -s, substituted heterocycloalky lens, acylci-8, substituted acylci-s, alkoxyci-8, substituted alkoxyci-8, alkylaminoci-8, substituted alkylaminoci-8, dialkylaminoc-12, or substituted dialkylaminoc-12;

[0048] R2 and R3 are each independently selected from CFhORa, C(O)ORt>, or C(O)NRcRc'; and

[0049] Ra, Rb, Rc, and RC' are each independently selected from hydrogen, alkylci-s, substituted alkylci-8, cycloalkylc3-i2, substituted cycloalky lc3-i 2, alkenylc,2-8, substituted alkenylo s, arylc6-i2, or substituted arylc.6-12; and n is 1, 2, 3, or 4; or a pharmaceutically acceptable salt thereof.

[0050] In some embodiments, the compound is further defined as: wherein:

[0051] Ri is amino, cyano, halo, hydroxy, alkylci-8, substituted alkylci-8, alkenylc2-s, substituted alkenylc2-8, cycloalkylc3-8, substituted cycloalkylc3-8, arylce-12, substituted arylce-12, aralkylc7-i2, substituted aralkylc7-i2, heteroarylci-8, substituted heteroarylci-8, heterocycloalkylci-s, substituted heterocycloalkylci-8, acylci-s, substituted acylci-s, alkoxyci-s, substituted alkoxyci-8, alkylaminoci-s, substituted alkylaminoci-8, dialkylaminoc-12, or substituted dialkylaminoc-12; and

[0052] R2 and R3 are each independently selected from CHOR,, C(O)ORb, or C(O)NRcRc'; and

[0053] Ra, Rb, Rc, and RC' are each independently selected from hydrogen, alkylci-s, substituted alkylci-8, cycloalkylc3-i2, substituted cycloalkylc3-i2, alkenylc2-8, substituted alkenylc2-8, arylce-12, or substituted arylce-12; or a pharmaceutically acceptable salt thereof.

[0054] 4932-3873-8280, v. 1 8 In some embodiments, Ri is alkoxyci-s or substituted alkoxyci-s- In some embodiments, n is 1. In some embodiments, R2 is C(O)ORb. In some embodiments, Rb is hydrogen. In some embodiments, R3 is C(O)ORb. In some embodiments, Rb is hydrogen.

[0055] In some embodiments, the compound is further defined as: or a pharmaceutically acceptable salt thereof.

[0056] In some embodiments, the compound is further defined as: or a pharmaceutically acceptable salt thereof.

[0057] In some embodiments, the methods further comprise a second therapeutic agent. In some embodiments, the second therapeutic agent is an anti-PD-Ll therapy. In some embodiments, the anti-PD-Ll therapy is an anti-PD-Ll antibody.

[0058] In another aspect, the present disclosure provides methods of inhibiting the activity of SLC13A3 comprising contacting SLC13A3 with a compound of the formula: wherein:

[0059] Ri is amino, cyano, halo, hydroxy, alkylci-8, substituted alkylci-s, alkenylc2-8, substituted alkenylc2-8, cycloalkylc3-8, substituted cycloalkylc3-8, arylce-12, substituted arylce 12, aralkylc? 12, substituted aralkylc? 12, heteroarylci 8, substituted heteroarylci-8, heterocycloalkylci-8, substituted heterocycloalkylci-s, acylci-8, substituted acylci-s, alkoxyci-8, substituted alkoxyci-8, alkylaminoci-8, substituted alkylaminoci-8, dialkylaminoc-12, or substituted dialkylaminoc-12;

[0060] R2and R3are each independently selected from CFPORa, C(O)ORt>, or C(O)NRcRc'; and

[0061] Ra, Rb, Rc, and RC' are each independently selected from hydrogen, alkylci-s, substituted alkylci-8, cycloalkylc3-i2, substituted cycloalky lc3-i 2, alkenylc.2-8, substituted alkenylc.2-8, arylc.6-12, or substituted arylc.6-12; and

[0062] 4932-3873-8280, v. 1 n is 1, 2, 3, or 4; or a pharmaceutically acceptable salt thereof.

[0063] In some embodiments, the SLC13A3 is contacted in a patient. In some embodiments, the SLC13A3 is contacted in vitro. In some embodiments, the compound is further defined as: or a pharmaceutically acceptable salt thereof.

[0064] In some embodiments, the compound is further defined as: or a pharmaceutically acceptable salt thereof.

[0065] The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” The word “about” means plus or minus 5% of the stated number.

[0066] It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein. Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.

[0067] 10

[0068] 4932-3873-8280, v. 1 BRIEF DESCRIPTION OF THE DRAWINGS

[0069] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0070] FIGS. 1A-G. Tumor SLC13A3 expression correlates with ICB efficacy and patient survival. (FIG. 1A) Expression of SLC13 transcripts were compared in Responders (R) and Non-Responders (N) in melanoma cohort treated with ICB (Cohort 1). n = 63 (R), 56 (N). For SLC13A3, p = 0.0409. (FIG. IB) Association of SLC13A3 expression levels with cancer patient survival was analyzed on melanoma cohort treated with ICB (Cohort 1), SLC13A3 high (n = 54) and low (n = 62) expression, p = 0.0139. (FIG. 1C) Expression of SLC13A3 transcripts were compared in Responders (R) and Non-Responders (N) in HCC cohort treated with ICB (Cohort 2). n = 63 (R), 27 (N), p = 0.0073. (FIG. ID) Association of SLC13A3 expression levels with cancer patient survival was analyzed on HCC cohort treated with ICB (Cohort 2), SLC13A3 high (n = 45) and low (n = 45) expression, p < 0.0001. (FIG. IE) Association of SLC13A3 expression levels with cancer patient survival was analyzed on cohort (Cohort 3) of head and neck cancer (SLC13A3 high n = 3, and low n = 23), bladder (urothelial carcinoma (SLC13A3 high n = 4, and low n = 17), and melanoma (SLC13A3 high n = 4, and low n = 15) patients treated with ICB, p = 0.0361. (FIG. IF) Analysis of single-cell RNA-seq data (GSE72056) depicting SEC 13 A3 expression in the malignant population within the human melanoma tumor microenvironment. (FIG. 1 G) Immunohistochemistry staining (IHC) staining depicting SLC13A3 expression in human melanoma and normal tissue microarrays (TMAs). Data are presented as mean ± SEM (****p < 0.0001).

[0071] FIGS. 2A-J. SLC13A3 diminishes tumor immunogenicity. (FIGS. 2A-B) Tumor growth curves. (FIG. 2A), and representative tumor images (FIG. 2B) of Slcl3a3+I+and SlclSaS'1' Yumm5.2 tumors in C57BL / 6 mice (n = 4-5). (FIGS. 2C-D) Tumor growth curves (FIG. 2C), and representative tumor images (FIG. 2D) of Slcl3a3+I+and Slcl3a3''~ B16-F10 tumors in C57BL / 6 mice (n = 6-8). (FIGS. 2E-F) Tumor growth curves (FIG. 2E) and tumor images (F FIG. 2) of Slcl3a3+’ Slcl3a3~'- MT3 tumors in C57BL / 6 mice (n = 10). (FIGS. 2G- H) Percentages of IFNy+CD8 T cells (FIG. 2G) and TNFa+CD4 T cells (FIG. 2H) in parental or Slcl3a3~'~ Yumm5.2 tumors, detected by FACS. (FIGS. 2I-J) Tumor growth curves (FIG. 21), and representative tumor images (FIG. 2J) of Slcl3a3+'+and Slcl3a3 '' B16-F10 tumors in NSG mice (n = 10-12). All data are presented as mean ± SEM (* / ? < 0.05, ****p < 0.0001).

[0072] 11

[0073] 4932-3873-8280, v. 1 FIGS. 3A-K. SLC13A3 imports itaconate to protect tumor cells from ferroptosis. (FIGS. 3A-B) Single cell RNA-seq and Gene Set Enrichment Analysis (GSEA) depicting up- and down-regulated pathways in malignant population from the in vivo Slcl3a3+ / +and Slcl3a3~ / _B16-F10 tumors (FIG. 3 A), and comparison of ferroptosis resistance signature in Slcl3a3+I+and Slcl 3a3~'~ B16-F10 tumors (FIG. 3B). (FIG. 3C) Tumor growth curves of Slcl3a3+I+and B16-F10 tumors in C57BL / 6 mice with Liproxstatin-1 or control reagent treatment (n = 7). (FIG. 3D) Cell viability assay demonstrating the impact of metabolites on ferroptosis in the presence of Erastin (n = 4). (FIG. 3E) Cell-based transporter assay illustrating the uptake curve of13C itaconate in Yumm5.2 Slcl3a3(>v- cells (n = 3). (FIG. 3F) Percentage of 7-AAD+cells among Yumm5.2 parental or Slcl 3a3~'~ cells pretreated with 5 mM itaconate or control for 4 days, then treated with 0.3 pM RSL3 or 2 pM Erastin for 16 hours. (FIG. 3G) Relative lipid ROS levels in Yumm5.2 parental or Slcl3a3~'~ cells pretreated with 5 mM itaconate or control for 4 days, then treated with 0.3 pM RSL3 for 10 hours. (FIGS. 3H-I) Percentage of 7- AAD+cells among Colo-679 (FIG. 3H) or RVH-421 (FIG. 31) parental or Slcl3a3~'~ cells pretreated with 5 mM itaconate or control for 6 days, then treated with 10 pM Erastin for 16 hours. (FIG. 3J) Percentage of 7-AAD+cells of B16-F10 parental, Slcl3a3 '~ cells, Slcl3a3'' cells rescued with Slcl3a3 rescued with Slcl3a3 or Sic 13a 3^ cells rescued with pretreated with 5mM itaconate or reagent control for 48 hours, then treated with 2pM Erastin for 16 hours. (FIG. 3K) Cell-based transporter assay displaying the uptake ofnC itaconate on B16-F10, parental cells, SlclSaS051(n=3). All data are presented as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

[0074] FIGS. 4A-G. Itaconate activates the NRF2-SLC7A11 axis to protect tumors from ferroptosis. (FIG. 4A) RNAseq and GSEA analysis depicting up- and down-regulated pathways in response to permeable itaconate, 4-octyl itaconate (OI) treatment. (FIGS. 4B-C) NRF2 pathway enrichment plots (B) and representative heatmap (FIG. 4C) demonstrating the association of 4-octyl itaconate (OI) treatment with NRF2-regulated genes. (FIG. 4D) Relative mRNA expression of Slc7all in Yumm5.2 cells treated with different doses of OI. Data are presented as mean ± SEM (n=3). (FIGS. 4E-F) Western blots showing OI (FIG. 4E) and itaconate (FIG. 4F) treatment induces SLC7A11 and NRF2 expression in Slcl3a3~'~ and Slcl3a3OBYumm5.2 cells. (FIG. 4G) Percentage of 7-AAD+cells in Slc7all+’\ Slc7air’- B 16- F10 cells pretreated with OI or control for 24 hours and then treated with RSL3 for 16 hours. Data are presented as mean + SEM (n - 3, ***p < 0.001).

[0075] FIGS. 5A-L. Itaconate promotes tumor progression via inducing ferroptosis resistance. (FIGS. 5A-C) Tumor growth curves of MC38 (FIG. 5A, n = 5), Yumm5.2 (FIG.

[0076] 12

[0077] 4932-3873-8280, v. 1 5B, n = 6-7), and B16-F10 (FIG. 5C, n = 8) in Acodl+I+and Acodl~'~ mice. (FIG. 5D) Relative lipid ROS was quantified in CD45 B 16-F10 tumor cells from Acodl+I+and Acodd mice (n = 7-8). (FIG. 5E) Tumor growth curves of B16-F10 in Acodl+ / +and Acodr" mice with Liproxstatin-1 treatments from day 11 (n = 8). (FIG. 5F) Tumor growth curves of Slddad ^ B16-F10 in Acodl+I+and Acodl~'~ mice (n = 14). (FIGS. 5G-H) Tumor growth curves of Slc7all-'- Yumm5.2 (FIG. 5G, n = 8), and ^ / c / afT^Blh-FlO (FIG. 5H, n = 8) in Acodl+ / +and Aco<LZ‘ / _mice. (FIG. 51) Itaconate level from Yumm5.2 tumor interstitial fluids in Acodl+I+and Acodr1' mice (n = 3). (FIGS. 5I-K) Tumor growth curves of Yumm5.2 (FIG. 51, n = 10), and B16-F10 (FIG. 5K, n = 7-10) in Aco<77LysMKOand Aco<77flox / floxmice. (FIG. 5L) Percentage of 7-AAD+cells in B16-F10 Slcl3a3OEcells, following 72 hours of culture with conditioned medium (CM) from macrophages or normal medium, were then treated with Erastin for 16 hours (n = 3). All data are presented as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001, ddd-'l'p < 0.0001).

[0078] FIGS. 6A-G. SLC13A3 inhibitor treats ICB resistant tumors and sensitizes tumor ferroptosis. (FIG. 6A) Relative inhibitory percentage of compounds on itaconate-induced ferroptosis resistance. Cells were pretreated with 2 mM compounds and 1 mM itaconate, followed by the treatment of 1.5 pM Erastin for an additional 16 hours (n = 4). (FIG. 6B) A graphical representation of the molecular docking simulation depicting the binding of the 2-(3- methoxybenzyl) succinic acid (SLC13A3i) in SLC13A3 model. (FIG. 6C) Cell-based transporter assay showing 20-200 pM SLC13A3i blocking the uptake of extracellular lOOpM13C itaconate on Yumm5.2 Slcl3a3OEcells (n = 3). (FIG. 6D) Percentage of 7-AAD+cells in Yumm5.2 Slcl3a3OEcells with cultured 2 mM SLC13A3i and 1 mM itaconate for 48 hours, then treated with 2 pM Erastin for 16 hours. (FIG. 6E) Tumor growth curves of B 16-F10 tumors in C57BL / 6 mice treated with SLC13A3i or control (n = 10). (FIG. 6F) Tumor growth curves of B16-F10 tumors in C57BL / 6 mice with treated with SLC13A3i, anti-PD-Ll, controls (DMSO or IgG isotype), and the combination of SLC13A3i and anti-PD-Ll (n = 6 - 7). (FIG. 6G) Percentage of tumor infiltrating IFNy+CD8 T cells shown by FACS in B16-F10 tumor bearing mice treated with different agents (n = 5). All data are presented as mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001).

[0079] FIGS. 7A-B. Biotinylated SLC13A3 peptides and Fc Fusion of ECL proteins used for selection of antibodies.

[0080] FIGS. 8A-D. ELISA binding ECso to SLC13A3. (FIG. 8A) ELISA binding curves of SLC13A3 ECL4 specific antibodies. (FIG. 8B) ELISA binding curves of SLC13A3 ECL5

[0081] 13

[0082] 4932-3873-8280, v. 1 specific antibodies. (FIG. 8C) ELISA binding curves of peptide 10-specific antibodies. (FIG. 8D) ELISA binding curves of peptide 11 specific antibodies.

[0083] FIG. 9. Affinity measurement of SLC13A3 antibodies determined by BLI. The binding affinity of SLC13A3 specific antibodies.

[0084] FIGS. 10A-C. Flow cytometry analysis using human and mouse SLC13A3 overexpressing cells to determine conformational binding of mAbs. (FIG. 10A) Detection of antibodies binding to human SLC13A3 expressed on HEK293 cell surface. (FIG. I0B) Detection of antibodies binding to mouse SLC 13A3 expressed on HEK293 cell surface. An isotype human IgGl used as control. Alexa Flour-488 conjugates Goat anti-Human monoclonal antibody used for detection by flow cytometry. (FIG. IOC) Detection of peptide 10- and peptide 11 -specific antibodies binding to human SLC13A3 expressed on HEK293 cell surface. PE- conjugated anti-Human Fab were used for detection by flow cytometry.

[0085] FIGS. 11A-D. Epitope binning of SLC13A3 antibodies. (FIG. 11 A) The antibody binding bins of SLC13A3 ECL-4 specific antibodies. (FIG. 1 IB) The antibody binding bins of SLC13A3 ECL-5 specific antibodies. (FIG. 11C) The antibody binding bins of SLC13A3 peptide 10 specific antibodies. (FIG. 1 ID) The antibody binding bins of SLC13A3 peptide 1 1 specific antibodies. The epitope binning was performed in an In-Tandem format, the biotinylated antigen is first immobilized on the streptavidin biosensor surface, followed by the two antibodies in sequence on Octet RED 96 System.

[0086] FIGS. 12A-D. Tumor SLC13A3 expression correlates with ICB efficacy and patient survival. (FIG. 12A) The relationship of SLC13A3 expression with cancer patient survival in TCGA dataset was analyzed in human low-grade glioma (LGG), pancreatic adenocarcinoma (PAAD), uterine carcinosarcoma (UCS), cholangiocarcinoma (bile duct cancer, CHOL), breast carcinoma (BRCA), skin cutaneous melanoma (SKCM), uterine corpus endometrial carcinoma (UCEC), head and neck squamous cell carcinoma (HNSC), and kidney renal clear cell carcinoma (KIRC).( LGG n = 258, p = 0.0000406; PAAD n = 54, p = 0.00475; UCS n = 30, p = 0.0451 ; CHOL n = 36, p = 0.00497; BRCA n= 550, p= 0.00707; SKCM- Primary n =82 , p = 0.0298; SKCM-Metastasis n =294 , p = 0.0455; UCEC n = 436, p = 0.0108; HNSC n = 261, p = 0.021 ; KIRC n = 320, p= 0.0228). (FIGS. 12B-C) Single-cell RNA-seq data analysis depicting SLC13A3 expression in the malignant population within the human melanoma (GSE115978) and colorectal (CRC, GSE146771) tumor microenvironment. (FIG. 12D) Representative immunohistochemistry (IHC) staining obtained from open resource (world-wide-web at proteinatlas.org / ) showcasing SLC13A3 expression in human pancreatic cancer, colorectal cancer, liver cancer, and ovarian cancer.

[0087] 14

[0088] 4932-3873-8280, v. 1 FIGS. 13A-C. SLC13A3 diminishes tumor immunogenicity. (FIG. 13 A) Tumor growth curves of Slcl3a3 ' B16-F10 rescued with Slcl3a3 (Slcl3a3l +OE~) or vehicle (Slcl3a3 / _) in C57BL / 6 mice (n = 8). (FIG. 13B) Tumor growth curves of Slcl3a3~'~ Yumm5.2 rescued with Slcl3a3 (Slcl 3a3~,-+OE)' or vehicle (Slcl3a3-'-) in C57BL / 6 mice (n = 8). (FIG. 13C) Single-cell RNA-seq analysis of immune cell proportion in the in vivo Slcl3a3+ / +and Slcl3a3" / _B16-F10 tumors. All data are presented as mean ± SEM (**p < 0.01, ****p < 0.0001).

[0089] FIGS. 14A-G. SLC13A3 imports itaconate to protect tumors from ferroptosis. (FIG. 14A) Cell-based transporter assay displaying the uptake of13C itaconate in Slcl3a3 / ' B16-F10 rescued with Slcl3a3 (SlcllaS^*) or vehicle (Slcl3a3-'-) (n = 3). (FIG. 14B) Percentage of 7-AAD+cells in Slcl 3a3 '' B16-F10 cells rescued with Slcl3a3 (Slcl 3a3' / ~+OE) or vehicle (Slcl3a3 '~) after pretreatment with 100 pM cell-permeable itaconate, 4-octyl itaconate (OI) or reagent control for 48 hours, followed by treatment with 2 pM Erastin for 16 hours (n = 3). (FIGS. 14C-G) Percentage of 7-AAD+cells among Yumm5.2 cells (FIG. 14C), B16-F0 cells (FIG. 14D), A375 cells (FIG. 14E), OC8 cells (FIG. 14F), and OVCA429 cells (FIG. 14G) pre-treated with OI or reagent control, then treated with Erastin or RSL3 for 16 hours (n = 3). All data are presented as mean ± SEM (**p < 0.01, ***p < 0.001, ****p < 0.0001).

[0090] FIGS. 15A-C. Itaconate activates the NRF2-SLC7A11 axis to protect tumors from ferroptosis. (FIG. 15A) Western blots illustrating SLC7A11 expression in Slc7all+'+and Slc7air'' Yumm5.2 treated with OI or reagent control for 48 hours. (FIG. 15B) Western blots showing SLC7A11 and NRF2 expression vash-Nfe2l2 or ,s7z-conlrol Slcl3a3OEYumm5.2 cells treated with OI or reagent control for 72 hours. (FIG. 15C) Percentage of 7-AAD+cells in sh- Nfe2l2 or control Slcl3a3OEYumm5.2 cells pre-treated with OI or reagent control for 72 hours, followed by RSL3 treatment for 16 hours (n = 3). Data are presented as mean ± SEM (***p < 0.001).

[0091] FIGS. 16A-D. Itaconate promotes tumor progression via inducing ferroptosis resistance. (FIGS. 16A-C) Single-cell RNA-seq data analysis depicting ACOD1 expression in the macrophage population within the human melanoma (GSE72056, and GSE115978), and colorectal (CRC, GSE146771) tumor microenvironment. (FIGS. 16D) Percentage of 7-AAD+cells in B 16-F10 Slcl3a3~'~ cells, following 72 hours of culture with conditioned medium (CM) from macrophages or normal medium, then treated with Erastin for 16 hours (n = 3).

[0092] FIGS. 17A-D. Targeting SLC13A3 sensitizes tumor ferroptosis and reduces tumor progression. (FIG. 17A) Homology modeling predicting the three-dimensional structure of SLC13A3 (blue) using the crystal structure of SLC13A5 (gray) (PDB id: 7JSJ) as a template.

[0093] 15

[0094] 4932-3873-8280, v. 1 (FIG. 17B) Western blots showing SLC7A11 expression in Yumm5.2 SlclSa^ cells treated with itaconate and 0-2 mM SLC13A3 inhibitor for 48 hours. (FIGS. 17C-D) Tumor growth curves of Slcl3a3 '~ B 16-F10 tumors in C57BL / 6 mice (FIG. 17C) or B16-F10 tumors in Acodl+I+and Acodl'1' mice (FIG. 17D) with SLC13A3i or control reagent (n = 6-8).

[0095] FIG. 18. Variable heavy (H) and variable light (L) DNA sequences.

[0096] FIG. 19. Amino acid sequences of variable heavy (H) and variable light (L) chains.

[0097] FIGS. 20A-C. Evaluation of SLC13A3 inhibition by mAbs. (FIG. 20A) Human SLC13A3 overexpressing melanoma cell line Colo679 were treated with 5 pg / ml anti- SLC13A3 or IgG for 20 minutes. Then cells were further treated with ImM itaconate for 48 hours and collected for WB detection of SLC7A11 expression. Itaconate treatment elevated SLC7A11 expression, which shows inhibitory activity by anti-SLC13A3 A3-P11-27. (FIG. 20B) Independent repeat of SLC13A3 mAb A3-P11-27 on Colo679 cells which shows reduction of downstream SLC7A11 protein expression which is indicative of blocking activity. (FIG. 20C) Mouse melanoma cell line Yumm5.2, overexpressing SLC13A3 were treated with 5|ig / ml anti-SLC13A3 or IgG for 20 minutes. Cells were further treated with ImM itaconate for 48 hours. A reduction in SLC7A1 1 expression directly correlates with the inhibitory activity of anti-SLC13A3 A3-P1 1-23 and A3-P11-27. UT denotes untreated cells.

[0098] FIGS. 21A-D. Generation of E3-Ligase mAbs and their application as PROTABs. (FIG. 21A) Construction of bispecific anti-E3 Ligase mAbs and anti-SLC13A3 mAbs. (FIG. 21B) Binding affinity of reference E3 ligase antibodies. (FIG. 21C) pH-RODO-based internalization assay demonstrating the internalization capability of mAbs upon binding to membrane-bound SLC13A3. (FIG. 21D) Schematic diagram showing PROTAB -mediated degradation of SLC13A3 in cancer cells.

[0099] 16

[0100] 4932-3873-8280, v. 1 DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0101] In this work, the inventors have attempted to address the questions set out above in the Background. The inventors revealed that SLC13A3 is a transporter for itaconate in tumor cells and endows tumor ferroptosis resistance, diminishing tumor immunity and Immune checkpoint blockade (ICB) efficacy. Mechanistically, tumor cells up took itaconate via SLC13A3 from tumor- associated macrophages (TAMs), thereby activating the NRF2-SLC7A11 pathway and escaping from immune-mediated ferroptosis. Structural modeling and molecular docking analysis identified a functional inhibitor for SLC13A3 (SLC13A3i). Specific deletion of ACOD1 (an essential enzyme catalyzing itaconate) in macrophages, genetic ablation of SLC13A3 in tumors, or treatment with SLC13A3i sensitized tumors to ferroptosis, curbed tumor progression, and bolstered ICB effectiveness. Thus, the interplay between tumors and TAMs via the SLC13A3-itaconate-NRF2-SLC7Al 1 axis is a previously unknown immune ferroptosis resistant mechanism in the TME. The inventors have identified a panel of monoclonal antibodies recognizing extracellular oops of SLC13A3 with therapeutic potential targeting SLC13A3 immune modulation axis.

[0102] These and other aspects of the disclosure are described in detail below.

[0103] I. SLC13A3

[0104] Solute carrier family 13 member 3 also called sodium-dependent dicarboxylate transporter (NaDC3) is a protein that in humans is encoded by the SLC13A3 gene. Mammalian sodium-dicarboxylate cotransporters transport succinate and other Krebs cycle intermediates. They fall into 2 categories based on their substrate affinity: low affinity and high affinity. Both the low- and high-affinity transporters play an important role in the handling of citrate by the kidneys. The protein encoded by this gene represents the high-affinity form. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been characterized yet.

[0105] Exemplary mRNA sequences include NM_022829, NM_001011554

[0106] NM_001193339, NM_001193340, NM_001193342, and NM_054055. Exemplary protein sequences include NP_001011554, NP_001180268

[0107] NP_001180269, NP_001180271, NP_073740, and NP_473396.

[0108] 17

[0109] 4932-3873-8280, v. 1 IL Monoclonal Antibodies and Production Thereof

[0110] An "isolated antibody" is one that has been separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In particular embodiments, the antibody is purified: (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most particularly more than 99% by weight; (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator; or (3) to homogeneity by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.

[0111] The basic four-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. An IgM antibody consists of 5 basic heterotetramer units along with an additional polypeptide called J chain, and therefore contain 10 antigen binding sites, while secreted IgA antibodies can polymerize to form polyvalent assemblages comprising 2-5 of the basic 4-chain units along with J chain. In the case of IgGs, the 4-chain unit is generally about 150,000 daltons. Each L chain is linked to an H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bridges. Each H chain has at the N-terminus, a variable region (Vn) followed by three constant domains (CH) for each of the alpha and gamma chains and four CH domains for mu and isotypes. Each L chain has at the N-terminus, a variable region (VL) followed by a constant domain (CL) at its other end. The VL is aligned with the VH and the CL is aligned with the first constant domain of the heavy chain (CHI). Particular amino acid residues are believed to form an interface between the light chain and heavy chain variable regions. The pairing of a Vn and VL together forms a single antigen-binding site. For the structure and properties of the different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, Conn., 1994, page 71, and Chapter 6.

[0112] The L chain from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda based on the amino acid sequences of their constant domains (CL). Depending on the amino acid sequence of the constant domain of their heavy chains (CH),

[0113] 18

[0114] 4932-3873-8280, v. 1 immunoglobulins can be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, having heavy chains designated alpha, delta, epsilon, gamma and mu, respectively. They gamma and alpha classes are further divided into subclasses on the basis of relatively minor differences in CH sequence and function, humans express the following subclasses: IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2.

[0115] The term "variable" refers to the fact that certain segments of the V domains differ extensively in sequence among antibodies. The V domain mediates antigen binding and defines specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed across the 110-amino acid span of the variable regions. Instead, the V regions consist of relatively invariant stretches called framework regions (FRs) of 15-30 amino acids separated by shorter regions of extreme variability called "hypervariable regions" that are each 9-12 amino acids long. The variable regions of native heavy and light chains each comprise four FRs, largely adopting a beta-sheet configuration, connected by three hypervariable regions, which form loops connecting, and in some cases forming part of, the beta-sheet structure. The hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al. , Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), antibody-dependent neutrophil phagocytosis (ADNP), and antibody-dependent complement deposition (ADCD).

[0116] The term "hypervariable region" when used herein refers to the amino acid residues of an antibody that are responsible for antigen binding. The hypervariable region generally comprises amino acid residues from a "complementarity determining region" or "CDR" (e.g., around about residues 24-34 (LI), 50-56 (L2) and 89-97 (L3) in the VL, and around about 31- 35 (Hl), 50-65 (H2) and 95-102 (H3) in the VH when numbered in accordance with the Kabat numbering system; Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)); and / or those residues from a "hypervariable loop" (e.g., residues 24-34 (LI), 50-56 (L2) and 89-97 (L3) in the VL, and 26-32 (Hl), 52-56 (H2) and 95-101 (H3) in the VH when numbered in accordance with the Chothia numbering system; Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987)); and / or those residues from a "hypervariable loop" / CDR (e.g., residues 27-38 (LI), 56-65 (L2)

[0117] 19

[0118] 4932-3873-8280, v. 1 and 105-120 (L3) in the VL, and 27-38 (Hl), 56-65 (H2) and 105-120 (H3) in the VHwhen numbered in accordance with the IMGT numbering system; Lefranc, M. P. et al. Nucl. Acids Res. 27:209-212 (1999), Ruiz, M. et al. Nucl. Acids Res. 28:219-221 (2000)). Optionally the antibody has symmetrical insertions at one or more of the following points 28, 36 (LI), 63, 74- 75 (L2) and 123 (L3) in the VL, and 28, 36 (Hl), 63, 74-75 (H2) and 123 (H3) in the VSUbH when numbered in accordance with AHo; Honneger, A. and Plunkthun, A. J. Mol. Biol. 309:657-670 (2001)).

[0119] By "germline nucleic acid residue" is meant the nucleic acid residue that naturally occurs in a germline gene encoding a constant or variable region. "Germline gene" is the DNA found in a germ cell ( / .<?., a cell destined to become an egg or in the sperm). A "germline mutation" refers to a heritable change in a particular DNA that has occurred in a germ cell or the zygote at the single-cell stage, and when transmitted to offspring, such a mutation is incorporated in every cell of the body. A germline mutation is in contrast to a somatic mutation which is acquired in a single body cell. In some cases, nucleotides in a germline DNA sequence encoding for a variable region are mutated (i.e., a somatic mutation) and replaced with a different nucleotide.

[0120] The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations that include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies. The modifier "monoclonal" is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies useful in the present disclosure may be prepared by the hybridoma methodology first described by Kohler el al. , Nature, 256:495 (1975), or may be made using recombinant DNA methods in bacterial, eukaryotic animal or plant cells (see, e.g. , U.S. Patent 4,816,567) after single cell sorting of an antigen specific B cell, an antigen specific plasmablast responding to an infection or immunization, or capture of linked heavy and light chains from single cells in a bulk sorted antigen specific collection. The "monoclonal antibodies" may also be isolated from phage antibody libraries using the techniques described in Clackson et al. , Nature, 352:624-628 (1991) and Marks et al. , J. Mol. Biol., 222:581-597 (1991), for example.

[0121] 20

[0122] 4932-3873-8280, v. 1 A. General Methods

[0123] It will be understood that monoclonal antibodies binding to SLC13A3 will have several applications. These include the production of diagnostic kits for use in detecting and diagnosing SLC13A3 disesaes, as well as for treating the same. In these contexts, one may link such antibodies to diagnostic or therapeutic agents, use them as capture agents or competitors in competitive assays, or use them individually without additional agents being attached thereto. The antibodies may be mutated or modified, as discussed further below. Methods for preparing and characterizing antibodies are well known in the art (see, e.g., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; U.S. Patent 4,196,265).

[0124] The methods for generating monoclonal antibodies (MAbs) generally begin along the same lines as those for preparing polyclonal antibodies. The first step for both these methods is immunization of an appropriate host or identification of subjects who are immune due to prior natural infection or vaccination with a licensed or experimental vaccine. As is well known in the art, a given composition for immunization may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers. Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobencoyl-N-hydroxysuccinimide ester, carbodiimyde and bisbiazotized benzidine. As also is well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants. Exemplary and preferred adjuvants in animals include complete Freund’s adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund’s adjuvants and aluminum hydroxide adjuvant and in humans include alum, CpG, MFP59 and combinations of immunostimulatory molecules (“Adjuvant Systems”, such as AS01 or AS03). Additional experimental forms of inoculation to induce SLC13A3-specific B cells is possible, including nanoparticle vaccines, or gene-encoded antigens delivered as DNA or RNA genes in a physical delivery system (such as lipid nanoparticle or on a gold biolistic bead), and delivered with needle, gene gun, transcutaneous electroporation device. The antigen gene also can be carried as encoded by a replication competent or defective viral vector such as adenovirus, adeno-associated virus, poxvirus, herpesvirus, or alphavirus replicon, or alternatively a virus like particle.

[0125] 4932-3873-8280, v. 1 21 In the case of human antibodies against natural pathogens, a suitable approach is to identify subjects that have been exposed to the pathogens, such as those who have been diagnosed as having contracted the disease, or those who have been vaccinated to generate protective immunity against the pathogen or to test the safety or efficacy of an experimental vaccine. Circulating anti-pathogen antibodies can be detected, and antibody encoding or producing B cells from the antibody-positive subject may then be obtained.

[0126] The amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature of the immunogen as well as the animal used for immunization. A variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal). The production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection, also may be given. The process of boosting and titering is repeated until a suitable titer is achieved. When a desired level of immunogenicity is obtained, the immunized animal can be bled and the serum isolated and stored, and / or the animal can be used to generate MAbs.

[0127] Following immunization, somatic cells with the potential for producing antibodies, specifically B lymphocytes (B cells), are selected for use in the MAb generating protocol. These cells may be obtained from biopsied spleens, lymph nodes, tonsils or adenoids, bone marrow aspirates or biopsies, tissue biopsies from mucosal organs like lung or GI tract, or from circulating blood. The antibody-producing B lymphocytes from the immunized animal or immune human are then fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized or human or human / mouse chimeric cells. Myeloma cell lines suited for use in hybridoma-producing fusion procedures preferably are non-antibody-producing, have high fusion efficiency, and enzyme deficiencies that render then incapable of growing in certain selective media which support the growth of only the desired fused cells (hybridomas). Any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, pp. 65-66, 1986; Campbell, pp. 75-83, 1984). HMMA2.5 cells or MFP-2 cells are particularly useful examples of such cells.

[0128] Methods for generating hybrids of antibody-producing spleen or lymph node cells and myeloma cells usually comprise mixing somatic cells with myeloma cells in a 2: 1 proportion, though the proportion may vary from about 20:1 to about 1:1, respectively, in the presence of an agent or agents (chemical or electrical) that promote the fusion of cell membranes. In some cases, transformation of human B cells with Epstein Barr virus (EBV) as an initial step increases the size of the B cells, enhancing fusion with the relatively large-sized myeloma cells.

[0129] 22

[0130] 4932-3873-8280, v. 1 Transformation efficiency by EBV is enhanced by using CpG and a Chk2 inhibitor drug in the transforming medium. Alternatively, human B cells can be activated by co-culture with transfected cell lines expressing CD40 Ligand (CD 154) in medium containing additional soluble factors, such as IL-21 and human B cell Activating Factor (BAFF), a Type II member of the TNF superfamily. Fusion methods using Sendai virus have been described, and those using polyethylene glycol (PEG), such as 37% (v / v) PEG. The use of electrically induced fusion methods also is appropriate and there are processes for better efficiency (Yu et al. , 2008). Fusion procedures usually produce viable hybrids at low frequencies, about 1 x 10'6to 1 x 10"8, but with optimized procedures one can achieve fusion efficiencies close to 1 in 200. However, relatively low efficiency of fusion does not pose a problem, as the viable, fused hybrids are differentiated from the parental, infused cells (particularly the infused myeloma cells that would normally continue to divide indefinitely) by culturing in a selective medium. The selective medium is generally one that contains an agent that blocks the de novo synthesis of nucleotides in the tissue culture medium. Exemplary and preferred agents are aminopterin, methotrexate, and azaserine. Aminopterin and methotrexate block de novo synthesis of both purines and pyrimidines, whereas azaserine blocks only purine synthesis. Where aminopterin or methotrexate is used, the medium is supplemented with hypoxanthine and thymidine as a source of nucleotides (HAT medium). Where azaserine is used, the medium is supplemented with hypoxanthine. Ouabain is added if the B cell source is an EBV-transformed human B cell line, in order to eliminate EBV-transformed lines that have not fused to the myeloma.

[0131] The preferred selection medium is HAT or HAT with ouabain. Only cells capable of operating nucleotide salvage pathways are able to survive in HAT medium. The myeloma cells are defective in key enzymes of the salvage pathway, e.g., hypoxanthine phosphoribosyl transferase (HPRT), and they cannot survive. The B cells can operate this pathway, but they have a limited life span in culture and generally die within about two weeks. Therefore, the only cells that can survive in the selective media are those hybrids formed from myeloma and B cells. When the source of B cells used for fusion is a line of EBV-transformed B cells, as here, ouabain may also be used for drug selection of hybrids as EBV-transformed B cells are susceptible to drug killing, whereas the myeloma partner used is chosen to be ouabain resistant.

[0132] Culturing provides a population of hybridomas from which specific hybridomas are selected. Typically, selection of hybridomas is performed by culturing the cells by single-clone dilution in microtiter plates, followed by testing the individual clonal supernatants (after about two to three weeks) for the desired reactivity. The assay should be sensitive, simple and rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays dot

[0133] 23

[0134] 4932-3873-8280, v. 1 immunobinding assays, and the like. The selected hybridomas are then serially diluted or single-cell sorted by flow cytometric sorting and cloned into individual antibody-producing cell lines, which clones can then be propagated indefinitely to provide mAbs. The cell lines may be exploited for MAb production in two basic ways. A sample of the hybridoma can be injected (often into the peritoneal cavity) into an animal e.g., a mouse). Optionally, the animals are primed with a hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior to injection. When human hybridomas are used in this way, it is optimal to inject immunocompromised mice, such as SCID mice, to prevent tumor rejection. The injected animal develops tumors secreting the specific monoclonal antibody produced by the fused cell hybrid. The body fluids of the animal, such as serum or ascites fluid, can then be tapped to provide MAbs in high concentration. The individual cell lines could also be cultured in vitro, where the MAbs are naturally secreted into the culture medium from which they can be readily obtained in high concentrations. Alternatively, human hybridoma cells lines can be used in vitro to produce immunoglobulins in cell supernatant. The cell lines can be adapted for growth in serum- free medium to optimize the ability to recover human monoclonal immunoglobulins of high purity.

[0135] MAbs produced by either means may be further purified, if desired, using filtration, centrifugation and various chromatographic methods such as FPLC or affinity chromatography. Fragments of the monoclonal antibodies of the disclosure can be obtained from the purified monoclonal antibodies by methods which include digestion with enzymes, such as pepsin or papain, and / or by cleavage of disulfide bonds by chemical reduction. Alternatively, monoclonal antibody fragments encompassed by the present disclosure can be synthesized using an automated peptide synthesizer.

[0136] It also is contemplated that a molecular cloning approach may be used to generate monoclonal antibodies. Single B cells identified as responding to infection or vaccination because of plasmablast or activated B cell markers, or memory B cells labelled with the antigen of interest, can be sorted physically using paramagnetic bead selection or flow cytometric sorting, then RNA can be isolated from the single cells and antibody genes amplified by RT- PCR. Various single-cell RNA-seq methods are available to obtain antibody variable genes from single cells. Alternatively, antigen-specific bulk sorted populations of cells can be segregated into microvesicles and the matched heavy and light chain variable genes recovered from single cells using physical linkage of heavy and light chain amplicons, or common barcoding of heavy and light chain genes from a vesicle. Matched heavy and light chain genes from single cells also can be obtained from populations of antigen specific B cells by treating

[0137] 24

[0138] 4932-3873-8280, v. 1 cells with cell -penetrating nanoparticles bearing RT-PCR primers and barcodes for marking transcripts with one barcode per cell. The antibody variable genes also can be isolated by RNA extraction of a hybridoma line and the antibody genes obtained by RT-PCR and cloned into an immunoglobulin expression vector. Alternatively, combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the cell lines and phagemids expressing appropriate antibodies are selected by panning using viral antigens. The advantages of this approach over conventional hybridoma techniques are that approximately 104times as many antibodies can be produced and screened in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies.

[0139] Other U.S. patents, each incorporated herein by reference, that teach the production of antibodies useful in the present disclosure include U.S. Patent 5,565,332, which describes the production of chimeric antibodies using a combinatorial approach; U.S. Patent 4,816,567 which describes recombinant immunoglobulin preparations; and U.S. Patent 4,867,973 which describes antibody-therapeutic agent conjugates.

[0140] B. Antibodies of the Present Disclosure

[0141] Antibodies according to the present disclosure may be defined, in the first instance, by their binding specificity. Those of skill in the art, by assessing the binding specificity / affinity of a given antibody using techniques well known to those of skill in the art, can determine whether such antibodies fall within the scope of the instant claims. For example, the epitope to which a given antibody bind may consist of a single contiguous sequence of 3 or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14. 15, 16, 17, 18, 19, 20) amino acids located within the antigen molecule (e.g. , a linear epitope in a domain). Alternatively, the epitope may consist of a plurality of non-contiguous amino acids for amino acid sequences) located within the antigen molecule (e.g., a conformational epitope).

[0142] Various techniques known to persons of ordinary skill in the art can be used to determine whether an antibody “interacts with one or more amino acids" within a polypeptide or protein. Exemplary techniques include, for example, routine cross -blocking assays, such as that described in Antibodies, Harlow and Lane (Cold Spring Harbor Press, Cold Spring Harbor, N.Y.). Cross-blocking can be measured in various binding assays such as ELISA, biolayer interferometry, or surface plasmon resonance. Other methods include alanine scanning mutational analysis, peptide blot analysis (Reineke, Methods Mol. Biol. 248: 443-63, 2064), peptide cleavage analysis, high -resolution electron microscopy techniques using single particle

[0143] 25

[0144] 4932-3873-8280, v. 1 reconstruction, cryoEM, or tomography, crystallographic studies and NMR analysis. In addition, methods such as epitope excision, epitope extraction and chemical modification of antigens can be employed (Tomer Prot. Sei. 9: 487-496, 2000), Another method that can be used to identify the amino acids within a polypeptide with which an antibody interacts is hydrogen / deuterium exchange detected by mass spectrometry. In general terms, the hydrogen / deulerium exchange method involves deuterium-labeling the protein of interest, followed by binding the antibody to the deuterium -labeled protein. Next, the protein / andbody complex is transferred to water and exchangeable protons within amino acids that are protected by die antibody complex undergo deuierium-to-hydrogen back-exchange at a slower rate than exchangeable protons within amino acids that are not part of the interface. As a result, amino acids that form part of the protein / antibody interface may retain deuterium and therefore exhibit relatively higher mass compared to amino acids not included in the interface. After dissociation of the antibody, the target protein is subjected to protease cleavage and mass spectrometry analysis, thereby revealing the deuterium-labeled residues which correspond to the specific amino acids with which the antibody interacts. See, <?.g., Ehring, Analytical Biochemistry 267: 252-259 (1999): Eugen and Smith, Ana]. Chem. 73: 256A-265A (2001 ).

[0145] The term “epitope” refers to a site on an antigen to which B and / or T cells respond. B- cell epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents, whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation.

[0146] Modification-Assisted Profiling (MAP), also known as Antigen Structure-based Antibody Profiling (ASAP) is a method that categorizes large numbers of monoclonal antibodies (m.Abs) directed against the same antigen according to the similarities of the binding profile of each antibody to chemically or enzymatically modified antigen surfaces (see U.S. Patent Publication 2004 / 0101920, herein specifically incorporated by reference in its entirety ). Each category may reflect a unique epitope either distinctly different from or partially overlapping with epitope represented by another category. This technology allows rapid filtering of genetically identical antibodies, such that characterization can be focused on genetically distinct antibodies. When applied to hybridoma screening, MAP may facilitate identification of rare hybridoma clones that produce mAbs having tlte desired characteristics. MAP may be used to sort the antibodies of the disclosure into groups of antibodies binding different epitopes.

[0147] 26

[0148] 4932-3873-8280, v. 1 The present disclosure includes antibodies that may bind to the same epitope, or a portion of the epitope. Likewise, the present disclosure also includes antibodies that compete for binding to a target or a fragment thereof with any of the specific exemplary antibodies described herein. One can easily determine whether an antibody binds to tire same epitope as, or competes for binding with, a reference antibody by using routine methods known in the art. For example, to determine- if a test antibody binds to the same epitope as a reference, the reference antibody is allowed to bind to target under saturating conditions. Next, the ability of a test antibody to bind to the target molecule is assessed. If the test antibody is able to bind to the target molecule following saturation binding with the reference antibody, it can be concluded that the test antibody binds to a different epitope than the reference antibody. On the other hand, if the test antibody is not able to bind to the target molecule following saturation binding with the reference antibody, then the test antibody may bind to the same epitope as the epitope bound by the reference antibody.

[0149] To determine if an antibody competes for binding with a reference and-SLC13A3 antibody, the above-described binding methodology is performed in two orientations: In a first orientation, the reference antibody is allowed to bind to the SLC13A3 antigen under saturating conditions followed by assessment of binding of the test antibody to the SLC13A3molecule. In a second orientation, the test antibody is allowed to bind to the SLC13A3 antigen molecule under saturating conditions followed by assessment of binding of the reference antibody to the SLC13A3 molecule. If, in both orientations, only the first (saturating) antibody is capable of binding to SLC13A3, then it is concluded that the test antibody and the reference antibody compete for binding to SLC13A3. As will be appreciated by a person of ordinary skill in the art, an antibody that competes for binding with a reference antibody may not necessarily bind to the identical epitope as the reference antibody but may sterically block binding of the reference antibody by binding an overlapping or adjacent epitope.

[0150] Two antibodies bind to the same or overlapping epitope if each competitively inhibits (blocks) binding of the other to the antigen. That is, a l-, 5-, 10-, 20- or 100-fold excess of one antibody inhibits binding of the other by at least 50% but preferably 75%, 90% or even 99% as measured in a competitive binding assay (see, e.g.. .lunghans et al., Cancer Res. 1990 50: 1495- 1502). Alternatively, two antibodies have the same epitope if essentially all amino acid mutations in the antigen that reduce or eliminate binding of one antibody reduce or eliminate binding of the other. Two antibodies have overlapping epitopes if some amino acid mutations that reduce or eliminate binding of one antibody reduce or eliminate binding of the other.

[0151] 27

[0152] 4932-3873-8280, v. 1 Additional routine experimentation (<?.#., peptide mutation and binding analyses) can then be earned out to confirm whether the observed lack of binding of the test antibody is in fact due to binding to the same epitope as the reference antibody or if steric blocking (or another phenomenon) is responsible for the lack of observed binding. Experiments of this sort can be performed using ELISA, RIA, surface plasmon resonance, flow cytometry or any other quantitative or qualitative antibody-binding assay available in the art. Structural studies with EM or crystallography also can demonstrate whether or not two antibodies that compete for binding recognize the same epitope.

[0153] In another aspect, there are provided monoclonal antibodies having clone-paired CDRs from the heavy and light chains as illustrated in Tables 3 and 4, respectively. Such antibodies may be produced by the clones discussed below in the Examples section using methods described herein.

[0154] In another aspect, the antibodies may be defined by their variable sequence, which include additional “framework” regions. Furthermore, the antibodies sequences may vary from these sequences, optionally using methods discussed in greater detail below. For example, nucleic acid sequences may vary from those set out above in that (a) the variable regions may be segregated away from the constant domains of the light and heavy chains, (b) the nucleic acids may vary from those set out above while not affecting the residues encoded thereby, (c) the nucleic acids may vary from those set out above by a given percentage, e.g., 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology, (d) the nucleic acids may vary from those set out above by virtue of the ability to hybridize under high stringency conditions, as exemplified by low salt and / or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50°C to about 70°C, (e) the amino acids may vary from those set out above by a given percentage, e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology, or (f) the amino acids may vary from those set out above by permitting conservative substitutions (discussed below). Each of the foregoing applies to the nucleic acid sequences and the amino acid sequences.

[0155] When comparing polynucleotide and polypeptide sequences, two sequences are said to be "identical" if the sequence of nucleotides or amino acids in the two sequences is the same when aligned for maximum correspondence, as described below. Comparisons between two sequences are typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity. A "comparison window" as used herein, refers to a segment of at least about 20 contiguous positions, usually 30 to about 75, 40

[0156] 28

[0157] 4932-3873-8280, v. 1 to about 50, in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.

[0158] Optimal alignment of sequences for comparison may be conducted using the Megalign program in the Lasergene suite of bioinformatics software (DNASTAR, Inc., Madison, Wis.), using default parameters. This program embodies several alignment schemes described in the following references: Dayhoff, M. O. (1978) A model of evolutionary change in proteins- Matrices for detecting distant relationships. In Dayhoff, M. O. (ed.) Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington D.C. Vol. 5, Suppl. 3, pp. 345-358; Hein J. (1990) Unified Approach to Alignment and Phylogeny pp. 626-645 Methods in Enzymology vol. 183, Academic Press, Inc., San Diego, Calif.; Higgins, D. G. and Sharp, P. M. (1989) CABIOS 5:151-153; Myers, E. W. and Muller W. (1988) CABIOS 4:11- 17; Robinson, E. D. (1971) Comb. Theor 11 :105; Santou, N. Nes, M. (1987) Mol. Biol. Evol. 4:406-425; Sneath, P. H. A. and Sokal, R. R. (1973) Numerical Taxonomy— the Principles and Practice of Numerical Taxonomy, Freeman Press, San Francisco, Calif.; Wilbur, W. J. and Lipman, D. J. (1983) Proc. Natl. Acad., Sci. USA 80:726-730.

[0159] Alternatively, optimal alignment of sequences for comparison may be conducted by the local identity algorithm of Smith and Waterman (1981) Add. APL. Math 2:482, by the identity alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, by the search for similarity methods of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.), or by inspection.

[0160] One particular example of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nucl. Acids Res. 25:3389-3402 and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. BLAST and BLAST 2.0 can be used, for example, with the parameters described herein, to determine percent sequence identity for the polynucleotides and polypeptides of the disclosure. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. The rearranged nature of an antibody sequence and the variable length of each gene requires multiple rounds of BLAST searches for a single antibody sequence. Also, manual assembly of different genes is difficult and error prone. The sequence analysis tool IgBLAST (world- wide- web at ncbi.nlm.nih.gov / igblast / ) identifies matches to the germline V, D and J genes, details at rearrangement junctions, the delineation of Ig V domain framework regions and

[0161] 29

[0162] 4932-3873-8280, v. 1 complementarity determining regions. IgBLAST can analyze nucleotide or protein sequences and can process sequences in batches and allows searches against the germline gene databases and other sequence databases simultaneously to minimize the chance of missing possibly the best matching germline V gene.

[0163] In one illustrative example, cumulative scores can be calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments, (B) of 50, expectation (E) of 10, M=5, N=-4 and a comparison of both strands.

[0164] For amino acid sequences, a scoring matrix can be used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment.

[0165] In one approach, the "percentage of sequence identity" is determined by comparing two optimally aligned sequences over a window of comparison of at least 20 positions, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (z.<?., gaps) of 20 percent or less, usually 5 to 15 percent, or 10 to 12 percent, as compared to the reference sequences (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid bases or amino acid residues occur in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the reference sequence (z'.<?. , the window size) and multiplying the results by 100 to yield the percentage of sequence identity.

[0166] Yet another way of defining an antibody is as a “derivative” of any of the below- described antibodies and their antigen-binding fragments. The term “derivative” refers to an antibody or antigen-binding fragment thereof that immunospecifically binds to an antigen, but

[0167] 4932-3873-8280, v. 1 30 which comprises, one, two, three, four, five or more amino acid substitutions, additions, deletions or modifications relative to a “parental’- (or wild-type) molecule. Such amino acid substitutions or additions may introduce naturally occurring (;.<?., DNA-encoded) or non- naturally occurring amino acid residues. The term “derivative” encompasses, for example, as variants having altered CHI, hinge, CH2, CH3 or CH4 regions, so as to form, for example, antibodies, etc. , having variant Fc regions that exhibit enhanced or impaired effector or binding characteristics. The term “derivative” additionally encompasses non-amino acid modifications, for example, amino acids that may be glycosylated (e.g., have altered mannose, 2-N- acetylglucosamine, galactose, fucose, glucose, sialic acid, 5 -N- acetylneuraminic acid, 5- glycolneuraminic acid, etc. content), acetylated, pegylated, phosphorylated, amidated, derivatized by known protecting / blocking groups, proteolytic cleavage, linked to a cellular ligand or other protein, etc. In some embodiments, the altered carbohydrate modifications modulate one or more of the following: solubilization of the antibody, facilitation of subcellular transport and secretion of the antibody, promotion of antibody assembly, conformational integrity, and antibody-mediated effector function. In a specific embodiment, the altered carbohydrate modifications enhance antibody mediated effector function relative to the antibody lacking the carbohydrate modification. Carbohydrate modifications that lead to altered antibody mediated effector function are well known in the art (for example, see Shields, R. L. et al. (2002) "Lack Of Fucose On Human IgG N-Linked Oligosaccharide Improves Binding To Human Fcgamma RIH And Antibody-Dependent Cellular Toxicity,” J. Biol. Chem. 277(30): 26733-26740; Davies J. et al. (2001) ‘‘‘'Expression Of GnTIH In A Recombinant Anti- CD20 CHO Production Cell Line: Expression Of Antibodies With Altered Glycoforms Leads To An Increase In ADCC Through Higher Affinity For FC Gamma RIIL” Biotechnology & Bioengineering 74(4): 288-294). Methods of altering carbohydrate contents are known to those skilled in the art, see, e.g., Wallick, S. C. et al. (1988), J. Exp. Med. 168(3): 1099- 1109; Tao, M. H. et al. (1989), J. Immunol. 143(8): 2595-2601; Routledge, E. G. et al. (1995), Transplantation 60(8):847-53; Elliott, S. et al. (2003), Nature Biotechnol. 21 :414-21; Shields, R. L. el al. (2002), J. Biol. Chem. 277(30): 26733-26740).

[0168] A derivative antibody or antibody fragment can be generated with an engineered sequence or glycosylation state to confer preferred levels of activity in antibody dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), antibodydependent neutrophil phagocytosis (ADNP), or antibody-dependent complement deposition (ADCD) functions as measured by bead-based or cell-based assays or in vivo studies in animal models.

[0169] 4932-3873-8280, v. 1 31 A derivative antibody or antibody fragment may be modified by chemical modifications using techniques known to those of skill in the art, including, but not limited to, specific chemical cleavage, acetylation, formulation, metabolic synthesis of tunicamycin, etc. In one embodiment, an antibody derivative will possess a similar or identical function as the parental antibody. In another embodiment, an antibody derivative will exhibit an altered activity relative to the parental antibody. For example, a derivative antibody (or fragment thereof) can bind to its epitope more tightly or be more resistant to proteolysis than the parental antibody.

[0170] C. Engineering of Antibody Sequences

[0171] In various embodiments, one may choose to engineer sequences of the identified antibodies for a variety of reasons, such as improved expression, improved cross-reactivity or diminished off-target binding. Modified antibodies may be made by any technique known to those of skill in the art, including expression through standard molecular biological techniques, or the chemical synthesis of polypeptides. Methods for recombinant expression are addressed elsewhere in this document. The following is a general discussion of relevant goals techniques for antibody engineering.

[0172] Hybridomas may be cultured, then cells lysed, and total RNA extracted. Random hexamers may be used with RT to generate cDNA copies of RNA, and then PCR performed using a multiplex mixture of PCR primers expected to amplify all human variable gene sequences. PCR products can be cloned into pGEM-T Easy vector, then sequenced by automated DNA sequencing using standard vector primers. Assay of binding and neutralization may be performed using antibodies collected from hybridoma supernatants and purified by FPLC, using Protein G columns.

[0173] Recombinant full-length IgG antibodies can be generated by subcloning heavy and light chain Fv DNAs from the cloning vector into an IgG plasmid vector, transfected into 293 (e.g., Freestyle) cells or CHO cells, and antibodies can be collected and purified from the 293 or CHO cell supernatant. Other appropriate host cells systems include bacteria, such as E. coli, insect cells (S2, Sf9, Sf29, High Five), plant cells (e.g., tobacco, with or without engineering for human-like glycans), algae, or in a variety of non-human transgenic contexts, such as mice, rats, goats or cows.

[0174] Expression of nucleic acids encoding antibodies, both for the purpose of subsequent antibody purification, and for immunization of a host, is also contemplated. Antibody coding sequences can be RNA, such as native RNA or modified RNA. Modified RNA contemplates certain chemical modifications that confer increased stability and low immunogenicity to

[0175] 4932-3873-8280, v. 1 32 mRNAs, thereby facilitating expression of therapeutically important proteins. For instance, Nl-methyl-pseudouridine (NlmT) outperforms several other nucleoside modifications and their combinations in terms of translation capacity. In addition to turning off the immune / eIF2a phosphorylation-dependent inhibition of translation, incorporated Nlm'P nucleotides dramatically alter the dynamics of the translation process by increasing ribosome pausing and density on the mRNA. Increased ribosome loading of modified mRNAs renders them more permissive for initiation by favoring either ribosome recycling on the same mRNA or de novo ribosome recruitment. Such modifications could be used to enhance antibody expression in vivo following inoculation with RNA. The RNA, whether native or modified, may be delivered as naked RNA or in a delivery vehicle, such as a lipid nanoparticle.

[0176] Alternatively, DNA encoding the antibody may be employed for the same purposes. The DNA is included in an expression cassette comprising a promoter active in the host cell for which it is designed. The expression cassette is advantageously included in a replicable vector, such as a conventional plasmid or minivector. Vectors include viral vectors, such as poxviruses, adenoviruses, herpesviruses, adeno-associated viruses, and lentiviruses are contemplated. Replicons encoding antibody genes such as alphavirus replicons based on VEE virus or Sindbis virus are also contemplated. Delivery of such vectors can be performed by needle through intramuscular, subcutaneous, or intradermal routes, or by transcutaneous electroporation when in vivo expression is desired.

[0177] The rapid availability of antibody produced in the same host cell and cell culture process as the final cGMP manufacturing process has the potential to reduce the duration of process development programs. Lonza has developed a generic method using pooled transfectants grown in CDACF medium, for the rapid production of small quantities (up to 50 g) of antibodies in CHO cells. Although slightly slower than a true transient system, the advantages include a higher product concentration and use of the same host and process as the production cell line. Example of growth and productivity of GS-CHO pools, expressing a model antibody, in a disposable bioreactor: in a disposable bag bioreactor culture (5 L working volume) operated in fed-batch mode, a harvest antibody concentration of 2 g / L was achieved within 9 weeks of transfection.

[0178] Antibody molecules will comprise fragments (such as F(ab'), F(ab')2) that are produced, for example, by the proteolytic cleavage of the mAbs, or single-chain immunoglobulins producible, for example, via recombinant means. F(ab') antibody derivatives are monovalent, while F(ab')2 antibody derivatives are bivalent. In one embodiment, such fragments can be

[0179] 33

[0180] 4932-3873-8280, v. 1 combined with one another, or with other antibody fragments or receptor ligands to form “chimeric” binding molecules. Significantly, such chimeric molecules may contain substituents capable of binding to different epitopes of the same molecule.

[0181] In related embodiments, the antibody is a derivative of the disclosed antibodies, e.g., an antibody comprising the CDR sequences identical to those in the disclosed antibodies e.g., a chimeric, or CDR-grafted antibody). Alternatively, one may wish to make modifications, such as introducing conservative changes into an antibody molecule. In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art. It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

[0182] It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: basic amino acids: arginine (+3.0), lysine (+3.0), and histidine (-0.5); acidic amino acids: aspartate (+3.0 + 1), glutamate (+3.0 + 1), asparagine (+0.2), and glutamine (+0.2); hydrophilic, nonionic amino acids: serine (+0.3), asparagine (+0.2), glutamine (+0.2), and threonine (-0.4), sulfur containing amino acids: cysteine (-1.0) and methionine (-1.3); hydrophobic, nonaromatic amino acids: valine (-1.5), leucine (-1.8), isoleucine (-1.8), proline (-0.5 + 1), alanine (-0.5), and glycine (0); hydrophobic, aromatic amino acids: tryptophan (- 3.4), phenylalanine (-2.5), and tyrosine (-2.3).

[0183] It is understood that an amino acid can be substituted for another having a similar hydrophilicity and produce a biologically or immunologically modified protein. In such changes, the substitution of amino acids whose hydrophilicity values are within + 2 is preferred, those that are within + 1 are particularly preferred, and those within + 0.5 are even more particularly preferred.

[0184] As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include

[0185] 4932-3873-8280, v. 1 34 arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.

[0186] The present disclosure also contemplates isotype modification. By modifying the Fc region to have a different isotype, different functionalities can be achieved. For example, changing to IgGi can increase antibody dependent cell cytotoxicity, switching to class A can improve tissue distribution, and switching to class M can improve valency.

[0187] Alternatively or additionally, it may be useful to combine amino acid modifications with one or more further amino acid modifications that alter Clq binding and / or the complement dependent cytotoxicity (CDC) function of the Fc region of an IL-23pl9 binding molecule. The binding polypeptide of particular interest may be one that binds to Clq and displays complement dependent cytotoxicity. Polypeptides with pre-existing Clq binding activity, optionally further having the ability to mediate CDC may be modified such that one or both of these activities are enhanced. Amino acid modifications that alter Clq and / or modify its complement dependent cytotoxicity function are described, for example, in WO / 0042072, which is hereby incorporated by reference.

[0188] One can design an Fc region of an antibody with altered effector function, e.g., by modifying Clq binding and / or FcyR binding and thereby changing CDC activity and / or ADCC activity. “Effector functions” are responsible for activating or diminishing a biological activity e.g., in a subject). Examples of effector functions include, but are not limited to: Clq binding; complement dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell- mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors e.g., B cell receptor; BCR), etc. Such effector functions may require the Fc region to be combined with a binding domain (e.g., an antibody variable domain) and can be assessed using various assays (e.g., Fc binding assays, ADCC assays, CDC assays, etc.).

[0189] For example, one can generate a variant Fc region of an antibody with improved Clq binding and improved FcyRIII binding (e.g., having both improved ADCC activity and improved CDC activity). Alternatively, if it is desired that effector function be reduced or ablated, a variant Fc region can be engineered with reduced CDC activity and / or reduced ADCC activity. In other embodiments, only one of these activities may be increased, and, optionally, also the other activity reduced (e.g., to generate an Fc region variant with improved ADCC activity, but reduced CDC activity and vice versa).

[0190] FcRn binding. Fc mutations can also be introduced and engineered to alter their interaction with the neonatal Fc receptor (FcRn) and improve their pharmacokinetic properties. A collection of human Fc variants with improved binding to the FcRn have been described.

[0191] 35

[0192] 4932-3873-8280, v. 1 High resolution mapping of the binding site on human IgGl for FcyRI, FcyRII, FcyRIII, and FcRn and design of IgGl variants with improved binding to the FcyR, (J. Biol. Chem. 276:6591-6604). A number of methods are known that can result in increased half-life (Kuo and Aveson, (2011)), including amino acid modifications may be generated through techniques including alanine scanning mutagenesis, random mutagenesis and screening to assess the binding to the neonatal Fc receptor (FcRn) and / or the in vivo behavior. Computational strategies followed by mutagenesis may also be used to select one of amino acid mutations to mutate.

[0193] The present disclosure therefore provides a variant of an antigen binding protein with optimized binding to FcRn. In a particular embodiment, the said variant of an antigen binding protein comprises at least one amino acid modification in the Fc region of said antigen binding protein, wherein said modification is selected from the group consisting of 226, 227, 228, 230, 231, 233, 234, 239, 241, 243, 246, 250, 252, 256, 259, 264, 265, 267, 269, 270, 276, 284, 285,

[0194] 288, 289, 290, 291, 292, 294, 297, 298, 299, 301, 302, 303, 305, 307, 308, 309, 311, 315, 317,

[0195] 320, 322, 325, 327, 330, 332, 334, 335, 338, 340, 342, 343, 345, 347, 350, 352, 354, 355, 356,

[0196] 359, 360, 361, 362, 369, 370, 371, 375, 378, 380, 382, 384, 385, 386, 387, 389, 390, 392, 393,

[0197] 394, 395, 396, 397, 398, 399, 400, 401 403, 404, 408, 411, 412, 414, 415, 416, 418, 419, 420,

[0198] 421, 422, 424, 426, 428, 433, 434, 438, 439, 440, 443, 444, 445, 446 and 447 of the Fc region as compared to said parent polypeptide, wherein the numbering of the amino acids in the Fc region is that of the EU index in Kabat. In a further aspect of the disclosure the modifications are M252Y / S254T / T256E.

[0199] Additionally, various publications describe methods for obtaining physiologically active molecules whose half-lives are modified, see for example Kontermann (2009) either by introducing an FcRn-binding polypeptide into the molecules or by fusing the molecules with antibodies whose FcRn-binding affinities are preserved but affinities for other Fc receptors have been greatly reduced or fusing with FcRn binding domains of antibodies.

[0200] Derivatized antibodies may be used to alter the half-lives (e.g., serum half-lives) of parental antibodies in a mammal, particularly a human. Such alterations may result in a halflife of greater than 15 days, preferably greater than 20 days, greater than 25 days, greater than 30 days, greater than 35 days, greater than 40 days, greater than 45 days, greater than 2 months, greater than 3 months, greater than 4 months, or greater than 5 months. The increased halflives of the antibodies of the present disclosure or fragments thereof in a mammal, preferably a human, results in a higher serum titer of said antibodies or antibody fragments in the mammal, and thus reduces the frequency of the administration of said antibodies or antibody fragments

[0201] 36

[0202] 4932-3873-8280, v. 1 and / or reduces the concentration of said antibodies or antibody fragments to be administered. Antibodies or fragments thereof having increased in vivo half-lives can be generated by techniques known to those of skill in the art. For example, antibodies or fragments thereof with increased in vivo half-lives can be generated by modifying (e.g., substituting, deleting or adding) amino acid residues identified as involved in the interaction between the Fc domain and the FcRn receptor.

[0203] Beltramello et al. (2010) previously reported the modification of neutralizing mAbs, due to their tendency to enhance dengue virus infection, by generating in which leucine residues at positions 1.3 and 1.2 of CH2 domain (according to the IM GT unique numbering for C-domain) were substituted with alanine residues. This modification, also known as a “LALA” mutation, abolishes antibody binding to FcyRI, FcyRII and FcyRIIIa, as described by Hessell et al. (2007). The variant and unmodified recombinant mAbs were compared for their capacity to neutralize and enhance infection by the four dengue virus serotypes. LALA variants retained the same neutralizing activity as unmodified mAb but were completely devoid of enhancing activity. LALA mutations of this nature are therefore contemplated in the context of the presently disclosed antibodies.

[0204] Altered Glycosylation. A particular embodiment of the present disclosure is an isolated monoclonal antibody, or antigen binding fragment thereof, containing a substantially homogeneous glycan without sialic acid, galactose, or fucose. The monoclonal antibody comprises a heavy chain variable region and a light chain variable region, both of which may be attached to heavy chain or light chain constant regions respectively. The aforementioned substantially homogeneous glycan may be covalently attached to the heavy chain constant region.

[0205] Another embodiment of the present disclosure comprises a mAb with a novel Fc glycosylation pattern. The isolated monoclonal antibody, or antigen binding fragment thereof, is present in a substantially homogenous composition represented by the GNGN or G1 / G2 glycoform. Fc glycosylation plays a significant role in anti-viral and anti-cancer properties of therapeutic mAbs. The disclosure is in line with a recent study that shows increased anti- lentivirus cell-mediated viral inhibition of a fucose free anti-HIV mAb in vitro. This embodiment of the present disclosure with homogenous glycans lacking a core fucose, showed increased protection against specific viruses by a factor greater than two-fold. Elimination of core fucose dramatically improves the ADCC activity of mAbs mediated by natural killer (NK) cells but appears to have the opposite effect on the ADCC activity of polymorphonuclear cells (PMNs).

[0206] 37

[0207] 4932-3873-8280, v. 1 The isolated monoclonal antibody, or antigen binding fragment thereof, comprising a substantially homogenous composition represented by the GNGN or G1 / G2 glycoform exhibits increased binding affinity for Fc gamma RI and Fc gamma RIII compared to the same antibody without the substantially homogeneous GNGN glycoform and with GO, GIF, G2F, GNF, GNGNF or GNGNFX containing glycoforms. In one embodiment of the present disclosure, the antibody dissociates from Fc gamma RI with a Kd of 1 x 10'8M or less and from Fc gamma RIII with a Kd of 1 x 10‘7M or less.

[0208] Glycosylation of an Fc region is typically either N-linked or O-linked. N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue. O- linked glycosylation refers to the attachment of one of the sugars N- acetylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5- hydroxyproline or 5-hydroxylysine may also be used. The recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain peptide sequences are asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline. Thus, the presence of either of these peptide sequences in a polypeptide creates a potential glycosylation site.

[0209] The glycosylation pattern may be altered, for example, by deleting one or more glycosylation site(s) found in the polypeptide, and / or adding one or more glycosylation site(s) that are not present in the polypeptide. Addition of glycosylation sites to the Fc region of an antibody is conveniently accomplished by altering the amino acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-linked glycosylation sites). An exemplary glycosylation variant has an amino acid substitution of residue Asn 297 of the heavy chain. The alteration may also be made by the addition of, or substitution by, one or more serine or threonine residues to the sequence of the original polypeptide (for O-linked glycosylation sites). Additionally, a change of Asn 297 to Ala can remove one of the glycosylation sites.

[0210] In certain embodiments, the antibody is expressed in cells that express beta (1,4)-N- acetylglucosaminyltransferase III (GnT III), such that GnT III adds GlcNAc to the IL-23pl9 antibody. Methods for producing antibodies in such a fashion are provided in WO / 9954342, WO / 03011878, patent publication 20030003097A1, and Umana et al., Nature Biotechnology, 17: 176- 180, February 1999. Cell lines can be altered to enhance or reduce or eliminate certain post-translational modifications, such as glycosylation, using genome editing technology such as Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR). For example, CRISPR technology can be used to eliminate genes encoding glycosylating enzymes in 293 or CHO cells used to express recombinant monoclonal antibodies.

[0211] 38

[0212] 4932-3873-8280, v. 1 Elimination of monoclonal antibody protein sequence liabilities. It is possible to engineer the antibody variable gene sequences obtained from human B cells to enhance their manufacturability and safety. Potential protein sequence liabilities can be identified by searching for sequence motifs associated with sites containing:

[0213] 1) Unpaired Cys residues,

[0214] 2) N-linked glycosylation,

[0215] 3) Asn deamidation,

[0216] 4) Asp isomerization,

[0217] 5) SYE truncation,

[0218] 6) Met oxidation,

[0219] 7) Trp oxidation,

[0220] 8) N-terminal glutamate,

[0221] 9) Integrin binding,

[0222] 10) CD 11 c / CD 18 binding , or

[0223] 11) Fragmentation

[0224] Such motifs can be eliminated by altering the synthetic gene for the cDNA encoding recombinant antibodies.

[0225] Protein engineering efforts in the field of development of therapeutic antibodies clearly reveal that certain sequences or residues are associated with solubility differences (Fernandez- Escamilla et al., Nature Biotech., 22 (10), 1302-1306, 2004; Chennamsetty et al., PNAS, 106 (29), 11937-11942, 2009; Voynov et al., Biocon. Chem., 21 (2), 385-392, 2010) Evidence from solubility-altering mutations in the literature indicate that some hydrophilic residues such as aspartic acid, glutamic acid, and serine contribute significantly more favorably to protein solubility than other hydrophilic residues, such as asparagine, glutamine, threonine, lysine, and arginine.

[0226] Stability. Antibodies can be engineered for enhanced biophysical properties. One can use elevated temperature to unfold antibodies to determine relative stability, using average apparent melting temperatures. Differential Scanning Calorimetry (DSC) measures the heat capacity, Cp, of a molecule (the heat required to warm it, per degree) as a function of temperature. One can use DSC to study the thermal stability of antibodies. DSC data for mAbs is particularly interesting because it sometimes resolves the unfolding of individual domains within the mAh structure, producing up to three peaks in the thermogram (from unfolding of the Fab, CH2, and CH3 domains). Typically unfolding of the Fab domain produces the strongest peak. The DSC profiles and relative stability of the Fc portion show characteristic differences

[0227] 39

[0228] 4932-3873-8280, v. 1 for the human IgGi, IgG , IgGs, and IgG4 subclasses (Garber and Demarest, Biochem. Biophys. Res. Commun. 355, 751-757, 2007). One also can determine average apparent melting temperature using circular dichroism (CD), performed with a CD spectrometer. Far-UV CD spectra will be measured for antibodies in the range of 200 to 260 nm at increments of 0.5 nm. The final spectra can be determined as averages of 20 accumulations. Residue ellipticity values can be calculated after background subtraction. Thermal unfolding of antibodies (0.1 mg / mL) can be monitored at 235 nm from 25-95 °C and a heating rate of 1 °C / min. One can use dynamic light scattering (DLS) to assess the propensity for aggregation. DLS is used to characterize the size of various particles including proteins. If the system is not dispersed in size, the mean effective diameter of the particles can be determined. This measurement depends on the size of the particle core, the size of surface structures, and particle concentration. Since DLS essentially measures fluctuations in scattered light intensity due to particles, the diffusion coefficient of the particles can be determined. DLS software in commercial DLA instruments displays the particle population at different diameters. Stability studies can be done conveniently using DLS. DLS measurements of a sample can show whether the particles aggregate over time or with temperature variation by determining whether the hydrodynamic radius of the particle increases. If particles aggregate, one can see a larger population of particles with a larger radius. Stability depending on temperature can be analyzed by controlling the temperature in situ. Capillary electrophoresis (CE) techniques include proven methodologies for determining features of antibody stability. One can use an iCE approach to resolve antibody protein charge variants due to deamidation, C-terminal lysines, sialylation, oxidation, glycosylation, and any other change to the protein that can result in a change in pl of the protein. Each of the expressed antibody proteins can be evaluated by high throughput, free solution isoelectric focusing (IEF) in a capillary column (cIEF), using a Protein Simple Maurice instrument. Whole-column UV absorption detection can be performed every 30 seconds for real time monitoring of molecules focusing at the isoelectric points (pls). This approach combines the high resolution of traditional gel IEF with the advantages of quantitation and automation found in column-based separations while eliminating the need for a mobilization step. The technique yields reproducible, quantitative analysis of identity, purity, and heterogeneity profiles for the expressed antibodies. The results identify charge heterogeneity and molecular sizing on the antibodies, with both absorbance and native fluorescence detection modes and with sensitivity of detection down to 0.7 pg / mL.

[0229] Solubility. One can determine the intrinsic solubility score of antibody sequences. The intrinsic solubility scores can be calculated using CamSol Intrinsic (Sormanni et al. , J Mol Biol

[0230] 40

[0231] 4932-3873-8280, v. 1 427, 478-490, 2015). The amino acid sequences for residues 95-102 (Kabat numbering) in HCDR3 of each antibody fragment such as a scFv can be evaluated via the online program to calculate the solubility scores. One also can determine solubility using laboratory techniques. Various techniques exist, including addition of lyophilized protein to a solution until the solution becomes saturated and the solubility limit is reached, or concentration by ultrafiltration in a microconcentrator with a suitable molecular weight cut-off. The most straightforward method is induction of amorphous precipitation, which measures protein solubility using a method involving protein precipitation using ammonium sulfate (Trevino et al., J Mol Biol, 366: 449-460, 2007). Ammonium sulfate precipitation gives quick and accurate information on relative solubility values. Ammonium sulfate precipitation produces precipitated solutions with well-defined aqueous and solid phases and requires relatively small amounts of protein. Solubility measurements performed using induction of amorphous precipitation by ammonium sulfate also can be done easily at different pH values. Protein solubility is highly pH dependent, and pH is considered the most important extrinsic factor that affects solubility.

[0232] Autoreactivity. Generally, it is thought that autoreactive clones should be eliminated during ontogeny by negative selection, however it has become clear that many human and naturally occurring antibodies with autoreactive properties persist in adult mature repertoires, and the autoreactivity may enhance the antiviral function of many antibodies to pathogens. It has been noted that HCDR3 loops in antibodies during early B cell development are often rich in positive charge and exhibit autoreactive patterns (Wardemann et al., Science 301 , 1374- 1377, 2003). One can test a given antibody for autoreactivity by assessing the level of binding to human origin cells in microscopy (using adherent HeLa or HEp-2 epithelial cells) and flow cytometric cell surface staining (using suspension Jurkat T cells and 293S human embryonic kidney cells). Autoreactivity also can be surveyed using assessment of binding to tissues in tissue arrays.

[0233] Preferred residues (“Human Likeness”). B cell repertoire deep sequencing of human B cells from blood donors is being performed on a wide scale in many recent studies. Sequence information about a significant portion of the human antibody repertoire facilitates statistical assessment of antibody sequence features common in healthy humans. With knowledge about the antibody sequence features in a human recombined antibody variable gene reference database, the position specific degree of “Human Likeness” (HL) of an antibody sequence can be estimated. HL has been shown to be useful for the development of antibodies in clinical use, like therapeutic antibodies or antibodies as vaccines. The goal is to increase the human likeness

[0234] 4932-3873-8280, v. 1 41 of antibodies to reduce potential adverse effects and anti-antibody immune responses that will lead to significantly decreased efficacy of the antibody drug or can induce serious health implications. One can assess antibody characteristics of the combined antibody repertoire of three healthy human blood donors of about 400 million sequences in total and created a novel “relative Human Likeness” (rHL) score that focuses on the hypervariable region of the antibody. The rHL score allows one to easily distinguish between human (positive score) and non-human sequences (negative score). Antibodies can be engineered to eliminate residues that are not common in human repertoires.

[0235] D. Single Chain Antibodies

[0236] A single chain variable fragment (scFv) is a fusion of the variable regions of the heavy and light chains of immunoglobulins, linked together with a short (usually serine, glycine) linker. This chimeric molecule retains the specificity of the original immunoglobulin, despite removal of the constant regions and the introduction of a linker peptide. This modification usually leaves the specificity unaltered. These molecules were created historically to facilitate phage display where it is highly convenient to express the antigen binding domain as a single peptide. Alternatively, scFv can be created directly from subcloned heavy and light chains derived from a hybridoma or B cell. Single chain variable fragments lack the constant Fc region found in complete antibody molecules, and thus, the common binding sites (e.g., protein A / G) used to purify antibodies. These fragments can often be purified / immobilized using Protein L since Protein L interacts with the variable region of kappa light chains.

[0237] Flexible linkers generally are comprised of helix- and turn-promoting amino acid residues such as alanine, serine, and glycine. However, other residues can function as well. Tang et al. (1996) used phage display as a means of rapidly selecting tailored linkers for singlechain antibodies (scFvs) from protein linker libraries. A random linker library was constructed in which the genes for the heavy and light chain variable domains were linked by a segment encoding an 18-amino acid polypeptide of variable composition. The scFv repertoire (approx. 5 x 106different members) was displayed on filamentous phage and subjected to affinity selection with hapten. The population of selected variants exhibited significant increases in binding activity but retained considerable sequence diversity. Screening 1 ,054 individual variants subsequently yielded a catalytically active scFv that was produced efficiently in soluble form. Sequence analysis revealed a conserved proline in the linker two residues after the VH C terminus and an abundance of arginines and prolines at other positions as the only common features of the selected tethers.

[0238] 42

[0239] 4932-3873-8280, v. 1 The recombinant antibodies of the present disclosure may also involve sequences or moieties that permit dimerization or multimerization of the receptors. Such sequences include those derived from IgA, which permit formation of multimers in conjunction with the J-chain. Another multimerization domain is the Gal4 dimerization domain. In other embodiments, the chains may be modified with agents such as biotin / avidin, which permit the combination of two antibodies.

[0240] In a separate embodiment, a single-chain antibody can be created by joining receptor light and heavy chains using a non-peptide linker or chemical unit. Generally, the light and heavy chains will be produced in distinct cells, purified, and subsequently linked together in an appropriate fashion (z.e. , the N-terminus of the heavy chain being attached to the C-terminus of the light chain via an appropriate chemical bridge).

[0241] Cross-linking reagents are used to form molecular bridges that tie functional groups of two different molecules, e.g., a stabilizing and coagulating agent. However, it is contemplated that dimers or multimers of the same analog or heteromeric complexes comprised of different analogs can be created. To link two different compounds in a stepwise manner, heterobifunctional cross-linkers can be used that eliminate unwanted homopolymer formation.

[0242] An exemplary hetero-bifunctional cross-linker contains two reactive groups: one reacting with primary amine group (e.g., N-hydroxy succinimide) and the other reacting with a thiol group (e.g., pyridyl disulfide, maleimides, halogens, etc.). Through the primary amine reactive group, the cross-linker may react with the lysine residue(s) of one protein (e.g., the selected antibody or fragment) and through the thiol reactive group, the cross-linker, already tied up to the first protein, reacts with the cysteine residue (free sulfhydryl group) of the other protein (e.g., the selective agent).

[0243] It is preferred that a cross-linker having reasonable stability in blood will be employed. Numerous types of disulfide bond-containing linkers are known that can be successfully employed to conjugate targeting and therapeutic / preventative agents. Linkers that contain a disulfide bond that is sterically hindered may prove to give greater stability in vivo, preventing release of the targeting peptide prior to reaching the site of action. These linkers are thus one group of linking agents.

[0244] Another cross-linking reagent is SMPT, which is a bifunctional cross-linker containing a disulfide bond that is “sterically hindered” by an adjacent benzene ring and methyl groups. It is believed that steric hindrance of the disulfide bond serves a function of protecting the bond from attack by thiolate anions such as glutathione which can be present in tissues and blood,

[0245] 43

[0246] 4932-3873-8280, v. 1 and thereby help in preventing decoupling of the conjugate prior to the delivery of the attached agent to the target site.

[0247] The SMPT cross-linking reagent, as with many other known cross-linking reagents, lends the ability to cross-link functional groups such as the SH of cysteine or primary amines (e.g., the epsilon amino group of lysine). Another possible type of cross-linker includes the hetero-bifunctional photoreactive phenylazides containing a cleavable disulfide bond such as sulfosuccinimidyl-2-(p-azido salicylamido) ethyl- l,3'-dithiopropionate. The N-hydroxy- succinimidyl group reacts with primary amino groups and the phenylazide (upon photolysis) reacts non- selectively with any amino acid residue.

[0248] In addition to hindered cross-linkers, non-hindered linkers also can be employed in accordance herewith. Other useful cross-linkers, not considered to contain or generate a protected disulfide, include SATA, SPDP and 2-iminothiolane (Wawrzynczak & Thorpe, 1987). The use of such cross-linkers is well understood in the art. Another embodiment involves the use of flexible linkers.

[0249] U.S. Patent 4,680,338 describes bifunctional linkers useful for producing conjugates of ligands with amine-containing polymers and / or proteins, especially for forming antibody conjugates with chelators, drugs, enzymes, detectable labels and the like. U.S. Patents 5,141,648 and 5,563,250 disclose cleavable conjugates containing a labile bond that is cleavable under a variety of mild conditions. This linker is particularly useful in that the agent of interest may be bonded directly to the linker, with cleavage resulting in release of the active agent. Particular uses include adding a free amino or free sulfhydryl group to a protein, such as an antibody, or a drug.

[0250] U.S. Patent 5,856,456 provides peptide linkers for use in connecting polypeptide constituents to make fusion proteins, e.g., single chain antibodies. The linker is up to about 50 amino acids in length, contains at least one occurrence of a charged amino acid (preferably arginine or lysine) followed by a proline, and is characterized by greater stability and reduced aggregation. U.S. Patent 5,880,270 discloses aminooxy-containing linkers useful in a variety of immunodiagnostic and separative techniques.

[0251] E. Multispecific Antibodies

[0252] In certain embodiments, antibodies of the present disclosure are bispecific or multispecific. Bispecific antibodies are antibodies that have binding specificities for at least two different epitopes. Exemplary bispecific antibodies may bind two different epitopes of a single antigen. Other such antibodies may combine a first antigen binding site with a binding

[0253] 44

[0254] 4932-3873-8280, v. 1 site for a second antigen. Alternatively, an anti-pathogen arm may be combined with an arm that binds to a triggering molecule on a leukocyte, such as a T-cell receptor molecule (e.g., CD3), or Fc receptors for IgG (FcyR), such as FcyRI (CD64), FcyRII (CD32) and Fc gamma RIII (CD16), so as to focus and localize cellular defense mechanisms to the infected cell. Bispecific antibodies may also be used to localize cytotoxic agents to infected cells. These antibodies possess a pathogen-binding arm and an arm that binds the cytotoxic agent (e.g., saporin, anti-interferon-a, vinca alkaloid, ricin A chain, methotrexate or radioactive isotope hapten). Bispecific antibodies can be prepared as full-length antibodies or antibody fragments e.g., F(ab')2 bispecific antibodies). WO 96 / 16673 describes a bispecific anti-ErbB2 / anti-Fc gamma RIII antibody and U.S. Patent 5,837,234 discloses a bispecific anti-ErbB2 / anti-Fc gamma RI antibody. A bispecific anti-ErbB2 / Fc alpha antibody is shown in WO98 / 02463. U.S. Patent 5,821,337 teaches a bispecific anti-ErbB2 / anti-CD3 antibody.

[0255] Methods for making bispecific antibodies are known in the art. Traditional production of full-length bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain- light chain pairs, where the two chains have different specificities (Millstein et al., Nature, 305:537-539 (1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low. Similar procedures are disclosed in WO 93 / 08829, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).

[0256] According to a different approach, antibody variable regions with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. Preferably, the fusion is with an Ig heavy chain constant domain, comprising at least part of the hinge, Cu2, and CH3 regions. It is preferred to have the first heavy-chain constant region (Cm) containing the site necessary for light chain bonding, present in at least one of the fusions. DNA encoding the immunoglobulin heavy chain fusions and, if desired, DNA encoding the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host cell. This provides for greater flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yield of the desired bispecific antibody. It is, however, possible to insert the coding sequences for two or all three polypeptide chains into a single expression vector when the expression of at least two

[0257] 45

[0258] 4932-3873-8280, v. 1 polypeptide chains in equal ratios results in high yields or when the ratios have no significant effect on the yield of the desired chain combination.

[0259] In a particular embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in WO 94 / 04690. For further details of generating bispecific antibodies see, for example, Suresh et al. , Methods in Enzymology, 121:210 (1986).

[0260] According to another approach described in U.S. Patent 5,731,168, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers that are recovered from recombinant cell culture. The preferred interface comprises at least a part of the CH3 domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g., tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones e.g. , alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.

[0261] Bispecific antibodies include cross-linked or "heteroconjugate" antibodies. For example, one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Patent 4,676,980), and for treatment of HIV infection (WO 91 / 00360, WO 92 / 200373, and EP 03089). Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Patent 4,676,980, along with a number of cross-linking techniques.

[0262] Techniques for generating bispecific antibodies from antibody fragments have also been described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al., Science, 229: 81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab’)2 fragments. These fragments are reduced in the presence of the dithiol complexing agent, sodium arsenite, to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab' fragments generated are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then

[0263] 46

[0264] 4932-3873-8280, v. 1 reconverted to the Fab'-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes.

[0265] Techniques exist that facilitate the direct recovery of Fab’-SH fragments from E. coli, which can be chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med., 175: 217-225 (1992) describe the production of a humanized bispecific antibody F(ab')2 molecule. Each Fab' fragment was separately secreted from E. coli and subjected to directed chemical coupling in vitro to form the bispecific antibody. The bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets.

[0266] Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described (Merchant et al., Nat. Biotechnol. 16, 677-681 (1998). doi:10.1038 / nbt0798-677pmid:9661204). For example, bispecific antibodies have been produced using leucine zippers (Kostelny et al., J. Immunol., 148(5): 1547-1553, 1992). The leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion. The antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers. The "diabody" technology described by Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993) has provided an alternative mechanism for making bispecific antibody fragments. The fragments comprise a Vn connected to a VL by a linker that is too short to allow pairing between the two domains on the same chain. Accordingly, the VH and VL domains of one fragment are forced to pair with the complementary VL and VH domains of another fragment, thereby forming two antigen-binding sites. Another strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See Gruber et al., J. Immunol., 152:5368 (1994).

[0267] In a particular embodiment, a bispecific or multispecific antibody may be formed as a DOCK-AND-LOCK™ (DNL™) complex (see, e.g., U.S. Patents 7,521,056; 7,527,787; 7,534,866; 7,550,143 and 7,666,400, the Examples section of each of which is incorporated herein by reference.) Generally, the technique takes advantage of the specific and high-affinity binding interactions that occur between a dimerization and docking domain (ODD) sequence of the regulatory (R) subunits of cAMP-dependent protein kinase (PKA) and an anchor domain (AD) sequence derived from any of a variety of AKAP proteins (Baillie et al.. FEES Letters.

[0268] 47

[0269] 4932-3873-8280, v. 1 2005; 579: 3264; Wong and Scott, Nat. Rev. Mol. Cell Biol. 2004; 5: 959). The DDD and AD peptides may be attached to any protein, peptide, or other molecule. Because the DDD sequences spontaneously dimerize and bind to the AD sequence, die technique allows the formation of complexes between any selected molecules that may be attached to DDD or AD sequences.

[0270] Antibodies with more than two valencies are contemplated. For example, trispecific antibodies can be prepared (Tutt et al., J. Immunol. 147: 60, 1991 ; Xu et al. , Science, 358(6359):85-90, 2017). A multivalent antibody may be internalized (and / or catabolized) faster than a bivalent antibody by a cell expressing an antigen to which the antibodies bind. The antibodies of the present disclosure can be multivalent antibodies with three or more antigen binding sites (e.g., tetravalent antibodies), which can be readily produced by recombinant expression of nucleic acid encoding the polypeptide chains of the antibody. The multivalent antibody can comprise a dimerization domain and three or more antigen binding sites. The preferred dimerization domain comprises (or consists of) an Fc region or a hinge region. In this scenario, the antibody will comprise an Fc region and three or more antigen binding sites amino-terminal to the Fc region. The preferred multivalent antibody herein comprises (or consists of) three to about eight, but preferably four, antigen binding sites. The multivalent antibody comprises at least one polypeptide chain (and preferably two polypeptide chains), wherein the polypeptide chain(s) comprise two or more variable regions. For instance, the polypeptide chain(s) may comprise VDl-(Xl)n-VD2-(X2)n-Fc, wherein VD1 is a first variable region, VD2 is a second variable region, Fc is one polypeptide chain of an Fc region, XI and X2 represent an amino acid or polypeptide, and n is 0 or 1. For instance, the polypeptide chain(s) may comprise: VH-CH1 -flexible linker-VH-CHl-Fc region chain; or VH-CH1-VH- CHl-Fc region chain. The multivalent antibody herein preferably further comprises at least two (and preferably four) light chain variable region polypeptides. The multivalent antibody herein may, for instance, comprise from about two to about eight light chain variable region polypeptides. The light chain variable region polypeptides contemplated here comprise a light chain variable region and, optionally, further comprise a CL domain.

[0271] Charge modifications are particularly useful in the context of a multi-specific antibody, where amino acid substitutions in Fab molecules result in reducing the mispairing of light chains with non-matching heavy chains (Bence-Jones-type side products), which can occur in the production of Fab-based bi- / multi- specific antigen binding molecules with a VH / VL exchange in one (or more, in case of molecules comprising more than two antigen-binding Fab

[0272] 48

[0273] 4932-3873-8280, v. 1 molecules) of their binding arms (see also PCT publication no. WO 2015 / 150447, particularly the examples therein, incorporated herein by reference in its entirety).

[0274] Accordingly, in particular embodiments, an antibody comprised in the therapeutic agent comprises:

[0275] (a) a first Fab molecule which specifically binds to a first antigen

[0276] (b) a second Fab molecule which specifically binds to a second antigen, and wherein the variable domains VL and VH of the Fab light chain and the Fab heavy chain are replaced by each other, wherein the first antigen is an activating T cell antigen and the second antigen is a target cell antigen, or the first antigen is a target cell antigen and the second antigen is an activating T cell antigen; and wherein i) in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted by a positively charged amino acid (numbering according to Kabat), and wherein in the constant domain CHI of the first Fab molecule under a) the amino acid at position 147 or the amino acid at position 213 is substituted by a negatively charged amino acid (numbering according to Kabat EU index); or ii) in the constant domain CL of the second Fab molecule under b) the amino acid at position 124 is substituted by a positively charged amino acid (numbering according to Kabat), and wherein in the constant domain CHI of the second Fab molecule under b) the amino acid at position 147 or the amino acid at position 213 is substituted by a negatively charged amino acid (numbering according to Kabat EU index).

[0277] The antibody may not comprise both modifications mentioned under i) and ii). The constant domains CL and CHI of the second Fab molecule are not replaced by each other (i.e., remain unexchanged).

[0278] In another embodiment of the antibody, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat) (in one preferred embodiment independently by lysine (K) or arginine (R)), and in the constant domain CHI of the first Fab molecule under a) the amino acid at position 147 or the amino acid at position 213 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index).

[0279] In a further embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted independently by lysine (K), arginine (R) or

[0280] 49

[0281] 4932-3873-8280, v. 1 histidine (H) (numbering according to Kabat), and in the constant domain CHI of the first Fab molecule under a) the amino acid at position 147 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index).

[0282] In a particular embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat) (in one preferred embodiment independently by lysine (K) or arginine (R)) and the amino acid at position 123 is substituted independently by lysine (K), arginine (R) or histidine (H) (numbering according to Kabat) (in one preferred embodiment independently by lysine (K) or arginine (R)), and in the constant domain CHI of the first Fab molecule under a) the amino acid at position 147 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index) and the amino acid at position 213 is substituted independently by glutamic acid (E), or aspartic acid (D) (numbering according to Kabat EU index).

[0283] In a more particular embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted by lysine (K) (numbering according to Kabat) and the amino acid at position 123 is substituted by lysine (K) or arginine (R) (numbering according to Kabat), and in the constant domain CHI of the first Fab molecule under a) the amino acid at position 147 is substituted by glutamic acid (E) (numbering according to Kabat EU index) and the amino acid at position 213 is substituted by glutamic acid (E) (numbering according to Kabat EU index).

[0284] In an even more particular embodiment, in the constant domain CL of the first Fab molecule under a) the amino acid at position 124 is substituted by lysine (K) (numbering according to Kabat) and the amino acid at position 123 is substituted by arginine (R) (numbering according to Kabat), and in the constant domain CHI of the first Fab molecule under a) the amino acid at position 147 is substituted by glutamic acid (E) (numbering according to Kabat EU index) and the amino acid at position 213 is substituted by glutamic acid (E) (numbering according to Kabat EU index).

[0285] F. Chimeric Antigen Receptors

[0286] Artificial T cell receptors (also known as chimeric T cell receptors, chimeric immunoreceptors, chimeric antigen receptors (CARs)) are engineered receptors that graft an arbitrary specificity onto an immune effector cell. Typically, these receptors are used to graft the specificity of a monoclonal antibody onto a T cell, with transfer of their coding sequence

[0287] 4932-3873-8280, v. 1 50 facilitated by retroviral vectors. In this way, many target- specific T cells can be generated for adoptive cell transfer. Phase I clinical studies of this approach show efficacy.

[0288] The most common form of these molecules are fusions of single-chain variable fragments (scFv) derived from monoclonal antibodies, fused to CD3-zeta transmembrane and endodomain. Such molecules result in the transmission of a zeta signal in response to recognition by the scFv of its target. An example of such a construct is 14g2a-Zeta, which is a fusion of a scFv derived from hybridoma 14g2a (which recognizes disialoganglioside GD2). When T cells express this molecule (usually achieved by oncoretroviral vector transduction), they recognize and kill target cells that express GD2 (e.g., neuroblastoma cells). To target malignant B cells, investigators have redirected the specificity of T cells using a chimeric immunoreceptor specific for the B-lineage molecule, CD 19.

[0289] The variable portions of an immunoglobulin heavy and light chain are fused by a flexible linker to form a scFv. This scFv is preceded by a signal peptide to direct the nascent protein to the endoplasmic reticulum and subsequent surface expression (this is cleaved). A flexible spacer allows the scFv to orient in different directions to enable antigen binding. The transmembrane domain is a typical hydrophobic alpha helix usually derived from the original molecule of the signaling endodomain which protrudes into the cell and transmits the desired signal.

[0290] Type I proteins are in fact two protein domains linked by a transmembrane alpha helix in between. The cell membrane lipid bilayer, through which the transmembrane domain passes, acts to isolate the inside portion (endodomain) from the external portion (ectodomain). It is not so surprising that attaching an ectodomain from one protein to an endodomain of another protein results in a molecule that combines the recognition of the former to the signal of the latter.

[0291] Ectodomain. A signal peptide directs the nascent protein into the endoplasmic reticulum. This is essential if the receptor is to be glycosylated and anchored in the cell membrane. Any eukaryotic signal peptide sequence usually works fine. Generally, the signal peptide natively attached to the amino-terminal most component is used (e. ., in a scFv with orientation light chain - linker - heavy chain, the native signal of the light-chain is used

[0292] The antigen recognition domain is usually an scFv. There are, however, many alternatives. An antigen recognition domain from native T-cell receptor (TCR) alpha and beta single chains have been described, as have simple ectodomains (e.g., CD4 ectodomain to recognize HIV infected cells) and more exotic recognition components such as a linked cytokine (which leads to recognition of cells bearing the cytokine receptor). In fact, almost

[0293] 4932-3873-8280, v. 1 51 anything that binds a given target with high affinity can be used as an antigen recognition region.

[0294] A spacer region links the antigen binding domain to the transmembrane domain. It should be flexible enough to allow the antigen binding domain to orient in different directions to facilitate antigen recognition. The simplest form is the hinge region from IgGl. Alternatives include the CH2CH3 region of immunoglobulin and portions of CD3. For most scFv based constructs, the IgGl hinge suffices. However, the best spacer often has to be determined empirically.

[0295] Transmembrane domain. The transmembrane domain is a hydrophobic alpha helix that spans the membrane. Generally, the transmembrane domain from the most membrane proximal component of the endodomain is used. Interestingly, using the CD3-zeta transmembrane domain may result in incorporation of the artificial TCR into the native TCR, a factor that is dependent on the presence of the native CD3-zeta transmembrane charged aspartic acid residue. Different transmembrane domains result in different receptor stability. The CD28 transmembrane domain results in a brightly expressed, stable receptor.

[0296] Endodomain. This is the "business-end" of the receptor. After antigen recognition, receptors cluster and a signal is transmitted to the cell. The most commonly used endodomain component is CD3-zeta which contains 3 IT AMs. This transmits an activation signal to the T cell after antigen is bound. CD3-zeta may not provide a fully competent activation signal and additional co-stimulatory signaling is needed.

[0297] "First- generation" CARs typically had the intracellular domain from the CD3 chain, which is the primary transmitter of signals from endogenous TCRs. "Second-generation" CARs add intracellular signaling domains from various costimulatory protein receptors (e.g., CD28, 41BB, ICOS) to the cytoplasmic tail of the CAR to provide additional signals to the T cell. Preclinical studies have indicated that the second generation of CAR designs improve the antitumor activity of T cells. More recent, "third generation" CARs combine multiple signaling domains, such as CD3z-CD28-41BB or CD3z-CD28-OX40, to further augment potency.

[0298] G. ADCs

[0299] Antibody Drug Conjugates or ADCs are a new class of highly potent biopharmaceutical drugs designed as a targeted therapy for the treatment of people with infectious disease. ADCs are complex molecules composed of an antibody (a whole mAh or an antibody fragment such as a single-chain variable fragment, or scFv) linked, via a stable chemical linker with labile

[0300] 4932-3873-8280, v. 1 52 bonds, to a biological active cytotoxic / anti- viral payload or drug. Antibody Drug Conjugates are examples of bioconjugates and immunoconjugates.

[0301] By combining the unique targeting capabilities of monoclonal antibodies with the cancer-killing ability of cytotoxic drugs, antibody-drug conjugates allow sensitive discrimination between healthy and diseased tissue. This means that, in contrast to traditional systemic approaches, antibody-drug conjugates target and attack the infected cell so that healthy cells are less severely affected.

[0302] In the development ADC-based anti-tumor therapies, an anticancer drug (e.g., a cell toxin or cytotoxin) is coupled to an antibody that specifically targets a certain cell marker e.g. , a protein that, ideally, is only to be found in or on infected cells). Antibodies track these proteins down in the body and attach themselves to the surface of cancer cells. The biochemical reaction between the antibody and the target protein (antigen) triggers a signal in the tumor cell, which then absorbs or internalizes the antibody together with the cytotoxin. After the ADC is internalized, the cytotoxic drug is released and kills the cell or impairs viral replication. Due to this targeting, ideally the drug has lower side effects and gives a wider therapeutic window than other agents.

[0303] A stable link between the antibody and cytotoxic / anti-viral agent is a crucial aspect of an ADC. Linkers are based on chemical motifs including disulfides, hydrazones or peptides (cleavable), or thioethers (noncleavable) and control the distribution and delivery of the cytotoxic agent to the target cell. Cleavable and noncleavable types of linkers have been proven to be safe in preclinical and clinical trials. Brentuximab vedotin includes an enzyme-sensitive cleavable linker that delivers the potent and highly toxic antimicrotubule agent Monomethyl auristatin E or MMAE, a synthetic antineoplastic agent, to human specific CD30-positive malignant cells. Because of its high toxicity MMAE, which inhibits cell division by blocking the polymerization of tubulin, cannot be used as a single-agent chemotherapeutic drug. However, the combination of MMAE linked to an anti-CD30 monoclonal antibody (cAClO, a cell membrane protein of the tumor necrosis factor or TNF receptor) proved to be stable in extracellular fluid, cleavable by cathepsin and safe for therapy. Trastuzumab emtansine, the other approved ADC, is a combination of the microtubule- formation inhibitor mertansine (DM- 1), a derivative of the Maytansine, and antibody trastuzumab (HerceptinO / Genentech / Roche) attached by a stable, non-cleavable linker.

[0304] The availability of better and more stable linkers has changed the function of the chemical bond. The type of linker, cleavable or noncleavable, lends specific properties to the cytotoxic (anti-cancer) drug. For example, a non-cleavable linker keeps the drug within the cell. As a

[0305] 4932-3873-8280, v. 1 53 result, the entire antibody, linker, and cytotoxic agent enter the targeted cancer cell where the antibody is degraded to the level of an amino acid. The resulting complex - amino acid, linker and cytotoxic agent - now becomes the active drug. In contrast, cleavable linkers are catalyzed by enzymes in the host cell where it releases the cytotoxic agent.

[0306] Another type of cleavable linker, currently in development, adds an extra molecule between the cytotoxic / anti-viral drug and the cleavage site. This linker technology allows researchers to create ADCs with more flexibility without worrying about changing cleavage kinetics. Researchers are also developing a new method of peptide cleavage based on Edman degradation, a method of sequencing amino acids in a peptide. Future direction in the development of ADCs also includes the development of site-specific conjugation (TDCs) to further improve stability and therapeutic index and a emitting immunoconjugates and antibody-conjugated nanoparticles.

[0307] H. BITES

[0308] Bi-specific T-cell engagers (BiTEs) are a class of artificial bispecific monoclonal antibodies that are investigated for the use as anti-cancer drugs. They direct a host's immune system, more specifically the T cells' cytotoxic activity, against infected cells. BiTE is a registered trademark of Micromet AG.

[0309] BiTEs are fusion proteins consisting of two single-chain variable fragments (scFvs) of different antibodies, or amino acid sequences from four different genes, on a single peptide chain of about 55 kilodaltons. One of the scFvs binds to T cells via the CD3 receptor, and the other to an infected cell via a specific molecule.

[0310] Like other bispecific antibodies, and unlike ordinary monoclonal antibodies, BiTEs form a link between T cells and target cells. This causes T cells to exert cytotoxic / anti-viral activity on infected cells by producing proteins like perforin and granzymes, independently of the presence of MHC I or co-stimulatory molecules. These proteins enter infected cells and initiate the cell’s apoptosis. This action mimics physiological processes observed during T cell attacks against infected cells.

[0311] I. Intrabodies

[0312] In a particular embodiment, the antibody is a recombinant antibody that is suitable for action inside of a cell - such antibodies are known as “intrabodies.” These antibodies may interfere with target function by a variety of mechanisms, such as by altering intracellular protein trafficking, interfering with enzymatic function, and blocking protein-protein or

[0313] 4932-3873-8280, v. 1 54 protein-DNA interactions. In many ways, their structures mimic or parallel those of single chain and single domain antibodies, discussed above. Indeed, single-transcript / single-chain is an important feature that permits intracellular expression in a target cell, and also makes protein transit across cell membranes more feasible. However, additional features are required.

[0314] The two major issues impacting the implementation of intrabody therapeutic are delivery, including cell / tissue targeting, and stability. With respect to delivery, a variety of approaches have been employed, such as tissue-directed delivery, use of cell-type specific promoters, viral-based delivery and use of cell-permeability / membrane translocating peptides. With respect to the stability, the approach is generally to either screen by brute force, including methods that involve phage display and may include sequence maturation or development of consensus sequences, or more directed modifications such as insertion stabilizing sequences (e.g., Fc regions, chaperone protein sequences, leucine zippers) and disulfide replacement / modification.

[0315] An additional feature that intrabodies may require is a signal for intracellular targeting. Vectors that can target intrabodies (or other proteins) to subcellular regions such as the cytoplasm, nucleus, mitochondria and ER have been designed and are commercially available (Invitrogen Corp.).

[0316] By virtue of their ability to enter cells, intrabodies have additional uses that other types of antibodies may not achieve. In the case of the present antibodies, the ability to interact with the MUC 1 cytoplasmic domain in a living cell may interfere with functions associated with the MUC1 CD, such as signaling functions (binding to other molecules) or oligomer formation. In particular, it is contemplated that such antibodies can be used to inhibit MUC1 dimer formation.

[0317] J. Purification

[0318] In certain embodiments, the antibodies of the present disclosure may be purified. The term “purified,” as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein is purified to any degree relative to its naturally obtainable state. A purified protein therefore also refers to a protein, free from the environment in which it may naturally occur. Where the term “substantially purified” is used, this designation will refer to a composition in which the protein or peptide forms the major component of the

[0319] 4932-3873-8280, v. 1 55 composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition.

[0320] Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing. Other methods for protein purification include precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; gel filtration, reverse phase, hydroxylapatite and affinity chromatography; and combinations of such and other techniques.

[0321] In purifying an antibody of the present disclosure, it may be desirable to express the polypeptide in a prokaryotic or eukaryotic expression system and extract the protein using denaturing conditions. The polypeptide may be purified from other cellular components using an affinity column, which binds to a tagged portion of the polypeptide. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide.

[0322] Commonly, complete antibodies are fractionated utilizing agents (?'.<?. , protein A) that bind the Fc portion of the antibody. Alternatively, antigens may be used to simultaneously purify and select appropriate antibodies. Such methods often utilize the selection agent bound to a support, such as a column, filter, or bead. The antibodies are bound to a support, contaminants removed (e.g. , washed away), and the antibodies released by applying conditions (salt, heat, etc.).

[0323] Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS / PAGE analysis. Another method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity. The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay

[0324] 4932-3873-8280, v. 1 56 technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity.

[0325] It is known that the migration of a polypeptide can vary, sometimes significantly, with different conditions of SDS / PAGE (Capaldi et al., 1977). It will therefore be appreciated that under differing electrophoresis conditions, the apparent molecular weights of purified or partially purified expression products may vary.

[0326] III. Treatments

[0327] A. Formulation and Administration

[0328] The present disclosure provides pharmaceutical compositions and methods for preparing the same. Such compositions comprise a prophylactically or therapeutically effective amount of an antibody or a fragment thereof, or a peptide immunogen, and a pharmaceutically acceptable carrier. In a specific embodiment, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a particular carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Other suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.

[0329] The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations, and the like. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical agents are described in “Remington’s Pharmaceutical Sciences.” Such compositions will contain a prophylactically or therapeutically effective amount of the antibody or fragment thereof, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration, which can be oral, intravenous, intraarterial, intrabuccal,

[0330] 4932-3873-8280, v. 1 57 intranasal, nebulized, bronchial inhalation, intra-rectal, vaginal, topical, or delivered by mechanical ventilation.

[0331] Passive transfer of antibodies, known as artificially acquired passive immunity, generally will involve the use of intravenous or intramuscular injections. The forms of antibody can be human or animal blood plasma or serum, as pooled human immunoglobulin for intravenous (IVIG) or intramuscular (IG) use, as high-titer human IVIG or IG from immunized or from donors recovering from disease, and as monoclonal antibodies (MAb). Such immunity generally lasts for only a short period of time, and there is also a potential risk for hypersensitivity reactions, and serum sickness, especially from gamma globulin of non-human origin. However, passive immunity provides immediate protection. The antibodies will be formulated in a carrier suitable for injection, i.e.. sterile and syringeable.

[0332] Generally, the ingredients of compositions of the disclosure are supplied either separately or mixed in unit dosage form, for example, as a dry lyophilized powder or water- free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.

[0333] The compositions of the disclosure can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.

[0334] IV. Examples

[0335] The following examples are included to demonstrate preferred embodiments. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of embodiments, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure.

[0336] 4932-3873-8280, v. 1 58 Example 1 - Methods

[0337] Human studies. Patient cohort 1 is a published cohort (Liu et al., 2019). The inventors enrolled patient cohort 2 with HCC received immune checkpoint inhibitor at CHA Bundang Medical Center, Korea, between June 2020 and December 2021 (Table SI, S2). All patients had histologically or radiologically confirmed unresectable or metastatic HCC according to the American Association for the Study of Liver Diseases (AASLC) criteria, had no history of systemic anticancer treatment, and had sufficient baseline tumor tissues for transcriptomic analysis. All patients received first-line atezolizumab and bevacizumab immunotherapy. Objective response to immunotherapy was assessed according to Response Evaluation Criteria in Solid Tumors version 1.1 using computed tomography or magnetic resonance imaging at 6- 9-week intervals. Progression-free survival (PFS) was defined as the time interval from the initiation of treatment to disease progression or the last follow-up. Overall survival (OS) was defined as the time interval from treatment initiation to death or the last follow-up. The study was approved by the institutional review boards (CHA Bundang Medical Center, Korea, CHA- 2017-11-052 and CHA-2017-11-054). All patients provided written, informed consent.

[0338] The inventors recruited patient cohort 3 through the University of Michigan Hospital, Ann Arbor, MI, USA (Table S3). All clinical records in this study were obtained with the approval of Institutional Review Boards and patients’ consents were waived following Institutional Review Board protocol review (HUM00146400, HUM00139259,

[0339] HUM00163915, HUM00161860, and HUM00046018). Cohort 3 represents patients at the University of Michigan who have undergone comprehensive tumor and somatic bulk RNA sequencing as previously described who received immunotherapy and had evaluable cross- sectional imaging (Robinson et al., 2017). RECIST 1.1 Eisenhauer et al., 2009) was utilized for response assessment. Tumor burden was defined as the sum of the longest cross-sectional diameters of lesions noted on radiographic studies. Progression-free survival and overall survival were calculated from initiation of therapy.

[0340] Cell lines. Murine melanoma cell lines (B16-F0, B16-F10, Yumm5.2), human melanoma cell line A375, human ovarian cancer cell line OVCAR-3 and were procured from ATCC. Human melanoma cell lines COLO-679 and RVH-421 were obtained from DSMZ. OC8 was generated in the inventors’ laboratory and reported previously (Cui et al., 2013). The murine colon cancer cell line MC38 and MT3 murine pancreatic cancer cell line were acquired as previously reported (Lin et al., 2018; Tanikawa et al., 2012; Boj et al., 2015). All cell lines underwent routine screening for mycoplasma contamination.

[0341] 4932-3873-8280, v. 1 59 In vivo experiments. Approval for animal procedures was obtained from the Institutional Animal Care and Use Committee at the University of Michigan. Mice aged 8-10 weeks, of both sexes, were employed for the study, including NOD-scid IL2Rgnull (NSG) and wild-type C57B / 6J mice sourced from The Jackson Laboratory. ACOD1 -deficient (Acodl'^) and Acodlflox / floxmice were graciously provided by Dr. Michael S. Diamond.18All mice were housed under pathogen- free conditions.

[0342] For the various tumor models (B16-F10, Yumm5.2, MT3, and MC38), 10 6 tumor cells were subcutaneously injected into the left flank of the mice. Tumor dimensions were regularly measured using calipers, and tumor volume was calculated accordingly. In itaconate blocking experiments, treatment was initiated when tumors reached approximately 100 mm3. 2-(3- methoxybenzyl) succinic acid (SLC13A31) and controls were administered intraperitoneally daily at a dose of 10 mg / kg mouse body weight throughout the study.

[0343] Anti-PD-Ll and IgGl isotype monoclonal antibodies were administered intraperitoneally at a dose of 100 pg per mouse on day 3 after tumor cell inoculation, followed by subsequent dosing every 3 days for the duration of the experiment.

[0344] Flow cytometry analysis (FACS). Cell death was assessed via flow cytometry using 7- aminoactinomycin D (7-AAD) to identify 7-AAD-positive cells. For lipid oxidation detection, cells were stained with Cl 1-BODIPY dye, a lipid peroxidation sensor, and the ratio of oxidized Cl 1-BODIPY to total Cl 1-BODIPY was determined using FACS. T cell phenotyping was determined in single-cell suspensions from fresh tumor tissues. Cells were stained with specific antibodies against mouse CD45 (30-F11), CD90 (53-2.1), and CD8 (53- 6.7) to define CD45+CD90+CD8+T cells. T cell cytokine expression was assessed through intracellular staining using antibodies against mouse IFNy (XMG1.2), and TNFa (MP6-XT22) from eBioscience or BD Biosciences. Flow cytometry was performed on an LSR Fortessa (BD), and data were analyzed using DIVA software (BD Biosciences).

[0345] CRISPR gene targeting and gene overexpression. CRISPR gene targeting utilized the Double-Nickase plasmid (Santa Cruz Biotechnology, Inc) for mouse Slcl3a3 (sc-431118- NIC) and mouse Slc7al l (sc-424104-NIC). Successful gene targeting was confirmed by sequencing each cell clone or verifying protein levels through Western Blotting. Multiple deficient clones were pooled. Slcl3a3 overexpression was achieved by transfecting B 16-F10 and Yumm5.2 cells with lentivirus encoding Slcl3a3 (Vector builder) or a scrambled control. Following transfection, cells were selected with puromycin for 7 days, tested for Slcl3a3 expression, and cultured for in vivo experiments.

[0346] 4932-3873-8280, v. 1 60 Immunohistochemistry (IHC) staining. Heat-induced epitope retrieval in a pH9 buffer and endogenous peroxidase quenching were performed. Rabbit anti-human polyclonal primary anti-SLC13A3 antibody (Invitrogen, PA5-53224) was applied to an unstained TMA slide (Tissue Array _ME204) at a dilution of 1 : 100 for 4°C overnight. Staining was detected by a biotin-free polymer-based alkaline phosphatase (AP) reagent system (double stain polymer RDS513 and Universal HRP Tertiary Reagent, IPT5002, BioCare Medical) and a red chromogen (IP Fast Red, IPK5017, BioCare Medical). TMA slides were converted to pyramidal digital image files using a digital slide scanner (AT2, Leica Aperio Biosystems) at scanning magnifications of up to 20x (0.5 pm / pixel). Quantitative assessment of immunohistochemical staining in the digitized slide files was performed using the open-source program QuPath vO.4.3. Results were reported as the percent of all tumor cells having positivity for the chromogen at levels of 1+ (weak), 2+ (moderate), 3+ (strong), and total positivity. H- scores were calculated as (1 x %1+ staining) + (2 x %2+ staining) + (3 x %3+ staining), giving a potential range of 0 (all cells negative) to 300 (all cells strongly positive).

[0347] Real-time PCR. Total RNA extraction utilized TRIzo LS Reagent (Invitrogen, 10296010), and cDNA synthesis was performed with 0.5-1 pg of total RNA using the RevertAid RT Reverse Transcription Kit (Invitrogen KI 691). The mRNA levels were quantified with gene-specific primers and SYBR Green PCR Master Mix (Invitroge, 4368702). The results were normalized to GAPDH using the following primers: mouse slc!3a3 forward: TGTTGTTCCTACTGGTGGGC (SEQ ID NO: 1) mouse slcl3a3 reverse: TGGATCACCGCTTTAGCCTG (SEQ ID NO: 2) mouse slc7all forward: GCTCGTAATACGCCCTGGAG (SEQ ID NO: 3) mouse slc7all reverse: GGAAAATCTGGATCCGGGCA (SEQ ID NO: 4) mouse gapdh forward: CATCACTGCCACCCAGAAGACTG (SEQ ID NO: 5) mouse gapdh reverse: ATGCCAGTGAGCTTCCCGTTCAG (SEQ ID NO: 6) Western blotting. For immunoblot analysis, whole-cell lysates were prepared in RIPA lysis buffer (Thermo Scientific, 89900) supplemented with Halt Protease Inhibitor Cocktail (Thermo Scientific, 78429). Protein concentrations were quantified using BCA protein assay kits (Pierce, 23227). Subsequently, 20 pg of protein samples were loaded onto SDS-PAGE and transferred to a polyvinylidene difluoride membrane. Immune blotting antibodies included anti-SLC7Al l (D2M7A or #98051), anti-NRF2 (D1Z9C), anti-GAPDH (D16H11), and 0- Actin (D6A8). The inventors sourced all antibodies from Cell Signaling Technology, Inc.

[0348] RNA sequencing (RNA-seq). Yumm5.2 cells underwent treatment with permeable itaconate or DMSO reagent control and were cultured for 20 hours. Total RNA extraction

[0349] 4932-3873-8280, v. 1 61 utilized the Direct-zol RNA Miniprep Plus kit (Zymo Research), and mRNA libraries were prepared using Illumina TruSeq technology. Sequencing was performed on an Illumina NextSeq sequencer at 150 bp, paired-end reads with an approximate yield of 30 million reads per sample. Each condition was independently sequenced in four experiments. Gene categories were chosen based on primary function or GSEA reference. Differential gene expression was calculated using DESeq2, and significance was determined with an adjusted P value per the DESeq2 algorithm (< 0.05).

[0350] Single-cell RNA-seq. Samples were fixed and dissociated using the Miltenyi Octo MACS according to 10X Demonstrated Protocol #CGOOO553. Dissociated cells were counted on Luna Fx7 (Logos Biosystems). Probes were hybridized, and samples were pooled and processed according to manufacturer instructions for 10X Genomics Chromium Fixed RNA Profiling Reagent Kits for Multiplexed Samples (PN 1000568). Final library quality was assessed using the Lab Chip GXII HT (PerkinElmer), and libraries were quantified by Qubit (Thermo Fisher). Pooled libraries were subjected to paired-end sequencing according to the manufacturer’s protocol (Illumina Nova-Seq X Plus). BCL Convert Software (Illumina) was used to generate de-multiplexed Fastq files, and the Cell Ranger Pipeline (10X Genomics) was used to align reads and generate count matrices.

[0351] Itaconate detection by ion chromatography mass spectrometry (IC-MS). To quantify the relative abundance of itaconate in mouse tumor fluids or 13C itaconate in cell pellets, ultra-high-resolution mass spectrometry (HRMS) analysis was conducted. For this purpose, 20 pL of samples were utilized, and metabolites were extracted using 0.3 ml of ice- cold 0.1% ammonium hydroxide in 80 / 20 (v / v) methanol / water. Extracts underwent centrifugation at 17,000 g for 5 min at 4°C, and supernatants were transferred to clean tubes. The next step involved evaporation to dryness under nitrogen. The dried extracts were reconstituted in 1 mM KOH in water, and 10 pl was injected for analysis by ion chromatography (IC)-MS.

[0352] For IC, mobile phase A (MPA; weak) consisted of water, while mobile phase B (MPB; strong) was water containing 100 mM KOH. The Thermo Scientific Dionex ICS-6000+ system featured a Thermo lonPac AS 11 column (4 pm particle size, 250 x 2 mm) maintained at 30°C. The autosampler tray was chilled to 4°C. The mobile phase flow rate was 360 pl / min, and the gradient elution program proceeded as follows: 0-5 min, 1% MPB; 5-25 min, 1-35% MPB; 25-39 min, 35-100% MPB; 39-49 min, 100% MPB; 49-50, 100-1% MPB. The total run time was 55 minutes. To enhance desolvation for improved sensitivity, methanol was delivered by an external pump and combined with the eluent via a low dead volume mixing tee. Data

[0353] 4932-3873-8280, v. 1 62 acquisition occurred using a Thermo Orbitrap IQ-X Tribrid Mass Spectrometer under ESI negative ionization mode at a resolution of 240,000. Raw data files were imported into Thermo Trace Finder 5. 1 software for final analysis.

[0354] Homology modeling of SLC13A3, ligands Selection, and docking. The inventors used the Molecular Operating Environment (MOE) to conduct homology modeling and ligand docking based on the crystal structure complex of SLC13A5 with its ligand PF2 (PDB id: 7JSJ).37They imported the human protein sequences SLC13A3 (UniProt: Q8WWT9) (SEQ ID NO: 1 14) and SLC13A5 (Q86YT5) (SEQ ID NO: 1 15) into MOE and aligned them to match the 7JSJ SLC13A5 template. Incorporating the itaconate substructure-based search, 460 potential SLC13A3 ligands were selected from eMolecules (world-wide-web at emolecules.com / ) and prepared for docking into the Chain A pocket of the homology model. The docking procedure involved ligand conformations superimposed onto the protein binding site based on the substructure of the crystallographic ligand. The inventors conducted additional conformational sampling of the docked ligand after removing the crystallographic ligand and then minimized its energy while maintaining the protein's rigidity. This process generated refined poses and scores for ranking. The prioritization of potential SLC13A3 competitive ligands for functional screening was based on binding scores, docking pose visualization, and compound availability.

[0355] Bioinformatics analysis. RNA-seq data analysis in human patients: Transcriptomic analysis included a reported cohort of metastasis melanoma patients treated with ICB (Cohort 1) (Liu et al., 2019), a cohort of patients with advanced HCC treated with immunotherapy at CHA Bundang Medical Centre, Korea (Cohort 2, Table S1,S2), and a cohort from the University of Michigan (UM) of patients with head and neck cancer, bladder (urothelial carcinoma), and melanoma (Cohort 3, Table S3). For the HCC cohort (Cohort 2), RNA extraction and RNA sequencing was performed using the QuantSeq 30 mRNA-sequencing kit (Lexogen, Austria) following the previous protocol (Yang et al., 2023). The median SLC13A3 expression level in tumor tissue were used as a cut-off value to distinguish between SLC1 SAS- high and SLC13A3-low tumors. For the UM cohort (Cohort 3), the Maxstar R package was implemented to determine the impact of SLC 13 A3 expression on survival among the multiple tumor types in the UM cohort. Three tumor types independently yielded patient stratifications, in which low SLC 13 A3 was associated with prolonged overall survival. Data for patients bearing these three tumor types were combined, and Maxstat was implemented again to determine the appropriate stratification by SLC 13 A3 expression. The inventors used unpaired,

[0356] 63

[0357] 4932-3873-8280, v. 1 nonparametric t-tests to compare SLC 13 transcripts between responders (CR, PR, SD) and nonresponders (PD).

[0358] Single-cell RNA-seq analysis for human datasets: melanoma (GSE72056, GSE1 15978) and colon cancer (GSE146771) were downloaded from the GEO database. The SLC13A3 and AC0D1 expression matrix was processed and analyzed by the Seurat package. A dot plot was used to show specific gene expression.

[0359] Single-cell RNA-seq analysis of mouse melanoma tumors: Raw read data were aligned to the mouse reference genome, GRCm38-2020A. Feature barcode matrices from the Cell Ranger multi-pipeline were used for downstream analysis with the Seurat R package (version 4.3.2). To enhance the robustness and reproducibility, triplicates were designed for Slcl3a3 / _and wild-type Slcl3a3+ / +conditions. Quality control measures included the exclusion of cells with fewer than 200 detected genes and those with over 20% mitochondrial RNA content. After quality control, the Slcl3a3- / ‘ and Slcl3a3+ / +sample triplicates yielded 25,059 and 25,644 cells, respectively. Filtered gene counts were log normalized with the “NormalizeData” function in Seurat. The top 2,000 highly variable genes were identified with Seurat’s ‘vst’ method. PCA was performed on the above-mentioned scaled preprocessed data for dimension reduction. Unsupervised clustering was done by the graph based “Find Clusters” function, with a resolution of 0.5. The embeddings were visualized using UMAP. Four major clusters were identified from the unsupervised clustering: melanoma cells, fibroblasts, endothelial cells, and immune cells. The cluster identity was assigned based on the log2 transformed expression levels of canonical markers (Zhang et al., 2022). The melanoma cluster exhibits high expression levels of Mlana (Mlana > 1) and Pmel (Pmel > 1), along with low expression of immune-related genes (Ptprc < 0.2, Gzmb < 1, Prfl < 1). The fibroblast cluster is marked by the exclusive expression of Pecaml. The endothelial cluster is marked by the exclusive expression of Colla2. The immune cluster is characterized by high expression of Ptprc (Ptprc > 0.2). Re-clustering of the immune cells with a resolution of 0.8 further identified the detailed composition of immune cells: cytotoxic lymphocytes (Cd8a, Nkg7, Prfl), myeloid cells (Ms4a7), and dendritic cells (Clec9a).

[0360] To explore the biological pathways impacted by Slcl3a3, differentially expressed genes between Slcl3a3 / _and Slcl3a3+ / +conditions were identified in all four cell types using the "Find Markers" function in Seurat. Pathway enrichment analysis was performed using GSEA (version 4.1.0) on the differentially expressed genes. A two-sided Student's t-test was used to assess the statistical significance of differences in the average expression levels of ferroptosis-

[0361] 64

[0362] 4932-3873-8280, v. 1 resistance signatures14(Txnl, Gclc, Txnrdl, Slcla5, Acsl3, Slc7al l, Nqol) between Slcl3a3"7and Slcl3a3+ / +conditions.

[0363] Statistical methods and software. Statistical analyses were performed using the GraphPad Prism software. Two independent groups were compared using Wilcoxon rank-sum and two-tailed t-tests or a two-way ANOVA for tumor growth. Survival functions were estimated employing the Kaplan-Meier methods, and comparisons were made utilizing the logrank test. A significance level of P < 0.05 was considered statistically significant. Sample size determination was based on animal experimental trials and considered previous publications on similar experiments to ensure robust statistical analysis. Unless otherwise specified, the samples analyzed were independent biological replicates.

[0364] Antibody screening using extracellular peptides of SLC13A3. The inventors designed biotinylated peptides of SLC13A3 (FIG. 7A; Table 1 ) for panning the human antibody scFv phage display libraries. Solution panning using the streptavidin dynabeads (ThermoFisher) was used to immobilize the biotinylated SLC13A3 peptides. Similarly, they made construct for producing ECL loops in a mammalian expression system (Expi HEK293) (FIG. 7B; Table 2). SLC13A3 binding clones were screened using phage ELISA. Phage clones demonstrating positive binding activity were selected, sequenced, and cloned into IgG expression vectors for the purification of full-length antibody.

[0365] Expression and purification of SLC13A3 mAbs. Full-length IgGs are expressed using an expression vector system in human embryonic kidney (HEK293) cells. Selected SLC13A3 binding antibodies were expressed as human IgG 1 and / or Fc engineered for null Fc mediated effector function with a mammalian expression vector system in HEK293 cells using a shaker flask CO2 incubator. Antibodies were purified using a column with protein A resin (GenScript) using a fast protein liquid chromatography (FPLC) separation unit. Purified SLCT3A3 binding antibodies were used for characterization of their biochemical and biological properties. The antibody nucleotide and amino acid sequences are reported in Tables 5 and 6 respectively.

[0366] Binding affinity of anti-SLC13A3 monoclonal antibodies. ELISA titration was used to determine the binding affinity of a panel of monoclonal antibodies to SLC13A3 antigen (FIGS. 8A-D). Binding affinities of the SECT 3 A3 monoclonal antibodies were measured as EC50 using 4-parameter curve fitting concentration titration graphs with GraphPad Prism program. The EC50values were reported in Table 3.

[0367] 65

[0368] 4932-3873-8280, v. 1 For kinetic binding affinity measurements, biotinylated peptides (20 pg / rnL) were loaded onto streptavidin biosensors for 4 min. Following incubation in kinetics buffer to establish baseline.

[0369] Peptide-loaded biosensors were exposed to a series of concentrations (0.1-100 nM) of mAbs and allowed to associate for 200 seconds followed by dissociation for 200 seconds. Background subtraction was used to correct any sensor drifting. All experiments were performed with shaking at 1,000 rpm at 25 °C according to the manufacturer's suggestion. Kinetic sensorgrams for antibodies are shown in FIG. 9. ForteBio's data analysis software was used to determine association rate (kon) and dissociation rate (koff) and KD was calculated using the ratio of koff / kon (Table 4).

[0370] Binding of SLC13A3 monoclonal antibodies on SC13A3 overexpressing cells. The inventors performed flow cytometry (1QUE3, Sartorius) using HEK293 cells overexpressing human or mouse SLC13A3 to verify the conformational binding ability of the mAbs to cell surface SLC 13 A3. Purified mAbs along with an isotype control al a concentration of 10 pg / ml were added to live SLC13A3 overexpressing cells (3 x 10Acells) and allowed to bind for 1 hour. Goat anti-human (Fab )2 Alexa Fluor 488 was used as a secondary antibody and the samples were detected using flow cytometry (FIGS. 10A-C). Antibodies exhibited strong positive binding shift in cells with human or mouse SLC 13 A3 expression in comparison with the isotype control.

[0371] SLC13A3 antibody binning using antigen competition binding. Epitope binning was performed with the SLC 13 A3 antibodies by In-Tandem format competition binding using Octet RED96 system. Biotinylated peptide at 30 pg / ml was captured onto the streptavidin sensor and antibodies at 30 ug / ml were cross-binned with the rest of antibodies. Antibodies compete with each other for binding were considered in the same bin (FIGS. 11A-D).

[0372] Evaluation of SLC13A3 inhibition by mAbs. Functional evaluation of SLC13A3 inhibition was assessed by the downstream expression of SLC7A11. Human melanoma cell line Colo679, overexpressing human SLC 13 A3 were incubated with 5 ug / ml SLC 13 A3 antibodies or IgG for 20 minutes. Cells were further treated with ImM itaconate for 48 hours and collected for Western Blot detection of SLC7A11 expression (FIGS. 20A-B). Mouse melanoma cell line Yumm5.2, overexpressing SLC13A3 were treated with 5pg / ml anti- SLC13A3 or IgG for 20 minutes. Cells were further treated with ImM itaconate for 48 hours. A reduction in SLC7A 11 expression directly correlates with the inhibitory activity of anti- SLC13A3 A3-P11-23 and A3-P11 -27 (FIG. 20C).

[0373] 66

[0374] 4932-3873-8280, v. 1 Generation of bispecific mAbs targeting SLC13A3 and E3 Ligase. Apart from their use as a single target antibody, the inventors identify the potential of targeting both SLC 13 A3 and E3 Ligase to program SLC 13 A3 for proteosome degradation. Here the inventors proposed several constructs of anti-SLC13A3-E3 Ligase bispecific antibodies (FIG. 21A) based on sequences and structural insights previously reported (Genentech Inc Patent #: U.S. Patent Publication 2024 / 0101708 Al; Tables 7 and 8, below). The inventors propose the use of reference E3 ligase antibodies targeting RNF43 and ZNRF3. These mAbs were codon- optimized, synthesized, cloned into human IgGl vectors, and transiently expressed and purified. The binding affinity of recombinant RNF43 and ZNRF3 proteins to the respective mAbs was assessed using BLI (FIG. 21B). Lead anti-SLC13A3 mAbs identified as A3-LP4-2 and A3-LP5-20, based on their high affinities, specificity, and internalization potentials (FIG. 21C), have been proposed to be paired with anti-E3 ligase mAbs targeting either RNF43 or ZNRF3. A schematic diagram of proposed PROTAB model is shown in FIG. 21D.

[0375] Example 2 - Results

[0376] Tumor SLC13A3 expression correlates with ICB efficacy and patient survival. Oncometabolites, including several di- and tri-carboxylate TCA cycle metabolites, impair antitumor immunity in the tumor microenvironment (TME) (Zou & Green, 2023; Notarangelo et al. , 2022; Cheng et al., 2023; Rowe et al., 2023). The SLC13 family is a group of cell membrane transporters, potentially importing di- or tricarboxylate metabolites into cells (Bergeron et al., 2013). The inventors hypothesized that the SLC13 family may import oncometabolites into tumor cells, contributing to immune suppression and therapeutic resistance. To test this hypothesis, they first assessed the expression of the SLC13 family members in a patient cohort with metastasis melanoma receiving anti-PDl monoclonal antibody (nivolumab or pembrolizumab) treatment (Cohort 1) (Liu etal., 2019). The inventors found that the expression levels of tumor SLC 13 A3 were the highest among three major SLC 13 family members. Moreover, its expression levels were lower in patients who responded to ICB (R) than those who did not respond (N) (FIG. 1A). High expression of tumor SLC13A3 was associated with poor overall survival in these patients (FIG. IB). Thus, SLC13A3 expression negatively correlates with the clinical response to ICB.

[0377] The inventors extended and validated their study to a cohort of patients with advanced hepatocellular carcinoma (HCC) treated with atezolizumab plus bevacizumab immunotherapy at Cha University Bundang Medical Center, South Korea (Table SI and S2) (Cohort 2). Again, there existed a negative correlation between SLC 13 A3 expression and the clinical response to

[0378] 67

[0379] 4932-3873-8280, v. 1 ICB (FIG. 1C). The levels of HCC SLC13A3 were negatively associated with the patient’s overall survival (FIG. ID). The inventors additionally analyzed a cohort of patients at the University of Michigan received ICB treatment across three tumor types, including melanoma, head and neck cancer (HNSC), and bladder (Table S3) (Cohort 3). They also observed that high levels of tumor SLC13A3 expression were associated with poor overall survival (FIG. IE). Similar results were observed in TCGA data set covering multiple cancer types, including low-grade glioma (LGG), pancreatic adenocarcinoma (PAAD), uterine carcinosarcoma (UCS), cholangiocarcinoma (bile duct cancer, CHOL), breast carcinoma (BRCA), skin cutaneous melanoma (SKCM), uterine corpus endometrial carcinoma (UCEC), head and neck squamous cell carcinoma (HNSC), and kidney renal clear cell carcinoma (KIRC) (FIG. 12A). Three single-cell RNA sequencing datasets (Tirosh et al., 2016; Jerby-Amon et al., 2018; Zhang et al. , 2020) demonstrated an enriched expression pattern of SLC13A3 in malignant cell clusters compared to other clusters in patients with melanoma and colorectal carcinoma (FIG. IF, FIGS. 12B-C). Immunohistochemistry staining (IHC) confirmed potent SLC13A3 protein expression in melanoma cells, but not normal skin tissues (FIG. 1G). Similar results were observed in human pancreatic cancer, colorectal cancer, liver cancer, and ovarian cancer from the open source (FIG. 12D). Thus, the inventors’ findings underscore a potential link between tumor SLC13A3 expression, impaired tumor immunity, and tumor resistance to ICB.

[0380] SLC13A3 diminishes tumor immunogenicity. To unravel the functional significance of tumor SLC13A3 in tumor immunity, the inventors generated several murine Slcl3a3 knockout (Slcl3a3 / _) tumor cell lines. They observed that genetic deletion of SLC13A3 led to reduced tumor development and progression in C57BL / 6J mice bearing Yumm5.2 melanoma, B16-F10 melanoma, and MT3 pancreatic cancer (FIGS. 2A-F). To further validate this finding, the inventors ectopically expressed and rescued SLC13A3 expression in Slcl3a3 / _tumors (Slcl3a3 / +OE). Restoration of the SLC13A3 expression resulted in tumor progression in both Yumm5.2 and B16-F10 melanoma models (FIGS. 13A-B). Accordingly, the percentages of tumor infiltrating IFNy+CD8+T cells and TNFa+CD4+T cells were increased in mice bearing Slcl3a3 / _tumors compared to Slcl3a3+ / +tumors (FIGS. 2G-H). In line with this, single-cell RNA sequencing analysis revealed elevated levels of cytotoxic lymphocyte proportion in Slcl3a3 / _B16-F10 tumors compared to Slcl3a3+ / +tumors (FIG. 13C). Then, the inventors inoculated Slcl3a3+ / +and Slcl3a3AB16-F10 cells in NOD-scid IL2Rgnull (NSG) mice. As expected, the growth disparity between Slcl3a3+ / +and Slcl3a3 / _tumors in wild type (immune competent) mice was diminished in the NSG mice (FIGS. 2I-J). These data indicate that SLC13A3 impairs tumor immunogenicity.

[0381] 68

[0382] 4932-3873-8280, v. 1 SLC13A3 imports itaconate to protect tumors from ferroptosis. To elucidate the potential mechanism by which SLC13A3 impairs tumor immunogenicity, the inventors analyzed single-cell sequencing data on Slcl3a3+ / +and Slcl3a3 / _B16-F10 tumors in vivo. The Gene Set Enrichment Analysis (GSEA) analysis demonstrated that the ferroptosis resistance and NRF2 gene signatures were among the top upregulated gene signals in Slcl3a3+ / +tumors when compared to Slcl3a3 / _tumors (FIGS. 3A-B). The inventors previously reported that ICB triggered tumor cell ferroptosis, contributing to the anti-tumor immune response (Wang et al., 2019; Liao et al., 2022; Lang et al., 2019). This prompted us to investigate whether SLC1 A3, as a metabolite transporter, influences tumor cell ferroptosis, thereby altering tumor immunogenicity. To test the hypothesis, the inventors treated mice bearing Slcl3a3_ / _and Slcl3a3+ / +B16-F10 tumors with Liproxstatin-1, a ferroptosis inhibitor (FIG. 3C). Treatment with Liproxstatin-1 had minimal effect on Slcl3a3+ / +tumor growth but dramatically enhanced Slcl3a3 / _tumor progression, diminishing the growth difference between Slcl3a3 / _and Slcl3a3+ / +B16-F10 tumors (FIG. 3C). Thus, Slcl3a3 impairs tumor immunogenicity via enabling tumor resistance to ferroptosis in the TME.

[0383] To decipher how SLC13A3 influences tumor ferroptosis, the inventors hypothesized that tumor SLC13A3 imported di- or tricarboxylate metabolite (Bergeron et al., 2013), endowing tumor resistance. To test this hypothesis, they cultured Slcl3a3OEYumm5.2 cells with a series of di- and tri-carboxylate TCA cycle metabolites and examined their responses to Erastin, a ferroptosis inducer. The inventors discovered that itaconate, not other metabolites, strongly protected tumor cells from Erastin-induced ferroptosis (FIG. 3D). A cell-based transporter assay demonstrated that13C-labeled itaconate was efficiently absorbed from extracellular space into Slcl3a3OEYumm5.2 cells in a dose-dependent manner (FIG. 3E). The data suggest that Slcl3a3 is an itaconate transporter for tumor cells. To validate a role for Slcl3a3 in tumor ferroptosis resistance, the inventors pretreated Slcl3a3+ / +Yumm5.2 cells and Slcl3a3 / _Yumm5.2 cells with itaconate, and subsequently cultured these cells with 2 ferroptosis inducers, RSL3 and Erastin. Treatment with itaconate profoundly protected Slcl3a3+ / +Yumm5.2 cells from ferroptosis (FIG. 3F) and reduced oxidized lipid production in Slcl3a3+ / +Yumm5.2 cells (FIG. 3G). These effects were not observed on Slcl3a3‘ / _Yumm5.2 cells (FIGS. 3F-G).

[0384] The protective effect of itaconate on ferroptosis was extended to human melanoma cell lines Colo-679 (FIG. 3H) and RVH-421 (FIG. 31). Furthermore, itaconate showed a superior protection on Erastin-induced ferroptosis in Slcl3a3+ / +B16-F10 cells rather than Slcl3a3zcells, while reintroducing SLC13A3 expression in Slcl3a3 / _cells (Slcl3a3 / +OE) rescued this

[0385] 69

[0386] 4932-3873-8280, v. 1 protective effect (FIG. 3J). Transporter assay confirmed a dramatic increase in the import of extracellular itaconate in Slcl3a3OE(FIG. 3K) and Slcl3a37 +OEB16-F10 cells (FIG. 14A). As a confirmatory experiment, treatment with cell-permeable itaconate (4-octyl itaconate (01)) generated similar levels of ferroptosis protection on Slcl3a3 / _B16-F10 cells and Slcl3a3 / +OEB16-F10 cells (FIG. 14B). To further delve into the ferroptosis protection feature of intracellular of itaconate, the inventors extended their studies to multiple mouse and human tumor cell lines. They confirmed that cell-permeable itaconate enabled ferroptosis resistance to Yumm5.2 (FIG. 14C), B16-F0 (FIG. 14D), A375 human melanoma cell line (FIG. 14E), 0C8 human ovarian cancer cell line (FIG. 14F), and OVCA429 (FIG. 14G). Altogether, these results demonstrate that SLC13A3 is an active itaconate transporter for tumor cells and imports itaconate to protect tumors from ferroptosis.

[0387] Itaconate activates the NRF2-SLC7A11 axis to protect tumors from ferroptosis. To explore the intracellular mechanisms underlying the impact of itaconate in tumor cells, the inventors conducted an RNA sequencing study on Yumm5.2 cells treated with cell-permeable itaconate. In line with the inventors’ observation on Slcl3a3+ / +tumor cells (FIG. 3A), they found an enrichment in the NRF2 pathway in tumor cells treated with cell-permeable itaconate (FIGS. 4A-B). NRF2 plays a pivotal role in cellular antioxidant defense mechanisms (Rojo de la Vega et al., 2018) and serves as a modulator in mediating resistance to ferroptosis (Sun et al. , 2016; Roh et al. , 2017; Dong et al., 2021). Notably, the cystine transporter SLC7A11, a critical regulator of ferroptosis, emerged as one of the top NRF2- targeted genes upregulated by cell-permeable itaconate treatment (FIG. 4C). In line with this, treatment with permeable itaconate stimulated SLC7A11 transcripts in Yumm5.2 cells in a dose dependent manner (FIG. 4D). Moreover, treatment with permeable itaconate comparably stimulated expression of SLC7A11 and NRF2 protein in SLC13A3’7’ and SLC13A3+ / +Yumm5.2 cells (FIG. 4E). As expected, treatment with itaconate stimulated expression of SLC7A11 and NRF2 protein in SLC13A3+ / +Yumm5.2 cells, but not in SLC13A3"7" Yumm5.2 cells (FIG. 4F). The data demonstrate that SLC13A3 is an essential transporter for importing itaconate to stimulate SLC7A11 and NRF2 expression in tumor cells.

[0388] To determine if SLC7A11 mediates itaconate-induced ferroptosis resistance, the inventors established Slc7al I’7' Yumm5.2 cells (FIG. 15A). As expected, permeable itaconate stimulated SLC7A11 expression in Slc7al l+ / +Yumm5.2 cells, but not in Slc7ai r / _Yumm5.2 cells (FIG. 15A). In line with this, permeable itaconate induced ferroptosis resistance in SLC7A11+ / +B16-F10 cells, but not SLC7A117B16-F10 cells (FIG. 4G). To explore the role of NRF2 in itaconate-induced ferroptosis resistance, the inventors used small hairpin RNAs to

[0389] 4932-3873-8280, v. 1 70 generate several stable Nfe212 gene knockdown Yumm5.2 cells (sh-Nfe212 #1-3) (FIG. 15B). They observed that permeable itaconate failed to upregulate SLC7A11 expression in sh-Nfe212 Yumm5.2 cells (FIG. 15B) and was unable to protect Yumm5.2 cells from RSL-3-induced ferroptosis (FIG. 15C). Collectively, these data suggest that SLC13A3-transported itaconate activates the NRF2-SLC7A11 axis to protect tumors from ferroptosis.

[0390] Itaconate promotes tumor progression via inducing ferroptosis resistance. The inventors next evaluated the role of itaconate-induced ferroptosis resistance in tumor progression in vivo. Aconitate decarboxylase 1 (AC0D1 ) catalyzes cis-aconitate to generate itaconate (Nair et al., 2018; Michelucci et al., 2013). To examine the impact of itaconate on tumor progression, they used the global ACOD1 knockout mouse strain (Acodl7’), lacking endogenous itaconate (Nair et al. , 2018). The inventors inoculated several syngeneic tumor cell lines into Acodl7’ mice and wild-type Acodl mice (Acodl+ / +). They observed a reduced tumor progression in Acodl7’ mice compared to Acodl+ / +mice bearing MC38, Yumm5.2, and B16- F10 tumors (FIGS. 5A-C). Meanwhile, tumor cells isolated from Acodl7’ mice exhibited elevated levels of lipid ROS, suggesting an increase in ferroptosis in vivo (FIG. 5D). Notably, treatment with liproxstatin-1 diminished the differences in B16-F10 tumor growth between Acodl7’ and Acodl+ / +mice (FIG. 5E). The data reveals a close correlation between itaconate and tumor ferroptosis resistance in vivo. To assess the involvement of tumor SLC13A3 in this context, the inventors inoculated Slcl3a37’ B16-F10 tumor cells into Acodl7’ and Acodl+ / +mice. Ablation of tumor Slcl3a3 mitigated the differences in tumor growth between Acodl+ / +and Acodl7’ mice, as shown by comparable and smaller tumors in both groups (FIG. 5F). To test if tumor SLC7A11 expression is crucial for the in vivo effect of itaconate, Slc7al l7’ Yumm5.2 or Slc7al I7’ B16-F10 tumor cells were inoculated into Acodl7’ and Acodl+ / +mice. As expected, Slc7al l7’ tumor progression was no longer different between Acodl7’ and Acodl+ / +mice (FIGS. 5G-H). To further solidify the role of itaconate in vivo, the inventors detected 3-fold high levels of itaconate in Yumm5.2 tumor interstitial fluids in Acodl+ / +mice than Acodl7’ mice (FIG. 51).

[0391] ACOD1 is highly expressed in myeloid cells in the infection model (O’Neill & Artymov, 2019; Hooftman & O’Neill, 2019; McGettrick & O’Neill, 2018; Cordes et al., 2015). To investigate the source of itaconate in the TME, the inventors analyzed human single-cell RNA-seq data sets, including melanoma (Tirosh et al., 2016; Jerby-Arnon et al., 2018) and colorectal cancer (CRC) (Zhang et al., 2020). The inventors’ analysis revealed that macrophages expressed the highest levels of ACOD1 in the human TME (FIGS. S5A-C). To experimentally test the role of macrophage-derived itaconate in tumor models, they generated

[0392] 71

[0393] 4932-3873-8280, v. 1 mice with macrophage-specific Acodl knockout mice (AcodlLyzKO) by breeding the LysM- Cre mice with Acodlfloxmice (Nair et al., 2018). Then, the inventors inoculated Yumm5.2 or B16-F10 tumor cells into AcodlLyzKOmice and wild-type (WT) Acodlfloxlittermates. Mirroring tumor progression in global Acodl / _mice (FIGS. 5A-C), the inventors observed a reduced tumor progression in AcodlLyzKOmice as compared to WT mice (FIGS. 5J-K). The data indicate a key protumor role of macrophage-derived itaconate in vivo. To directly test the impact of macrophage-derived itaconate on tumor cells, the inventors cultured B l 6-F 10 tumor cells with medium from bone marrow-derived macrophages. Macrophage conditional medium strongly protected Slcl3a3OEB16-F10 cells from RSL3-induced ferroptosis as compared to normal medium (FIG. 5L). This protection was abolished in Slcl3a3 / _B16-F10 cells (FIG. 16D). Thus, macrophages serve as the major source of itaconate in the TME and tumor SLC13A3 uptakes TAM-derived itaconate in the TME, enabling tumor progression via itaconate-induced tumor ferroptosis resistance.

[0394] SLC13A3 inhibitor treats ICB resistant tumor and sensitizes tumor ferroptosis. To subvert tumor resistance to ferroptosis mediated by the itaconate-SLC13A3 axis, the inventors explored structural mimics of itaconate which may competitively block itaconate importing through SLC13A3. The structure of SLC13A3 is not available in literature. Based on the crystal structure complex of another SLC13A family member, SLC13A5 with its ligand PF2 (PDB id: 7JSJ) (Sauer et al., 2021), they computationally constructed a homology modeling of SLC13A3 in the Molecular Operating Environment (MOE) (FIG. 17A) (Vilar et al. , 2008). Based on the model, the itaconate substructure-based search revealed 460 potential ligands for SLC13A3 in the eMolecules database (world-wide- web at emolecules.com / ) for molecular docking into the homology model and processed to generate refined poses and scores for ranking. Based on the molecular docking into the homology model, the inventors generated refined poses and scores to rank these potential ligands. They tested the top 10 ranked ligands (itaconate-analogs) for their potential effect on reversing itaconate-induced Yumm5.2 cell ferroptosis resistance. Among these ligands, 2-(3-methylbenzyl) succinic acid showed a maximal capability of reversing itaconate-induced ferroptosis resistance in Yumm5.2 Slcl3a3OEcells (FIG. 6A). The inventors named 2-(3 -methylbenzyl) succinic acid as SLC13A3 inhibitor (SLC13A3i). The potential binding site of SLC13A3i was illustrated in the docking model of SLC13A3 (FIG. 6B). Transporter assay confirmed that SLC13A3i inhibited the import of13C-labeled itaconate in a dose-dependent manner (FIG. 6C). SLC13A3i strongly reversed itaconate-induced Yumm5.2 cell death resistance to Erastin (FIG. 6D) and inhibited itaconate-induced SLC7A11 expression in a dose dependent manner (FIG. 17B). The inventors

[0395] 4932-3873-8280, v. 1 72 further studied the impact of SLC13A3i on tumor progression in vivo. Treatment with SLC13A3i inhibited (Slcl3a3+ / +) B16-F10 tumor progression in WT (Acodl+ / +) C57 / BL6 mice (FIG. 6E). Interestingly, treatment with SLC13A3i failed to inhibit Slcl3a3 / _B16-F10 tumor progression in WT (Acodl+ / +) C57 / BL6 mice (FIG. 17C) and had no effect on Slcl3a3+ / +B16- F10 tumor progression in Acodl / _mice (FIG. 17D). Finally, the inventors examined if SLC13A3i treatment can sensitize B 16-F10 tumors to anti-PD-Ll therapy. B16-F10 tumor model is known for its limited response to single ICB treatment. They found that the combination of SLC13A3i and anti-PD-Ll resulted in a superior tumor inhibition compared to single treatment or control (FIG. 6F). Additionally, the combination therapy led to a robust T cell response as shown by high amounts of IFNy+CD8+T cells in the TME (FIG. 6G). Thus, the anti-tumor effect of SLC13A3i depends on tumor SLC13A3 and host itaconate, and monotherapy with SLC13A3i can treat ICB resistant tumor and sensitize tumor response to ICB.

[0396] E3 ligase target selection. The success of proteolysis-targeting antibodies (PROTABs) depends on identifying E3 ubiquitin ligases that are (1) expressed on the surface of tumor cells, (2) functionally active in mediating ubiquitination, and (3) amenable to antibody binding. The inventors will use curated online databases to systematically identify suitable E3 ligase candidates and integrate transcriptomic and proteomic data from tumor models. We will begin by mining publicly available resources such as UbiBrowser 2.0, Human E3 Ubiquitin Ligases Database, E3 Ligase Landscape (E3 Atlas). They will cross-reference the candidates with online databases such as TCGA, DepMap Portal, Uniprot, and Protein Atlas to confirm tumor-specific or tumor-enriched expression and membrane localization. To ensure expression compatibility, cell surface expression will be confirmed using in-house RNA-seq and proteomics data from our tumor models and patient samples.

[0397] Generation of anti-E3 ligase mAbs. The inventors have generated two reference antibodies targeting E3 ligase proteins, RNF43 and ZNRF3, based on sequences and structural insights previously reported. These mAbs were codon-optimized, synthesized, cloned into human IgGl vectors, and transiently expressed and purified. The binding affinity of recombinant RNF43 and ZNRF3 proteins to the respective mAbs was assessed using BLI. They will generate more high-affinity mAbs against a wide panel of membrane-bound E3 ligase proteins and characterize their biochemical and biophysical properties using ELISA, Octet BLI, and HPLC. Conformational binding of all E3 ligase mAbs will be confirmed by FACS using melanoma tumor cell lines (Colo679 and HS294T) that naturally express high levels of SLC13A3 and E3 ligase proteins.

[0398] 4932-3873-8280, v. 1 73 Engineering bispecific PROTABs. Lead anti-SLC13A3 mAbs identified as A3-LP4- 2 and A3-LP5-20, based on their high affinities, specificity, and internalization potentials (Fig 1C), will be paired with anti-E3 ligase mAbs targeting either RNF43 or ZNRF3. These bispecific antibody constructs are constructed using Cross-mAb technology together with the knob-into-hole platform to construct antibodies targeting SLC13A3 and the selected E3 ligase. Constructs will be expressed, purified, and confirmed for dual specificity and binding kinetics using BLI and conformational binding using FACS. Binding will be assessed on cells expressing either or both target proteins to ensure that the bsAbs retain high-affinity interactions with SLC13A3 and the E3 ligase. Constructs will also be evaluated to determine if they induce internalization of the SLC13A3-E3 complex, a prerequisite for efficient degradation. The inventors will treat SLC13A3OE tumor cell lines with the bsAbs and measure SEC 13 A3 protein levels over time using WB and FACS to assess functional activity. Using proteasome inhibitors (e.g., MG132) will confirm that degradation is mediated through the ubiquitin-proteasome system. They will also evaluate the specificity of degradation by comparing effects in SLC13A3hlghversus SLC13A3~'~ cell lines and by assessing off-target effects on unrelated membrane proteins. They will also evaluate the impact of PROTAB-based SLC13A3 degradation on the itaconate transporter assay, ferroptosis resistance, MHC-I expression, T cell killing assay, and the in vivo impact on tumor progression.

[0399] 74

[0400] 4932-3873-8280, v. 1 Table 1. Table denoting the characterization of synthetic biotinylated peptides. Table 2. Table denoting the Fc-fusion protein construct bearing the sequence Of SLC13A3 ECL 1-6.

[0401] 75

[0402] 4932-3873-8280, v. 1 Table 3. Table of calculated ECso values of SLC13A3 antibodies

[0403] 76

[0404] 4932-3873-8280, v. 1 Table 4. Table denoting the calculated KD values of SLC13A3 antibodies.

[0405] 77

[0406] 4932-3873-8280, v. 1 Table 5A. DNA sequences of antibody heavy chain CDRs

[0407] 4932-3873-8280, v 1 78

[0408] Table 5B. DNA sequences of antibody light chain CDRs

[0409] 79

[0410] 4932-3873-8280, v. 1 Table 6A. Table denoting the respective amino acid sequences of each heavy chain CDR of antibodies.

[0411] 80

[0412] 4932-3873-8280, v. 1 Table 6B. Table denoting the respective amino acid sequences of each light chain CDR of antibodies.

[0413] 4932-3873-8280, v. 1 81 Table 7. Table denoting the respective nucleotide sequences of CDRs of E3-Ligase reference antibodies

[0414] 5 Table 8. Table denoting the respective amino acid sequences of E3-Ligase reference antibodies.

[0415] 82

[0416] 4932-3873-8280, v 1

[0417] Example 3 - Discussion

[0418] In this work the inventors have explored endogenous cellular and molecular mechanisms by which endow tumor cell resistance to ferroptosis and protect tumor cells from immune-mediated ferroptotic killing in the TME. They have unexpectedly discovered that TAMs protect tumor cells from ferroptosis, thereby enabling tumor resistance to ICB via the SLC13A3-itaconate-NRF2-SLC7Al 1 axis.

[0419] The SLC13 family is a group of cell membrane transporters importing di- and tricarboxylate Krebs cycle intermediates (Bergeron et al., 2013). Interestingly, the inventors discover that SLC13A3, but not other SLC13 family members, is highly and selectively expressed in various tumors and negatively correlated with ICB efficacy and clinical outcomes in several cohorts of patients from different hospitals (including the inventors’ own institutions) across multiple cancer types. Moreover, the inventors have identified that SLC13A3 is a transporter for itaconate in tumor cells and that endows tumor cell resistance to ferroptosis via distinct molecular mechanisms. The expression pattern, selectivity, and functional importance of SLC13A13 suggest that SLC13A13 is a promising immune metabolic checkpoint for cancer therapy. They have examined this possibility in tumor bearing animal models and in patients with cancer receiving ICB. Human SLC13A3 and SLC13A5 share 48% amino acid sequences. Given the unknown structure of SLC 13A3, based on the crystal structure of SLC13A5 and molecular docking analysis (Sauer et al., 2021), the inventors have identified a competitive inhibitor for SLC13A3 (SLC13A3i). SLC13A3i monotherapy can treat ICB resistant tumor and the combination of SLC13A3i and ICB results in a potent inhibition of tumor progression and bolsters the effectiveness of ICB in murine models. The anti-tumor effect of SLC13A3i relies on tumor SLC13A3 and host ACOD1. Thus, the inventors’ work demonstrates that SLC13A3 is a previously undefined itaconate transporter in tumors, a potential therapeutic target, and a disease biomarker for treating SLC13A3+cancers. The biochemical, immunological, and therapeutic insights the inventors have gained on SLC13A3i, may pave the way for testing, improving, and designing SLC13A3 inhibitors (or blocking antibody) in future studies and clinical trials.

[0420] Itaconate has been relatively well-studied in the context of inflammation and bacterial infection (Nair et al., 2018; O’Neill & Artymov, 2019). Recent studies have emphasized the pro-tumor effects of several metabolites in the TME (Zou & Green, 2023; Notarangelo et al., 2022; Cheng et al., 2023; Rowe et al., 2023).’ In support of this line of scientific development, the inventors have detected high levels of itaconate in the TME. Moreover, they have found

[0421] 83

[0422] 4932-3873-8280, v. 1 that TAMs are the major sources of itaconate in the TME in mouse tumors and several human cancer types. Several studies have shown the pro-tumor effect of itaconate (Weiss et

[0423] Chen et al. , 2023; Zhao et al. , 2022; 2023; Gu et al. , 2023). Although it is unclear how T cells import itaconate, it seems that itaconate can be up taken by activated murine CD8+T cells, thereby inhibiting T cell proliferation and function (Chen et al., 2023). In addition, neutrophils can express high levels of ACOD1 (IRG1), producing and consuming their own intracellular itaconate, leading to neutrophil accumulation and promoting tumor metastasis (Zhao et al. , 2022). Prior to the current work, it is unknown if and how tumor cells consume itaconate in the TME and what is the immunopathological consequence of tumor consummation of itaconate. The inventors’ study at least partly addresses these questions. The inventors demonstrate that itaconate transporter SLC13A3 is predominantly and functionally expressed in both human and mouse tumor cells, allowing tumor cells to efficiently uptake exogenous itaconate from TAMs to escape from ferroptotic cell death. Thus, they reveal a previously unreported immune evasion and ICB resistant mechanism by which the interplay between TAMs and tumor cells endows tumor ferroptosis resistance via SLC13A3.

[0424] The inventors have assessed the underlying mechanisms involved in crosstalk between TAMs and tumor cells via the itaconate-SLC13A3 axis. It has been reported that itaconate is in macrophage cytosol and binds to the cysteine residue of Kelch-like ECH- associated protein 1 (KEAP1), leading to the activation of NRF2 in macrophages (Mills et al., 2018). NRF2 is the master transcriptional factor that regulates the antioxidant gene network (Rojo de la Vega et al. , 2018). Consistent with the study on macrophages (Mills et al., 2018), the inventors show that itaconate can activate the NRF2-SLC7A11 axis in tumor cells, thereby endowing tumor cell resistance to ferroptosis. Notably, differed from macrophages (Mills et al., 2018), they demonstrate that tumor cells do not produce itaconate by themselves, rather import extracellular itaconate from TAMs via SEC 13 A3. This further enforces the notion that the interplay between TAMs and tumor cells is critical for programming the tumor immune microenvironment and ICB response. In this vein, it is reported that ICB triggers tumor ferroptosis, shaping the fate of tumor cells and the efficacy of ICB (Wang el al., 2019; Liao el al. , 2022; Lang et al., 2019; Shi et al. , 2022; Efimova et al. 2020). Indeed, activated immune cell derived IFNy and specific fatty acids are endogenous ferroptosis inducers in vivo during ICB and radiation therapy (Wang et al., 2019; Liao et al. , 2022; Lang et al., 2019). Given that most patients are not responsive to ICB, the inventors’ current work suggests an intriguing possibility that the acquisition of ferroptosis resistance via SLC13A3 contributes to ICB

[0425] 84

[0426] 4932-3873-8280, v. 1 resistance. Thus, SLC13A3 builds a metabolic bridge between TAMs and tumor cells, resulting in tumor escape from ferroptosis and thereby causing ICB resistance. In summary, this work unveils that the SLC13A3-itaconate-NRF2-SLC7AH axis is a previously unknown immune evasion mechanism in the TME and identifies that SLC13A3 is a promising target for combating cancer.

[0427] All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this disclosure have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.

[0428] 85

[0429] 4932-3873-8280, v. 1 V. REFERENCES

[0430] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.

[0431] Zou, W., Wolchok, J. D., & Chen, L. (2016). Science translational medicine, 8(32 ), 328rv4. Kalbasi, A., & Ribas, A. (2020). Nature reviews. Immunology, 20(1), 25-39.

[0432] Pitt et al. (2016). Annals of oncology: official journal of the European Society for Medical Oncology, 27(3), 1482-1492.

[0433] Zou, W., & Green, D. R. (2023). Cell metabolism, 35(7), 1101-1113.

[0434] Chapman, N. M., & Chi, H. (2022). Immunity, 55(1), 14-30.

[0435] O'Sullivan et al. (2019). Nature reviews. Immunology, 19(5), 324-335.

[0436] Kao et al. (2022). Nature cell biology, 24(11), 1574-1583.

[0437] Notarangelo et al. (2022). Science (New York, N. Y.), 577(6614), 1519-1529.

[0438] Cheng et al. (2023). Cell metabolism, 55(6), 961-978. elO.

[0439] Rowe et al. (2023). Cancer discovery, 13( 12), 2566-2583.

[0440] Amer, E. N., & Rathmell, J. C. (2023). Cancer cell, 41(3), 421-433.

[0441] Macintyre et al. (2014). Cell metabolism, 20(1), 61-72.

[0442] Reinfeld et al. (2021). Nature, 595(7858), 282-288.

[0443] Wang et al. (2019). Nature, 569(7755), 270-274

[0444] Bian et al. (2020). Nature, 585(7824), 277-282.

[0445] Wang, W., & Zou, W. (2020). Molecular cell, 80(3), 384-395.

[0446] Bergeron et al. (2013). Molecular aspects of medicine, 34(2-3), 299-312

[0447] Nair et al. (2018). The Journal of experimental medicine, 215(4), 1035-1045.

[0448] Michelucci et al. (2013). Proceedings of the National Academy of Sciences of the United States of America, 110(19), 7820-7825.

[0449] O'Neill, L. A. J., & Artyomov, M. N. (2019). Nature reviews. Immunology, 19(5), 273-281.

[0450] Dixon et al. (2012). Cell, 149(5), 1060-1072.

[0451] Liao et al. (2022). Cancer cell, 40( ), 365-378. e6.

[0452] Bell, H. N., & Zou, W. (2024). Annual review of immunology, 10.1146 / annurev-immunol- 101819-024752. Advance online publication.

[0453] Liu et al. (2019). Nature medicine, 25(12), 1916-1927.

[0454] Tirosh et a / . (2016). Science (New York, N. Y), 552(6282), 189-196.

[0455] 86

[0456] 4932-3873-8280, v. 1 Jerby-Amon et al. (2018). Cell, 175(4), 984-997.e24.

[0457] Zhang et al. (2020). Cell, 181(2), 442-459.e29.

[0458] Lang et al. (2019). Cancer discovery’, 9(12), 1673-1685.

[0459] Rojo de la Vega et al. (2018). Cancer cell, 34(1), 21-43.

[0460] Sun et al. (2016). Hepatology (Baltimore, Md.), 63(1), 173-184.

[0461] Roh et al. (2017). Redox biology, 11, 254-262.

[0462] Dong et al. (2021). Cell death & disease, 12(11), 1027.

[0463] Hooftman, A., & O'Neill, L. A. J. (2019). Trends in immunology, 40(8), 687-698.

[0464] McGettrick, A. F., & O'Neill, L. A. (2023). Current opinion in immunology, 80, 102268.

[0465] Murphy, M. P., & O’Neill, L. A. J. (2018). Krebs Cycle Reimagined: The Emerging Roles of Succinate and Itaconate as Signal Transducers. Cell, 174(4), 780-784.

[0466] Cordes et al. (2015). Annual review of nutrition, 35, 451-473.

[0467] Sauer et al. (2021). Nature, 597(7848), 157-161.

[0468] Vilar, S., Cozza, G., & Moro, S. (2008). Current topics in medicinal chemistry’, <3(18), 1555— 1572.

[0469] Weiss et al. (2018). The Journal of clinical investigation, 128(9), 3794-3805.

[0470] Chen, et al. (2023). Science advances, 9(17), eadg0654.

[0471] Zhao et al. (2022). Nature metabolism, 4(12), 1660-1673.

[0472] Zhao et al. (2023). Cell metabolism, 35(10), 1688-1703. elO.

[0473] Gu et al. (2023). Nature communications, 14(1), 8154.

[0474] Mills et al. (2018). Nature, 556(1699), 113-117.

[0475] Shi et al. (2022). The FEBS journal, 289(13), 3655-3665.

[0476] Efimova et al. (2020). Journal for immunotherapy of cancer, 8(2), e001369.

[0477] Robinson et al. (2017). Nature, 548(1661), 297-303.

[0478] Eisenhauer et al. (2009). European journal of cancer (Oxford, England: 1990), 45(2), 228- 247.

[0479] Cui et al. (2013). Immunity, 39(3), 611-621.

[0480] Lin et al. (2018). The Journal of clinical investigation, 128(2), 805-815.

[0481] Tanikawa et al. (2012). Cancer research, 72(2), 420-429.

[0482] Boj et al. (2015). Cell, 160(1-2), 324-338.

[0483] Yang et al. (2023). JHEP reports: innovation in hepatology, 5(4), 100672.

[0484] Zhang et al. (2022). Nature communications, 73(1), 7250.

[0485] 87

[0486] 4932-3873-8280, v. 1

Claims

1. WHAT IS CLAIMED IS:

1. An isolated monoclonal antibody or an antigen-binding fragment thereof comprising a heavy chain (HC) variable region (VH) and a light chain (LC) variable region (VL) comprising clone-paired CDR sequences as set forth in Table 6; and variants thereof wherein one or more of the HC-CDRs and / or LC-CDRs has one, two, or three amino acid substitutions, additions, deletions, or combinations thereof.

2. The isolated monoclonal antibody or an antigen binding fragment thereof of claim 1 , wherein the isolated monoclonal antibody is a murine, a rodent, a rabbit, a chimeric, humanized, or human antibody.

3. The isolated monoclonal antibody or an antigen-binding fragment thereof of claim 1, wherein the antigen-binding fragment is a recombinant ScFv (single chain fragment variable) antibody, Fab fragment, F(ab’)2 fragment, or Fv fragment.

4. The isolated monoclonal antibody or an antigen binding fragment thereof of claim 1, wherein the isolated monoclonal antibody is a human antibody.

5. The isolated monoclonal antibody or an antigen-binding fragment thereof of claim 1, wherein the VH and VL chains have amino acid sequences at least 90% or 95% identical to clone-paired sequences of Appendix II.

6. The isolated monoclonal antibody or an antigen-binding fragment thereof of claim 1, wherein the VH and VL chains are encoded by nucleic acid sequences at least 80% or 90% identical to clone-paired sequences of Appendix I.

7. The isolated monoclonal antibody or an antigen-binding fragment thereof of claim 5, wherein the VH and VL chains have amino acid sequences identical to clone-paired sequences of Appendix II.884932-3873-8280, v.

18. The isolated monoclonal antibody or an antigen binding fragment thereof of claim 5, wherein the VH and VL chains are encoded by nucleic acid sequences identical to clone-paired sequences of Appendix I.

9. The isolated monoclonal antibody or an antigen binding fragment thereof of claims 1- 8, wherein the isolated monoclonal antibody is a humanized antibody or a chimeric antibody.

10. The isolated monoclonal antibody or an antigen binding fragment thereof of claim 1, wherein the antibody is a bispecific antibody, such as a bispecific antibody having binding to both SLC13A3 and an E3 ligase (e.g., RNF43, ZNRF3).

11. The isolated monoclonal antibody or an antigen binding fragment thereof of claim 1 , which suppresses the activity of SLC13A3.

12. The isolated monoclonal antibody or an antigen binding fragment thereof of claim 1, which prevents binding of itaconate to SLC13A3.

13. An isolated monoclonal antibody or an antigen-binding fragment thereof, which competes for the same epitope with the isolated monoclonal antibody or an antigenbinding fragment thereof according to any of claims 1-12.

14. A pharmaceutical composition comprising the isolated monoclonal antibody or an antigen-binding fragment thereof according to any one of claims 1-13, and a pharmaceutically acceptable carrier.

15. An isolated nucleic acid that encodes the isolated monoclonal antibody according to any one of claims 1-13.

16. A vector comprising the isolated nucleic acid of claim 15.

17. A host cell comprising the vector of claim 16.

18. The host cell of claim 17, wherein the host cell is a mammalian cell.894932-3873-8280, v.

119. The host cell of claim 17, wherein the host cell is a CHO cell.

20. A hybridoma or engineered cell encoding and / or producing the isolated monoclonal antibody according to any one of claims 1-13.

21. A process of producing an antibody, comprising culturing the host cell of claim 17 under conditions suitable for expressing the antibody, and recovering the antibody.

22. A chimeric antigen receptor (CAR) protein comprising an antigen-binding fragment according to any one of claims 1-13.

23. An isolated nucleic acid that encodes a CAR protein of claim 22.

24. A vector comprising the isolated nucleic acid of claim 23.

25. An engineered cell comprising the isolated nucleic acid of claim 23.

26. The engineered cell of claim 25, wherein the cell is a T cell, NK cell, or macrophage.

27. A method of treating or ameliorating the effect of a cancer in a subject, inhibiting the progression of cancer in a subject, or inhibiting the growth of a cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of the antibody or an antigen-binding fragment thereof according to any one of claims 1 - 13 or the engineered cell of claims 25 or 26.

28. The method of claim 27, wherein the method reduces or eradicates the tumor burden in the subject.

29. The method of claim 27, wherein the method reduces the number of tumor cells and / or slows tumor growth rate.

30. The method of claim 27, wherein the method reduces tumor size.

31. The method of claim 27, wherein the method reduces or prevents tumor metastasis.904932-3873-8280, v.

132. The method of claim 27, wherein the method eradicates the tumor in the subject.

33. The method of claim 27, wherein the cancer is a solid cancer.

34. The method of claim 33, wherein the solid cancer is selected from the group consisting of adrenal cancer, bile duct carcinoma, bone cancer, brain cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, colorectal cancer, esophageal cancer, eye cancer, gastric cancer, glioblastoma, head and neck cancer, kidney cancer, liver cancer, lung cancer, mesothelioma, melanoma, merkel cell cancer, nasopharyngeal carcinoma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, penile cancer, pinealoma, prostate cancer, renal cell cancer, retinoblastoma, sarcoma, skin cancer, testicular cancer, thymic carcinoma, thyroid cancer, uterine cancer, and vaginal cancer.

35. The method of claim 27, wherein the monocytes, macrophages, dendritic cells, neutrophils and other myeloid cells, myeloid-derived suppressor cells, and tumor- associated macrophages are targeted.

36. The method of claim 27, wherein the cancer is a hematologic malignancy.

37. The method of claim 36, wherein the hematologic malignancy is selected from the group consisting of acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), B-cell leukemia, chronic lymphoblastic leukemia (CLL), blastic plasmacytoid dendritic cell neoplasm (BPDCN), chronic myelomonocytic leukemia (CMML), chronic myelocytic leukemia (CML), pre-B acute lymphocytic leukemia (Pre-B ALL), diffuse large B-cell lymphoma (DLBCL), extranodal NK / T-cell lymphoma, hairy cell leukemia, heavy chain disease, HHV8-associated primary effusion lymphoma, plasmablastic lymphoma, primary CNS lymphoma, primary mediastinal large B-cell lymphoma, T-cell / histiocyte-rich B-cell lymphoma, Hodgkin’s lymphoma, nonHodgkin’s lymphoma, Waldenstrom's macroglobulinemia, multiple myeloma (MM), myelodysplastic syndromes (MDS), myeloproliferative neoplasms, and polycythemia vera.4932-3873-8280, v. 1 9138. The method of claim 27, wherein the antibody or an antigen-binding fragment thereof is administered intravenously, intra-arterially, intra-tumorally, or subcutaneously.

39. The method of claim 27, further comprising administering to the subject one or more drugs selected from the group consisting of a topoisomerase inhibitor, an anthracycline topoisomerase inhibitor, an anthracycline, a daunorubicin, a nucleoside metabolic inhibitor, a cytarabine, a hypomethylating agent, a low dose cytarabine (LDAC), a combination of daunorubicin and cytarabine, a daunorubicin and cytarabine liposome for injection, Vyxeos®, an azacytidine, Vidaza®, a decitabine, an all-trans-retinoic acid (ATRA), an arsenic, an arsenic trioxide, a histamine dihydrochloride, Ceplene®, an interleukin-2, an aldesleukin, Proleukin®, a gemtuzumab ozogamicin, Mylotarg®, an FLT-3 inhibitor, a midostaurin, Rydapt®, a clofarabine, a farnesyl transferase inhibitor, a decitabine, an IDH1 inhibitor, an ivosidenib, Tibsovo®, an IDH2 inhibitor, an enasidenib, Idhifa®, a smoothened (SMO) inhibitor, a glasdegib, an arginase inhibitor, an IDO inhibitor, an epacadostat, a BCL-2 inhibitor, a venetoclax, Venclexta®, a platinum complex derivative, oxaliplatin, a kinase inhibitor, a tyrosine kinase inhibitor, a PI3 kinase inhibitor, a BTK inhibitor, an ibrutinib, IMBRUVICA®, an acalabrutinib, CALQUENCE®, a zanubrutinib, a PD-1 antibody, a PD-L1 antibody, a CTLA-4 antibody, a LAG3 antibody, an ICOS antibody, a TIGIT antibody, a TIM3 antibody, a CD40 antibody, a 4-1BB antibody, a CD47 antibody, a SIRPla antibody or fusions protein, a CD70 antibody, and CLL1 antibody, a CD 123 antibody, an antagonist of E- selectin, an antibody binding to a tumor antigen, an antibody binding to a T-cell surface marker, an antibody binding to a myeloid cell or NK cell surface marker, an alkylating agent, a nitrosourea agent, an antimetabolite, an antitumor antibiotic, an alkaloid derived from a plant, a hormone therapy medicine, a hormone antagonist, an aromatase inhibitor, and a P-glycoprotein inhibitor.

40. The method according to any of claims 27-39, wherein said isolated monoclonal antibody or an antigen binding fragment thereof further comprises an antitumor drug linked thereto.

41. The method of claim 40, wherein said antitumor drug is linked to said antibody through a photolabile linker.924932-3873-8280, v.

142. The method of claim 40, wherein said antitumor drug is linked to said antibody through an enzymatically-cleaved linker.

43. The method of claim 40, wherein said antitumor drug is a toxin, a radioisotope, a cytokine, or an enzyme.

44. A method of detecting a cancer cell or cancer stem cell in a sample or subject comprising:(a) contacting a subject or a sample from the subject with the antibody or an antigen-binding fragment thereof according to any one of claims 1-13; and(b) detecting binding of said antibody to a cancer cell or cancer stem cell in said subject or sample.

45. The method of claim 44, wherein the sample is a body fluid or biopsy.

46. The method of claim 44, wherein the sample is blood, bone marrow, sputum, tears, saliva, mucous, serum, urine or feces.

47. The method of claim 44, wherein detection comprises immunohistochemistry, flow cytometry, an immunoassay (including ELISA, RIA, etc.) or Western blot.

48. The method of claim 44, further comprising performing steps (a) and (b) a second time and determining a change in detection levels as compared to the first time.

49. The method of claim 44, wherein said isolated monoclonal antibody or an antigen binding fragment thereof further comprises a label.

50. The method of claim 49, wherein said label is a peptide tag, an enzyme, a magnetic particle, a chromophore, a fluorescent molecule, a chemo-luminescent molecule, or a dye.934932-3873-8280, v.

151. The method according to any of claims 27-50, wherein said isolated monoclonal antibody or an antigen binding fragment thereof is conjugated to a liposome or nanoparticle.

52. A method of treating or ameliorating the effect of a cancer in a subject, inhibiting the progression of cancer in a subject, or inhibiting the growth of a cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a compound of the formula:wherein:Ri is amino, cyano, halo, hydroxy, alkylci-8, substituted alkylci-s, alkenylc2-8, substituted alkenylc2-8, cycloalkylc3-8, substituted cycloalkylc3-8, arylce- 12, substituted arylce-12, aralkylc7-i2, substituted aralkylc7-i2, heteroarylci-8, substituted heteroarylci-8, heterocycloalkylci-8, substituted heterocycloalkylci-s, acylci-s, substituted acylci-s, alkoxyci- s, substituted alkoxyci-8, alkylaminoci-s, substituted alkylaminoci-s, dialkylaminoc-12, or substituted dialkylaminoc-12;R2 and R3 are each independently selected from CTbORj, C(O)ORb, or C(O)NRcRc ; andRa, Rb, Rc, and Rc' are each independently selected from hydrogen, alkylci-s, substituted alkylci-8, cycloalkylc3-i2, substituted cycloalkylc3-i2, alkenylc2-8, substituted alkenylc2-8, arylce-12, or substituted arylce-12; and n is 1, 2, 3, or 4; or a pharmaceutically acceptable salt thereof.

53. The method of claim 52, wherein the compound is further defined as:wherein:Ri is amino, cyano, halo, hydroxy, alkylci-8, substituted alkylci-8, alkenylc2-s, substituted alkenylc2-8, cycloalkylc3-8, substituted cycloalkylc3-8, arylce- 12, substituted arylce-12, aralkylc7-i2, substituted aralkylc7-i2,4932-3873-8280, v. 1 94heteroarylci-8, substituted heteroarylci-s, heterocycloalkylci-s, substituted heterocycloalkylci-s, acylci-8, substituted acylci-8, alkoxyci- 8, substituted alkoxyci-s, alkylaminoci-s, substituted alkylaminoci-x, dialkylaminoc-12, or substituted dialkylaminoc-12; andR2 and R3 are each independently selected from CThOR.,, C(O)ORt>, or C(O)NRcRc ; andRa, Rb, Rc, and Rc- are each independently selected from hydrogen, alkylci-8, substituted alkylci-8, cycloalkylc3-i2, substituted cycloalkylc3-i2, alkenylc2-s, substituted alkenylc2-8, arylc6-i2, or substituted arylc6-i2j or a pharmaceutically acceptable salt thereof.

54. The method of either claim 52 or claim 53, wherein Ri is alkoxyci-s or substituted alkoxyci-s-55. The method of either claim 52 or claim 54, wherein n is 1.

56. The method according to any one of claims 52-55, wherein R2 is C(O)ORb.

57. The method of claim 56, wherein Rb is hydrogen.

58. The method according to any one of claims 52-57, wherein R3 is C(O)ORb.

59. The method of claim 58, wherein Rb is hydrogen.

60. The method according to any one of claims 52-59, wherein the compound is further defined as:or a pharmaceutically acceptable salt thereof.

61. The method according to any one of claims 52-60, wherein the compound is further defined as:or a pharmaceutically acceptable salt thereof.954932-3873-8280, v.

162. The method according to any one of claims 52-61, wherein the method further comprises a second therapeutic agent.

63. The method of claim 62, wherein the second therapeutic agent is an anti-PD-Ll therapy.

64. The method of claim 63, wherein the anti-PD-Ll therapy is an anti-PD-Ll antibody.

65. A method of inhibiting the activity of SLC 13 A3 comprising contacting SLC 13 A3 with a compound of the formula:wherein:Ri is amino, cyano, halo, hydroxy, alkylci-s, substituted alkylci-s, alkenyltv-x, substituted alkenylc2-8, cycloalkylc3-8, substituted cycloalky levs, arylce- 12, substituted arylce-12, aralkylc7-i2, substituted aralkylc7-i2, heteroarylci-8, substituted heteroarylci-8, heterocycloalkylci-8, substituted heterocycloalkylci-s, acylci-s, substituted acylci-s, alkoxyci- 8, substituted alkoxyci-8, alkylaminoci-s, substituted alkylaminoci-s, dialkylaminoc i2, or substituted dialkylaminoc-12;R2 and R3 are each independently selected from CTLORj, C(O)ORb, or C(O)NRcRc ; andRa, Rb, Rc, and Rc- are each independently selected from hydrogen, alkylci-8, substituted alkylci-8, cycloalkylc3-i2, substituted cycloalkylc3-i2, alkenylc2-8, substituted alkenylc2-8, arylce-12, or substituted arylce-12; and n is 1 , 2, 3, or 4; or a pharmaceutically acceptable salt thereof.

66. The method of claim 65, wherein the SLC 13 A3 is contacted in a patient.

67. The method of claim 65, wherein the SLC 13 A3 is contacted in vitro.

68. The method according to any one of claims 65-67, wherein the compound is further defined as:964932-3873-8280, v. 1or a pharmaceutically acceptable salt thereof.

69. The method according to any one of claims 65-68, wherein the compound is further defined as:CO2H,H or a pharmaceutically acceptable salt thereof.974932-3873-8280, v. 1

Citation Information

Patent Citations

  • Antibodies against interleukin-1 beta

    US20100183616A1

  • Magea3 binding antibodies

    US20140186363A1

  • CD20 therapies, CD22 therapies, and combination therapies with a CD19 chimeric antigen receptor (CAR)- expressing cell

    US20160362472A1

  • Antibody-drug conjugates for targeting CD56-positive tumors

    US20180214568A1

  • Antigen-binding proteins targeting CD56 and uses thereof

    US20180230214A1