Individualized neoantigen vaccines for the treatment of non-small cell lung cancer
Combining individualized neoantigen vaccines with immune checkpoint inhibitors in a sequential treatment regimen addresses the limitations of current therapies for NSCLC, enhancing tumor-specific immune responses and improving patient outcomes.
Patent Information
- Application Number
- PCT/US2025/046733
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-18
- Filing Date
- 2025-09-17
- Publication Date
- 2026-03-26
AI Technical Summary
Current cancer immunotherapy approaches, such as checkpoint inhibitors, often fail to provide a significant response in many patients with non-small cell lung cancer (NSCLC), highlighting an unmet need for more effective treatments.
A combination therapy involving individualized neoantigen vaccines and immune checkpoint inhibitors, administered before and after surgical resection of the tumor, where the vaccine comprises an mRNA polynucleotide encoding tumor-specific neoepitopes formulated in a lipid delivery vehicle.
Enhances the immune response against tumor-specific mutations, potentially improving clinical outcomes and preventing recurrence of NSCLC by leveraging personalized immune responses.
Smart Images

Figure US2025046733_26032026_PF_FP_ABST
Abstract
Description
[0001] 131986-7101
[0002] INDIVIDUALIZED NEOANTIGEN VACCINES FOR THE TREATMENT OF NON-SMALL CELL LUNG CANCER
[0003] CROSS-REFERENCE TO RELATED APPLICATIONS
[0004] The present application claims priority to U.S. Provisional Application No. 63 / 696,264, filed September 18, 2024, the entire contents of which are incorporated herein by reference.
[0005] SEQUENCE LISTING
[0006] The present application contains a Sequence Listing submitted electronically in XML format and s hereby incorporated by reference in its entirety. Said XML file, created on September 15, 2025, is named “131986-7101_SL.xml” and is 351,724 bytes in size.
[0007] BACKGROUND
[0008] Recent breakthroughs in cancer immunotherapy (e.g., checkpoint inhibitors and chimeric antigen receptor-T cell therapies) have demonstrated that powerful anti-tumor responses can be achieved by activating large numbers of T cells in a variety of cancer settings. Several checkpoint inhibitor biologic agents (e.g., anti-CTLA-4 [anti-cytotoxic T lymphocyte-associated antigen-4], anti-PD-1 [anti-programmed cell death protein 1], and anti-PD-Ll [anti-programmed death-ligand 1]) are currently approved for human use in several cancer types, including metastatic melanoma, non-small cell lung carcinoma and bladder carcinoma. These inhibitory receptors and their ligands play complementary roles in down-regulating adaptive immunity; PD-1 / PD-L1 contributes to T cell exhaustion in peripheral tissues (Sharma and Allison 2015). Though single agent checkpoint inhibitor therapy can provide significant benefit for some patients, many patients have incomplete or no response to therapy presenting a clear unmet need.
[0009] SUMMARY
[0010] Provided herein are individualized neoantigen therapies for the treatment of non-small cell lung cancer (NSCLC). The therapies include individualized neoantigen vaccines specific to mutations present in a subject’s tumor and an immune checkpoint inhibitor. Also provided are methods of inducing an immune response to a NSCLC tumor in a subject, e.g., by administering an individualized neoantigen vaccine and an immune checkpoint inhibitor to the subject, optionally following surgical resection of the tumor. In some embodiments, the subject is additionally administered a neoadjuvant therapy (e.g., an immune checkpoint inhibitor and chemotherapy).
[0011] The disclosure, in some aspects, provides a method of treating non-small cell lung cancer (NSCLC) in a subject, the method comprising: identifying a subject with NSCLC that has received 131986-7101 a neoadjuvant therapy prior to undergoing a surgical resection of a tumor; and administering to the subject an effective amount of an adjuvant therapy after the surgical resection, wherein the adjuvant therapy comprises administering an immune checkpoint inhibitor and administering an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle.
[0012] Some aspects of the disclosure provide a method of treating non-small cell lung cancer (NSCLC) in a subject, the method comprising administering to the subject a neoadjuvant therapy prior to a surgical resection of a tumor in the subject; and administering to the subject an effective amount of an adjuvant therapy after the surgical resection, wherein the adjuvant therapy comprises administering an immune checkpoint inhibitor and administering an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle.
[0013] In some embodiments, the NSCLC is resectable Stage II, IIIA, or IIIB (N2) NSCLC. In some embodiments, the NSCLC is squamous cell NSCLC or non-squamous cell NSCLC.
[0014] In some embodiments, the tumor of the subject does not comprise a tumor-activating epidermal growth factor receptor (EGFR) mutation. In some embodiments, the tumor of the subject has a tumor proportion score (TPS) of < about 50%. In some embodiments, the tumor of the subject has a TPS of > about 50%.
[0015] In some embodiments, the neoadjuvant therapy is administered at three-week intervals; optionally wherein the neoadjuvant therapy is administered for about 2-6 cycles. In some embodiments, the neoadjuvant therapy comprises chemotherapy and administering the immune checkpoint inhibitor.
[0016] In some embodiments, the chemotherapy is platinum-based doublet chemotherapy. In some embodiments, the chemotherapy comprises administering one or more chemotherapeutic agents selected from the group consisting of: cisplatin, carboplatin, pemetrexed, gemcitabine, and paclitaxel. In some embodiments, if the subject has non-squamous cell NSCLC, the chemotherapeutic agents comprise cisplatin and pemetrexed or carboplatin and pemetrexed; or if the subject has squamous cell NSCLC, the chemotherapeutic agents comprise cisplatin and gemcitabine or carboplatin and gemcitabine. In some embodiments, the chemotherapeutic agents comprise cisplatin and paclitaxel or carboplatin and paclitaxel. 131986-7101
[0017] In some embodiments, the method further comprises the surgical resection and surgical resection is performed within about 20 weeks of administering a first dose of the neoadjuvant therapy and within 8 weeks after administering a last dose of the neoadjuvant therapy. In some embodiments, the surgical resection is an R0 resection or an R1 resection. In some embodiments, the surgical resection is an R1 resection and the subject is administered radiation therapy. In some embodiments, the subject has not achieved a pathological complete response (pCR) following the surgical resection. In some embodiments, the subject does not have apparent disease in an image taken after the surgical resection.
[0018] In some embodiments, the immune checkpoint inhibitor is an anti-PD-1 antibody, optionally wherein the anti-PD-1 antibody comprises light chain complementarity determining regions (CDRs) comprising a sequence of amino acids as set forth in SEQ ID NOs: 43, 44 and 45 and heavy chain CDRs comprising a sequence of amino acids as set forth in SEQ ID NOs: 48, 49 and 50; a light chain variable region comprising SEQ ID NO: 46 and a heavy chain variable region comprising SEQ ID NO: 51; and / or a light chain comprising SEQ ID NO: 47 and a heavy chain comprising SEQ ID NO: 52. In some embodiments, the immune checkpoint inhibitor is pembrolizumab.
[0019] In some embodiments, the immune checkpoint inhibitor of the neoadjuvant therapy is administered to the subject at a dose of about 100-300 mg per administration. In some embodiments, the immune checkpoint inhibitor of the neoadjuvant therapy is administered to the subject at a dose of about 200 mg per administration. In some embodiments, the immune checkpoint inhibitor of the neoadjuvant therapy is administered every three weeks.
[0020] In some embodiments, the chemotherapeutic agents comprise cisplatin, and wherein about 30 to about 80 mg / m2cisplatin is administered every three weeks. In some embodiments, about 38, about 56 or about 75 mg / m2cisplatin is administered.
[0021] In some embodiments, the chemotherapeutic agents comprise pemetrexed, and wherein about 200 to about 600 mg / m2pemetrexed is administered every three weeks. In some embodiments, about 250, about 375 or about 500 mg / m2pemetrexed is administered.
[0022] In some embodiments, the chemotherapeutic agents comprise carboplatin, and wherein AUC of about 2 to about 7 mg / mL-min carboplatin is administered once every three weeks. In some embodiments, AUC of about 2.5, about 3, about 3.75, about 4.5, about 5 or about 6 mg / mL-min carboplatin is administered.
[0023] In some embodiments, the chemotherapeutic agents comprise gemcitabine, and wherein about 500 to about 1300 mg / m2gemcitabine is administered every three weeks. In some 131986-7101 embodiments, about 500, about 600, about 750, about 900, about 1000 or about 1250 mg / m2gemcitabine is administered.
[0024] In some embodiments, the chemotherapeutic agents comprise paclitaxel and wherein about 50 mg / m2to about 300 mg / m2paclitaxel is administered every three weeks. In some embodiments, about 100, about 150, about 175 or about 200 mg / m2paclitaxel is administered.
[0025] In some embodiments, the subject has non-squamous cell NSCLC, wherein the chemotherapeutic agents comprise cisplatin and pemetrexed, and wherein about 75 mg / m2cisplatin and about 175 or about 200 mg / m2pemetrexed are administered every three weeks. In some embodiments, the subject has non-squamous cell NSCLC, wherein the chemotherapeutic agents comprise carboplatin and pemetrexed, and wherein AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 175 or about 200 mg / m2pemetrexed are administered every three weeks.
[0026] In some embodiments, the subject has squamous cell NSCLC, wherein the chemotherapeutic agents comprise cisplatin and gemcitabine, and wherein about 75 mg / m2cisplatin and about 1000 mg / m2or about 1250 mg / m2gemcitabine are administered every three weeks. In some embodiments, the subject has squamous cell NSCLC, wherein the chemotherapeutic agents comprise carboplatin and gemcitabine, and wherein about AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 1000 mg / m2or about 1250 mg / m2gemcitabine are administered every three weeks.
[0027] In some embodiments, the chemotherapeutic agents comprise cisplatin and paclitaxel, and wherein about 75 mg / m2cisplatin and about 175 mg / m2or about 200 mg / m2paclitaxel are administered every three weeks. In some embodiments, the chemotherapeutic agents comprise carboplatin and paclitaxel, and wherein about AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 175 mg / m2or about 200 mg / m2paclitaxel are administered every three weeks.
[0028] In some embodiments, the immune checkpoint inhibitor and the chemotherapy of the neoadjuvant therapy are administered for about 4 cycles.
[0029] In some embodiments, the immune checkpoint inhibitor of the neoadjuvant therapy is administered to the subject at a dose of about 300-500 mg per administration. In some embodiments, the immune checkpoint inhibitor of the neoadjuvant therapy is administered to the subject at a dose of about 400 mg per administration. In some embodiments, the immune checkpoint inhibitor is administered every six weeks. 131986-7101
[0030] In some embodiments, the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject at a dose of about 300-500 mg per administration. In some embodiments, the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject at a dose of about 400 mg per administration. In some embodiments, the immune checkpoint inhibitor of the adjuvant therapy is administered to the subj ect every six weeks. In some embodiments, the immune checkpoint inhibitor of the adjuvant therapy is administered for about 5-10 cycles. In some embodiments, the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject for about 7 cycles.
[0031] In some embodiments, the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject at a dose of about 100-300 mg per administration. In some embodiments, the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject at a dose of about 200 mg per administration. In some embodiments, the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject every three weeks. In some embodiments, the immune checkpoint inhibitor of the adjuvant therapy is administered for about 10-20 cycles. In some embodiments, the immune checkpoint inhibitor of the adjuvant therapy is administered for about 14 cycles.
[0032] In some embodiments, the individualized neoantigen vaccine is administered to the subject every three weeks. In some embodiments, a total of about 5-15 doses of the individualized neoantigen vaccine are administered to the subject. In some embodiments, a total of about 9 doses of the individualized neoantigen vaccine are administered to the subject.
[0033] In some embodiments, the individualized neoantigen vaccine and the immune checkpoint inhibitor are each administered separately and each administered via an intradermal, intramuscular, intravascular, intratumoral, and / or subcutaneous route. In some embodiments, the individualized neoantigen vaccine is administered intramuscularly and the immune checkpoint inhibitor is administered intravenously.
[0034] In some embodiments, the open reading frame of the mRNA polynucleotide comprises nucleosides selected from the group consisting of N1 -methylpseudouridine, adenosine, guanosine, and cytidine.
[0035] In some embodiments, the lipid delivery vehicle comprises a lipid nanoparticle, a liposome, or a lipoplex.
[0036] In some embodiments, the lipid delivery vehicle comprises a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid. In some embodiments, the ionizable amino lipid comprises a compound of Formula (I): 131986-7101 wherein
[0037] Ri is selected from the group consisting of C5-30 alkyl, C5-20 alkenyl, and -R"M'R';
[0038] R2 and R3 are independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;
[0039] R4 is -(CH2)nQ, wherein Q is -OR, and n is selected from 1, 2, 3, 4, and 5; each Rs is H; each Re is H;
[0040] M and M' are independently selected from -C(O)O- and -OC(O)-;
[0041] R7is H;
[0042] R is H;
[0043] R' is selected from the group consisting of Ci-18 alkyl and C2-18 alkenyl;
[0044] R" is selected from the group consisting of C3-14 alkyl and C3-14 alkenyl; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some embodiments, the compound of Formula (I) comprises Compound (1-25):
[0045] In some embodiments, the neutral lipid comprises l,2-distearoyl-sn-glycero-3- phosphocholine (DSPC), the sterol comprises cholesterol, and the PEG-modified lipid comprises 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG).
[0046] In some embodiments, the mRNA polynucleotide of the individualized neoantigen vaccine comprises an open reading frame encoding 5-34 neoepitopes expressed in the tumor in the subject, is fully modified with N1 -methyl pseudouridine, and is formulated with lipid nanoparticles comprising 50% ionizable lipid, 10% non-ionizable lipid, 38.5% sterol, and 1.5% PEG-modified lipid, wherein the ionizable lipid is Compound 1-25 as disclosed herein, the non-ionizable lipid is distearoylphosphatidylcholine (DSPC), the sterol is cholesterol, and the PEG-modified lipid is PEG-DMG.
[0047] The disclosure, in some aspects, provides a method of treating non-small cell lung cancer (NSCLC) in a subject having NSCLC, the method comprising: administering to the subject a 131986-7101 neoadjuvant therapy comprising administering about 200 mg of pembrolizumab every three weeks for at least two cycles and a platinum-based doublet chemotherapy prior to a surgical resection of a tumor in the subject; and administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises administering about 400 mg pembrolizumab every size weeks for at least five cycles and administering about 1 mg of an individualized neoantigen vaccine every three weeks for at least five cycles, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid.
[0048] Some aspects of the disclosure include a method of treating non-small cell lung cancer (NSCLC) in a subject having NSCLC, the method comprising: administering to the subject a neoadjuvant therapy comprising administering about 400 mg of pembrolizumab every six weeks for at least two cycles and a platinum-based doublet chemotherapy prior to a surgical resection of a tumor in the subject; and administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises administering about 400 mg pembrolizumab every six weeks for at least five cycles and administering about 1 mg of an individualized neoantigen vaccine every three weeks for at least five cycles, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid.
[0049] Aspects of the disclosure include a method of treating non-small cell lung cancer (NSCLC) in a subject having NSCLC, the method comprising: administering to the subject a neoadjuvant therapy comprising administering about 400 mg of pembrolizumab every six weeks for at least two cycles and a platinum-based doublet chemotherapy prior to a surgical resection of a tumor in the subject; and administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises administering about 200 mg pembrolizumab every three weeks for at least five cycles and administering about 1 mg of an individualized neoantigen vaccine every three weeks for at least five cycles, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the 131986-7101 subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid.
[0050] Some aspects of the disclosure include a method of treating non-small cell lung cancer (NSCLC) in a subject having NSCLC, the method comprising: administering to the subject a neoadjuvant therapy comprising administering about 200 mg of pembrolizumab every three weeks for at least two cycles and a platinum-based doublet chemotherapy prior to a surgical resection of a tumor in the subject; and administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises administering about 200 mg pembrolizumab every three weeks for at least five cycles and administering about 1 mg of an individualized neoantigen vaccine every three weeks for at least five cycles, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid.
[0051] In some embodiments, at least one of the neoepitopes are MHC class I epitopes; at least 10% of the neoepitopes are MHC class I epitopes; at least 50% of the neoepitopes are MHC class I epitopes; at least 70% of the neoepitopes are MHC class I epitopes; at least one of the neoepitopes are MHC class II epitope; at least 30% of the neoepitopes are MHC class II epitopes; each of the neoepitopes is 20-50 amino acids in length; each of the neoepitopes comprises 25-35 amino acids; the neoepitopes are T cell epitopes; each of the neoepitopes comprises an antigenic region and an MHC stabilizing region; two or more of the neoepitopes are connected directly to one another; two or more of the neoepitopes are connected to one another through a linker that is not a cleavage sensitive site; each of the neoepitopes includes a centrally located mutation encoded by a single nucleotide polymorphism (SNP); the mRNA polynucleotide comprises at least 30 neoepitopes; and / or the open reading frame of the mRNA polynucleotide comprises nucleosides selected from the group consisting of N1 -methylpseudouridine, adenosine, guanosine, and cytidine.
[0052] In some embodiments, the ionizable amino lipid comprises Compound (1-25): (Compound 1-25). 131986-7101
[0053] In some embodiments, the neutral lipid comprises l,2-distearoyl-sn-glycero-3- phosphocholine (DSPC), the sterol comprises cholesterol, and the PEG-modified lipid comprises 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG).
[0054] In some embodiments, the lipid nanoparticle comprises 20-60 mol% ionizable cationic lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and 0.5-15 mol% PEG-modified lipid; the lipid nanoparticle comprises about 45-55 mol% ionizable cationic lipid, about 5-15 mol% noncationic lipid, about 35-40 mol% sterol, and about 1-2 mol% PEG-modified lipid; or the lipid nanoparticle comprises about 50 mol% ionizable cationic lipid, about 10 mol% non-cationic lipid, about 38.5 mol% sterol, and about 1.5 mol% PEG-modified lipid.
[0055] In some embodiments, the platinum-based doublet chemotherapy comprises administering one or more chemotherapeutic agents selected from the group consisting of cisplatin, carboplatin, pemetrexed, gemcitabine, and paclitaxel. In some embodiments, if the subject has non-squamous cell NSCLC, the chemotherapeutic agents comprise cisplatin and pemetrexed or carboplatin and pemetrexed; or if the subject has squamous cell NSCLC, the chemotherapeutic agents comprise cisplatin and gemcitabine or carboplatin and gemcitabine.
[0056] In some embodiments, the chemotherapeutic agents comprise cisplatin, and about 30 to about 80 mg / m2cisplatin is administered every three weeks, optionally, about 38, about 56 or about 75 mg / m2cisplatin is administered; the chemotherapeutic agents comprise pemetrexed, and wherein about 200 to about 600 mg / m2pemetrexed is administered every three weeks, optionally, about 250, about 375 or about 500 mg / m2pemetrexed is administered; the chemotherapeutic agents comprise carboplatin, and wherein AUC of about 2 to about 7 mg / mL-min carboplatin is administered once every three weeks, optionally, AUC of about 2.5, about 3, about 3.75, about 4.5, about 5 or about 6 mg / mL-min carboplatin is administered; the chemotherapeutic agents comprise gemcitabine, and wherein about 500 to about 1300 mg / m2gemcitabine is administered every three weeks, optionally, about 500, about 600, about 750, about 900, about 1000 or about 1250 mg / m2gemcitabine is administered; and / or the chemotherapeutic agents comprise paclitaxel and wherein about 50 mg / m2to about 300 mg / m2paclitaxel is administered every three weeks, optionally, about 100, about 150, about 175 or about 200 mg / m2paclitaxel is administered.
[0057] In some embodiments, the subject has non-squamous cell NSCLC, the chemotherapeutic agents comprise cisplatin and pemetrexed, and about 75 mg / m2cisplatin and about 175 or about 200 mg / m2pemetrexed are administered every three weeks; the subject has non-squamous cell NSCLC, the chemotherapeutic agents comprise carboplatin and pemetrexed, and AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 175 or about 200 mg / m2 131986-7101 pemetrexed are administered every three weeks; the subject has squamous cell NSCLC, the chemotherapeutic agents comprise cisplatin and gemcitabine, and about 75 mg / m2cisplatin and about 1000 mg / m2or about 1250 mg / m2gemcitabine are administered every three weeks; the subject has squamous cell NSCLC, the chemotherapeutic agents comprise carboplatin and gemcitabine, and about AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 1000 mg / m2or about 1250 mg / m2gemcitabine are administered every three weeks; the chemotherapeutic agents comprise cisplatin and paclitaxel, and about 75 mg / m2cisplatin and about 175 mg / m2or about 200 mg / m2paclitaxel are administered every three weeks; or the chemotherapeutic agents comprise carboplatin and paclitaxel, and about AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 175 mg / m2or about 200 mg / m2paclitaxel are administered every three weeks.
[0058] Each of the limitations of the disclosure can encompass various embodiments of the disclosure. It is, therefore, anticipated that each of the limitations of the disclosure involving any one element or combinations of elements can be included in each aspect of the disclosure. This disclosure is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The disclosure is capable of other embodiments and of being practiced or of being carried out in various ways.
[0059] BRIEF DESCRIPTION OF DRAWING
[0060] FIG. 1 shows a schematic of the clinical trial described in Example 1.
[0061] DETAILED DESCRIPTION
[0062] In aspects, the present disclosure relates to methods for treating non-small cell lung cancer (NSCLC) in a subject (e.g., inducing an immune response against a tumor) using individualized neoantigen therapies. The vaccines described herein are designed to induce an immune response that recognizes tumor-specific mutations and / or neoantigens. The tumor mutations and their antigen presenting molecules (i.e., HLA) are unique to each subject, and an individualized antigen / HLA strategy, such as the individualized neoantigen vaccines of the disclosure, maximize the personalized immune response. The design of the vaccine which incorporates multiple, subjectspecific neoepitopes as provided herein may improve clinical benefit for subjects having NSCLC. In some aspects, the individualized neoantigen vaccines as provided herein may help to prevent the subject’s NSCLC from recurring by instructing their immune system to better identify cancerous tissue derived from the original cancer lesion. 131986-7101
[0063] In some aspects, the present disclosure relates to methods of treating NSCLC in a subject (e.g., inducing an immune response against a tumor) by administering to the subject a neoadjuvant therapy prior to a surgical resection of a tumor in the subject, and then administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises an immune checkpoint inhibitor and an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle.
[0064] In some aspects, the present disclosure relates to methods of treating NSCLC in a subject (e.g., inducing an immune response against a tumor) by treatment with an adjuvant therapy, the method comprising: identifying a subject with NSCLC that has received a neoadjuvant therapy and has undergone surgical resection of a tumor; and then administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises an immune checkpoint inhibitor and an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoantigens expressed in the tumor in the subject formulated in a lipid delivery vehicle.
[0065] In other aspects, the methods provided herein involve improving other anti-cancer therapies such as checkpoint inhibitor therapies (e.g., anti-PD-1 antibodies). Immune checkpoint inhibitor efficacy may be driven by blocking the negative signals generated by engagement of these inhibitory receptors on T cells with their ligands on tumors and other immune cells, especially antigen presenting cells. The loss of inhibition following checkpoint blockade allows the subjects’ T cells to recognize neoantigens as foreign. Combining the individualized neoantigen vaccines of the disclosure with immune checkpoint inhibitor therapy leads to T cell-mediated destruction of the tumor cells by increasing both the number and antitumor activity of a subject’s T cells that recognize tumor-specific mutations / neoantigens.
[0066] In a newly diagnosed subject, a neoadjuvant therapy comprising an immune checkpoint inhibitor, such as pembrolizumab, in conjunction with chemotherapy, may begin as soon as possible. Then, the subject’s tumor sample can be screened for neoantigens and an individualized neoantigen vaccine may be designed and synthesized, before, during, or after surgical resection of the tumor. Following surgical resection of the tumor, the subject may be started on the adjuvant therapy (i.e., a combination treatment comprising the individualized neoantigen vaccine and the immune checkpoint inhibitor). The immune checkpoint inhibitor may be administered together with individualized neoantigen vaccine (e.g., on the same day) or they may be administered 131986-7101 separately on different schedules. Treatment in this manner may improve clinical benefit and may help to prevent the subject’s NSCLC from recurring.
[0067] The use of mRNA technology allows for induced production of a broad array of secreted, membrane-bound, and intracellular proteins in humans. Antigen-encoded mRNA is an attractive technology platform for neoantigen vaccination, as an mRNA cancer vaccine can deliver multiple neoepitopes in a single molecule. In this way, a vaccine unique to each particular subject can be rapidly manufactured, and the encoded neoepitopes are endogenously translated and enter into the natural cellular antigen processing and presentation pathway. Moreover, mRNA-based vaccine technology overcomes the challenges commonly associated with DNA- based vaccines, such as risk of genome integration or the high doses and devices needed for administration (e.g., electroporation).
[0068] Each individualized neoantigen mRNA vaccine comprises an mRNA encoding multiple neoepitopes designed specifically for each individual subject’s tumor mutanome and HLA type. This allows for the inclusion of the maximum number of neoepitopes while both maintaining a sufficient amount of flanking sequence to facilitate both HLA Class I and Class II presentation of the peptides (neoepitopes) and retaining an mRNA construct length that can be reliably and rapidly manufactured.
[0069] Embodiments provide individualized neoantigen vaccines that include one or more nucleic acids having one or more open reading frames encoding neoepitopes. As provided herein, individualized neoantigen vaccines encoding neoepitopes having different properties may be used to induce a balanced immune response, comprising cellular and / or humoral immunity. As is described in more detail below, the individualized neoantigen vaccines may be used in conjunction with an immune checkpoint inhibitor (e.g., anti-PD-1 antibody (e.g., pembrolizumab)) as an adjuvant therapy administered after surgical resection of an NSCLC tumor. In some embodiments, surgical resection of the tumor is preceded by administration of a neoadjuvant therapy (e.g., an immune checkpoint inhibitor (e.g., anti-PD-1 antibody (e.g., pembrolizumab)) and chemotherapy).
[0070] Non-Small Cell Lung Cancer
[0071] Provided herein, in some aspects, are method for treating non-small cell lung cancer (NSCLC). NSCLC, which is any type of epithelial lung cancer other than small cell lung cancer, accounts for 85% of lung cancers and, by the time it has been diagnosed, over 40% of NSCLC- positive subjects have metastatic cancer (i.e., their cancer has spread beyond the lungs) (Yale Medicine, “Non-small Cell Lung Cancer”, yalemedicine.org / conditions / non-small-cell-lung- 131986-7101 cancer). Lung cancer is the leading cause of cancer-related mortality in the United States, with five-year survival rate is around 25% (National Cancer Institute, cancer.gov / types / lung / hp / non- small-cell-lung-treatment-pdq). Current treatments for NSCLC include surgery, chemotherapy, radiation therapy, targeted therapy, and immunotherapy; however, results of the standard of treatment are poor except for localized cancer (ztZ.). The methods and compositions provided herein are designed to treat NSCLC and improve subjects’ outcomes.
[0072] There are three main types of NSCLC: adenocarcinoma (non-squamous cell carcinoma), squamous cell carcinoma, and large cell carcinoma, each of which may be treated using the methods and compositions described herein. In some embodiments, the subject has adenocarcinoma (non-squamous cell carcinoma). In some embodiments, the subject has squamous cell carcinoma. In some embodiments, the subject has large cell carcinoma.
[0073] Several mutations in lung cancers have been identified, some of which may represent targets for current therapies include: EFGR, ALK, BRAF, ROS1, RET, NTRK1, NTRK2, NTRK3, MET, KRAS, and HER2. In some embodiments, the subject’s NSCLC tumor has a mutation in at least one of the following genes: EFGR, ALK, BRAF, ROS1, RET, NTRK1, NTRK2, NTRK3, MET, KRAS, and HER2. In some embodiments, the subject’s NSCLC tumor lacks an EGFR sensitizing mutation and / or an ALK translocation. In some embodiments, the subject’s NSCLC tumor lacks a tumor-activating EGFR mutation. For example, in some embodiments, the subject’s NSCLC tumor lacks an exon 19 deletion (DEL19) and / or does not comprise an L858R mutation.
[0074] The stage of NSCLC has important prognostic implications for subjects. In some embodiments, the NSCLC is stage II NSCLC. In some embodiments, the NSCLC is stage III NSCLC. In some embodiments, the NSCLC is stage IIIA NSCLC. In some embodiments, the NSCLC is stage IIIB NSCLC. In some embodiments, the NSCLC is resectable; that is, it may be cured by surgery alone or by surgery followed by adjuvant treatment. In some embodiments, the NSCLC is resectable stage II NSCLC. In some embodiments, the NSCLC is resectable stage III NSCLC. In some embodiments, the NSCLC is resectable stage IIIA NSCLC. In some embodiments, the NSCLC is resectable stage IIIB NSCLC.
[0075] In some embodiments, the subject’s Tumor Proportion Score (TPS) is determined. The TPS is a measure of the percentage of viable tumor cells showing partial or complete membrane staining at any intensity for programmed cell death ligand 1 (PD-L1), and is typically used to predict the efficacy of immune checkpoint inhibitor therapy (Ulas et al. Predictive Value of Combined Positive Score and Tumor Proportion Score for Immunotherapy Response in Advanced NSCLC. JTO Clin Res Rep. 2023 May 25;4(9): 100532). A TPS may be calculated using any method known 131986-7101 in the art, for example, using commercially available assays. In some embodiments, the subject’s TPS is less than 50%, for example, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0%. In some embodiments, the TPS is 0%-10%, 0% - 15%, 0% - 20%, 0% - 25%, 0% - 30%, 0% - 35%, 0% - 40%, 0% - 45%, 0% - 50%, 10% - 20%, 10% - 25%, 10% - 30%, 10%
[0076] - 35%, 10% - 40%, 10% - 45%, 10% - 50%, 15% - 20%, 15% - 25%, 15% - 30%, 15% - 35%, 15%
[0077] - 40%, 15% - 45%, 15% - 50%, 20% - 25%, 20% - 30%, 20% - 35%, 20% - 40%, 20% - 45%, 20%
[0078] - 50%, 25% - 30%, 25% - 35%, 25% - 40%, 25% - 45%, 25% - 50%, 30% - 35%, 30% - 40%, 30%
[0079] - 45%, 30% - 50%, 35% - 40%, 35% - 45%, 35% - 50%, 40% - 45%, 40% - 50%, or 45% - 50%. In some embodiments, the subject’s TPS is equal to or greater than 50% (the specimen / tumor has high PD-L1 expression), for example 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the TPS is 50% - 55%, 50% - 60%, 50% - 65%, 50% - 70%, 50% - 75%, 50% - 80%, 50% - 85%, 50% - 90%, 50% - 95%, 50%
[0080] - 100%, 55% - 60%, 55% - 65%, 55% - 70%, 55% - 75%, 55% - 80%, 55% - 85%, 55% - 90%, 55% - 95%, 55% - 100%, 60% - 65%, 60% - 70%, 60% - 75%, 60% - 80%, 60% - 85%, 60% - 90%, 60% - 95%, 60% - 100%, 65% - 70%, 65% - 75%, 65% - 80%, 65% - 85%, 65% - 90%, 65%
[0081] - 95%, 65% - 100%, 70% - 75%, 70% - 80%, 70% - 85%, 70% - 90%, 70% - 95%, 70% - 100%, 75% - 80%, 75% - 85%, 75% - 90%, 75% - 95%, 75% - 100%, 80% - 85%, 80% - 90%, 80% - 95%, 80% - 100%, 85% - 90%, 85% - 95%, 85% - 100%, 90% - 95%, 90% - 100%, or 95% - 100%..
[0082] In some embodiments, the subject has a particular score according to a patient evaluation metric. For example, in some embodiments, the subject has a given Eastern Cooperative Oncology Group (ECOG) performance status score. In some embodiments, the subject has an ECOG performance status score of 0, 1, 2, 3, or 4 (e.g., 0, 1, or 2). In some embodiments, the subject has an ECOG performance status score in the range of 0-1. In some embodiments, the subject has an ECOG performance status score of 0. In some embodiments, the subj ect has an ECOG performance status score of 1. ECOG performance status score is determined according to the scale: 131986-7101
[0083] The ECOG performance status score is described in Oken, et al. “Toxicity and response criteria of the Eastern Cooperative Oncology Group” Am J Clin Oncol. 5(6):649-655 (1982), the entire contents of which are incorporated by reference herein for this purpose.
[0084] The subject, in some embodiments, is also one who is able to undergo surgical resection of the tumor (for example, the physician-recommended treatment of the NSCLC in the subject includes surgical resection of the tumor). In some embodiments, the subject is able to receive chemotherapy (e.g., the physician-recommended treatment of the NSCLC in the subject includes chemotherapy). In some embodiments, the subject is able to receive immune checkpoint inhibitor therapy (e.g., the physician-recommended treatment of the NSCLC in the subject includes administration of an immune checkpoint inhibitor, such as pembrolizumab).
[0085] The subject, in some embodiments, is a human subject. The subject, in some embodiments is at least 18 years of age. In some embodiments, the subject is over 50 years of age. In some embodiments, the subject is over 65 years of age. In some embodiments, the subject is over 70 years of age.
[0086] Non-Small Cell Lung Cancer Treatments; Immune Responses
[0087] The disclosure, in some aspects, provides methods of treating NSCLC and / or inducing an immune response against an NSCLC tumor by administering a neoadjuvant therapy prior to surgical resection of the tumor and then administering an effective amount of an adjuvant therapy after the surgical resection of the tumor. In other aspects, the disclosure provides methods of treating NSCLC and / or inducing an immune response against an NSCLC tumor by identifying a subject with NSCLC that has received neoadjuvant therapy prior to undergoing a surgical resection of the tumor and then administering an effective amount of an adjuvant therapy after the surgical resection of the tumor.
[0088] As used herein, “treating NSCLC” refers to an intervention that alters the natural course of NSCLC, for example, alleviating at least one symptom of NSCLC, diminishing any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, ameliorating or palliating the disease state, and / or remission (e.g., partial or complete) or improved 131986-7101 prognosis. In some embodiments, the methods described herein are used to slow the progression of NSCLC, for example, by inducing an immune response against the NSCLC tumor.
[0089] As used herein, “inducing an immune response” against an NSCLC tumor refers to the induction of a humoral and / or cellular-mediated response against NSCLC (e.g., tumor cells). In some embodiments, an induced immune response to a tumor comprises a cellular response to one or more antigens (e.g., neoantigens) expressed in the tumor. In some embodiments, a cellular response comprises a T cell response, e.g., a CD4 T cell response and / or a CD8 T cell response. In some embodiments, a T cell response comprises generation of one or more de novo T cell responses to a tumor antigen. For example, in some embodiments, a T cell response to a tumor antigen results in the presence of a T cell with specificity for the tumor antigen, wherein the T cell with specificity for the tumor antigen was not previously present or was not previously detectable (e.g., in a subject or in a biological sample collected from a subject). Such a T cell response to a tumor antigen can result from the immune system’s response to a neoantigen, or to a peptide corresponding to the neoantigen (e.g., a peptide encoded by a nucleic acid vaccine provided herein). In some embodiments, a T cell response to a tumor antigen is not detectable in a subject prior to administration to the subject of a cancer vaccine (e.g., individualized neoantigen vaccine) but is detectable in the subject after administration of the vaccine. In some embodiments, a T cell response to a tumor antigen is increased in a subject following administration to the subject of a cancer vaccine (e.g., individualized neoantigen vaccine) relative to a level of immune response to the tumor antigens prior to administration of the vaccine.
[0090] A T cell response to a specific antigen can be detected, for example, by collecting a sample comprising immune cells (e.g., peripheral blood mononuclear cells (PBMCs), such as PBMCs from a blood sample), stimulating the immune cells with the specific antigen, and subsequently measuring immune activation signals (e.g., cytokine production) from the immune cells. T cells with specificity for the specific antigen produce activation signals (e.g., cytokines) in response to the stimulation, and can thereby be detected. A T cell response to a specific antigen can also be detected by a method described in U.S. Patent Application Pub. No. US2022 / 0236253A1, the contents of which are herein incorporated by reference in their entirety for this purpose.
[0091] In some embodiments, a T cell response comprises an increase in an existing T cell responses to a tumor antigen in the subject. This increase can be the result of an increase in the individual strength of the reaction of the antigen-specific T cells to the antigen, an increase in the size of the population of T cells specific for the antigen, and / or a decrease in immunosuppressive 131986-7101 signals (e.g., a decrease in the size of a population of cells which suppress T cell activity against the antigen, such as regulatory T cells (Tregs)).
[0092] An increase in the individual strength of the reaction of antigen-specific T cells to the antigen can be measured, e.g., as described above, by first selecting for antigen-specific T cells and normalizing the measured immune activation signals (e.g., cytokines) to the total number of antigen-specific T cells.
[0093] An increase in the size of a population of antigen-specific T cells can be detected by comparing the measured immune activation signals (e.g., cytokines) from a defined number of T cells (e.g., from PBMCs) in a sample collected prior to the immune response induction (e.g., prior to the administration of an individualized neoantigen vaccine) with that in a sample collected after the immune response induction. Sizes of populations of cells (e.g., antigen-specific T cells and cells which suppress T cell activity) can also be measured, for example, by flow cytometric analysis using markers for the particular population(s) of interest. Such flow cytometric analysis can, for example, allow one to determine the ratio of a specific population of T cells (e.g., antigenspecific T cells) to a broader population of cells (e.g., to all T cells) in a biological sample.
[0094] An “effective amount” of a neoadjuvant or adjuvant therapy may be provided based, at least in part, on the target tissue, target cell type, means of administration, and, with respect to the individualized neoantigen vaccine, physical characteristics of the polynucleotide (e.g., size, and extent of modified nucleosides) and other components of the vaccine. In general, an effective amount of the adjuvant therapy provides an induced or boosted immune response as a function of neoantigen production in the cell, preferably more efficient than a composition containing a corresponding unmodified polynucleotide encoding the same neoantigen or a neoepitope. Increased neoantigen production may be demonstrated by increased cell transfection (the percentage of cells transfected with the individualized neoantigen vaccine), increased protein translation from the polynucleotide, decreased nucleic acid degradation (as demonstrated, for example, by increased duration of protein translation from a modified polynucleotide), or altered antigen specific immune response of the host.
[0095] Neoadjuvant Therapy
[0096] The methods provided herein relate to, in part, selecting a subject who has NSCLC and has received a neoadjuvant therapy prior to undergoing a surgical resection of a tumor or administering a neoadjuvant therapy to the subject prior to a surgical resection of a tumor. As used herein, 131986-7101
[0097] “neoadjuvant therapy” refers to any treatment given before the surgical resection of the NSCLC tumor.
[0098] In some embodiments, the neoadjuvant therapy comprises chemotherapy or administration of an immune checkpoint inhibitor. In some embodiments, the neoadjuvant therapy comprises chemotherapy and administration of an immune checkpoint inhibitor.
[0099] In some embodiments, an immune checkpoint inhibitor may be administered together with chemotherapy (e.g., on the same day) or they may be administered separately on different schedules.
[0100] In some embodiments, the immune checkpoint inhibitor is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, or every eight weeks. In some embodiments, the immune checkpoint inhibitor is administered every 3 weeks. In some embodiments, the immune checkpoint inhibitor is administered every 6 weeks. In some embodiments, the immune checkpoint inhibitor is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more total times (each time is a cycle of immune checkpoint administration). In some embodiments, the immune checkpoint inhibitor is administered 2-6 times (i.e., 2-6 cycles). In some embodiments, the immune checkpoint inhibitor is administered 3-5 times (i.e., 3-5 cycles). In some embodiments, the immune checkpoint inhibitor is administered four times (i.e., four cycles). In a preferred embodiment, the immune checkpoint inhibitor is administered once every three weeks for four total cycles.
[0101] In some embodiments, the chemotherapy is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, or every eight weeks. In some embodiments, the chemotherapy is administered every 3 weeks. In some embodiments, the immune checkpoint inhibitor is administered every 6 weeks. In some embodiments, the chemotherapy is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more total times (each time is a cycle of immune checkpoint inhibitor administration). In some embodiments, the chemotherapy is administered 2-6 times (i.e., 2-6 cycles). In some embodiments, the chemotherapy is administered 3-5 times (i.e., 3-5 cycles). In some embodiments, the chemotherapy is administered four times (i.e., four cycles). In a preferred embodiment, the chemotherapy is administered once every three weeks for four total cycles.
[0102] In some embodiments, the neoadjuvant therapy’s duration is 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks or more. In some 131986-7101 embodiments, the neoadjuvant therapy’s duration is 10-14 weeks. In some embodiments, the neoadjuvant therapy’s duration is 12 weeks.
[0103] Chemotherapy in Neoadjuvant Therapy
[0104] The neoadjuvant therapy, in some embodiments, comprises chemotherapy. Chemotherapy refers to the use of at least one chemotherapeutic agent to slow or stop the growth of cancer cells (e.g., by halting the division of cancer cells and / or by killing cancer cells). In some embodiments, the chemotherapy is platinum-based doublet chemotherapy. Platinum-based doublet chemotherapy is the standard-of-care, first line treatment for most subjects having advanced NSCLC. Without wishing to be bound by theory, it is thought that platinum-based doublet chemotherapy sensitizes NSCLC tumors to immune checkpoint inhibitors (Juergens et al., Journal of Thoracic Oncology, 12(11):S1792-S1793, 2017).
[0105] In some embodiments, the chemotherapy comprises administration of a chemotherapeutic agent selected from the group consisting of cisplatin, carboplatin, pemetrexed, gemcitabine, and paclitaxel. In some embodiments, the chemotherapy regimen used is dependent on the cell type of NSCLC tumor. For example, in some embodiments, if the subject has non-squamous cell NSCLC, the chemotherapy comprises cisplatin and pemetrexed. In some embodiments, if the subject has non-squamous NSCLC, the chemotherapy comprises carboplatin and pemetrexed. In some embodiments, if the subject has squamous cell NSCLC, the chemotherapy comprises cisplatin and gemcitabine. In some embodiments, if the subject has squamous cell NSCLC, the chemotherapy comprises carboplatin and gemcitabine. In some embodiments, the chemotherapy comprises cisplatin and paclitaxel. In some embodiments, the chemotherapy comprises carboplatin and paclitaxel.
[0106] In some embodiments, the chemotherapy comprises cisplatin and pemetrexed. In some embodiments, about 30 to about 80 mg / m2cisplatin is administered every three weeks. In some embodiments, about 38, about 56 or about 75 mg / m2cisplatin is administered. In some embodiments, about 38 mg / m2cisplatin is administered. In some embodiments, about 56 mg / m2cisplatin is administered. In some embodiments, about 75 mg / m2cisplatin is administered. In some embodiments, about 200 to about 600 mg / m2pemetrexed is administered every three weeks. In some embodiments, about 250, about 375 or about 500 mg / m2pemetrexed is administered. In some embodiments, about 250 mg / m2pemetrexed is administered. In some embodiments, about 375 mg / m2pemetrexed is administered. In some embodiments, about 500 mg / m2pemetrexed is administered. 131986-7101
[0107] In some embodiments, the chemotherapy comprises carboplatin and pemetrexed. In some embodiments, area under concentration-time curve (AUC) of about 2 to about 7 mg / mL-min carboplatin is administered once every three weeks. In some embodiments, AUC of about 2.5, about 3, about 3.75, about 4.5, about 5 or about 6 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 2.5 or about 3 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 2.5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 3 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 3.75 or about 4.5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 3.75 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 4.5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 5 or 6 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 6 mg / mL-min carboplatin is administered. In some embodiments, about 200 to about 600 mg / m2pemetrexed is administered every three weeks. In some embodiments, about 250, about 375 or about 500 mg / m2pemetrexed is administered. In some embodiments, about 250 mg / m2pemetrexed is administered. In some embodiments, about 375 mg / m2pemetrexed is administered. In some embodiments, about 500 mg / m2pemetrexed is administered.
[0108] In some embodiments, the chemotherapy comprises cisplatin and gemcitabine. In some embodiments, about 30 to about 80 mg / m2cisplatin is administered every three weeks. In some embodiments, about 38, about 56 or about 75 mg / m2cisplatin is administered. In some embodiments, about 38 mg / m2cisplatin is administered. In some embodiments, about 56 mg / m2cisplatin is administered. In some embodiments, about 75 mg / m2cisplatin is administered. In some embodiments, about 500 to about 1300 mg / m2gemcitabine is administered every three weeks. In some embodiments, about 500, about 600, about 750, about 900, about 1000 or about 1250 mg / m2gemcitabine is administered, about 500, or about 600 mg / m2gemcitabine is administered. In some embodiments, about 500 mg / m2gemcitabine is administered. In some embodiments, about 600 mg / m2gemcitabine is administered. In some embodiments, about 750, or about 900 mg / m2gemcitabine is administered. In some embodiments, about 750 mg / m2gemcitabine is administered. In some embodiments, about 900 mg / m2gemcitabine is administered. In some embodiments, about 1000 or about 1250 mg / m2gemcitabine is administered. In some embodiments, about 1000 mg / m2gemcitabine is administered. In some embodiments, about 1250 mg / m2gemcitabine is administered. 131986-7101
[0109] In some embodiments, the chemotherapy comprises carboplatin and gemcitabine. In some embodiments, area under concentration-time curve (AUC) of about 2 to about 7 mg / mL-min carboplatin is administered once every three weeks. In some embodiments, AUC of about 2.5, about 3, about 3.75, about 4.5, about 5 or about 6 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 2.5 or about 3 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 2.5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 3 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 3.75 or about 4.5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 3.75 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 4.5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 5 or 6 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 6 mg / mL-min carboplatin is administered. In some embodiments, about 500 to about 1300 mg / m2gemcitabine is administered every three weeks. In some embodiments, about 500, about 600, about 750, about 900, about 1000 or about 1250 mg / m2gemcitabine is administered, about 500, or 600 mg / m2gemcitabine is administered. In some embodiments, about 500 mg / m2gemcitabine is administered. In some embodiments, about 600 mg / m2gemcitabine is administered. In some embodiments, about 750, or about 900 mg / m2gemcitabine is administered. In some embodiments, about 750 mg / m2gemcitabine is administered. In some embodiments, about 900 mg / m2gemcitabine is administered. In some embodiments, about 1000 or about 1250 mg / m2gemcitabine is administered. In some embodiments, about 1000 mg / m2gemcitabine is administered. In some embodiments, about 1250 mg / m2gemcitabine is administered.
[0110] In some embodiments, the chemotherapy comprises cisplatin and paclitaxel. In some embodiments, about 30 to about 80 mg / m2cisplatin is administered every three weeks. In some embodiments, about 38, about 56 or about 75 mg / m2cisplatin is administered. In some embodiments, about 38 mg / m2cisplatin is administered. In some embodiments, about 56 mg / m2cisplatin is administered. In some embodiments, about 75 mg / m2cisplatin is administered. In some embodiments, about 50 mg / m2to about 300 mg / m2paclitaxel is administered every three weeks. In some embodiments, about 100, about 150, about 175 or about 200 mg / m2paclitaxel is administered. In some embodiments, about 100 mg / m2paclitaxel is administered. In some embodiments, about 150 mg / m2paclitaxel is administered. In some embodiments, about 175 or about 200 mg / m2paclitaxel is administered. In some embodiments, about 175 mg / m2paclitaxel is administered. In some embodiments, about 200 mg / m2paclitaxel is administered. 131986-7101
[0111] In some embodiments, the chemotherapy comprises carboplatin and gemcitabine. In some embodiments, area under concentration-time curve (AUC) of about 2 to about 7 mg / mL-min carboplatin is administered once every three weeks. In some embodiments, AUC of about 2.5, about 3, about 3.75, about 4.5, about 5 or about 6 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 2.5 or about 3 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 2.5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 3 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 3.75 or about 4.5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 3.75 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 4.5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 5 or 6 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 5 mg / mL-min carboplatin is administered. In some embodiments, AUC of about 6 mg / mL-min carboplatin is administered. In some embodiments, about 50 mg / m2to about 300 mg / m2paclitaxel is administered every three weeks. In some embodiments, about 100, about 150, about 175 or about 200 mg / m2paclitaxel is administered. In some embodiments, about 100 mg / m2paclitaxel is administered. In some embodiments, about 150 mg / m2paclitaxel is administered. In some embodiments, about 175 or about 200 mg / m2paclitaxel is administered. In some embodiments, about 175 mg / m2paclitaxel is administered. In some embodiments, about 200 mg / m2paclitaxel is administered.
[0112] The chemotherapy, in some embodiments, is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, or every eight weeks. In some embodiments, the chemotherapy is administered every 3 weeks. In some embodiments, the chemotherapy is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more total times. In some embodiments, the chemotherapy is administered 3-5 times. In some embodiments, the chemotherapy is administered four times. In a preferred embodiment, the chemotherapy is administered once every three weeks for four total times.
[0113] Immune Checkpoint Inhibitors in Neoadjuvant Therapy
[0114] The neoadjuvant therapy, in some embodiments, comprises administration of at least one immune checkpoint inhibitor. As described in more detail below, the adjuvant therapy may also comprise at least one immune checkpoint inhibitor.
[0115] Inhibitory checkpoint molecules include, but are not limited to: PD-1, TIM-3, VISTA, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR and LAG3. CTLA-4, PD-1, and ligands thereof are members of the CD28-B7 family of co-signaling molecules that play important roles 131986-7101 throughout all stages of T-cell function and other cell functions. CTLA-4, Cytotoxic T- Lymphocyte-Associated protein 4 (CD 152), is involved in controlling T cell proliferation.
[0116] The PD-1 receptor is expressed on the surface of activated T cells (and B cells) and, under normal circumstances, binds to its ligands (PD-L1 and PD-L2) that are expressed on the surface of antigen-presenting cells, such as dendritic cells or macrophages. This interaction sends a signal into the T cell and inhibits it. Cancer cells take advantage of this system by driving high levels of expression of PD-L1 on their surface. This allows them to gain control of the PD-1 pathway and switch off T cells expressing PD-1 that may enter the tumor microenvironment, thus suppressing the anticancer immune response.
[0117] In some embodiments, the immune checkpoint inhibitor is an anti -PD-1 antibody. In some embodiments, the anti-PD-1 antibody is pembrolizumab (formerly MK-3475 and lambrolizumab, trade name KETRUDA®), a human antibody used in cancer immunotherapy that targets the PD- 1 receptor. In some embodiments, the anti-PD-1 antibody is BMS-936558 (nivolumab).
[0118] In some embodiments, the anti-PD-1 antibody is a human antibody. In other embodiments, the anti-PD-1 antibody is a humanized antibody. In other embodiments, the anti-PD-1 antibody is a chimeric antibody. In specific embodiments, the anti-PD-1 antibody or antigen binding fragment thereof is a monoclonal antibody.
[0119] In some embodiments, the anti-PD-1 antibody comprises: (a) light chain CDRs comprising a sequence of amino acids as set forth in SEQ ID NOs: 43, 44 and 45 and heavy chain CDRs comprising a sequence of amino acids as set forth in SEQ ID NOs: 48, 49 and 50. In some embodiments, the anti-PD-1 antibody specifically binds to human PD-1 and comprises (a) a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 51, or a variant thereof, and (b) a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NO :46. In some embodiments, the anti-PD-1 antibody is a monoclonal antibody which specifically binds to human PD-1 and comprises (a) a heavy chain comprising or consisting of a sequence of amino acids as set forth in SEQ ID NO:52, or a variant thereof; and (b) a light chain comprising or consisting of a sequence of amino acids as set forth in SEQ ID NO:47, or a variant thereof. In some embodiments, the anti-PD-1 antibody is a monoclonal antibody which specifically binds to human PD-1 and comprises (a) a heavy chain comprising or consisting of a sequence of amino acids as set forth in SEQ ID NO:52 and (b) a light chain comprising or consisting of a sequence of amino acids as set forth in SEQ ID NO:47.
[0120] In some embodiments, the anti-PD-1 antibody is pembrolizumab or a variant thereof. 131986-7101
[0121] Table A. Exemp ary PD-1 Antibody Sequences
[0122] A variant of a heavy chain variable region sequence or full-length heavy chain sequence is identical to the reference sequence except having up to 17 conservative amino acid substitutions in the framework region (z.e., outside of the CDRs), and preferably has less than ten, nine, eight, seven, six or five conservative amino acid substitutions in the framework region. A variant of a light chain variable region sequence or full-length light chain sequence is identical to the reference sequence except having up to five conservative amino acid substitutions in the framework region (z.e., outside of the CDRs), and preferably has less than four, three or two conservative amino acid substitution in the framework region.
[0123] In some embodiments, the anti -PD-1 antibody has a variable light domain and / or a variable heavy domain with at least 95%, 90%, 85%, 80%, 75% or 50% sequence identity to one of the variable light domains or variable heavy domains described above and exhibits specific binding to PD-1. In another embodiment of the methods of treatment of the disclosure, the anti-PD-1 131986-7101 antibody comprises variable light and variable heavy domains having up to 1, 2, 3, 4, or 5 or more amino acid substitutions, and exhibits specific binding to PD-1.
[0124] The dose of an immune checkpoint inhibitor in a neoadjuvant therapy, in some embodiments, is 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, or 500 mg. In some embodiments, the dose is 100 mg - 300 mg. In some embodiments, the dose is 200 mg. In some embodiments the dose of an immune checkpoint inhibitor in a neoadjuvant therapy is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, or every eight weeks. In some embodiments, the dose of an immune checkpoint inhibitor in a neoadjuvant therapy is administered every 3 weeks. For example, in some embodiments, the dose of the immune checkpoint inhibitor in a neoadjuvant therapy is 200 mg administered every 3 weeks.
[0125] In some embodiments, an immune checkpoint inhibitor is pembrolizumab. The dose of pembrolizumab in a neoadjuvant therapy, in some embodiments, is 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, or 500 mg. In some embodiments, the dose is 200 mg. In some embodiments the dose of pembrolizumab in a neoadjuvant therapy is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, or every eight weeks. In some embodiments, the dose of pembrolizumab in a neoadjuvant therapy is administered every 3 weeks. In some embodiments, the dose of pembrolizumab in a neoadjuvant therapy is 400 mg administered every 6 weeks. For example, in some embodiments, the dose of pembrolizumab in a neoadjuvant therapy is 200 mg administered every 3 weeks. The dose approved in the United States for treatment of cutaneous melanoma subjects is 2 mg / kg every 3 weeks. It has been concluded that a dose of 200 mg consistently across multiple tumor types is similar to 2 mg / kg.
[0126] In some embodiments, an immune checkpoint inhibitor is administered to a subject on a regular basis (e.g., once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, etc.) for a specified total period of time, or until a particular endpoint is reached. The specified total period of time, in some embodiments, is the time corresponding to the administration of 2 doses, 3 doses, 4 doses, 5 doses, 6 doses, 7 doses, 8 doses, 9 doses, 10 doses, 11 doses, 12 doses, 13 doses, 14 doses, 15 doses, 16 doses, 17 doses, 18 doses, 19 doses, 20 doses, 21 doses, 22 doses, 23 doses, 24 doses or more. In some embodiments, the specified total period of time is 2-6 doses of the immune checkpoint inhibitor (e.g., pembrolizumab) in the neoadjuvant therapy. In some 131986-7101 embodiments, the specified total period of time is four doses of the immune checkpoint inhibitor (e.g., pembrolizumab) in the neoadjuvant therapy.
[0127] In some embodiments, the immune checkpoint inhibitors are delivered in the form of mRNA encoding the immune checkpoint inhibitor(s). In other embodiments, the immune checkpoint inhibitors are delivered in the form of polypeptides. The immune checkpoint inhibitor may be administered by any route. In some embodiments, the immune checkpoint inhibitor is administered by an intradermal, intramuscular, intravascular, intratumoral, and / or subcutaneous route. In some embodiments, the immune checkpoint inhibitor is administered by an intravenous route. In some embodiments, the immune checkpoint inhibitor is administered by a subcutaneous route.
[0128] Surgical Resection / Screening
[0129] The subject, in some embodiments, is one who has received neoadjuvant therapy and surgical resection prior to administration of the adjuvant therapy. Surgical resection refers to the surgical removal of all or part of a lung affected by cancer. There are several types of resections which may be performed, including, but not limited to, lobectomy, pneumonectomy, segmentectomy (wedge resection), and sleeve resection. The surgical resection, in some embodiments is an RO surgical resection. As used herein, an “RO surgical resection” refers to a surgical resection procedure that removed all of the visible cancerous tissue; additionally, there are no cancer cells at the margins of the area of the resection. In some embodiments, the surgical resection is an R1 surgical resection. As used herein, an “R1 surgical resection” refers to a surgical resection in which all visible cancer tissue was removed during the procedure; however, cancer cells are present at the margins of the area of the resection. If the surgical resection was an R1 surgical resection, in some embodiments, the subject is administered a further anti-cancer therapy (e.g., radiation therapy).
[0130] In some embodiments, the surgical resection is performed 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks after the neoadjuvant therapy was first administered. In some embodiments, the surgical resection is performed 1, 2, 3, 4, 5, 6, 7, or 8 weeks after the last dose of the neoadjuvant therapy has been administered. In some embodiments, the surgical resection is performed 20 weeks after the neoadjuvant therapy was first administered and 8 weeks from the last dose of neoadjuvant therapy.
[0131] Before, during, or after surgical resection, the subj ect may be screened for adjuvant therapy. In a preferred embodiment, following surgical resection, the subject is screened for adjuvant 131986-7101 therapy. In some embodiments, the pathological complete response status is determined. Pathological complete response (pCR) is the complete absence of cancer in tissue samples after treatment (e.g., after neoadjuvant therapy and surgical resection). If the subject has a pCR, then, in some embodiments, the subject may be administered immune checkpoint inhibitor therapy, if recommended. If the subject does not have pCR after neoadjuvant therapy and surgical resection, the subject may be administered an adjuvant therapy, as described in more detail below.
[0132] In addition, following surgical resection, a new baseline image (re-baseline image) of the diseased area may be taken. In some embodiments, the re-baseline image does not show any apparent disease (i.e., there is no apparent or visible cancer tissue). In subjects in which the rebaseline image does not show any apparent disease, the adjuvant therapy may be administered.
[0133] Adjuvant Therapy
[0134] The subject, following administration of a neoadjuvant therapy and surgical resection, may then be administered an adjuvant therapy. As used herein, “adjuvant therapy” refers to a treatment or therapy administered after the primary treatment (surgical resection). The adjuvant therapy, in some embodiments, comprises an immune checkpoint inhibitor and an individualized neoantigen vaccine as described herein. The individualized neoantigen vaccine, as described in more detail below, comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes formulated in a lipid delivery vehicle.
[0135] Immune Checkpoint Inhibitors in Adjuvant Therapy
[0136] In other aspects the disclosure provides anti-cancer immunotherapies, such as immune checkpoint inhibitors, for use in combination with the individualized neoantigen vaccines as an adjuvant therapy. Immune checkpoint modulators include both stimulatory checkpoint molecules and inhibitory checkpoint molecules (e.g., an anti-CTLA4 and / or an anti-PDl antibody) and are discussed in detail in the section “Immune Checkpoint Inhibitors in Neoadjuvant Therapy” above.
[0137] The dose of an immune checkpoint inhibitor in an adjuvant therapy, in some embodiments, is 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, or more. In some embodiments, the dose is 400 mg. In some embodiments the dose of an immune checkpoint inhibitor in an adjuvant therapy is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, every eight weeks, every nine weeks, every 10 weeks, every 11 weeks, or every 12 weeks. In some embodiments, the dose of an immune checkpoint inhibitor in an adjuvant therapy is administered every 6 weeks. For example, in some embodiments, the dose of the immune 131986-7101 checkpoint inhibitor in an adjuvant therapy is 400 mg administered every 6 weeks. In some embodiments, the dose of the immune checkpoint inhibitor in an adjuvant therapy is 200 mg administered every 3 weeks.
[0138] The dose of pembrolizumab in an adjuvant therapy, in some embodiments, is 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, or more. In some embodiments, the dose is 400 mg. In some embodiments the dose of pembrolizumab in an adjuvant therapy is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, every eight weeks, every nine weeks, every 10 weeks, every 11 weeks, or every 12 weeks. In some embodiments, the dose of pembrolizumab in an adjuvant therapy is administered every 6 weeks. For example, in some embodiments, the dose of pembrolizumab in an adjuvant therapy is 400 mg administered every 6 weeks. In some embodiments, the dose of pembrolizumab in an adjuvant therapy is 200 mg administered every 3 weeks.
[0139] In some embodiments, an immune checkpoint inhibitor in an adjuvant therapy is administered to a subject on a regular basis (e.g., once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, etc.) for a specified total period of time, or until a particular endpoint is reached. The specified total period of time, in some embodiments, is the time corresponding to the administration of 2 doses, 3 doses, 4 doses, 5 doses, 6 doses, 7 doses, 8 doses, 9 doses, 10 doses, 11 doses, 12 doses, 13 doses, 14 doses, 15 doses, 16 doses, 17 doses, 18 doses, 19 doses, 20 doses, 21 doses, 22 doses, 23 doses, 24 doses or more. In some embodiments, the specified total period of time is 6-8 doses of the immune checkpoint inhibitor (e.g., pembrolizumab) in the adjuvant therapy. In some embodiments, the specified total period of time is seven doses of the immune checkpoint inhibitor (e.g., pembrolizumab) in the adjuvant therapy.
[0140] Individualized Neoantigen Vaccines
[0141] The adjuvant therapy, in some embodiments, comprises an individualized neoantigen vaccine. The term “individualized neoantigen vaccine” and “individualized neoantigen therapy” (or INT) are used interchangeably herein. An individualized neoantigen vaccine, as used herein, refers to a vaccine comprising a nucleic acid (e.g., an mRNA polynucleotide) encoding at least two neoepitopes specific to the subj ect’ s cancer. A neoantigen is a tumor-specific antigen that is present in a tumor of an individual that is not expressed or expressed at low levels in normal non-cancerous 131986-7101 tissue (e.g., blood, serum, plasma) of the subject. The neoantigen may or may not be present in tumors of other individuals. As used herein, “neoepitope” refers to an epitope of a neoantigen that is present in the tumor of the subject and not expressed or expressed at low levels in normal non- cancerous tissue of the subject. Herein, an individualized neoantigen vaccine may also be referred to as a “nucleic acid (cancer) vaccine” and / or an “mRNA (cancer) vaccine”.
[0142] For instance, the individualized neoantigen vaccine may include nucleic acids encoding a portion of one or more cancer antigens (e.g., neoantigens, tumor associated antigens) specific for each subject, referred to as neoepitopes. Cancer antigens are antigens expressed in or by cancer cells. Antigens that are expressed in or by tumor cells (e.g., of a malignant tumor) are referred to as “tumor associated antigens.” A particular tumor associated antigen may or may not also be expressed in non-cancerous cells. Many tumor mutations are well known in the art. Neoantigens (or tumor-specific antigens) are tumor associated antigens that are not expressed or rarely expressed in non-cancerous cells, or whose expression in non-cancerous cells is sufficiently reduced in comparison to that in cancerous cells and that induce an immune response induced upon vaccination. Neoepitopes, which are immunogenic portions of cancer antigens (neoantigens, tumor associated antigens), are ideally foreign to the body and thus would not normally produce an immune response against healthy tissue or be masked by the protective components of the immune system.
[0143] In some embodiments, individualized vaccines based on neoepitopes of neoantigens are desirable because such vaccines will maximize specificity against a subject’s specific tumor. Mutation-derived neoepitopes can arise from point mutations, non-synonymous mutations leading to different amino acids in the protein; read-through mutations in which a stop codon is modified or deleted, leading to translation of a longer protein with a novel tumor-specific sequence at the C- terminus; splice site mutations that lead to the inclusion of an intron in the mature mRNA and thus a unique tumor-specific protein sequence; chromosomal rearrangements that give rise to a chimeric protein with tumor-specific sequences at the junction of 2 proteins (i.e., gene fusion); frameshift mutations or deletions that lead to a new open reading frame with a novel tumor-specific protein sequence; and / or translocations.
[0144] The individualized neoantigen vaccines of the disclosure may encode one or more neoepitopes (which are portions of cancer antigens, also known as neoantigens). A neoepitope, also known as an antigenic determinant, as used herein, is a portion of an antigen (e.g., neoantigen) that is recognized by the immune system in the appropriate context, specifically by antibodies, B cells, or T cells. Neoepitopes may include B cell epitopes (e.g., predicted B cell reactive epitopes) 131986-7101 and / or T cell epitopes (e.g., predicted T cell reactive epitopes). B-cell epitopes (e.g., predicted B cell reactive epitopes) are peptide sequences which are required for recognition by specific antibody producing B-cells. B cell epitopes (e.g., predicted B cell reactive epitopes) refer to a specific region of the antigen that is recognized by an antibody. T-cell epitopes (e.g., predicted T cell reactive epitopes) are peptide sequences which, in association with proteins on APC, are required for recognition by specific T-cells. T cell epitopes (e.g., predicted T cell reactive epitopes) are processed intracellularly and presented on the surface of APCs, where they are bound to MHC molecules including MHC class II and MHC class I molecules. The portion of an antibody that binds to the epitope is called a paratope. An epitope may be a conformational epitope or a linear epitope, based on the structure and interaction with the paratope. A linear, or continuous, epitope is defined by the primary amino acid sequence of a particular region of a protein. The sequences that interact with the antibody are situated next to each other sequentially on the protein, and the epitope can usually be mimicked by a single peptide. Conformational epitopes are epitopes that are defined by the conformational structure of the native protein. These epitopes may be continuous or discontinuous (i.e., may be components of the epitope can be situated on disparate parts of the protein, which are brought close to each other in the folded native protein structure).
[0145] Each neoepitope (e.g., peptide epitope) may be any length that is reasonable for a neoepitope. In some embodiments, one or more predicted T cell reactive epitopes of the individualized neoantigen vaccine comprises between 8-11 amino acids. In some embodiments, one or more predicted T cell reactive epitope of the individualized neoantigen vaccine comprises between 13-25 amino acids. In some embodiments, one or more predicted B cell reactive epitope of the individualized neoantigen vaccine comprises between 13-17 amino acids. In some embodiments, one or more predicted B cell reactive epitope of the individualized neoantigen vaccine comprises between 13-25 amino acids.
[0146] In some embodiments, the length of each neoepitope in an individualized neoantigen vaccine is not necessarily equal. In some embodiments, each neoepitope in the individualized neoantigen vaccine is a different length. In certain embodiments, at least two (e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, and up to and including all) of the neoepitopes in the individualized neoantigen vaccine are different lengths.
[0147] In some embodiments, the length of at least one (such as one or more, two or more, or all) of the neoepitopes is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at 131986-7101 least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, or at least 100 amino acids. In other embodiments, the length of at least one of the neoepitopes is 100 or less, 95 or less, 90 or less, 85 or less, 80 or less, 75 or less, 70 or less, 65 or less, 60 or less, 55 or less, 50 or less, 45 or less, 40 or less, 35 or less, 30 or less, 25 or less, 20 or less, 15 or less,
[0148] 14 or less, 13 or less, 12 or less, 11 or less, 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, or 2 or less amino acids. In other embodiments, the length of at least one of the neoepitopes is up to 100, up to 95, up to 90, up to 85, up to 80, up to 75, up to 70, up to 65, up to 60, up to 55, up to 50, up to 45, up to 40, up to 35, up to 30, up to 25, up to 20, up to 15, or up to 10 amino acids. In some embodiments, the length of at least one of the neoepitopes is 25 amino acids. In some embodiments, the length of at least one of the neoepitopes is 15-25 amino acids. In some embodiments, the length of at least one of the neoepitopes is 20-25 amino acids. In some embodiments, the length of at least one of the neoepitopes is 25-35 amino acids. In some embodiments, the length of at least one of the neoepitopes is 13-25 amino acids. In some embodiments, the length of all of the neoepitopes is 13-25 amino acids.
[0149] In some embodiments, different percentages of neoepitope lengths are encoded by the nucleic acids. All of the percentages described in the following listings may be approximate (i.e., within 5% of the stated amount). The use of the terms “approximate” and “about” is equivalent.
[0150] In some embodiments, the percentages of neoepitope lengths encoded by the nucleic acids may be as follows: about 100% < 15 amino acids, about 0% > 15 amino acids; about 95% < 15 amino acids, about 5% > 15 amino acids; about 90% < 15 amino acids, about 10% > 15 amino acids; about 85% < 15 amino acids, about 15% > 15 amino acids; about 80% < 15 amino acids, about 20% > 15 amino acids; about 75% < 15 amino acids, about 25% > 15 amino acids; about 70% < 15 amino acids, about 30% > 15 amino acids; about 65% < 15 amino acids, about 35% >
[0151] 15 amino acids; about 60% < 15 amino acids, about 40% > 15 amino acids; about 55% < 15 amino acids, about 45% > 15 amino acids; about 50% < 15 amino acids, about 50% > 15 amino acids; about 45% < 15 amino acids, about 55% > 15 amino acids; about 40% < 15 amino acids, about 60% > 15 amino acids; about 35% < 15 amino acids, about 65% > 15 amino acids; about 30% < 15 amino acids, about 70% > 15 amino acids; about 25% < 15 amino acids, about 75% > 15 amino acids; about 20% < 15 amino acids, about 80% > 15 amino acids; about 15% < 15 amino acids, about 85% > 15 amino acids; about 10% < 15 amino acids, about 90% > 15 amino acids; about 5% 131986-7101
[0152] < 15 amino acids, about 95% > 15 amino acids; or about 0% < 15 amino acids, about 100% > 15 amino acids.
[0153] In some embodiments, the neoepitope lengths may be categorized in one of the following groups (for atotal of 100%): 8-12 amino acids, 13-17 amino acids, 18-21 amino acids, 13-25 amino acids, 22-26 amino acids, or 27-31 amino acids. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 8-12 amino acids in length. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 13-17 amino acids in length. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 18-21 amino acids in length. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 13-25 amino acids in length. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 22-26 amino acids in length. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 27-31 amino acids in length. Several non-limiting examples of the percentages of neoepitope lengths encoded by the open reading frames of the nucleic acids follow.
[0154] In some embodiments, the neoepitopes comprise at least one MHC class I epitope and at least one MHC class II epitope. In some embodiments, at least 10% of the neoepitopes are MHC class I epitopes. In some embodiments, at least 20% of the neoepitopes are MHC class I epitopes. In some embodiments, at least 30% of the neoepitopes are MHC class I epitopes. In some embodiments, at least 40% of the neoepitopes are MHC class I epitopes. In some embodiments, at least 0%, 60%, 70%, 80%, 90%, or 100% of the neoepitopes are MHC class I epitopes.
[0155] In some embodiments, none (0%) of the neoepitopes are MHC class II epitopes. In some embodiments, at least 10% of the neoepitopes are MHC class II epitopes. In some embodiments, at least 20% of the neoepitopes are MHC class II epitopes. In some embodiments, at least 30% of the neoepitopes are MHC class II epitopes. In some embodiments, at least 40% of the neoepitopes are MHC class II epitopes. In some embodiments, at least 50%, 60%, 70%, 80%, 90% or 100% of the neoepitopes are MHC class II epitopes. 131986-7101
[0156] In some embodiments, the ratio of MHC class I epitopes to MHC class II epitopes is a ratio selected from about 10%:about 90%; about 20%:about 80%; about 30%:about 70%; about 40%:about 60%; about 50%:about 50%; about 60%:about 40%; about 70%:about 30%; about 80%: about 20%; about 90%: about 10% MHC class 1 : MHC class II epitopes. In some embodiments, the ratio of MHC class I : MHC class II epitopes is 1 : 1. In some embodiments, the ratio of MHC class I : MHC class II epitopes is 2: 1. In some embodiments, the ratio of MHC class I : MHC class II epitopes is 3: 1. In some embodiments, the ratio of MHC class I : MHC class II epitopes is 4: 1. In some embodiments, the ratio of MHC class I : MHC class II epitopes is 5: 1. In some embodiments, the ratio of MHC class II epitopes to MHC class I epitopes is a ratio selected from about 10%:about 90%; about 20%:about 80%; about 30%:about 70%; about 40%:about 60%; about 50%:about 50%; about 60%:about 40%; about 70%:about 30%; about 80%: about 20%; about 90%: about 10% MHC class II: MHC class I epitopes. In some embodiments, the ratio of MHC class II : MHC class I epitopes is 1 : 1. In some embodiments, the ratio of MHC class II : MHC class I epitopes is 1 :2. In some embodiments, the ratio of MHC class II : MHC class I epitopes is 1 :3. In some embodiments, the ratio of MHC class II : MHC class I epitopes is 1 :4. In some embodiments, the ratio of MHC class II : MHC class I epitopes is 1 :5.
[0157] The individualized neoantigen vaccine of the disclosure, in some aspects comprises an mRNA vaccine encoding multiple neoepitopes arranged in a head-to-tail structure. In some embodiments, the mRNA encodes multiple neoepitopes directly connected to one another without a spacer between the neoepitopes. In some embodiments, the mRNA encodes multiple neoepitopes with an amino acid spacer (e.g., a single amino acid spacer, a double amino acid spacer, a triple amino acid spacer, etc.) between the neoepitopes. In some embodiments, the mRNA encodes multiple neoepitopes wherein two or more neoepitopes are directly connected to one another (without a spacer), and two or more neoepitopes are connected with a single amino acid spacer between the neoepitopes. Additionally or alternatively, two or more neoepitopes may be connected by a short linker between the epitopes. The multiple neoepitopes may include both MHC class I epitopes and MHC class II epitopes.
[0158] The individualized neoantigen vaccine, in some aspects, comprises a nucleic acid encoding one or more neoepitopes that include a mutation causing a unique expressed peptide sequence. In some embodiments, a mutation causing a unique expressed peptide sequence may be, but is not limited to, an insertion, deletion, frameshift mutation, and / or splicing variant. In some embodiments, the nucleic acid individualized neoantigen vaccine encodes multiple neoepitopes including one or more single nucleotide polymorphism (SNP) mutations with flanking amino acids 131986-7101 on each side of the SNP mutation. In some embodiments, the number of flanking amino acids on each side of the SNP mutation may be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, or 30. In some embodiments, the SNP mutation is centrally located and the number of flanking amino acids on each side of the SNP mutation is approximately the same. In some embodiments, the SNP mutation does not have an equivalent number of flanking amino acids on each side. In some embodiments, a neoepitope of the individualized neoantigen vaccine comprises an SNP flanked by two Class I sequences, each sequence comprising seven amino acids. In some embodiments, a neoepitope of the individualized neoantigen vaccine comprises a SNP flanked by two Class II sequences, each sequence comprising 10 amino acids. In some embodiments, a neoepitope may comprise a centrally located SNP and flanks which are both Class I sequences, both Class II sequences, or one Class I and one Class II sequence.
[0159] In some embodiments, the neoepitopes are in the form of a concatemeric cancer antigen comprising neoepitopes. As used herein a “a concatemeric cancer antigen comprising neoepitopes” refers to a plurality of neoepitopes arranged in a head-to-tail structure, wherein each pair of adjacent neoepitopes independently may be linked together directly or via a linker. Any number of neoepitopes may be used. In certain embodiments, the neoepitopes are in the form of a concatemeric cancer antigen comprising 5-200 neoepitopes. In certain embodiments, the neoepitopes are in the form of a concatemeric cancer antigen comprising 5-130 neoepitopes. In certain embodiments, the neoepitopes are in the form of a concatemeric cancer antigen comprising 5-40 neoepitopes. In certain embodiments, the neoepitopes are in the form of a concatemeric cancer antigen comprising 7-34 neoepitopes. In some embodiments, the concatemeric cancer antigen comprises one or more of: a) the neoepitopes (e.g., the 5-200 or 5-130 or 5-40 or 7-34 neoepitopes) are interspersed by cleavage sensitive sites; and / or b) each neoepitope is linked directly to one another without a linker; and / or c) each neoepitope is linked to one or another with a single amino acid linker; and / or d) each neoepitope is linked to one or another with a short linker; and / or e) each neoepitope comprises 8-31 or 13-31 amino acids and includes one or more SNP mutations (e.g., a centrally located SNP mutation); and / or f) each neoepitope comprises 8-31 or 13-31 amino acids and includes a mutation causing a unique expressed peptide sequence; and / or g) the nucleic acids encoding the neoepitopes are arranged such that the neoepitopes are ordered to minimize pseudo-epitopes, and / or h) no class II MHC molecule neoepitopes are present. A single open reading frame of a nucleic acid molecule (e.g., an mRNA) may encode a concatemeric cancer antigen comprising a plurality of neoepitopes. 131986-7101
[0160] It will be appreciated that a concatemer of 2 or more peptides, e.g., 2 or more neoepitopes, may create unintended new epitopes (pseudoepitopes) at peptide boundaries. To prevent or eliminate such pseudoepitopes, class I alleles may be scanned for hits across peptide boundaries in a concatemer. In some embodiments, the neoepitope order within the concatemer is shuffled to reduce or eliminate pseudoepitope formation. In some embodiments, a linker is used between neoepitopes, e.g., a single amino acid linker such as glycine (Gly) or a double amino acid linker such as Gly-Gly, to reduce or eliminate pseudoepitope formation. In some embodiments, anchor amino acids can be replaced with other amino acids which will reduce or eliminate pseudoepitope formation. In some embodiments, neoepitopes are trimmed at the peptide boundary within the concatemer to reduce or eliminate pseudoepitope formation.
[0161] In some embodiments, the multiple neoepitopes are arranged and ordered to minimize pseudoepitopes. In some embodiments, glycine insertion can be used to disrupt pseudoepitopes. In other embodiments, the multiple neoepitopes are a polypeptide that is free of pseudoepitopes. When the cancer antigen epitopes (e.g., neoepitopes) are arranged in a concatemeric structure in a head to tail formation, a junction is formed between each of the cancer antigen epitopes. That includes several, e.g., 1-10, amino acids from a neoepitope on a N-terminus of the peptide and several, e.g., 1-10, amino acids on a C-terminus of an adjacent directly linked neoepitope. It is important that the junction not be an immunogenic peptide that may produce an immune response. In some embodiments, the junction forms a peptide sequence that binds to an HLA protein of a subject for which the individualized neoantigen vaccine is designed with an IC50 greater than about 50 nM. In other embodiments, the junction peptide sequence binds to an HLA protein of a subject with an IC50 greater than about 10 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nm, or 500 nM.
[0162] In some embodiments, the mRNA of an individualized neoantigen vaccine as described herein comprises an open reading frame that encodes 5-34 neoepitopes arranged in a head-to-tail structure, optionally wherein each neoepitope has a length of 13-25 amino acids. As discussed in more detail below, the encoded neoepitopes may include MHC Class I epitopes and MHC class II epitopes, and typically will include more MHC Class I epitopes than MHC class II epitopes. As also discussed in more detail below, the encoded neoepitopes may be T cell epitopes.
[0163] Hotspot / Driver Mutations
[0164] In population analyses of cancer, certain mutations occur in a higher percentage of patients than would be expected by chance. These “recurrent” or “hotspot” mutations have often been shown to have a “driver” role in the tumor, producing some change in the cancer cell function that 131986-7101 is important to tumor initiation, maintenance, or metastasis, and is therefore selected for in the evolution of the tumor. These mutations are often also termed “driver” mutations. In addition to their importance in tumor biology and therapy, recurrent mutations provide the opportunity for precision medicine, in which the patient population is stratified into groups more likely to respond to a particular therapy, including but not limited to targeting the mutated protein itself.
[0165] Therefore, in some embodiments, the individualized neoantigen vaccine comprises or further comprises one or more cancer hotspot neoepitopes (e.g., comprising a driver mutation) as a subset of the individualized neoepitopes and, optionally, traditional cancer antigens. In some embodiments, one or more cancer hotspot neoepitopes are cancer hotspot antigens. In some embodiments, cancer hotspot mutations that occur over a threshold prevalence in an indication of interest are included in the vaccine. The threshold prevalence, in some embodiments, is greater than 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%.
[0166] In some embodiments, a nucleic acid (e.g., mRNA) individualized neoantigen vaccine provided herein encodes 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more peptides corresponding to driver mutations. In some embodiments, one or more of the driver mutations are present in the tumor of the subject and not expressed or expressed at low levels in normal non-cancerous tissue of the subject. In some embodiments, the nucleic acid (e.g., mRNA) individualized neoantigen vaccine encodes at least 5 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) neoepitopes corresponding to driver mutations. In some embodiments, the nucleic acid (e.g., mRNA) individualized neoantigen vaccine encodes fewer than 15 (e.g., 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0) neoepitopes corresponding to driver mutations.
[0167] Exemplary driver mutations are provided in Table B below.
[0168] Table B. Exemplary driver mutations 131986-7101
[0169] Much effort and research on recurrent mutations has focused on non-synonymous (or “missense”) single nucleotide variants (SNVs), but population analyses have revealed that a variety of more complex (non-SNV) variant classifications, such as synonymous (or “silent”), splice site, multi -nucleotide variants, insertions, and deletions, can also occur at high frequencies.
[0170] The p53 gene (official symbol TP53) is mutated more frequently than any other gene in human cancers. Large cohort studies have shown that, for most p53 mutations, the genomic position is unique to one or only a few patients and the mutation cannot be used as recurrent neoantigens for therapeutic vaccines designed for a specific population of patients. Surprisingly, a small subset of p53 loci do, however, exhibit a “hotspot” pattern, in which several positions in the gene are mutated with relatively high frequency. Strikingly, a large portion of these recurrently mutated regions occur near exon-intron boundaries, disrupting the canonical nucleotide sequence motifs recognized by the mRNA splicing machinery. Mutation of a splicing motif can alter the final mRNA sequence even if no change to the local amino acid sequence is predicted (i.e., for synonymous or intronic mutations). Therefore, these mutations are often annotated as “noncoding” by common annotation tools and neglected for further analysis, even though they may alter mRNA splicing in unpredictable ways and exert severe functional impact on the translated protein. If an alternatively spliced isoform produces an in-frame sequence change (i.e., no PTC is produced), it can escape depletion by NMD and be readily expressed, processed, and presented on the cell surface by the HLA system. Further, mutation-derived alternative splicing is usually “cryptic”, i.e., not expressed in normal tissues, and therefore may be recognized by T-cells as non-self neoantigens.
[0171] Additional Antigens (Traditional Cancer Antigens)
[0172] In some embodiments, the individualized neoantigen vaccines described herein may include or further include neoepitopes expressed by cancer-germline genes (e.g., antigens common to tumors found in multiple patients, referred to herein as “traditional cancer antigens” or “shared cancer antigens”). In some embodiments, a traditional antigen is one that is known to be found in cancers or tumors generally or in a specific type of cancer or tumor. In some embodiments, a traditional cancer antigen is a non-mutated tumor antigen. In some embodiments, a traditional cancer antigen is a mutated tumor antigen.
[0173] In some embodiments, the individualized neoantigen vaccines described herein may include neoepitopes based on cancer / testis (CT) antigens. Cancer / testis antigen expression is limited to male germ cells in healthy adults, but ectopic expression has been observed in tumor 131986-7101 cells of multiple types of human cancer. Since male germ cells are devoid of HLA-class I molecules and cannot present antigens to T cells, cancer / testis antigens are generally considered neoantigens when expressed in cancer cells and have the capacity to elicit immune responses that are strictly cancer-specific.
[0174] Cancer / testis antigens for use with the compositions and methods described herein may be any such cancer / testis antigen known in the field including, but not limited to, MAGEA1, MAGEA2, MAGEA3, MAGEA4, MAGEA5, MAGEA6, MAGEA8, MAGEA9, MAGEA10, MAGEA11, MAGEA12, BAGE, BAGE2, BAGE3, BAGE4, BAGE5, MAGEB1, MAGEB2, MAGEB5, MAGEB6, MAGEB3, MAGEB4, GAGE1, GAGE2A, GAGE3, GAGE4, GAGE5, GAGE6, GAGE7, GAGE8, SSX1, SSX2, SSX2b, SSX3, SSX4, CTAG1B, LAGE-lb, CTAG2, MAGECI, MAGEC3, SYCP1, BRDT, MAGEC2, SPANXA1, SPANXB1, SPANXC, SPANXD, SPANXN1, SPANXN2, SPANXN3, SPANXN4, SPANXN5, XAGE1D, XAGE1C, XAGE1B, XAGE1, XAGE2, XAGE3, XAGE-3b, XAGE-4 / RP11-167P23.2, XAGE5, DDX43, SAGE1, ADAM2, PAGE5, CT16.2, PAGE1, PAGE2, PAGE2B, PAGE3, PAGE4, LIPI, VENTXP1, IL13RA2, TSP50, CTAGE1, CTAGE-2, CTAGE5, SPA17, ACRBP, CSAG1, CSAG2, DSCR8, MMAlb, DDX53, CTCFL, LUZP4, CASC5, TFDP3, JARID1B, LDHC, M0RC1, DKKL1, SPO11, CRISP2, FMR1NB, FTHL17, NXF2, TAF7L, TDRD1, TDRD6, TDRD4, TEX15, FATE1, TPTE, CT45A1, CT45A2, CT45A3, CT45A4, CT45A5, CT45A6, H0RMAD1, H0RMAD2, CT47A1, CT47A2, CT47A3, CT47A4, CT47A5, CT47A6, CT47A7, CT47A8, CT47A9, CT47A10, CT47A11, CT47B1, SLCO6A1, TAG, LEMD1, HSPB9, CCDC110, ZNF165, SPACA3, CXorf48, THEG, ACTL8, NLRP4, COX6B2, LOC348120, CCDC33, LOC196993, PASD1, LOC647107, TULP2, CT66 / AA884595, PRSS54, RBM46, CT69 / BC040308, CT70 / BI818097, SPINLW1, TSSK6, ADAM29, CCDC36, LOC440934, SYCE1, CPXCR1, TSPY3, TSGA10, HIWI, MIWI, PIWI, PIWIL2, ARMC3, AKAP3, Cxorf61, PBK, C21orf99, OIP5, CEP290, CABYR, SPAG9, MPHOSPH1, ROPN1, PLAC1, CALR3, PRM1, PRM2, CAGE1, TTK, LY6K, IMP-3, AKAP4, DPPA2, KIAA0100, DCAF12, SEMG1, POTED, POTEE, POTEA, POTEG, POTEB, POTEC, POTEH, GOLGAGL2 FA, CDCA1, PEPP2, OTOA, CCDC62, GPATCH2, CEP55, FAM46D, TEX14, CTNNA2, FAM133A, LOC130576, ANKRD45, ELOVL4, IGSF11, TMEFF1, TMEFF2, ARX, SPEF2, GPAT2, TMEM108, NOL4, PTPN20A, SPAG4, MAEL, RQCD1, PRAME, TEX101, SPATAI 9, ODF1, ODF2, ODF3, ODF4, ATAD2, ZNF645, MCAK, SPAG1, SPAG6, SPAG8, SPAG17, FBXO39, RGS22, cyclin Al, C15orf60, CCDC83, TEKT5, NR6A1, TMPRSS12, TPPP2, PRSS55, DMRT1, EDAG, NDR, DNAJB8, CSAG3B, CTAG1A, GAGE12B, GAGE12C, GAGE12D, GAGE12E, 131986-7101
[0175] GAGE12F, GAGE12G, GAGE12H, GAGE12I, GAGE12J, GAGE13, LOC728137, MAGEA2B, MAGEA9B / LOC728269, NXF2B, SPANXA2, SPANXB2, SPANXE, SSX4B, SSX5, SSX6, SSX7, SSX9, TSPY1D, TSPY1E, TSPY1F, TSPY1G, TSPY1H, TSPY1I, TSPY2, XAGE1E, XAGE2B / CTD-2267G17.3, and / or variants thereof.
[0176] In some embodiments, the traditional cancer antigen is present in the tumor of the subject and not expressed or expressed at low levels in normal non-cancerous tissue of the subject, e.g., is a neoepitope of the subject.
[0177] In some embodiments, individualized neoantigen vaccines may further include one or more nucleic acids encoding one or more non-mutated tumor antigens. In some embodiments, the individualized neoantigen vaccines may further include one or more nucleic acids encoding one or more mutated tumor antigens.
[0178] Many tumor antigens are known in the art. Cancer or tumor antigens (e.g., traditional cancer antigens) for use with the compositions and methods described herein may be any such cancer or tumor antigens known in the field. In some embodiments, the cancer or tumor antigen (e.g., the traditional cancer antigen) is one of the following antigens: CD2, CD19, CD20, CD22, CD27, CD33, CD37, CD38, CD40, CD44, CD47, CD52, CD56, CD70, CD79, CD137, 4- IBB, 5T4, AGS-5, AGS-16, Angiopoietin 2, B2M, B7.1, B7.2, B7DC, B7H1, B7H2, B7H3, BT-062, BTLA, CAIX, Carcinoembryonic antigen, CTLA4, Cripto, ED-B, ErbBl, ErbB2, ErbB3, ErbB4, EGFL7, EpCAM, EphA2, EphA3, EphB2, FAP, Fibronectin, Folate Receptor, Ganglioside GM3, GD2, glucocorticoid-induced tumor necrosis factor receptor (GITR), gplOO, gpA33, GPNMB, ICOS, IGF1R, Integrin av, Integrin avP , LAG-3, Lewis Y, Mesothelin, c-MET, MN Carbonic anhydrase IX, MUC1, MUC16, Nectin-4, NKGD2, NOTCH, 0X40, OX40L, PD-1, PDL1, PSCA, PSMA, RANKL, ROR1, ROR2, SLC44A4, Syndecan-1, TACI, TAG-72, Tenascin, TIM3, TRAILR1 , TRAILR2,VEGFR- 1 , VEGFR-2, VEGFR-3, and / or variants thereof.
[0179] Additional Neoepitope Design Considerations
[0180] Epitopes (e.g., neoepitopes) can be identified using a free or commercial database (Lonza Epibase, antitope for example). Such tools are useful for predicting the most immunogenic epitopes within a target antigen protein (e.g., neoantigen). The selected peptides may then be synthesized and screened in human HLA panels, and the most immunogenic sequences are used to construct the nucleic acids encoding the neoepitope(s). One strategy for mapping epitopes of Cytotoxic T- Cells based on generating equimolar mixtures of the four C-terminal peptides for each nominal 11- mer across a protein. This strategy would produce a library antigen containing all the possible active CTL epitopes. 131986-7101
[0181] The neoepitopes may be designed to optimally bind to MHC in order to promote a robust immune response. In some embodiments, each neoepitope comprises an antigenic region and an MHC stabilizing region. An MHC stabilizing region is a sequence which stabilizes the peptide in the MHC.
[0182] All of the MHC stabilizing regions within the neoepitopes may be the same or they may be different. The MHC stabilizing regions may be at the N terminal portion of the neoepitope or the C terminal portion of the neoepitope. Alternatively, the MHC stabilizing regions may be in the central region of the neoepitope.
[0183] The MHC stabilizing region may be 5-10, 5-15, 8-10, 1-5, 3-7, or 3-8 amino acids in length. In yet other embodiments, the antigenic region is 5-100 amino acids in length. The peptides interact with the molecules of MHC class I by competitive affinity binding within the endoplasmic reticulum, before they are presented on the cell surface. The affinity of an individual peptide is directly linked to its amino acid sequence and the presence of specific binding motifs in defined positions within the amino acid sequence. The peptide being presented in the MHC is held by the floor of the peptide-binding groove, in the central region of the al / a2 heterodimer (a molecule composed of two nonidentical subunits). The sequence of residues of the peptide-binding groove’s floor determines which particular peptide residues it binds.
[0184] Optimal binding regions may be identified by a computer assisted comparison of the affinity of a binding site (MHC pocket) for a particular amino acid at each amino acid in the binding site for each of the target epitopes to identify an ideal binder for all of the examined antigens. The MHC stabilization regions of the epitopes may be identified using amino acid prediction matrices of data points for a binding site. An amino acid prediction matrix is a table having a first and a second axis defining data points. Prediction matrices can be generated as shown in Singh, H. and Raghava, G.P.S. (2001), “ProPred: prediction of HLA-DR binding sites.” Bioinformatics, 17(12), 1236-37). In some embodiments, the prediction matrix is based on evolutionary conservation. In some embodiments, the prediction matrix uses physiochemical similarity to examine how similar a somatic amino acid is to the germline amino acid (e.g., Kim et al., J Immunol. 2017: 3360-3368). The similarity of the somatic amino acid to the germline amino acid approximates how a mutation affects binding (e.g., T cell receptor recognition). In some embodiments, less similarity is indicative of improved binding (e.g., T cell receptor recognition).
[0185] In some embodiments, the MHC stabilizing region is designed based on the subject’s particular MHC. In that way, the MHC stabilizing region can be optimized for each subject. 131986-7101
[0186] The neoepitopes selected for inclusion in the individualized neoantigen vaccine will typically be high affinity binding peptides. In some aspects, the neoepitope binds an HLA protein with greater affinity than a wild-type peptide. The neoepitope has an IC50 of at least less than 5000 nM, at least less than 500 nM, at least less than 250 nM, at least less than 200 nM, at least less than 150 nM, at least less than 100 nM, at least less than 50 nM or less in some embodiments. Typically, neoepitopes with predicted IC50 <50 nM are generally considered medium to high affinity binding neoepitopes and will be selected for testing their affinity empirically using biochemical assays of HLA-binding. Finally, it will be determined whether the human immune system can mount effective immune responses against these mutated tumor antigens and thus effectively kill tumor but not normal cells.
[0187] In some embodiments, the neoepitopes are 13 residues or less in length and may comprise between about 8 and about 11 residues, particularly 9 or 10 residues. In some embodiments, the neoepitopes are 25 residues or less in length and may comprise between about 13 and about 25 residues, particularly 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 residues. In other embodiments, the neoepitopes may be designed to be longer. For instance, the neoepitopes may have extensions of 2-5 amino acids toward the N- and C-terminus of each corresponding gene product. The use of a longer peptide may allow endogenous processing by subject cells and may lead to more effective antigen presentation and induction of T cell responses.
[0188] Neoepitopes having the desired activity may be modified as necessary to provide certain desired attributes, e.g., improved pharmacological characteristics, while increasing or at least retaining substantially all of the biological activity of the unmodified peptide to bind the desired MHC molecule and activate the appropriate T cell or B cell. For instance, the neoepitopes may be subject to various changes, such as substitutions, either conservative or non-conservative, where such changes might provide for certain advantages in their use, such as improved MHC binding. By conservative substitutions is meant replacing an amino acid residue with another which is biologically and / or chemically similar, e.g., one hydrophobic residue for another, or one polar residue for another. The substitutions include combinations such as Gly, Ala; Vai, He, Leu, Met; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr. The effect of single amino acid substitutions may also be probed using D-amino acids. Such modifications may be made using well known peptide synthesis procedures, as described in e.g., Merrifield, Science 232:341-347 (1986), Barany & Merrifield, The Peptides, Gross & Meienhofer, eds. (N.Y., Academic Press), pp. 1-284 (1979); and Stewart & Young, Solid Phase Peptide Synthesis, (Rockford, Ill., Pierce), 2d Ed. (1984). 131986-7101
[0189] The neoepitopes can also be modified by extending or decreasing the compound’s amino acid sequence, e.g., by the addition or deletion of amino acids. The peptides, polypeptides or analogs can also be modified by altering the order or composition of certain residues, it being readily appreciated that certain amino acid residues essential for biological activity, e.g., those at critical contact sites or conserved residues, may generally not be altered without an adverse effect on biological activity.
[0190] Typically, a series of peptides with single amino acid substitutions are employed to determine the effect of electrostatic charge, hydrophobicity, etc. on binding. For instance, a series of positively charged (e.g., Lys or Arg) or negatively charged (e.g., Glu) amino acid substitutions are made along the length of the peptide revealing different patterns of sensitivity towards various MHC molecules and T cell or B cell receptors. In addition, multiple substitutions using small, relatively neutral moieties such as Ala, Gly, Pro, or similar residues may be employed. The substitutions may be homo-oligomers or hetero-oligomers. The number and types of residues which are substituted or added depend on the spacing necessary between essential contact points and certain functional attributes which are sought (e.g., hydrophobicity versus hydrophilicity). Increased binding affinity for an MHC molecule or T cell receptor may also be achieved by such substitutions, compared to the affinity of the parent peptide. In any event, such substitutions should employ amino acid residues or other molecular fragments chosen to avoid, for example, steric and charge interference which might disrupt binding.
[0191] The neoepitopes may also comprise isosteres of two or more residues in the neoepitopes. An isostere as defined here is a sequence of two or more residues that can be substituted for a second sequence because the steric conformation of the first sequence fits a binding site specific for the second sequence. The term specifically includes peptide backbone modifications well known to those skilled in the art. Such modifications include modifications of the amide nitrogen, the alpha-carbon, amide carbonyl, complete replacement of the amide bond, extensions, deletions or backbone crosslinks. See, generally, Spatola, Chemistry and Biochemistry of Amino Acids, Peptides and Proteins, Vol. VII (Weinstein ed., 1983).
[0192] The consideration of immunogenicity is an important component in the selection of neoepitopes for inclusion in a vaccine. As a set of non-limiting examples, immunogenicity may be assessed by analyzing the MHC binding capacity of a neoepitope, HLA promiscuity, mutation position, predicted T cell reactivity, actual T cell reactivity, structure leading to particular conformations and resultant solvent exposure, and representation of specific amino acids. 131986-7101
[0193] One important aspect of a neoepitope included in a vaccine is a lack of self-reactivity. The putative neoepitopes may be screened to confirm that the epitope is restricted to tumor tissue, for instance, arising as a result of genetic change within malignant cells. Ideally, the neoepitope should not be present in normal tissue of the subject and thus, self-similar epitopes are filtered out of the dataset. A personalized coding genome may be used as a reference for comparison of neoantigen candidates to determine lack of self-reactivity. In some embodiments, a personalized coding genome is generated from an individualized transcriptome and / or exome.
[0194] In some embodiments, the individualized neoantigen vaccine is composed of open reading frames that may encode any number of neoepitopes. In some embodiments, the individualized neoantigen vaccine comprises open reading frames encoding 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more,
[0195] 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more,
[0196] 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more,
[0197] 30 or more, 31 or more, 32 or more, 33 or more, 34 or more, 35 or more, 36 or more, 37 or more,
[0198] 38 or more, 39 or more, 40 or more, 45 or more, 50 or more, 55 or more, 60 or more, 65 or more,
[0199] 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, 95 or more, 100 or more, 105 or more,
[0200] 110 or more, 115 or more, 120 or more, 125 or more, 130 or more, 135 or more, 140 or more, 145 or more, 150 or more, 155 or more, 160 or more, 165 or more, 170 or more, 175 or more, 180 or more, 185 or more, 190 or more, 195 or more, or 200 or more neoepitopes. In other embodiments, the individualized neoantigen vaccine comprises open reading frames encoding 200 or less, 195 or less, 190 or less, 185 or less, 180 or less, 175 or less, 170 or less, 165 or less, 160 or less, 155 or less, 150 or less, 145 or less, 140 or less, 135 or less, 130 or less, 125 or less, 120 or less, 115 or less, 110 or less, 100 or less, 95 or less, 90 or less, 85 or less, 80 or less, 75 or less, 70 or less, 65 or less, 60 or less, 55 or less, 50 or less, 45 or less, 40 or less, 35 or less, 30 or less, 25 or less, 20 or less, 15 or less, or 10 or less, or 5 or less neoepitopes. In other embodiments, the individualized neoantigen vaccine comprises open reading frames encoding up to 200, up to 195, up to 190, up to 185, up to 180, up to 175, up to 170, up to 165, up to 160, up to 155, up to 150, up to 145, up to 140, up to 135, up to 130, up to 125, up to 120, up to 115, up to 110, up to 100, up to 95, up to 90, up to 85, up to 80, up to 75, up to 70, up to 65, up to 60, up to 55, up to 50, up to 45, up to 40, up to 35, up to 30, up to 25, up to 20, up to 15, up to 10 neoepitopes, up to 5 neoepitopes, or up to 3 neoepitopes.
[0201] In some embodiments, the individualized neoantigen comprises one open reading frame encoding up to 50 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 131986-7101
[0202] 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) neoepitopes. In some embodiments, the individualized neoantigen vaccine comprises one open reading frame encoding 20-40 (e.g., 25-40, 30-40, 30-35, 20-35, 20-30, 22-27, 26-31, 32-37, or 34-40) neoepitopes. In some embodiments, the individualized neoantigen vaccine comprises one open reading frame encoding 5-34 neoepitopes. For example, in some embodiments, the individualized neoantigen vaccine comprises one open reading frame encoding 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34.
[0203] In some embodiments, the individualized neoantigen vaccines and vaccination methods described herein include open reading frames that encode neoepitopes or neoantigens based on specific mutations and / or those expressed by cancer-germline genes (e.g., antigens common to tumors found in multiple patients). Some antigens that can be encoded by open reading frames of nucleic acid vaccines disclosed herein correspond to “driver mutations,” which initiate cancer formation or accelerate cancer progression. In some embodiments, the encoded neoepitopes or neoantigens of the nucleic acid vaccines do not correspond to, and / or do not comprise portions corresponding to “driver mutations”, e.g., such that the vaccine does not contain any driver mutations.
[0204] Administration of Individualized Neoantigen Vaccines
[0205] Once an mRNA vaccine is synthesized (e.g., as discussed in more detail below), it is administered to the subject. In some embodiments, the vaccine is administered on a schedule for up to two months, up to three months, up to four month, up to five months, up to six months, up to seven months, up to eight months, up to nine months, up to ten months, up to eleven months, up to 1 year, up to 1 and ’A years, up to two years, up to three years, or up to four years. The schedule may be the same or varied. In some embodiments, the schedule is weekly for the first 3 weeks and then monthly thereafter. In some embodiments, the individualized neoantigen vaccine is administered to subject weekly, every 2 weeks, every 3 weeks, every 4 weeks, every 5 fives, every 6 weeks, every 7 weeks, or every 8 weeks. In some embodiments, the individualized neoantigen vaccine, as part of the adjuvant therapy, is administered once every 3-5 weeks. In some embodiments, the individualized neoantigen vaccine, as part of the adjuvant therapy, is administered once every three weeks. In some embodiments, the individualized neoantigen vaccine is administered once every three weeks at a dose that administers about 1 mg of the mRNA per administration. 131986-7101
[0206] In some embodiments, the individualized neoantigen vaccine is administered to the subject on a regular basis (e.g., once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, etc.) for a specified total period of time, or until a particular endpoint is reached. The specified total period of time, in some embodiments, is the time corresponding to the administration of 2 doses, 3 doses, 4 doses, 5 doses, 6 doses, 7 doses, 8 doses, 9 doses, 10 doses, 11 doses, 12 doses, 13 doses, 14 doses, 15 doses, 16 doses, 17 doses, 18 doses, 19 doses, 20 doses, 21 doses, 22 doses, 23 doses, 24 doses or more. In some embodiments, the specified total period of time is 5-13, 6-12, 7-11, or 8-10 doses of the individualized neoantigen vaccine in the adjuvant therapy. In some embodiments, the specified total period of time is nine doses of the individualized neoantigen vaccine in the adjuvant therapy. In some embodiments, the subject is administered the individualized neoantigen vaccine in the adjuvant therapy once every three weeks for nine total doses.
[0207] In embodiments in which an immune response (e.g., an immune response to a tumor) is or is not detected to a specific antigen (e.g., a neoantigen), such detection or lack thereof can inform optimization of the vaccine (e.g., individualized neoantigen vaccine). For example, if an immune response to a specific neoantigen is not detected following administration of an individualized neoantigen vaccine encoding a neoepitope corresponding to that neoantigen, that neoepitope may be removed from the individualized neoantigen vaccine. Similarly, if a new immune response (or an increase in a preexisting immune response) to a specific neoantigen is detected following administration of an individualized neoantigen vaccine encoding a neoepitope corresponding to that neoantigen, more than one copy of that neoepitope may be encoded by an individualized neoantigen vaccine, and / or additional similar neoepitopes corresponding to that neoantigen may be added to the individualized neoantigen vaccine.
[0208] Methods for Preparation of Individualized Neoantigen Vaccines
[0209] In other aspects, the disclosure provides a method for preparing an individualized neoantigen vaccine, comprising a combination (e.g., some or all) of the following steps: a) identifying between 5-130 (or 5-40 or 7-34) neoantigens for a subject; b) determining the antitumor efficacy of at least two neoepitopes for each of the 5-130 (or 5-40 or 7-34) neoantigens; and c) preparing an individualized neoantigen vaccine in which the total anti-cancer efficacy of the individualized neoantigen vaccine is maximized e.g., the predicted total anti-cancer efficacy of 131986-7101 the individualized neoantigen vaccine is maximized) for a given total length of the individualized neoantigen vaccine.
[0210] Methods for generating individualized neoantigen vaccines according to the disclosure may involve identification of mutations using techniques such as deep nucleic acid or protein sequencing methods of tissue samples as described herein. In some embodiments, an initial identification of mutations in a subject’s (e.g., a patient’s) transcriptome is performed. The data from the subject’s (e.g., the patient’s) transcriptome is compared with sequence information from the subject’s (e.g., the patient’s) exome in order to identify patient-specific and tumor-specific mutations that are expressed. The comparison produces a dataset of putative neoepitopes, referred to as a mutanome. The mutanome may include approximately 100-10,000 candidate mutations per subject. In some embodiments, an mRNA neoantigen vaccine is designed and manufactured. The subject is then treated with the vaccine. In certain embodiments, such a neoantigen-containing vaccine may be a polycistronic vaccine including multiple neoepitopes or one or more single RNA vaccines or a combination thereof.
[0211] In some embodiments, the entire method from the initiation of the mutation identification process to the start of subject treatment is achieved in less than 2 months. In other embodiments, the whole process is achieved in 7 weeks or less, 6 weeks or less, 5 weeks or less, 4 weeks or less, 3 weeks or less, 2 weeks or less or less than 1 week. In some embodiments, the whole method is performed in less than 30 days.
[0212] In an individualized neoantigen vaccine, the subject-specific cancer antigens may be identified in a sample (biological sample) of a subject. The term “biological sample” refers to a sample that contains biological materials such as a DNA, an RNA and / or a protein. In some embodiments, the biological sample may suitably comprise a bodily fluid from a subject. The bodily fluids can be fluids isolated from anywhere in the body of the subject, preferably a peripheral location, including but not limited to, for example, blood, plasma, serum, urine, sputum, spinal fluid, cerebrospinal fluid, pleural fluid, nipple aspirates, lymph fluid, fluid of the respiratory, intestinal, and genitourinary tracts, tear fluid, saliva, breast milk, fluid from the lymphatic system, semen, cerebrospinal fluid, intra-organ system fluid, ascitic fluid, tumor cyst fluid, amniotic fluid and combinations thereof. In some embodiments, the sample may be a tissue sample or a tumor sample. For instance, a sample of one or more tumor cells may be examined for the presence of subject-specific cancer antigens. 131986-7101
[0213] At any point in the treatment, the subject may be examined to determine whether the mutations in the vaccine are still appropriate. Based on that analysis, the vaccine may be adjusted or reconfigured to include one or more different mutations or to remove one or more mutations.
[0214] It has been recognized and appreciated that, by analyzing certain properties of cancer associated mutations, optimal neoepitopes may be assessed and / or selected for inclusion in an individualized neoantigen vaccine. A property of a neoepitope or set of neoepitopes may include, for instance, an assessment of gene or transcript-level expression in subject RNA-seq or other nucleic acid analysis, tissue-specific expression in available databases, known oncogenes / tumor suppressors, variant call confidence score, RNA-seq allele-specific expression, conservative vs. non-conservative AA substitution, position of point mutation (Centering Score for increased TCR engagement), position of point mutation (Anchoring Score for differential HLA binding), Selfness: <100% core epitope homology with subject WES data, HLA-A and -B ICso for 8mers-l Imers, HLA-DRB1 ICso for 15mers-20mers, promiscuity Score (i.e., number of subject HLAs predicted to bind), HLA-C IC50 for 8mers-l Imers, HLA-DRB3-5 IC50 for 15mers-20mers, HLA-DQB1 / A1 IC50 for 15mers-20mers, HLA-DPB1 / A1 IC50 for 15mers-20mers, Class I vs Class II proportion, Diversity of subject HLA-A, -B and DRB1 allotypes covered, proportion of point mutation vs complex epitopes (e.g., frameshifts), and / or pseudo-epitope HLA binding scores.
[0215] In some embodiments, the properties of cancer-associated mutations used to identify neoepitopes are properties related to the type of mutation, abundance of mutation in subject sample, immunogenicity, lack of self-reactivity, and nature of peptide composition.
[0216] The type of mutation should be determined and considered as a factor in determining whether a putative epitope should be included in a vaccine. The type of mutation may vary. In some instances, it may be desirable to include multiple different types of mutations in a single vaccine. In other instances, a single type of mutation may be more desirable. A value for each particular mutation can be weighted and calculated. In some embodiments, a particular mutation is a single nucleotide polymorphism (SNP). In some embodiments, a particular mutation is a complex variant, for example, a peptide sequence resulting from intron retention, complex splicing events, or insertion / deletion mutations changing the reading frame of a sequence.
[0217] The abundance of the mutation in a subject sample may also be scored and factored into the decision of whether a putative epitope should be included in a vaccine. Highly abundant mutations may promote a more robust immune response.
[0218] In some embodiments, methods for generating individualized neoantigen vaccines comprise steps or methods described in International Patent Application Pub. No. 131986-7101
[0219] W02020 / 006242 (published January 2, 2020, entitled “PERSONALIZED CANCER VACCINE EPITOPE SELECTION”), the contents of which are herein incorporated by reference in their entirety for this purpose. In some embodiments, methods for generating individualized neoantigen vaccines comprise steps or methods described in International Patent Application Pub. No. WO2024 / 151811 (published July 18, 2024, entitled “PERSONALIZED CANCER VACCINE EPITOPE SELECTION”), the contents of which are herein incorporated by reference in their entirety for this purpose.
[0220] In some embodiments, a method to optimize an individualized neoantigen vaccine comprises a step of selecting a subset of neoepitopes encoded by an individualized neoantigen vaccine for inclusion in an optimized individualized neoantigen vaccine, e.g., based on their determined immunogenicity. The selection may, for example, result in exclusion of certain neoepitopes from the optimized individualized neoantigen vaccine, e.g., if they are poorly immunogenic in subject following administration of the unoptimized vaccine. The selection may also, for example, result in identification of certain neoantigen(s) (e.g., corresponding to certain neoepitope(s) of the unoptimized vaccine) that are represented multiple times (e.g., 2, 3, 4, 5, 6, 7, 9, or more times) in the optimized individualized neoantigen vaccine. In such embodiments, the multiple representations of the neoantigen(s) may involve expression of multiple copies of the same neoepitope by the nucleic acid (e.g., mRNA), or may involve expression of multiple distinct neoepitopes that each correspond to the same neoantigen(s). For example, if neoantigen A is selected for multiple representations in the optimized vaccine, neoepitope Al corresponding to neoantigen A may be encoded multiple times in the open reading frame of the nucleic acid (e.g., mRNA), or neoepitopes Al, A2, A3, etc., each corresponding to neoantigen A but with distinct amino acid sequences, may each be encoded in the open reading frame.
[0221] In some embodiments, a method to optimize an individualized neoantigen vaccine comprises selection of additional neoantigens from the subject but not represented in an unoptimized vaccine. This may include any neoantigens identified in the subject but that were excluded from the unoptimized vaccine. The selection of additional neoantigens can be made according to the methods provided herein. For example, one or more neoantigens having a lower predicted efficacy than those included in the unoptimized vaccine may be selected to be included in the optimized vaccine. Neoepitope(s) corresponding to the additional neoantigen(s), in some embodiments, are encoded by the optimized individualized neoantigen vaccine (e.g., an mRNA of the optimized individualized neoantigen vaccine). 131986-7101
[0222] In some embodiments, an optimized individualized neoantigen vaccine encodes more peptides corresponding to driver mutations (e.g., 1 more, 2 more, 3 more, 4 more, 5 more, 6 more, 7 more, 8 more, 9 more, 10 more, or more) relative to a corresponding unoptimized individualized neoantigen vaccine. In some embodiments, an optimized individualized neoantigen vaccine encodes fewer peptides corresponding to driver mutations (e.g., 1 fewer, 2 fewer, 3 fewer, 4 fewer, 5 fewer, 6 fewer, 7 fewer, 8 fewer, 9 fewer, 10 fewer, or more) relative to a corresponding unoptimized individualized neoantigen vaccine. In some embodiments, 1 or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) peptides corresponding to driver mutations are added to an optimized individualized neoantigen vaccine relative to a corresponding unoptimized individualized neoantigen vaccine. In some embodiments, 1 or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) peptides corresponding to driver mutations are removed from an optimized individualized neoantigen vaccine relative to a corresponding unoptimized individualized neoantigen vaccine.
[0223] In some embodiments, methods for optimizing individualized neoantigen vaccines comprise steps or methods described in International Patent Application Pub. No. W02020 / 006242 (published January 2, 2020, entitled “PERSONALIZED CANCER VACCINE EPITOPE SELECTION”), the contents of which are herein incorporated by reference in their entirety for this purpose. In some embodiments, methods for optimizing individualized neoantigen vaccines comprise steps or methods described in International Patent Application Pub. No. WO2024 / 151811 (published July 18, 2024, entitled “PERSONALIZED CANCER VACCINE EPITOPE SELECTION”), the contents of which are herein incorporated by reference in their entirety for this purpose.
[0224] In some embodiments, the individualized neoantigen vaccines described herein may be used for treatment of cancer (e.g., NSCLC). As one non-limiting example, the disclosure provides methods for treating a subject having NSCLC, comprising: a) analyzing a sample derived from the subject in order to identify one or more neoantigens (personalized neoantigens); b) determining the anti-tumor efficacy of at least two neoepitopes for each of the identified neoantigens; c) preparing an individualized neoantigen vaccine in which the total anti-cancer efficacy of the individualized neoantigen vaccine is maximized e.g., the predicted total anti-cancer efficacy of the individualized neoantigen vaccine is maximized) for a given total length of the individualized neoantigen vaccine; and d) administering the individualized neoantigen vaccine to the subject, and optionally further preparing an optimized individualized neoantigen vaccine and administering the individualized neoantigen vaccine to the subject. 131986-7101
[0225] In some embodiments, the individualized neoantigen vaccine may be administered with an anti-cancer therapeutic agent, for example, as part of an adjuvant therapy. The individualized neoantigen vaccine and anti-cancer therapeutic can be combined to enhance immune therapeutic responses. The individualized neoantigen vaccine and other therapeutic agent may be administered simultaneously or sequentially. When the other therapeutic agents (e.g., an immune checkpoint inhibitor) are administered simultaneously they can be administered in the same or separate formulations but are administered at the same time. The other therapeutic agents (e.g., immune checkpoint inhibitors) are administered sequentially with one another and with the individualized neoantigen vaccine, when the administration of the other therapeutic agents and the individualized neoantigen vaccine is temporally separated. The separation in time between administrations of these compounds may be a matter of minutes or it may be longer, e.g., hours, days, weeks, months. Other therapeutic agents include but are not limited to anti-cancer therapeutic, adjuvants, cytokines, antibodies, antigens, etc. Examples of anti-cancer therapeutics include, but are not limited to, DNA-alkylating agents (e.g., cyclophosphamide, ifosfamide), antimetabolites (e.g., methotrexate, a folate antagonist, and 5-fluorouracil, a pyrimidine antagonist), microtubule disrupters (e.g., vincristine, vinblastine, paclitaxel), DNA intercalators (e.g., doxorubicin, daunomycin, cisplatin), hormone therapy (e.g., tamoxifen, flutamide), and gene-targeted therapies, such as protein-tyrosine kinase inhibitors (e.g. imatinib; the EGFR kinase inhibitor, erlotinib). In some embodiments, the anti-cancer therapeutic is pembrolizumab.
[0226] In some embodiments, the progression of the cancer can be monitored to identify changes in the expressed neoantigens. Thus, in some embodiments, the method also involves at least one month after the administration of an individualized neoantigen mRNA vaccine, identifying at least two neoepitopes from a sample of the subject to produce a second set of neoepitopes, and administering to the subject an mRNA vaccine having an open reading frame encoding the second set of neoepitopes to the subject. The mRNA vaccine having an open reading frame encoding second set of neoepitopes, in some embodiments, is administered to the subject 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, 10 months, or 1 year after the mRNA vaccine having an open reading frame encoding the first set of neoepitopes. In other embodiments, the mRNA vaccine having an open reading frame encoding second set of neoepitope is administered to the subject 1 ’A, 2, 2 % , 3, 3 ’A, 4, 4 ’A, or 5 years after the mRNA vaccine having an open reading frame encoding the first set of neoepitopes. 131986-7101
[0227] Nucleic Acids / Polynucleotides
[0228] Individualized neoantigen vaccines, as provided herein, comprise at least one (one or more) nucleic acid having an open reading frame encoding at least one neoepitope. The term “nucleic acid,” in its broadest sense, includes any compound and / or substance that comprises a polymer of nucleotides. These polymers are also referred to as polynucleotides.
[0229] Nucleic acids may be or may include, for example, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a P-D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino-a-LNA having a 2'-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or chimeras or combinations thereof.
[0230] As a non-limiting example, when a DNA nucleic acid individualized neoantigen vaccine is delivered to a cell, the DNA is transcribed into RNA, and the RNA will be processed into a polypeptide by the intracellular machinery which can then process the polypeptide into immunosensitive fragments capable of stimulating an immune response against a tumor or population of cancerous cells. As a non-limiting example, when an RNA (e.g., mRNA) nucleic acid individualized neoantigen vaccine is delivered to a cell, the RNA (e.g., mRNA) will be processed into a polypeptide by the intracellular machinery which can then process the polypeptide into immunosensitive fragments capable of stimulating an immune response against a tumor or population of cancerous cells.
[0231] In some embodiments, nucleic acids function as messenger RNA (mRNA). “Messenger RNA” (mRNA) refers to any nucleic acid that encodes a (at least one) polypeptide (a naturally occurring, non-naturally-occurring, or modified polymer of amino acids) and can be translated to produce the encoded polypeptide in vitro, in vivo, in situ or ex vivo.
[0232] The basic components of an mRNA molecule typically include at least one coding region, a 5' untranslated region (UTR), a 3' UTR, a 5' cap, and a poly- A tail. Nucleic acids may function as mRNA but can be distinguished from wild-type mRNA in their functional and / or structural design features, which serve to overcome existing problems of effective polypeptide expression using nucleic-acid based therapeutics.
[0233] Polynucleotides, in some embodiments, are codon optimized. Codon optimization methods are known in the art and may be used as provided herein. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure 131986-7101 proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove / add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the protein to fold properly; or to reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art - nonlimiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and / or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using optimization algorithms.
[0234] In some embodiments, a codon optimized sequence shares less than 95% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide). In some embodiments, a codon optimized sequence shares less than 90% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide). In some embodiments, a codon optimized sequence shares less than 85% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide). In some embodiments, a codon optimized sequence shares less than 80% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide). In some embodiments, a codon optimized sequence shares less than 75% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide).
[0235] In some embodiments, a codon optimized sequence shares between 65% and 85% (e.g., between about 67% and about 85% or between about 67% and about 80%) sequence identity with a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide). In some embodiments, a codon optimized sequence shares between 65% and 75% or about 80% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally-occurring or 131986-7101 wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide).
[0236] In some embodiments, a codon optimized RNA may, for instance, be one in which the levels of G / C are enhanced. The G / C-content of nucleic acid molecules may influence the stability of the RNA. RNA having an increased amount of guanine (G) and / or cytosine (C) residues may be functionally more stable than nucleic acids containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides. WO02 / 098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modifications in the translated region. Due to the degeneracy of the genetic code, the modifications work by substituting existing codons for those that promote greater RNA stability without changing the resulting amino acid. The approach is limited to coding regions of the RNA.
[0237] Chemically Modified Nucleotide Sequences
[0238] An mRNA may include nucleotides that are not chemically modified (z.e., unmodified nucleotides), nucleotides that are chemically modified, or both. Nucleotides that are not chemically modified are the standard ribonucleotides consisting of adenosine, guanosine, cytidine, and uridine.
[0239] In some embodiments, the nucleic acid individualized neoantigen vaccine of the disclosure comprises one or more chemically modified nucleobases. Some aspects include modified polynucleotides comprising a polynucleotide described herein (e.g., a nucleic acid comprising a nucleotide sequence encoding one or more neoepitopes). The modified nucleic acids can be chemically modified and / or structurally modified. When the nucleic acids are chemically and / or structurally modified, the polynucleotides can be referred to as “modified nucleic acids.”
[0240] The present disclosure provides for modified nucleosides and nucleotides of a nucleic acid (e.g., RNA polynucleotides, such as mRNA polynucleotides) encoding one or more cancer neoepitopes. A “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). A “nucleotide” refers to a nucleoside including a phosphate group. Modified nucleotides can by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Nucleic acids can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides. 131986-7101
[0241] The skilled artisan will appreciate that, except where otherwise noted, nucleic acid sequences set forth in the instant application will recite “T”s in a representative DNA sequence but where the sequence represents RNA, the “T”s would be substituted for “U”s.
[0242] Individualized neoantigen vaccines comprise, in some embodiments, at least one nucleic acid (e.g., RNA) having an open reading frame encoding at least one (e.g., 5-200 or 5-130 or 5-40 or 7-34) neoepitope(s), wherein the nucleic acid comprises nucleotides and / or nucleosides that can be standard (unmodified) or modified as is known in the art. In some embodiments, nucleotides and nucleosides comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally occurring modified nucleotides and nucleosides or non-naturally occurring modified nucleotides and nucleosides. Such modifications can include those at the sugar, backbone, or nucleobase portion of the nucleotide and / or nucleoside as are recognized in the art.
[0243] In some embodiments, a naturally occurring modified nucleotide or nucleotide of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the MODOMICS database.
[0244] In some embodiments, a non-naturally occurring modified nucleotide or nucleoside of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found, inter alia, in International Patent Application Nos. PCT / US2012 / 058519; PCT / US2013 / 075177; PCT / US2014 / 058897; PCT / US2014 / 058891; PCT / US2014 / 070413; PCT / US2015 / 36773; PCT / US2015 / 36759; PCT / US2015 / 36771; or PCT / IB2017 / 051367 all of which are incorporated by reference herein for this purpose.
[0245] In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced to a cell or organism, exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.
[0246] In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.
[0247] Nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the nucleic acids to achieve desired functions or properties. The modifications 131986-7101 may be present on intemucleotide linkages, purine or pyrimidine bases, or sugars. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a nucleic acid may be chemically modified.
[0248] In some embodiments, modified nucleobases in mRNA comprise Nl-methyl- pseudouridine (mly), Nl-ethyl-pseudouridine (ely), 5-methoxy -uridine (mo5U), 5-methyl - uridine (m5U), 5-methyl-cytidine (m5C), and / or pseudouridine (y). In some embodiments, modified nucleobases in mRNAs comprise 5-methoxymethyl uridine, 5-methylthio uridine, 1- methoxymethyl pseudouridine, 5-methyl cytidine, and / or 5-methoxy cytidine. In some embodiments, the mRNA includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications.
[0249] In some embodiments, an RNA nucleic acid of the disclosure comprises 1-methyl- pseudouridine (m h| / ) substitutions at one or more or all uridine positions of the nucleic acid. In some embodiments, an RNA nucleic acid of the disclosure comprises nucleosides consisting of N1 -methylpseudouridine, adenosine, guanosine, and cytidine. In some embodiments 100% of uracil nucleosides in the open reading frame are N1 -methylpseudouridine.
[0250] In some embodiments, an RNA nucleic acid of the disclosure comprises 1-methyl- pseudouridine (m h| / ) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid. In some embodiments, an RNA nucleic acid of the disclosure comprises nucleosides consisting of Nl- methylpseudouridine, adenosine, guanosine, and 5-methyl cytidine. In some embodiments 100% of uracil nucleosides in the open reading frame are N1 -methylpseudouridine.
[0251] In some embodiments, an RNA nucleic acid of the disclosure comprises pseudouridine (y) substitutions at one or more or all uridine positions of the nucleic acid.
[0252] In some embodiments, an RNA nucleic acid of the disclosure comprises pseudouridine (y) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.
[0253] In some embodiments, an RNA nucleic acid of the disclosure comprises uridine at one or more or all uridine positions of the nucleic acid.
[0254] In some embodiments, a mRNA comprises 5-methyl-uridine and 5-methyl cytidine at one or more or all uridine and cytidine positions, respectively, of the mRNA.
[0255] In some embodiments, mRNAs are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a mRNA can be 131986-7101 uniformly modified with 1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above. In some embodiments, the ORF is uniformly modified for a particular modification, such as 1-methyl-pseudouridine. In some embodiments, the uniform modification does not include the mRNA cap. For instance, a cap with different modifications from the remainder of the mRNA can be added co-transcriptionally or post-transcriptionally to the mRNA.
[0256] In Vitro Transcription ofRNA (e.g., mRNA)
[0257] Individualized neoantigen vaccines may comprise at least one nucleic acid (e.g., an RNA polynucleotide, such as an mRNA (messenger RNA) or an mmRNA (modified mRNA)). mRNA, for example, is transcribed in vitro from template DNA, referred to as an “zn vitro transcription template.” cDNA encoding RNA polynucleotides may be transcribed using an in vitro transcription (IVT) system. In vitro transcription ofRNA is known in the art and is described in PCT Publication WO 2014 / 152027, which is incorporated by reference herein to the extent it discloses IVT methods. In some embodiments, the RNA is prepared in accordance with any one or more of the methods described in WO 2018 / 053209 and WO 2019 / 036682, each of which is incorporated by reference herein to the extent it discloses RNA production methods.
[0258] In some embodiments, the RNA transcript is generated using a non-amplified, linearized DNA template in an in vitro transcription reaction to generate the RNA transcript. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of an RNA polynucleotide, for example, but not limited to mRNA encoding at least one neoepitope. In some embodiments, cells, e.g., bacterial cells, e.g., E. coli, e.g., DH-1 cells are transfected with the plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA which is then isolated and purified. In some embodiments, the DNA template includes an RNA polymerase promoter, e.g., a T7 promoter located 5' to and operably linked to the gene of interest.
[0259] In some embodiments, an in vitro transcription template encodes a 5' untranslated (UTR) region, contains an open reading frame, and encodes a 3' UTR and a poly(A) tail. The particular nucleic acid sequence composition and length of an in vitro transcription template will depend on the mRNA encoded by the template. 131986-7101
[0260] An in vitro transcription system typically comprises a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor, and an RNA polymerase.
[0261] The NTPs may be manufactured in house, may be selected from a supplier, or may be synthesized. The NTPs may be selected from natural and unnatural NTPs, and may be selected from unmodified (e.g., ATP, GTP, UTP, CTP) or modified NTPs.
[0262] Any number of RNA polymerases or variants may be used to transcribe RNA. The polymerase may be selected from, but is not limited to, a phage RNA polymerase, e.g., a T7 RNA polymerase, a T3 RNA polymerase, a SP6 RNA polymerase, and / or mutant polymerases such as, but not limited to, polymerases able to incorporate modified nucleic acids and / or modified nucleotides, including chemically modified nucleic acids and / or nucleotides. Some embodiments exclude the use of DNase.
[0263] In some embodiments, the RNA transcript is capped via enzymatic capping. In some embodiments, the RNA comprises 5' terminal cap, for example, 7mG(5')ppp(5')NlmpNp.
[0264] In some embodiments the RNA polymerase is a wild-type RNA polymerase. In some embodiments, the RNA polymerase is an RNA polymerase variant, such as those described in WO 2020 / 172239, incorporated herein by reference to the extent it describes RNA polymerase variants. RNA polymerase variants may include at least one amino acid substitution, relative to the wildtype (WT) RNA polymerase.
[0265] Purification
[0266] Purification of the nucleic acids may include, but is not limited to, nucleic acid clean-up, quality assurance and quality control. Clean-up may be performed by methods known in the arts such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes (EXIQON® Inc, Vedbaek, Denmark); HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC- HPLC); and / or tangential flow filtration. The term “purified” when used in relation to a nucleic acid such as a “purified nucleic acid” refers to one that is separated from at least one contaminant. A “contaminant” is any substance that makes another unfit, impure or inferior. Thus, a purified nucleic acid (e.g., DNA and RNA) is present in a form or setting different from that in which it is found in nature, or a form or setting different from that which existed prior to subjecting it to a treatment or purification method. 131986-7101
[0267] Untranslated Regions (UTRs)
[0268] Untranslated regions (UTRs) are sections of a nucleic acid before a start codon (5' UTR) and after a stop codon (3' UTR) that are not translated. In some embodiments, a nucleic acid (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the disclosure comprising an open reading frame (ORF) encoding one or more neoepitopes further comprises one or more UTRs (e.g., a 5 ' UTR or functional fragment thereof, a 3 ' UTR or functional fragment thereof, or a combination thereof).
[0269] A UTR can be homologous or heterologous to the coding region in a nucleic acid. In some embodiments, the UTR is homologous to the ORF encoding the one or neoepitopes. In some embodiments, the UTR is heterologous to the ORF encoding the one or more neoepitopes. In some embodiments, the nucleic acid comprises two or more 5' UTRs or functional fragments thereof, each of which have the same or different nucleotide sequences. In some embodiments, the nucleic acid comprises two or more 3' UTRs or functional fragments thereof, each of which have the same or different nucleotide sequences.
[0270] In some embodiments, the 5' UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof is sequence optimized.
[0271] In some embodiments, the 5' UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, e.g., 5 -methoxyuracil.
[0272] UTRs can have features that provide a regulatory role, e.g., increased or decreased stability, localization, and / or translation efficiency. A nucleic acid comprising a UTR can be administered to a cell, tissue, or organism, and one or more regulatory features can be measured using routine methods. In some embodiments, a functional fragment of a 5' UTR or 3' UTR comprises one or more regulatory features of a full length 5' or 3' UTR, respectively.
[0273] Natural 5' UTRs bear features that play roles in translation initiation. They harbor signatures like Kozak sequences that are commonly known to be involved in the process by which the ribosome initiates translation of many genes. 5' UTRs also have been known to form secondary structures that are involved in elongation factor binding.
[0274] By engineering the features typically found in abundantly expressed genes of specific target organs, one can enhance the stability and protein production of a nucleic acid. For example, introduction of 5' UTR of liver-expressed mRNA, such as albumin, serum amyloid A, Apolipoprotein A / B / E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, can enhance expression of nucleic acids in hepatic cell lines or liver. Likewise, use of 5' UTRs from other 131986-7101 tissue-specific mRNA to improve expression in that tissue is possible for muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (e.g., Tie-1, CD36), for myeloid cells (e.g., C / EBP, AML1, G-CSF, GM-CSF, CDl lb, MSR, Fr-1, i-NOS), for leukocytes (e.g., CD45, CD18), for adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin), and for lung epithelial cells (e.g., SP-A / B / C / D).
[0275] In some embodiments, UTRs are selected from a family of transcripts whose proteins share a common function, structure, feature, or property. For example, an encoded polypeptide can belong to a family of proteins (i.e., that share at least one function, structure, feature, localization, origin, or expression pattern), which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of the genes or mRNA can be swapped for any other UTR of the same or different family of proteins to create a new nucleic acid.
[0276] In some embodiments, the 5' UTR and the 3' UTR can be heterologous. In some embodiments, the 5' UTR can be derived from a different species than the 3' UTR. In some embodiments, the 3' UTR can be derived from a different species than the 5' UTR.
[0277] International Patent Application No. PCT / US2014 / 021522 (Publ. No. WO2014 / 164253) provides a listing of exemplary UTRs that may be utilized in the nucleic acids as flanking regions to an ORF. This publication is incorporated by reference herein for this purpose.
[0278] Additional exemplary UTRs that may be utilized in the nucleic acids include, but are not limited to, one or more 5' UTRs and / or 3' UTRs derived from the nucleic acid sequence of a globin, such as an a- or P-globin (e.g., aXenopus, mouse, rabbit, or human globin); a strong Kozak translational initiation signal; a CYBA (e.g., human cytochrome b-245 a polypeptide); an albumin (e.g., human albumin); aHSD17B4 (hydroxysteroid (17-P) dehydrogenase); a virus (e.g., a tobacco etch virus (TEV), a Venezuelan equine encephalitis virus (VEEV), a Dengue virus, a cytomegalovirus (CMV; e.g., CMV immediate early 1 (IE1)), a hepatitis virus (e.g., hepatitis B virus), a sindbis virus, or a PAV barley yellow dwarf virus); a heat shock protein (e.g., hsp70); a translation initiation factor (e.g., elF4G); a glucose transporter (e.g., hGLUTl (human glucose transporter 1)); an actin (e.g., human a or P actin); a GAPDH; a tubulin; a histone; a citric acid cycle enzyme; a topoisomerase (e.g., a 5' UTR of a TOP gene lacking the 5' TOP motif (the oligopyrimidine tract)); a ribosomal protein Large 32 (L32); a ribosomal protein (e.g., human or mouse ribosomal protein, such as, for example, rps9); an ATP synthase (e.g., ATP5A1 or the P subunit of mitochondrial H+-ATP synthase); a growth hormone (e.g., bovine (bGH) or human (hGH)); an elongation factor (e.g., elongation factor 1 al (EEF1A1)); a manganese superoxide dismutase (MnSOD); a myocyte enhancer factor 2A (MEF2A); a P-Fl-ATPase, a creatine kinase, 131986-7101 a myoglobin, a granulocyte-colony stimulating factor (G-CSF); a collagen (e.g., collagen type I, alpha 2 (Coll A2), collagen type I, alpha 1 (Coll Al), collagen type VI, alpha 2 (Col6A2), collagen type VI, alpha 1 (C0I6AI)); a ribophorin (e.g., ribophorin I (RPNI)); a low density lipoprotein receptor-related protein (e.g., LRP1); a cardiotrophin-like cytokine factor (e.g., Nntl); calreticulin (Calr); a procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (Plodl); and a nucleobindin (e.g., Nucbl).
[0279] In some embodiments, the 5' UTR is selected from the group consisting of a P-globin 5' UTR; a 5' UTR containing a strong Kozak translational initiation signal; a cytochrome b-245 a polypeptide (CYBA) 5' UTR; a hydroxysteroid (17-P) dehydrogenase (HSD17B4) 5' UTR; a Tobacco etch virus (TEV) 5' UTR; a Venezuelan equine encephalitis virus (VEEV) 5' UTR; a 5' proximal open reading frame of rubella virus (RV) RNA encoding nonstructural proteins; a Dengue virus (DEN) 5' UTR; a heat shock protein 70 (Hsp70) 5' UTR; a eIF4G 5' UTR; a GLUT1 5' UTR; functional fragments thereof and any combination thereof.
[0280] In some embodiments, the 3' UTR is selected from the group consisting of a P-globin 3' UTR; a CYBA 3' UTR; an albumin 3' UTR; a growth hormone (GH) 3' UTR; a VEEV 3' UTR; a hepatitis B virus (HBV) 3' UTR; a-globin 3' UTR; a DEN 3' UTR; a PAV barley yellow dwarf virus (BYDV-PAV) 3' UTR; an elongation factor 1 al (EEF1 Al) 3' UTR; a manganese superoxide dismutase (MnSOD) 3' UTR; a P subunit of mitochondrial H(+)-ATP synthase (P-mRNA) 3' UTR; a GLUT1 3' UTR; a MEF2A 3' UTR; a P-Fl-ATPase 3' UTR; functional fragments thereof and combinations thereof.
[0281] In some embodiments, the 5' UTR comprises a sequence provided in Table C below or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 5' UTR sequence provided in the following Table, or a variant or a fragment thereof. 131986-7101 131986-7101
[0282] In some embodiments, the 3' UTR comprises a sequence provided in the following Table or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3' UTR sequence provided in Table UTR-2 below, or a variant or a fragment thereof. 131986-7101
[0283] In some embodiments, the polynucleotide comprises a stop element and 3 ’-UTR, wherein the sequence is (stop element is italicized):
[0284] UUL4GCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCC CCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUC UGAGUGGGCGGC (SEQ ID NO:32) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:32.
[0285] Wild-type UTRs derived from any gene or mRNA can be incorporated into the nucleic acids of the disclosure. In some embodiments, a UTR can be altered relative to a wild type or native UTR to produce a variant UTR, e.g., by changing the orientation or location of the UTR relative to the ORF; or by inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. In some embodiments, variants of 5' or 3' UTRs can be utilized, for example, mutants of wild type UTRs, or variants wherein one or more nucleotides are added to or removed from a terminus of the UTR.
[0286] Additionally, one or more synthetic UTRs can be used in combination with one or more non- synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 2013 8(3): 568-82, and sequences available at addgene.org / Derrick_Rossi / , the contents of each are incorporated herein by reference in their entirety. UTRs or portions thereof can be placed in the same orientation as in the transcript from which they were selected or can be altered in orientation or location. Hence, a 5' and / or 3' UTR can be inverted, shortened, lengthened, or combined with one or more other 5' UTRs or 3' UTRs.
[0287] In some embodiments, the nucleic acid may comprise multiple UTRs, e.g., a double, a triple or a quadruple 5' UTR or 3' UTR. For example, a double UTR comprises two copies of the same UTR either in series or substantially in series. For example, a double beta-globin 3' UTR can be 131986-7101 used (see, for example, US Patent Application Publication No. US2010 / 0129877, the contents of which are incorporated herein by reference for this purpose).
[0288] The nucleic acids of the disclosure can comprise combinations of features. For example, the ORF can be flanked by a 5' UTR that comprises a strong Kozak translational initiation signal and / or a 3' UTR comprising an oligo(dT) sequence for templated addition of a poly-A tail. A 5' UTR can comprise a first nucleic acid fragment and a second nucleic acid fragment from the same and / or different UTRs (see, e.g., US Patent Application Publication No. US2010 / 0293625, herein incorporated by reference in its entirety for this purpose).
[0289] Other non-UTR sequences can be used as regions or subregions within the nucleic acids of the disclosure. For example, introns or portions of intron sequences can be incorporated into the nucleic acids of the disclosure. Incorporation of intronic sequences can increase protein production as well as nucleic acid expression levels. In some embodiments, the nucleic acid of the disclosure comprises an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun. 2010 394(1): 189-193, the contents of which are incorporated herein by reference in their entirety). In some embodiments, the nucleic acid comprises an IRES instead of a 5' UTR sequence. In some embodiments, the nucleic acid comprises an ORF and a viral capsid sequence. In some embodiments, the nucleic acid comprises a synthetic 5' UTR in combination with a non-synthetic 3' UTR.
[0290] In some embodiments, the UTR can also include at least one translation enhancer nucleic acid, translation enhancer element, or translational enhancer elements (collectively, “TEE,” which refers to nucleic acid sequences that increase the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE can include those described in US Patent Application Publication No. US2009 / 0226470, incorporated herein by reference in its entirety for this purpose, and others known in the art. As a non-limiting example, the TEE can be located between the transcription promoter and the start codon. In some embodiments, the 5' UTR comprises a TEE. In one aspect, a TEE is a conserved element in a UTR that can promote translational activity of a nucleic acid such as, but not limited to, cap-dependent or cap-independent translation. In one non-limiting example, the TEE comprises the TEE sequence in the 5 '-leader of the Gtx homeodomain protein. See Chappell et al., PNAS 2004 101 :9590-9594, incorporated herein by reference in its entirety for this purpose.
[0291] The terms “translational enhancer polynucleotide” or “translation enhancer polynucleotide sequence” refer to a nucleic acid that includes one or more of the TEE provided herein and / or known in the art (see, e.g., US Patent Nos. US6310197, US6849405, US7456273, andUS7183395; 131986-7101
[0292] US Patent Application Publication Nos. US2009 / 0226470, US2007 / 0048776, US2011 / 0124100, US2009 / 0093049, and US2013 / 0177581; International Patent Application Publication Nos. W02009 / 075886, W02007 / 025008, WO2012 / 009644, W02001 / 055371, and WO1999 / 024595; and European Patent Application Publication Nos. EP2610341A1, and EP2610340A1; the contents of each of which are incorporated herein by reference in their entirety for this purpose), or their variants, homologs, or functional derivatives. In some embodiments, the nucleic acid of the disclosure comprises one or multiple copies of a TEE. The TEE in a translational enhancer nucleic acid can be organized in one or more sequence segments. A sequence segment can harbor one or more of the TEEs provided herein, with each TEE being present in one or more copies. When multiple sequence segments are present in a translational enhancer nucleic acid, they can be homogenous or heterogeneous. Thus, the multiple sequence segments in a translational enhancer nucleic acid can harbor identical or different types of the TEE provided herein, identical or different number of copies of each of the TEE, and / or identical or different organization of the TEE within each sequence segment. In some embodiments, the nucleic acid of the disclosure comprises a translational enhancer nucleic acid sequence.
[0293] In some embodiments, a 5' UTR and / or 3' UTR comprising at least one TEE described herein can be incorporated in a monocistronic sequence such as, but not limited to, a vector system or a nucleic acid vector. In some embodiments, a 5' UTR and / or 3' UTR of a polynucleotide of the disclosure comprises a TEE or portion thereof described herein. In some embodiments, the TEEs in the 3' UTR can be the same and / or different from the TEE located in the 5' UTR.
[0294] In some embodiments, a 5' UTR and / or 3' UTR of a nucleic acid of the disclosure can include at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. In some embodiments, the 5' UTR of a nucleic acid of the disclosure can include 1-60, 1-55, 1-50, 1-45, 1- 40, 1-35, 1-30, 1-25, 1-20, 1-15, 1-10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 TEE sequences. The TEE sequences in the 5' UTR of the nucleic acid of the disclosure can be the same or different TEE sequences. A combination of different TEE sequences in the 5' UTR of the nucleic acid of the disclosure can include combinations in which more than one copy of any of the different TEE sequences are incorporated.
[0295] In some embodiments, the 5' UTR and / or 3' UTR comprises a spacer to separate two TEE sequences. As a non-limiting example, the spacer can be a 15 nucleotide spacer and / or other 131986-7101 spacers known in the art (e.g. , in multiples of three nucleotides). As another non-limiting example, the 5' UTR and / or 3' UTR comprises a TEE sequence-spacer module repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, or more than 10 times in the 5' UTR and / or 3' UTR, respectively. In some embodiments, the 5' UTR and / or 3' UTR comprises a TEE sequence-spacer module repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times.
[0296] 3’ UTR and the AU Rich Elements
[0297] In certain embodiments, a nucleic acid (e.g., a nucleic acid encoding a neoepitope of the disclosure) further comprises a 3' UTR.
[0298] A 3'-UTR is the section of mRNA that immediately follows the translation termination codon and often contains regulatory regions that post-transcriptionally influence gene expression. Regulatory regions within the 3'-UTR can influence polyadenylation, translation efficiency, localization, and stability of the mRNA. In some embodiments, the 3'-UTR useful for the disclosure comprises a binding site for regulatory proteins or microRNAs. In some embodiments, the 3'-UTR has a silencer region, which binds to repressor proteins and inhibits the expression of the mRNA. In other embodiments, the 3'-UTR comprises an AU-rich element (AREs). Proteins bind AREs to affect the stability or decay rate of transcripts in a localized manner or affect translation initiation. In other embodiments, the 3'-UTR comprises the sequence AAUAAA that directs addition of several hundred adenine residues called the poly(A) tail to the end of the mRNA transcript.
[0299] Natural or wild type 3' UTRs are known to have stretches of Adenosines and Uridines embedded in them. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes (Chen et al., 1995): Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C-Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing this type of AREs include GM-CSF and TNF-a. Class III ARES do not contain an AUUUA motif. c-Jun and Myogenin are two well-studied examples of this class. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3' UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo. 131986-7101
[0300] Introduction, removal or modification of 3' UTR AU rich elements (AREs) can be used to modulate the stability of nucleic acids of the disclosure. When engineering specific nucleic acids, one or more copies of an ARE can be introduced to make nucleic acids of the disclosure less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein. Transfection experiments can be conducted in relevant cell lines, using nucleic acids of the disclosure and protein production can be assayed at various time points post-transfection. For example, cells can be transfected with different ARE- engineering molecules and by using an ELISA kit to the relevant protein and assaying protein produced at 6 hour, 12 hour, 24 hour, 48 hour, and 7 days post-transfection.
[0301] Regions having a 5' Cap
[0302] The nucleic acid individualized neoantigen vaccine described herein may be an mRNA individualized neoantigen vaccine comprising one or more mRNA having open reading frames that encode neoepitopes. Each of these mRNA may have a 5' Cap.
[0303] The 5' cap structure of a natural mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5' proximal introns during mRNA splicing.
[0304] Endogenous mRNA molecules can be 5 '-end capped generating a 5 '-ppp-5 '-triphosphate linkage between a terminal guanosine cap residue and the 5 '-terminal transcribed sense nucleotide of the mRNA molecule (cap). This 5 '-guanylate cap can then be methylated to generate an N7- methyl-guanylate residue (cap-0). The ribose sugars of the terminal and / or anteterminal transcribed nucleotides of the 5' end of the mRNA can optionally also be 2'-O-methylated (e.g., with a 2'-hydroxy group on the first ribose sugar (cap-1); or with a 2'-hydroxy group on the first two ribose sugars (cap-2)). 5 '-decapping through hydrolysis and cleavage of the guanylate cap structure can target a nucleic acid molecule, such as an mRNA molecule, for degradation.
[0305] In some embodiments, nucleic acids (e.g., a nucleic acid encoding a neoepitope) incorporate a cap moiety.
[0306] In some embodiments, nucleic acids (e.g., a nucleic acid encoding a neoepitope) comprise a non-hydrolyzable cap structure preventing decapping and thus increasing mRNA half-life. Because cap structure hydrolysis requires cleavage of 5 '-ppp-5' phosphodiester linkages, modified nucleotides can be used during the capping reaction. For example, a Vaccinia Capping Enzyme 131986-7101 from New England Biolabs (Ipswich, MA) can be used with a-thio-guanosine nucleotides according to the manufacturer’s instructions to create a phosphorothioate linkage in the 5 '-ppp-5' cap. Additional modified guanosine nucleotides can be used such as a-methyl-phosphonate and seleno-phosphate nucleotides.
[0307] Additional modifications include, but are not limited to, 2'-O-methylation of the ribose sugars of 5 '-terminal and / or 5'-anteterminal nucleotides of the polynucleotide (as mentioned above) on the 2'-hydroxyl group of the sugar ring. Multiple distinct 5 '-cap structures can be used to generate the 5 '-cap of a nucleic acid molecule, such as a polynucleotide that functions as an mRNA molecule. Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (z.e., endogenous, wild-type or physiological) 5 '-caps in their chemical structure, while retaining cap function. Cap analogs can be chemically (ie., non-enzymatically) or enzymatically synthesized and / or linked to the polynucleotides of the disclosure.
[0308] For example, the Anti -Reverse Cap Analog (ARC A) cap contains two guanines linked by a 5 '-5 '-triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3'-O- methyl group (z.e., N7,3'-O-dimethyl-guanosine-5 '-triphosphate-5 '-guanosine (m7G-3'mppp-G; which can equivalently be designated 3' O-Me-m7G(5')ppp(5')G). The 3'-0 atom of the other, unmodified, guanine becomes linked to the 5 '-terminal nucleotide of the capped polynucleotide. The N7- and 3 '-O-methlyated guanine provides the terminal moiety of the capped polynucleotide.
[0309] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on guanosine (ie., N7,2'-O-dimethyl-guanosine-5 '-triphosphate-5 '-guanosine, m7Gm-ppp-G).
[0310] In some embodiments, the cap is a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog can be modified at different phosphate positions with a boranophosphate group or a phophoroselenoate group such as the dinucleotide cap analogs described in U.S. Patent No. US 8,519,110, the contents of which are herein incorporated by reference in its entirety for this purpose.
[0311] In some embodiments, the cap is a cap analog is a N7-(4-chlorophenoxyethyl) substituted dicucleotide form of a cap analog known in the art and / or described herein. Non-limiting examples of a N7-(4-chlorophenoxyethyl) substituted dicucleotide form of a cap analog include a N7-(4- chlorophenoxyethyl)-G(5')ppp(5')G and a N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analog (see, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21 :4570-4574; the contents of which are 131986-7101 herein incorporated by reference in its entirety for this purpose). In some embodiments, a cap analog is a 4-chloro / bromophenoxyethyl analog.
[0312] While cap analogs allow for the concomitant capping of a polynucleotide or a region thereof, in an in vitro transcription reaction, up to 20% of transcripts can remain uncapped. This, as well as the structural differences of a cap analog from an endogenous 5 '-cap structures of nucleic acids produced by the endogenous, cellular transcription machinery, can lead to reduced translational competency and reduced cellular stability.
[0313] Nucleic acids of the disclosure (e.g., nucleic acids encoding neoepitopes) can also be capped post-manufacture (e.g., through IVT or chemical synthesis), using enzymes, in order to generate more authentic 5 '-cap structures. As used herein, the phrase “more authentic” refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a “more authentic” feature is better representative of an endogenous, wildtype, natural or physiological cellular function and / or structure as compared to synthetic features or analogs, etc., or which outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more respects. Non-limiting examples of more authentic 5 'cap structures are those that, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5' endonucleases and / or reduced 5 'decapping, as compared to synthetic 5 'cap structures known in the art (or to a wild-type, natural or physiological 5'cap structure). For example, recombinant Vaccinia Virus Capping Enzyme and recombinant 2'- O-methyltransferase enzyme can create a canonical 5 '-5 '-triphosphate linkage between the 5'- terminal nucleotide of a polynucleotide and a guanine cap nucleotide wherein the cap guanine contains an N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-O-methyl. Such a structure is termed the cap-1 structure. This cap results in a higher translational-competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5'cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5')ppp(5')N,pN2p (cap-0), 7mG(5')ppp(5')NlmpNp (cap-1), and 7mG(5')- ppp(5')NlmpN2mp (cap-2).
[0314] As a non-limiting example, capping chimeric nucleic acids post-manufacture can be more efficient as nearly 100% of the chimeric nucleic acids can be capped. This is in contrast to -80% when a cap analog is linked to a chimeric nucleic acid in the course of an in vitro transcription reaction.
[0315] According to the present disclosure, 5' terminal caps can include endogenous caps or cap analogs. According to the present disclosure, a 5' terminal cap can comprise a guanine analog. 131986-7101
[0316] Useful guanine analogs include, but are not limited to, inosine, Nl-methyl-guanosine, 2'fluoro- guanosine, 7-deaza-guanosine, 8 -oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2- azido-guanosine.
[0317] Poly-A Tails
[0318] In some embodiments, the nucleic acids (e.g., a nucleic acid encoding neoepitopes) further comprise a poly-A tail. In further embodiments, terminal groups on the poly-A tail can be incorporated for stabilization. In other embodiments, a poly-A tail comprises des-3 ' hydroxyl tails.
[0319] During RNA processing, a long chain of adenine nucleotides (poly-A tail) can be added to a nucleic acid such as an mRNA molecule in order to increase stability. Immediately after transcription, the 3' end of the transcript can be cleaved to free a 3' hydroxyl. Then poly-A polymerase adds a chain of adenine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A tail that can be between, for example, approximately 80 to approximately 250 residues long, including approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 residues long. In some embodiments, the poly A tail comprises about 100 nucleotides.
[0320] PolyA tails can also be added after the construct is exported from the nucleus.
[0321] According to the present disclosure, terminal groups on the poly A tail can be incorporated for stabilization. Polynucleotides can include des-3' hydroxyl tails. They can also include structural moieties or 2'-O-methyl modifications as taught by Junjie Li, et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the contents of which are incorporated herein by reference in its entirety for this purpose).
[0322] The nucleic acids can be designed to encode transcripts with alternative polyA tail structures including histone mRNA. According to Norbury, “[t]erminal uridylation has also been detected on human replication-dependent histone mRNAs. The turnover of these mRNAs is thought to be important for the prevention of potentially toxic histone accumulation following the completion or inhibition of chromosomal DNA replication. These mRNAs are distinguished by their lack of a 3' poly(A) tail, the function of which is instead assumed by a stable stem-loop structure and its cognate stem-loop binding protein (SLBP); the latter carries out the same functions as those of PABP on polyadenylated mRNAs” (Norbury, “Cytoplasmic RNA: a case of the tail wagging the dog,” Nature Reviews Molecular Cell Biology; AOP, published online 29 August 2013; doi: 10.1038 / nrm3645) the contents of which are incorporated herein by reference in its entirety for this purpose. 131986-7101
[0323] Unique poly-A tail lengths provide certain advantages to the nucleic acids. Generally, the length of a poly-A tail, when present, is greater than 30 nucleotides in length. In some embodiments, the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, or 3,000 nucleotides).
[0324] In some embodiments, the nucleic acid or region thereof includes from about 15 to about 3,000 nucleotides (e.g., from 15 to 50, 15 to 100, 15 to 200, 15 to 300, 15 to 400, 15 to 500, 15 to 600, 15 to 700, 15 to 800, 15 to 900, 15 to 1000, 15 to 1200, 15 to 1400, 15 to 1500, 15 to 1800, 15 to 2000, 15 to 2500, 15 to 3000, 50 to 100, 50 to 200, 50 to 300, 50 to 400, 50 to 500, 50 to 600, 50 to 700, 50 to 800, 50 to 900, 50 to 1000, 50 to 1200, 50 to 1400, 50 to 1500, 50 to 1800, 50 to 2000, 50 to 2500, 50 to 3000, 100 to 200, 100 to 300, 100 to 400, 100 to 500, 100 to 600, 100 to 700, 100 to 800, 100 to 900, 100 to 1000, 100 to 1200, 100 to 1400, 100 to 1500, 100 to 1800, 100 to 2000, 100 to 2500, 100 to 3000, 200 to 300, 200 to 400, 200 to 500, 200 to 600, 200 to 700, 200, to 800, 200 to 900, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 2500, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 2500, 1000 to 3000, 1500 to 3000, 2500 to 3000, or 2000 to 3000 nucleotides).
[0325] In some embodiments, the poly-A tail is designed relative to the length of the overall nucleic acid or the length of a particular region of the nucleic acid. This design can be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the nucleic acids.
[0326] In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the nucleic acid or feature thereof. The poly-A tail can also be designed as a fraction of the nucleic acid to which it belongs. In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a construct region or the total length of the construct minus the poly-A tail. Further, engineered binding sites and conjugation of nucleic acids for Poly-A binding protein can enhance expression.
[0327] Additionally, multiple distinct nucleic acids can be linked together via the PABP (Poly-A binding protein) through the 3 '-end using modified nucleotides at the 3 '-terminus of the poly-A tail. Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12 hours, 24 hours, 48 hours, 72 hours, and / or day 7 post-transfection.
[0328] In some embodiments, the nucleic acids are designed to include a polyA-G Quartet region. The G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed 131986-7101 by G-rich sequences in both DNA and RNA. In these embodiments, the G-quartet is incorporated at the end of the poly-A tail. The resultant nucleic acid is assayed for stability, protein production, and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production from an mRNA equivalent to at least 75% of that seen using a poly-A tail of 120 nucleotides alone (e.g., SEQ ID NO: 55).
[0329] Start Codon and Stop Codon Regions
[0330] The disclosure also includes a nucleic acid that comprises both a start codon region and the nucleic acid described herein (e.g., a nucleic acid comprising a nucleotide sequence encoding neoepitopes). In some embodiments, the nucleic acids can have regions that are analogous to or function like a start codon region.
[0331] In some embodiments, the translation of a nucleic acid can initiate on a codon that is not the start codon AUG. Translation of the nucleic acid can initiate on an alternative start codon such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of each of which are herein incorporated by reference in its entirety for this purpose).
[0332] As a non-limiting example, the translation of a nucleic acid begins on the alternative start codon ACG. As another non-limiting example, nucleic acid translation begins on the alternative start codon CTG or CUG. As yet another non-limiting example, the translation of a nucleic acid begins on the alternative start codon GTG or GUG.
[0333] Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to affect the translation efficiency, the length and / or the structure of the nucleic acid. (See, e.g., Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of which are herein incorporated by reference in its entirety for this purpose). Masking any of the nucleotides flanking a codon that initiates translation can be used to alter the position of translation initiation, translation efficiency, length, and / or structure of a polynucleotide.
[0334] The disclosure also includes a nucleic acid that comprises both a stop codon region and the nucleic acid described herein (e.g., a nucleic acid encoding neoepitopes). In some embodiments, the nucleic acids can include at least two stop codons before the 3 ' untranslated region (UTR). The stop codon can be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In some embodiments, the nucleic acids include the stop codon TGA in the case of DNA, or the stop codon UGA in the case of RNA, and one additional stop 131986-7101 codon. In some embodiments, the addition stop codon can be TAA or UAA. In some embodiments, the nucleic acids include three consecutive stop codons, four stop codons, or more.
[0335] Insertions and Substitutions
[0336] The disclosure also includes a nucleic acid that further comprises insertions and / or substitutions.
[0337] In some embodiments, the 5' UTR of the nucleic acid can be replaced by the insertion of at least one region and / or string of nucleosides of the same base. The region and / or string of nucleotides can include, but is not limited to, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 nucleotides and the nucleotides can be natural and / or unnatural. As a non-limiting example, the group of nucleotides can include 5-8 adenine, cytosine, thymine, a string of any of the other nucleotides disclosed herein and / or combinations thereof.
[0338] In some embodiments, the 5' UTR of the nucleic acid can be replaced by the insertion of at least two regions and / or strings of nucleotides of two different bases such as, but not limited to, adenine, cytosine, thymine, any of the other nucleotides disclosed herein, and / or combinations thereof. For example, the 5' UTR can be replaced by inserting 5-8 adenine bases followed by the insertion of 5-8 cytosine bases. In another example, the 5' UTR can be replaced by inserting 5-8 cytosine bases followed by the insertion of 5-8 adenine bases.
[0339] In some embodiments, the nucleic acid can include at least one substitution and / or insertion downstream of the transcription start site that can be recognized by an RNA polymerase. As a non-limiting example, at least one substitution and / or insertion can occur downstream of the transcription start site by substituting at least one nucleic acid in the region just downstream of the transcription start site (such as, but not limited to, +1 to +6). Changes to region of nucleotides just downstream of the transcription start site can affect initiation rates, increase apparent nucleotide triphosphate (NTP) reaction constant values, and increase the dissociation of short transcripts from the transcription complex curing initial transcription (Brieba et al, Biochemistry (2002) 41 : 5144- 5149; herein incorporated by reference in its entirety for this purpose). The modification, substitution, and / or insertion of at least one nucleoside can cause a silent mutation of the sequence or can cause a mutation in the amino acid sequence.
[0340] In some embodiments, the nucleic acid can include the substitution of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 guanine bases downstream of the transcription start site.
[0341] In some embodiments, the nucleic acid can include the substitution of at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 guanine bases in the region just downstream of the 131986-7101 transcription start site. As a non-limiting example, if the nucleotides in the region are GGGAGA, the guanine bases can be substituted by at least 1, at least 2, at least 3, or at least 4 adenine nucleotides. In another non-limiting example, if the nucleotides in the region are GGGAGA the guanine bases can be substituted by at least 1, at least 2, at least 3, or at least 4 cytosine bases. In another non-limiting example, if the nucleotides in the region are GGGAGA the guanine bases can be substituted by at least 1, at least 2, at least 3, or at least 4 thymine, and / or any of the nucleotides described herein.
[0342] In some embodiments, the nucleic acid can include at least one substitution and / or insertion upstream of the start codon. For the purpose of clarity, one of skill in the art would appreciate that the start codon is the first codon of the protein coding region whereas the transcription start site is the site where transcription begins. The nucleic acid can include, but is not limited to, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 substitutions and / or insertions of nucleotide bases. The nucleotide bases can be inserted or substituted at 1, at least 1, at least 2, at least 3, at least 4, or at least 5 locations upstream of the start codon. The nucleotides inserted and / or substituted can be the same base (e.g., all A, or all C, or all T, or all G), two different bases (e.g., A and C, A and T, or C and T), three different bases (e.g., A, C and T, or A, C and T) or at least four different bases.
[0343] As a non-limiting example, the guanine base upstream of the coding region in the nucleic acid can be substituted with adenine, cytosine, thymine, or any of the nucleotides described herein. In another non-limiting example, the substitution of guanine bases in the nucleic acid can be designed so as to leave one guanine base in the region downstream of the transcription start site and before the start codon (see Esvelt et al. Nature (2011) 472(7344): 499-503; the contents of which is herein incorporated by reference in its entirety for this purpose). As a non-limiting example, at least 5 nucleotides can be inserted at 1 location downstream of the transcription start site but upstream of the start codon and the at least 5 nucleotides can be the same base type.
[0344] According to the present disclosure, two regions or parts of a chimeric nucleic acid may be joined or ligated, for example, using triphosphate chemistry. In some embodiments, a first region or part of 100 nucleotides or less is chemically synthesized with a 5 '-monophosphate and terminal 3'-desOH or blocked OH. If the region is longer than 80 nucleotides, it may be synthesized as two or more strands that will subsequently be chemically linked by ligation. If the first region or part is synthesized as a non-positionally modified region or part using IVT, conversion to the 5'- monophosphate with subsequent capping of the 3 '-terminus may follow. Monophosphate protecting groups may be selected from any of those known in the art. A second region or part of 131986-7101 the chimeric nucleic acid may be synthesized using either chemical synthesis or IVT methods, e.g., as described herein. IVT methods may include use of an RNA polymerase that can utilize a primer with a modified cap. Alternatively, a cap may be chemically synthesized and coupled to the IVT region or part.
[0345] It is noted that for ligation methods, ligation with DNA T4 ligase followed by DNAse treatment (to eliminate the DNA splint required for DNA T4 Ligase activity) should readily prevent the undesirable formation of concatenation products.
[0346] The entire chimeric polynucleotide need not be manufactured with a phosphate-sugar backbone. If one of the regions or parts encodes a polypeptide, then it is preferable that such region or part comprise a phosphate-sugar backbone.
[0347] Ligation may be performed using any appropriate technique, such as enzymatic ligation, click chemistry, orthoclick chemistry, solulink, or other bioconjugate chemistries known to those in the art. In some embodiments, the ligation is directed by a complementary oligonucleotide splint. In some embodiments, the ligation is performed without a complementary oligonucleotide splint.
[0348] Individualized Neoantigen mRNA Vaccines
[0349] The disclosure, in some aspects, provides individualized neoantigen mRNA vaccines comprising an mRNA comprising an (at least one) open reading frame encoding an (at least one) neoepitope. The mRNA, in some embodiments, comprises a 5’ untranslated region (UTR), an open reading frame, and a 3’ UTR. In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail. In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, and the poly(A) tail comprises 105 adenosine nucleotides (e.g., SEQ ID NO:56). In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, and the poly(A) tail consists of 105 adenosine nucleotides. In some embodiments, the mRNA comprises a 5’ cap, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly(A) tail. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail. In some embodiments, the mRNA comprises a 5’ cap, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly(A) tail. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, and the poly(A) tail comprises 105 adenosine nucleotides. In some embodiments, the mRNA comprises a 5’ cap, wherein the 5’ cap 131986-7101 comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, and the poly(A) tail consists of 105 adenosine nucleotides.
[0350] The mRNA, in some embodiments, consists of the following nucleosides: adenosine, cytidine, guanosine, and N1 -methylpseudouridine. Therefore, in some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, and a 3’ UTR; and the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine.
[0351] In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail comprises 105 adenosine nucleotides; and the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine. In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail consists of 105 adenosine nucleotides; and the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine.
[0352] In some embodiments, the mRNA comprises a 5’ cap, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly(A) tail; and the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly(A) tail; and the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail comprises 105 adenosine nucleotides; and the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and Nl- methylpseudouridine. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail consists of 105 adenosine nucleotides; and the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine.
[0353] In some embodiments, the 5’ UTR comprises the following nucleotide sequence: AGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC (SEQ ID NO: 53). In some embodiments, the 3’ UTR comprises the following nucleotide sequence: CCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCU UUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 54).
[0354] Therefore, in some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, and a 3’ UTR; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, and the 5’ UTR comprises SEQ ID NO: 53. 131986-7101
[0355] In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail comprises 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, and the 5’ UTR comprises SEQ ID NO: 53. In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail consists of 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and Nl- methylpseudouridine, and the 5’ UTR comprises SEQ ID NO: 53.
[0356] In some embodiments, the mRNA comprises a 5’ cap, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly(A) tail; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, and the 5’ UTR comprises SEQ ID NO: 53. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly(A) tail; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, and the 5’ UTR comprises SEQ ID NO: 53. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail comprises 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and Nl- methylpseudouridine, and the 5’ UTR comprises SEQ ID NO: 53. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail consists of 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and Nl- methylpseudouridine, and the 5’ UTR comprises SEQ ID NO: 53.
[0357] Therefore, in some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, and a 3’ UTR; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, and the 3’ UTR comprises SEQ ID NO: 54.
[0358] In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail comprises 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, and the 3’ UTR comprises SEQ ID NO: 54. In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail consists of 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and Nl- methylpseudouridine, and the 3’ UTR comprises SEQ ID NO: 54. 131986-7101
[0359] In some embodiments, the mRNA comprises a 5’ cap, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly(A) tail; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, and the 3’ UTR comprises SEQ ID NO: 54. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly(A) tail; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, and the 3’ UTR comprises SEQ ID NO: 54. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail comprises 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and Nl- methylpseudouridine, and the 3’ UTR comprises SEQ ID NO: 54. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail consists of 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and Nl- methylpseudouridine, and the 3’ UTR comprises SEQ ID NO: 54.
[0360] Therefore, in some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, and a 3’ UTR; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, the 5’ UTR comprises SEQ ID NO: 53, and the 3’ UTR comprises SEQ ID NO: 54.
[0361] In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail comprises 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, the 5’ UTR comprises SEQ ID NO: 53, and the 3’ UTR comprises SEQ ID NO: 54. In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail consists of 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, the 5’ UTR comprises SEQ ID NO: 53, and the 3’ UTR comprises SEQ ID NO: 54.
[0362] In some embodiments, the mRNA comprises a 5’ cap, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly(A) tail; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, the 5’ UTR comprises SEQ ID NO: 53, and the 3’ UTR comprises SEQ ID NO: 54. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly(A) tail; the mRNA comprises nucleosides consisting of adenosine, 131986-7101 cytidine, guanosine, and N1 -methylpseudouridine, the 5’ UTR comprises SEQ ID NO: 53, and the
[0363] 3’ UTR comprises SEQ ID NO: 54. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly (A) tail, the poly(A) tail comprises 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, the 5’ UTR comprises
[0364] SEQ ID NO: 53, and the 3’ UTR comprises SEQ ID NO: 54. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, the poly(A) tail consists of 105 adenosine nucleotides; the mRNA comprises nucleosides consisting of adenosine, cytidine, guanosine, and N1 -methylpseudouridine, the 5’ UTR comprises SEQ ID NO: 53, and the 3’ UTR comprises SEQ ID NO: 54.
[0365] The open reading frame of the mRNA, in some embodiments, is 700-3,000 nucleotides in length. In some embodiments, the open reading frame is 800 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 900 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 1,000 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 1,100 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 1,200 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 1,300 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 1,400 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 1,500 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 1,600 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 1,700 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 1,800 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 1,900 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 2,000 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 2,100 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 2,200 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 2,300 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 2,400 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 2,500 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 2,600 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 2,700 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 2,800 to 3,000 nucleotides in length. In some embodiments, the open reading frame is 2,900 to 3,000 nucleotides in length. 131986-7101
[0366] In some embodiments, the open reading frame is 700 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 800 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 900 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 1,000 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 1,100 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 1,200 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 1,300 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 1,400 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 1,500 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 1,600 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 1,700 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 1,800 to 2,000 nucleotides in length. In some embodiments, the open reading frame is 1,900 to 2,000 nucleotides in length.
[0367] In some embodiments, the open reading frame is 700 to 1,500 nucleotides in length. In some embodiments, the open reading frame is 800 to 1,500 nucleotides in length. In some embodiments, the open reading frame is 900 to 1,500 nucleotides in length. In some embodiments, the open reading frame is 1,000 to 1,500 nucleotides in length. In some embodiments, the open reading frame is 1,100 to 1,500 nucleotides in length. In some embodiments, the open reading frame is 1,200 to 1,500 nucleotides in length. In some embodiments, the open reading frame is 1,300 to 1,500 nucleotides in length. In some embodiments, the open reading frame is 1,400 to 1,500 nucleotides in length.
[0368] The mRNA of the individualized neoantigen vaccine, in some embodiments, is formulated in a lipid delivery vehicle, such as lipid nanoparticle, as described in more detail herein.
[0369] Lipid Compositions
[0370] In some embodiments, the individualized neoantigen vaccines are formulated in a lipid delivery vehicle, such as a lipid nanoparticle, a liposome, and / or a lipoplex. In some embodiments, nucleic acids are formulated as lipid nanoparticle (LNP) compositions. Lipid nanoparticles typically comprise amino lipid, non-cationic lipid, structural lipid, and PEG lipid components along with the nucleic acid cargo of interest. The lipid nanoparticles can be generated using components, compositions, and methods as are generally known in the art, see for example, International Patent Application Nos. PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016000129; PCT / US2016 / 014280; PCT / US2017 / 038426; PCT / US2014 / 027077; PCT / US2014 / 055394; 131986-7101
[0371] PCT / US2016 / 52117; PCT / US2012 / 069610; PCT / US2017 / 027492; PCT / US2016 / 059575; PCT / US2016 / 069491; PCT / US2016 / 069493; and PCT / US2014 / 66242, all of which are incorporated by reference herein in their entirety.
[0372] In some embodiments, the lipid nanoparticle comprises a molar ratio of 20-60% ionizable lipid, 5-25% non-cationic lipid, 25-55% structural lipid, and 0.5-15% PEG-modified lipid.
[0373] In some embodiments, the lipid nanoparticle comprises a molar ratio of 20-60% ionizable lipid, 5-30% non-cationic lipid, 10-55% structural lipid, and 0.5-15% PEG-modified lipid.
[0374] In some embodiments, the lipid nanoparticle comprises 40-50 mol% ionizable lipid, optionally 45-50 mol%, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49- 50 mol% for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%.
[0375] In some embodiments, the lipid nanoparticle comprises 20-60 mol% ionizable lipid. For example, the lipid nanoparticle may comprise 20-50 mol%, 20-40 mol%, 20-30 mol%, 30-60 mol%, 30-50 mol%, 30-40 mol%, 40-60 mol%, 40-50 mol%, or 50-60 mol% ionizable lipid. In some embodiments, the lipid nanoparticle comprises 20 mol%, 30 mol%, 40 mol%, 50 mol%, or 60 mol% ionizable lipid. In some embodiments, the lipid nanoparticle comprises 35 mol%, 36 mol%, 37 mol%, 38 mol%, 39 mol%, 40 mol%, 41 mol%, 42 mol%, 43 mol%, 44 mol%, 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, 50 mol%, 51 mol%, 52 mol%, 53 mol%, 54 mol%, or 55 mol% ionizable lipid.
[0376] In some embodiments, the lipid nanoparticle comprises 45 - 55 mole percent (mol%) ionizable lipid. For example, lipid nanoparticle may comprise 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mol% ionizable lipid.
[0377] Ionizable lipids
[0378] In some embodiments, the ionizable lipid is a compound of Formula (IL*)
[0379] (IL*) or a salt thereof, wherein: 131986-7101
[0380] R1is -OH, -NRN-C4-IO cycloalkenyl optionally substituted with one or more oxo or -N(RNRN);
[0381] RNis H or Ci-6 alkyl;
[0382] RNis H or Ci-6 alkyl;
[0383] RNis H or Ci-6 alkyl; o is 1, 2, 3, or 4; n is 4, 5, 6, 7, or 8; m is 4, 5, 6, 7, or 8;
[0384] M is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R2;
[0385] M’ is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R3;
[0386] R2aR2b
[0387] R2is or -(Ci-6 alkylene)-(C3-8 cycloalkyl)-Ci-6 alkyl;
[0388] R2ais -H or Ci-io alkyl;
[0389] R2bis -H or Ci-io alkyl;
[0390] R2Cis Ci-8 alkyl or C2-8 alkenyl;
[0391] R3ais H or Ci-10 alkyl;
[0392] R3bis H or C1-8 alkyl; and
[0393] R3Cis Ci-10 alkyl or C2-8 alkenyl.
[0394] In some embodiments, the ionizable lipid is of Formula (IL**-I):
[0395] (IL**-I) or a salt thereof, wherein:
[0396] R1is -OH; o is 2, 3, or 4; n is 4, 5, 6, 7, or 8;
[0397] M is -C(=O)-O-*, wherein * indicates attachment to R2; 131986-7101 m is 6, 7, or 8;
[0398] M’ is -C(=O)-O-* , wherein * indicates attachment to R3;
[0399] R2Cis C4-8 alkyl;
[0400] R3ais C7-10 alkyl; and
[0401] R3Cis C3-5 alkyl.
[0402] In some embodiments, the ionizable lipid is of Formula (IL**-III):
[0403] (IL**-III) or a salt thereof, wherein:
[0404] R1is NRN-C4-IO cycloalkenyl optionally substituted with one or more oxo or -N(RNRN);
[0405] RNis H;
[0406] RNis C1-2 alkyl;
[0407] RN” is H; o is 2, 3, or 4; n is 6, 7, or 8;
[0408] M is -C(=O)-O-* , wherein * indicates attachment to R2; m is 6, 7, or 8;
[0409] M’ is -C(=O)-O-* , wherein * indicates attachment to R3;
[0410] R2ais C7-10 alkyl;
[0411] R2Cis C4-6 alkyl;
[0412] R3ais C 1-3 alkyl; and
[0413] R3Cis C4-6 alkyl.
[0414] In some embodiments, the ionizable lipid is of Formula (IL**-IV): 131986-7101
[0415] (IL**-IV) or a salt thereof, wherein:
[0416] R1is OH; o is 2, 3, or 4; n is 6, 7, or 8;
[0417] M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8;
[0418] M’ is -C(=O)-O-*, wherein * indicates attachment to R3;
[0419] R2bis C3-5 alkyl;
[0420] R2Cis C2-4 alkyl;
[0421] R3ais C7-10 alkyl; and
[0422] R3Cis C4-6 alkyl.
[0423] In some embodiments, the ionizable lipid is of Formula (IL*-I):
[0424] (IL*-Ia) or a salt thereof, wherein:
[0425] R1, o, m, n, M, M’, R2c, and R3care as defined for variable IL*; and R3ais C 1-8 alkyl.
[0426] In some embodiments, ionizable lipid is of Formula (IL*-Ia): 131986-7101
[0427] (IL*-Ia) or a salt thereof, wherein:
[0428] R1, o, m, n, M, M’, R2c, and R3care as defined for Formula IL*; and R3ais C i-8 alkyl.
[0429] In some embodiments, the ionizable lipid is of Formula (IL*-Ia’):
[0430] (IL*-Ia’) or a salt thereof, wherein: o, M, M’, R2Cand R3care as defined for variable IL*; and R3ais C i-8 alkyl.
[0431] In some embodiments, the ionizable lipid is of Formula (IL*-Iia):
[0432] (IL*-Iia) or a salt thereof, wherein:
[0433] R1, o, m, n, M, M’, R2c, and R3care as defined for Formula IL*; and R3ais C i-8 alkyl.
[0434] In some embodiments, the ionizable lipid is of Formula (IL*-IF): or a salt thereof, wherein: o, M, M’, R2Cand R3care as defined for variable IL*; and R3ais C 1-8 alkyl. 131986-7101
[0435] In some embodiments, the ionizable lipid is of Formula (IL*-III):
[0436] (IL*-III) or a salt thereof, wherein:
[0437] R1, o, m, n, M, M’, R2c, and R3care as defined for variable IL*;
[0438] R2ais a Ci-8 alkyl; and
[0439] R3ais C 1-8 alkyl.
[0440] In some embodiments, the ionizable lipid is of Formula (IL*-IIIa): or a salt thereof, wherein:
[0441] R1, o, m, n, M, M’, R2c, and R3care as defined for variable IL*;
[0442] R2bis a Ci-8 alkyl; and
[0443] R3ais C i-8 alkyl.
[0444] In some embodiments, the ionizable lipid is of Formula (IL*-IIIa): or a salt thereof, wherein:
[0445] R1, o, M, M’, R2C, and R3care as defined for variable IL*;
[0446] R2ais a Ci-8 alkyl; and
[0447] R3ais C i-8 alkyl. 131986-7101
[0448] In some embodiments, the ionizable lipid is of Formula (IL*-IIIa’):
[0449] (IL*-IIIa’) or a salt thereof, wherein:
[0450] R1, o, M, M’, R2C, and R3care as defined for variable IL*;
[0451] R2ais a Ci-8 alkyl; and
[0452] R3ais C i-8 alkyl.
[0453] In some embodiments, the ionizable lipid is of Formula (IL*-IIIb):
[0454] (IL*-IIIb) or a salt thereof, wherein:
[0455] R1, o, M, M’, R2C, and R3care as defined for variable IL*;
[0456] R2ais a Ci-8 alkyl; and
[0457] R3ais C i-8 alkyl.
[0458] In some embodiments, the ionizable lipid is of Formula (IL*-IIIb’):
[0459] (IL*-IIIb’) or a salt thereof, wherein:
[0460] R1, o, M, M’, R2C, and R3care as defined for variable IL*;
[0461] R2ais a Ci-8 alkyl; and
[0462] R3ais C 1-8 alkyl. 131986-7101
[0463] In some embodiments, the ionizable lipid is of Formula (IL*-IV):
[0464] (IL*-IV) or a salt thereof, wherein:
[0465] R1, o, m, n, M, M’, R2c, and R3care as defined for variable IL*;
[0466] R2bis a Ci-8 alkyl; and
[0467] R3ais C 1-8 alkyl.
[0468] In some embodiments, the ionizable lipid is of Formula (IL*-Iva):
[0469] (IL* -Iva) or a salt thereof, wherein:
[0470] R1, o, m, n, M, M’, R2c, and R3care as defined for variable IL*;
[0471] R2bis a Ci-8 alkyl; and
[0472] R3ais C i-8 alkyl.
[0473] In some embodiments, the ionizable lipid is of Formula (IL*-Iva’): or a salt thereof, wherein: o, M, M’, R2C, and R3care as defined for variable IL*;
[0474] R2ais a Ci-8 alkyl; and
[0475] R3ais C 1-8 alkyl. 131986-7101
[0476] Variables o, R1, RN, RN’, RN" of Ionizable Lipid
[0477] In some embodiments of the ionizable lipid, o is 1.
[0478] In some embodiments of the ionizable lipid, o is 2.
[0479] In some embodiments of the ionizable lipid, o is 3.
[0480] In some embodiments of the ionizable lipid, o is 4.
[0481] In some embodiments of the ionizable lipid, R1is -OH.
[0482] In some embodiments of the ionizable lipid, RNis H.
[0483] In some embodiments of the ionizable lipid, RNis methyl.
[0484] In some embodiments of the ionizable lipid, RNis ethyl.
[0485] In some embodiments of the ionizable lipid, R1is -NRN-cyclobutenyl, wherein the cyclobutenyl is optionally substituted with one or more oxo or -N(RNRN”).
[0486] In some embodiments of the ionizable lipid, RNis H.
[0487] In some embodiments of the ionizable lipid, RNis methyl.
[0488] In some embodiments of the ionizable lipid, RNis ethyl.
[0489] In some embodiments of the ionizable lipid, RNis H.
[0490] In some embodiments of the ionizable lipid, RNis methyl.
[0491] In some embodiments of the ionizable lipid, RNis ethyl.
[0492] In some embodiments of the ionizable lipid, RNis H and RNis methyl.
[0493] In some embodiments of the ionizable lipid,
[0494] In some embodiments of the ionizable lipid,
[0495] Variables m and n of the Ionizable Lipid
[0496] In some embodiments of the ionizable lipid, m is 4. In some embodiments of the ionizable lipid, m is 5. In some embodiments of the ionizable lipid, m is 6. In some embodiments of the ionizable lipid, m is 7.
[0497] In some embodiments of the ionizable lipid, m is 8. In some embodiments of the ionizable lipid, m is 4. 131986-7101
[0498] In some embodiments of the ionizable lipid, n is 5.
[0499] In some embodiments of the ionizable lipid, n is 6.
[0500] In some embodiments of the ionizable lipid, n is 7.
[0501] In some embodiments of the ionizable lipid, n is 8.
[0502] In some embodiments of the ionizable lipid, n is 5 and m is 7.
[0503] In some embodiments of the ionizable lipid, n is 7 and m is 7.
[0504] In some embodiments of the ionizable lipid, m is 6 and n is 6.
[0505] Variables M and M ’ of Ionizable Lipid
[0506] In some embodiments of the ionizable lipid, M is -O-C(=O)-*, wherein * indicates attachment to R2.
[0507] In some embodiments of the ionizable lipid, M is -C(=O)-O-* wherein * indicates attachment to R2.
[0508] In some embodiments of the ionizable lipid, M’ is -O-C(=O)-*, wherein * indicates attachment to R3.
[0509] In some embodiments of the ionizable lipid, M’ is -C(=O)-O-* wherein * indicates attachment to R3.
[0510] In some embodiments of the ionizable lipid, M is -O-C(=O)-*, wherein * indicates attachment to R2, and M’ is -C(=O)-O-* wherein * indicates attachment to R3
[0511] Variables R2, R2a, R2b, R2cof Ionizable Lipid
[0512] R2aR2b
[0513] In some embodiments of the ionizable lipid, R2is
[0514] In some embodiments of the ionizable lipid, R2ais hydrogen.
[0515] In some embodiments of the ionizable lipid, R2ais methyl.
[0516] In some embodiments of the ionizable lipid, R2ais ethyl.
[0517] In some embodiments of the ionizable lipid, R2ais propyl.
[0518] In some embodiments of the ionizable lipid, R2ais butyl.
[0519] In some embodiments of the ionizable lipid, R2ais pentyl.
[0520] In some embodiments of the ionizable lipid, R2ais hexyl.
[0521] In some embodiments of the ionizable lipid, R2ais heptyl.
[0522] In some embodiments of the ionizable lipid, R2ais octyl.
[0523] In some embodiments of the ionizable lipid, R2bis hydrogen. 131986-7101
[0524] In some embodiments of the ionizable lipid, R2bis methyl.
[0525] In some embodiments of the ionizable lipid, R2bis ethyl.
[0526] In some embodiments of the ionizable lipid, R2bis propyl.
[0527] In some embodiments of the ionizable lipid, R2bis butyl.
[0528] In some embodiments of the ionizable lipid, R2bis pentyl.
[0529] In some embodiments of the ionizable lipid, R2bis hexyl.
[0530] In some embodiments of the ionizable lipid, R2bis heptyl.
[0531] In some embodiments of the ionizable lipid, R2bis octyl.
[0532] In some embodiments of the ionizable lipid, R2ais hydrogen and R2bis hydrogen.
[0533] In some embodiments of the ionizable lipid, R2ais hexyl and R2bis hydrogen.
[0534] In some embodiments of the ionizable lipid, R2ais octyl and R2bis hydrogen.
[0535] In some embodiments of the ionizable lipid, R2ais hydrogen and R2bis butyl.
[0536] In some embodiments of the ionizable lipid, R2cis methyl.
[0537] In some embodiments of the ionizable lipid, R2cis ethyl.
[0538] In some embodiments of the ionizable lipid, R2cis propyl.
[0539] In some embodiments of the ionizable lipid, R2cis butyl.
[0540] In some embodiments of the ionizable lipid, R2cis pentyl.
[0541] In some embodiments of the ionizable lipid, R2cis hexyl.
[0542] In some embodiments of the ionizable lipid, R2cis heptyl.
[0543] In some embodiments of the ionizable lipid, R2cis octyl.
[0544] In some embodiments of the ionizable lipid, R2is -(Ci-6 alkylene)-(C3-8 cycloalkyl)-Ci-6 alkyl.
[0545] In some embodiments of the ionizable lipid, R2is -(Ci-6 alkylene)-(cyclohexyl)-Ci-6 alkyl.
[0546] In some embodiments of the ionizable lipid, R2is -(Ci-6 alkylene)-(cyclopentyl)-Ci-6 alkyl.
[0547] Variables R3, R3a, R3b, and R3cof Ionizable Lipid
[0548] In some embodiments of the ionizable lipid, R3is R3aR3b
[0549] In some embodiments of the ionizable lipid, R3ais hydrogen.
[0550] In some embodiments of the ionizable lipid, R3ais methyl.
[0551] In some embodiments of the ionizable lipid, R3ais ethyl.
[0552] In some embodiments of the ionizable lipid, R3ais propyl. 131986-7101
[0553] In some embodiments of the ionizable lipid, R3ais butyl.
[0554] In some embodiments of the ionizable lipid, R3ais pentyl.
[0555] In some embodiments of the ionizable lipid, R3ais hexyl.
[0556] In some embodiments of the ionizable lipid, R3ais heptyl.
[0557] In some embodiments of the ionizable lipid, R3ais octyl.
[0558] In some embodiments of the ionizable lipid, R3bis hydrogen.
[0559] In some embodiments of the ionizable lipid, R3bis methyl.
[0560] In some embodiments of the ionizable lipid, R3bis ethyl.
[0561] In some embodiments of the ionizable lipid, R3bis propyl.
[0562] In some embodiments of the ionizable lipid, R3bis butyl.
[0563] In some embodiments of the ionizable lipid, R3bis pentyl.
[0564] In some embodiments of the ionizable lipid, R3bis hexyl.
[0565] In some embodiments of the ionizable lipid, R3bis heptyl.
[0566] In some embodiments of the ionizable lipid, R3bis octyl.
[0567] In some embodiments of the ionizable lipid, R3ais octyl and R3bis hydrogen.
[0568] In some embodiments of the ionizable lipid, R3ais ethyl and R3bis hydrogen.
[0569] In some embodiments of the ionizable lipid, R3ais hexyl and R3bis hydrogen.
[0570] In some embodiments of the ionizable lipid, R3cis methyl.
[0571] In some embodiments of the ionizable lipid, R3cis ethyl.
[0572] In some embodiments of the ionizable lipid, R3cis propyl.
[0573] In some embodiments of the ionizable lipid, R3cis butyl.
[0574] In some embodiments of the ionizable lipid, R3cis pentyl.
[0575] In some embodiments of the ionizable lipid, R3cis hexyl.
[0576] In some embodiments of the ionizable lipid, R3cis heptyl.
[0577] In some embodiments of the ionizable lipid, R3cis octyl.
[0578] It is understood that, for an ionizable lipid, variables o, R1, RN, RN, RN, m, n, M, M’, R2, R2a, R2b, R2C, R3, R3a, R3b, and R3ccan each be, where applicable, selected from the groups described herein, and any group described herein for any of variables o,.R RN, RN, RN, m, n, M, M’, R2, R2a, R2b, R2C, R3, R3a, R3b, and R3ccan be combined, where applicable, with any group described herein for one or more of the remainder of variables o, R1, RN, RN, RN, m, n, M, M’, R2, R2a, R2b, R2C, R3, R3a, R3b, and R3c. 131986-7101
[0579] In some embodiments, the ionizable lipid is a compound selected from:
[0580] In some embodiments, the ionizable lipid is
[0581] In some embodiments, the ionizable lipid is
[0582] In some embodiments, the ionizable lipid is
[0583] In some embodiments, the ionizable lipid is
[0584] Without wishing to be bound by theory, it is understood that an ionizable lipid may have a positive or partial positive charge at physiological pH. Such lipids may be referred to as cationic or ionizable (amino)lipids. Lipids may also be zwitterionic, z.e., neutral molecules having both a positive and a negative charge.
[0585] Non-cationic (neutral) lipids (Phospholipids) 131986-7101
[0586] In certain embodiments, lipid nanoparticles comprise one or more non-cationic lipids. Noncationic lipids may be phospholipids. Phospholipids, as defined herein, are any lipids that comprise a phosphate group.
[0587] In some embodiments, the lipid nanoparticle comprises 5-25 mol% non-cationic lipid. For example, the lipid nanoparticle may comprise 5-20 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 15-20 mol%, or 20-25 mol% non-cationic lipid. In some embodiments, the lipid nanoparticle comprises 5 mol%, 10 mol%, 15 mol%, 20 mol%, or 25 mol% non-cationic lipid.
[0588] In some embodiments, a non-cationic lipid comprises l,2-distearoyl-sn-glycero-3- phosphocholine (DSPC), l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE), 1,2- dilinoleoyl-sn-glycero-3-phosphocholine (DLPc), 1,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC), l,2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3- phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), l-palmitoyl-2- oleoyl-sn-glycero-3 -phosphocholine (POPC), 1 ,2-di-O-octadecenyl-sn-glycero-3 -phosphocholine (18:0 Diether PC), l-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), l-hexadecyl-sn-glycero-3 -phosphocholine (Cl 6 Lyso PC), 1,2-dilinolenoyl-sn- glycero-3 -phosphocholine, 1 ,2-diarachidonoyl-sn-glycero-3 -phosphocholine, 1 ,2- didocosahexaenoyl-sn-glycero-3 -phosphocholine, l,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16.0 PE), l,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3 -phosphoethanolamine, l,2-dilinolenoyl-sn-glycero-3- phosphoethanolamine, l,2-diarachidonoyl-sn-glycero-3 -phosphoethanolamine, 1,2- didocosahexaenoyl-sn-glycero-3 -phosphoethanolamine, l,2-dioleoyl-sn-glycero-3-phospho-rac- (1 -glycerol) sodium salt (DOPG), sphingomyelin, or mixtures thereof.
[0589] In some embodiments, the lipid nanoparticle comprises 5-15 mol%, 5-10 mol%, or 10-15 mol% DSPC. For example, the lipid nanoparticle may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mol% DSPC.
[0590] As reflected in the discussion above, phospholipids are a subset of non-cationic lipids. The lipid component of a lipid nanoparticle composition may include one or more phospholipids, such as one or more (poly)unsaturated lipids. Phospholipids may assemble into one or more lipid bilayers. In general, phospholipids may include a phospholipid moiety and one or more fatty acid moieties. A phospholipid moiety may be selected from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, 131986-7101 phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin. A fatty acid moiety may be selected from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Non-natural species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid may be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group may undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions may be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye).
[0591] In some embodiments, the nanoparticle described herein comprises about 5 mol% to about 15 mol% of phospholipid. In some embodiments, the nanoparticle comprises about 8 mol% to about 13 mol% of phospholipid. In some embodiments, the nanoparticle comprises about 10 mol% to about 12 mol% of phospholipid.
[0592] Phospholipids useful or potentially useful in the compositions and methods may be selected from the non-limiting group consisting of:
[0593] 1.2-distearoyl-sn-glycero-3-phosphocholine (DSPC),
[0594] 1.2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE),
[0595] 1.2-dilinoleoyl-sn-glycero-3 -phosphocholine (DLPC),
[0596] 1.2-dimyristoyl-sn-glycero-phosphocholine (DMPC), l,2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC),
[0597] 1.2-diundecanoyl-sn-glycero-phosphocholine (DUPC), l-palmitoyl-2-oleoyl-sn-glycero-3 -phosphocholine (POPC),
[0598] 1.2-di-O-octadecenyl-sn-glycero-3 -phosphocholine (18:0 Diether PC), l-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), l-hexadecyl-sn-glycero-3 -phosphocholine (Cl 6 Lyso PC),
[0599] 1.2-dilinolenoyl-sn-glycero-3 -phosphocholine, 1 ,2-diarachidonoyl-sn-glycero-3 -phosphocholine,
[0600] 1.2-didocosahexaenoyl-sn-glycero-3 -phosphocholine,
[0601] 1.2-diphytanoyl-sn-glycero-3 -phosphoethanolamine (ME 16.0 PE),
[0602] 1.2-diphytanoyl-sn-glycero-3 -phosphocholine (4ME 16:0 PC), 131986-7101
[0603] 1.2-diphytanoyl-sn-glycero-3-phospho-(l'-rac-glycerol) (sodium salt) (4ME 16:0 PG),
[0604] 1.2-diphytanoyl-sn-glycero-3-phospho-L-serine (sodium salt) (4ME 16:0 PS),
[0605] 1.2-distearoyl-sn-glycero-3-phosphoethanolamine,
[0606] 1.2-dilinoleoyl-sn-glycero-3 -phosphoethanolamine,
[0607] 1.2-dilinolenoyl-sn-glycero-3 -phosphoethanolamine,
[0608] 1.2-diarachidonoyl-sn-glycero-3 -phosphoethanolamine,
[0609] 1.2-didocosahexaenoyl-sn-glycero-3 -phosphoethanolamine, and
[0610] 1.2-dioleoyl-sn-glycero-3-phospho-rac-(l -glycerol) sodium salt (DOPG), and sphingomyelin. Each possibility represents a separate embodiment of the present invention.
[0611] In some embodiments, a lipid nanoparticle composition includes DSPC. In certain embodiments, a lipid nanoparticle composition includes DOPE. In some embodiments, a lipid nanoparticle composition includes both DSPC and DOPE. In some embodiments, the lipid nanoparticle includes:
[0612] 1.2-diphytanoyl-sn-glycero-3 -phosphoethanolamine (4ME 16:0 PE) l,2-diphytanoyl-sn-glycero-3 -phosphocholine (4ME 16:0 PC) l,2-diphytanoyl-sn-glycero-3-phospho-(l'-rac-glycerol) (sodium salt) (4ME 16:0 PG), or l,2-diphytanoyl-sn-glycero-3-phospho-L-serine (sodium salt) (4ME 16:0 PS) mixture thereof.
[0613] Examples of phospholipids include, but are not limited to, the following: 131986-7101 ,
[0614] (Compound 440), , 131986-7101 .
[0615] In certain embodiments, a phospholipid useful or potentially useful in the present invention is an analog or variant of DSPC.
[0616] In certain embodiments, a phospholipid useful or potentially useful in the present invention is a compound of Formula (IX): or a salt thereof, wherein: each R1is independently H or optionally substituted alkyl; or optionally two R1are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R1are joined together with the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; 131986-7101 m is O, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;
[0617] A is of the formula: each instance of L2is independently a bond or optionally substituted Ci-6 alkylene, wherein one methylene unit of the optionally substituted Ci-6 alkylene is optionally replaced with -O-, -N(RN)- -S-, -C(O)-, -C(O)N(RN)- -NRNC(O)-, -C(O)O- -OC(O)-, -OC(O)O-
[0618] -OC(O)N(RN)-, -NRNC(O)O- or -NRNC(O)N(RN)-; each instance of R2is independently optionally substituted C1-30 alkyl, optionally substituted Ci-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N(RN)-, -O-, -S-, -C(O)-, -C(O)N(RN)-, -NRNC(O)-, -NRNC(O)N(RN)-, -C(O)O-, -OC(O)- , -OC(O)O-, -OC(O)N(RN)-, -NRNC(O)O-, -C(O)S-, -SC(O)-, -C(=NRN)-, -C(=NRN)N(RN)- , -NRNC(=NRN)-, -NRNC(=NRN)N(RN)-, -C(S)-, -C(S)N(RN)-, -NRNC(S)-, -NRNC(S)N(RN)- , -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(RN)S(O)-, -S(O)N(RN)-, -N(RN)S(O)N(RN)-, -OS(O)N(RN)-, -N(RN)S(O)O-, -S(O)2-, -N(RN)S(O)2- -S(O)2N(RN)-, -N(RN)S(O)2N(RN)-, -OS(O)2N(RN)- or -N(RN)S(O)2O-; each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;
[0619] Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2; provided that the compound is not of the formula: wherein each instance of R2is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl.
[0620] In certain embodiments, a phospholipid useful or potentially useful in the present invention is a compound of Formula (IX): 131986-7101
[0621] (IX), or a salt thereof, wherein: each R1is independently optionally substituted alkyl; or optionally two R1are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R1are joined together with the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is O, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;
[0622] A is of the formula: each instance of L2is independently a bond or optionally substituted Ci-6 alkylene, wherein one methylene unit of the optionally substituted Ci-6 alkylene is optionally replaced with -O-, -N(RN)- -S-, -C(O)-, -C(O)N(RN)- -NRNC(O)-, -C(O)O-, -OC(O)-, -OC(O)O-
[0623] -OC(O)N(RN)-, -NRNC(O)O-, or -NRNC(O)N(RN)-; each instance of R2is independently optionally substituted C1-30 alkyl, optionally substituted Ci-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N(RN)-, -O-, -S-, -C(O)-, -C(O)N(RN)-, -NRNC(O)-, -NRNC(O)N(RN)-, -C(O)O-, -OC(O)- , -OC(O)O-, -OC(O)N(RN)-, -NRNC(O)O-, -C(O)S-, -SC(O)-, -C(=NRN)-, -C(=NRN)N(RN)- , -NRNC(=NRN)-, -NRNC(=NRN)N(RN)-, -C(S)-, -C(S)N(RN)-, -NRNC(S)-, -NRNC(S)N(RN)- , -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(RN)S(O)-, -S(O)N(RN)-, -N(RN)S(O)N(RN)-, -OS(O)N(RN)-, -N(RN)S(O)O-, -S(O)2-, -N(RN)S(O)2- -S(O)2N(RN)-, -N(RN)S(O)2N(RN)-, -OS(O)2N(RN)- or -N(RN)S(O)2O-; each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;
[0624] Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2; 131986-7101 provided that the compound is not of the formula: wherein each instance of R2is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl.
[0625] In some embodiments, the phospholipid is selected from:
[0626] 1.2-distearoyl-sn-glycero-3-phosphocholine (DSPC),
[0627] 1.2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE),
[0628] 1.2-dilinoleoyl-sn-glycero-3 -phosphocholine (DLPC),
[0629] 1.2-dimyristoyl-sn-glycero-phosphocholine (DMPC),
[0630] 1.2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC),
[0631] 1.2-dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC),
[0632] 1.2-diundecanoyl-sn-glycero-phosphocholine (DUPC), l-palmitoyl-2-oleoyl-sn-glycero-3 -phosphocholine (POPC),
[0633] 1.2-di-O-octadecenyl-sn-glycero-3 -phosphocholine (18:0 Diether PC), l-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), l-hexadecyl-sn-glycero-3 -phosphocholine (Cl 6 Lyso PC),
[0634] 1.2-dilinolenoyl-sn-glycero-3 -phosphocholine,
[0635] 1.2-diarachidonoyl-sn-glycero-3 -phosphocholine,
[0636] 1.2-didocosahexaenoyl-sn-glycero-3 -phosphocholine,
[0637] 1.2-diphytanoyl-sn-glycero-3 -phosphoethanolamine (ME 16.0 PE),
[0638] 1.2-diphytanoyl-sn-glycero-3 -phosphocholine (4ME 16:0 PC),
[0639] 1.2-diphytanoyl-sn-glycero-3-phospho-(l'-rac-glycerol) (sodium salt) (4ME 16:0 PG),
[0640] 1.2-diphytanoyl-sn-glycero-3-phospho-L-serine (sodium salt) (4ME 16:0 PS),
[0641] 1.2-distearoyl-sn-glycero-3-phosphoethanolamine,
[0642] 1.2-dilinoleoyl-sn-glycero-3 -phosphoethanolamine,
[0643] 1.2-dilinolenoyl-sn-glycero-3-phosphoethanolamine,
[0644] 1.2-diarachidonoyl-sn-glycero-3 -phosphoethanolamine,
[0645] 1.2-didocosahexaenoyl-sn-glycero-3 -phosphoethanolamine,
[0646] 1.2-dioleoyl-sn-glycero-3-phospho-rac-(l -glycerol) sodium salt (DOPG), and Sphingomyelin. 131986-7101
[0647] In some embodiments, the phospholipid is DSPC, DOPE, or combinations thereof. In some embodiments, the phospholipid is DSPC. In some embodiments, the phospholipid is DOPE. In some embodiments, the phospholipid is 4ME 16:0 PE, 4ME 16:0 PC, 4ME 16:0 PG, 4ME 16:0 PS, or combination thereof.
[0648] In some embodiments, the phospholipid is N-lauroyl-D-erythro- sphinganylphosphorylcholine.
[0649] Phospholipid Head Modifications
[0650] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phospholipid head (e.g., a modified choline group). In certain embodiments, a phospholipid with a modified head is DSPC, or analog thereof, with a modified quaternary amine. For example, in embodiments of Formula (IX), at least one of R1is not methyl. In certain embodiments, at least one of R1is not hydrogen or methyl. In certain embodiments, the compound of Formula (IX) is of one of the following formulae: or a salt thereof, wherein: each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each u is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and each v is independently 1, 2, or 3.
[0651] In certain embodiments, the compound of Formula (IX) is of one of the following formulae:
[0652] 131986-7101 or a salt thereof. In certain embodiments, a compound of Formula (IX) is one of the following: 131986-7101
[0653] In certain embodiments, a compound of Formula (IX) is of Formula (IX-a):
[0654] (IX-a), or a salt thereof.
[0655] In certain embodiments, phospholipids useful or potentially useful in the present invention comprise a modified core. In certain embodiments, a phospholipid with a modified core described herein is DSPC, or analog thereof, with a modified core structure. For example, in certain embodiments of Formula (IX-a), group A is not of the following formula: 131986-7101
[0656] In certain embodiments, the compound of Formula (IX-a) is of one of the following formulae:
[0657] In certain embodiments, a compound of Formula (IX) is one of the following: p , 131986-7101 p , or salts thereof.
[0658] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a cyclic moiety in place of the glyceride moiety. In certain embodiments, a phospholipid useful in the present invention is DSPC, or analog thereof, with a cyclic moiety in place of the glyceride moiety. In certain embodiments, the compound of Formula (IX) is of Formula (IX -b):
[0659] (IX-b), or a salt thereof.
[0660] In certain embodiments, the compound of Formula (IX-b) is of Formula (IX-b-1):
[0661] (IX-b-1), or a salt thereof, wherein: w is 0, 1, 2, or 3.
[0662] In certain embodiments, the compound of Formula (IX-b) is of Formula (IX-b-2):
[0663] (IX-b-2), or a salt thereof.
[0664] In certain embodiments, the compound of Formula (IX-b) is of Formula (IX-b-3): 131986-7101
[0665] (IX-b-3), or a salt thereof.
[0666] In certain embodiments, the compound of Formula (IX-b) is of Formula (IX-b-4):
[0667] (IX -b-4), or a salt thereof.
[0668] In certain embodiments, the compound of Formula (IX -b) is one of the following:
[0669] Structural lipids
[0670] The lipid composition of a pharmaceutical composition can comprise one or more structural lipids. As used herein, the term “structural lipid” includes sterols and also to lipids containing sterol moieties.
[0671] Incorporation of structural lipids in the lipid nanoparticle may help mitigate aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, “sterols” are a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alphatocopherol. 131986-7101
[0672] In some embodiments, the structural lipids may be one or more of the structural lipids described in U.S. Patent No. 11,969,506, which is incorporated herein by reference to the extent it describes structural lipids.
[0673] In some embodiments, the lipid nanoparticle comprises a molar ratio of 25-55% structural lipid relative to the other lipid components. For example, the lipid nanoparticle may comprise a molar ratio of 10-55%, 25-50%, 25-45%, 25-40%, 25-35%, 25-30%, 30-55%, 30-50%, 30-45%, 30-40%, 30-35%, 35-55%, 35-50%, 35-45%, 35-40%, 40-55%, 40-50%, 40-45%, 45-55%, 45- 50%, or 50-55% structural lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 55% structural lipid.
[0674] In some embodiments, the lipid nanoparticle comprises 30-45 mol% sterol, optionally 35- 40 mol%, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 38-38 mol%, 38-39 mol%, or 39-40 mol%. In some embodiments, the lipid nanoparticle comprises 25-55 mol% sterol. For example, the lipid nanoparticle may comprise 25- 50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% sterol. In some embodiments, the lipid nanoparticle comprises 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% sterol.
[0675] In some embodiments, the lipid nanoparticle comprises 35 - 40 mol% cholesterol. For example, the lipid nanoparticle may comprise 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, or 40 mol% cholesterol.
[0676] Polyethylene glycol (PEG) and PEG-modified lipids
[0677] A lipid composition as described herein, such as a lipid nanoparticle composition, can comprise one or more polyethylene glycol (PEG)-modified lipids.
[0678] As used herein, the term “PEG-lipid” or “PEG-modified lipid” refers to polyethylene glycol (PEG)-modified lipids. Non-limiting examples of PEG-modified lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified l,2-diacyloxypropan-3-amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG-modified lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.
[0679] In some embodiments, the PEG-modified lipid includes, but not limited to 1,2-dimyristoyl- sn-glycerol methoxypolyethylene glycol (PEG-DMG), l,2-distearoyl-sn-glycero-3- 131986-7101 phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEGDAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-1, 2- dimyristyloxlpropyl-3-amine (PEG-c-DMA).
[0680] As noted above, the lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. A PEG lipid may be selected from the non-limiting group including PEG- modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG- DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid. In some embodiments, a PEG lipid is DMG-PEG 2k or Compound 428.
[0681] In some embodiments, the PEG lipid is PEG-DMG. In some embodiments, the PEG lipid is PEG-DMG 2k. In some embodiments, a PEG lipid has the structure:
[0682] DMG-PEG 2k has the following structure:
[0683] In some embodiments, the PEG-modified lipids are a modified form of PEG DMG. PEG- DMG has the following structure:
[0684] In some embodiments, the nanoparticle described herein comprises about 1 mol% to about 5 mol% of PEG-lipid. In some embodiments, the nanoparticle comprises about 1 mol% to about 2.5 mol% of PEG-lipid. 131986-7101
[0685] In certain embodiments, a PEG lipid useful in the present invention is a compound of Formula (VII). Provided herein are compounds of Formula (VII):
[0686] (VII), or salts thereof, wherein:
[0687] R3is -OR°;
[0688] R° is hydrogen, optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive;
[0689] L1is optionally substituted Ci-io alkylene, wherein at least one methylene of the optionally substituted Ci-io alkylene is independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -O-, -N(RN)-, -S-, -C(O)-, -C(O)N(RN)-, -NRNC(O)-, -C(O)O-, -OC(O)-, - OC(O)O-, -OC(O)N(RN)- -NRNC(O)O-, or -NRNC(O)N(RN)-;
[0690] D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions; m is O, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;
[0691] A is of the formula: each instance of L2is independently a bond or optionally substituted Ci-6 alkylene, wherein one methylene unit of the optionally substituted Ci-6 alkylene is optionally replaced with -O-, -N(RN)- -S-, -C(O)-, -C(O)N(RN)- -NRNC(O)-, -C(O)O-, -OC(O)-, -OC(O)O-
[0692] -OC(O)N(RN)-, -NRNC(O)O-, or -NRNC(O)N(RN)-; each instance of R2is independently optionally substituted C1-30 alkyl, optionally substituted Ci-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N(RN)-, -O-, -S-, -C(O)-, -C(O)N(RN)-, -NRNC(O)-, -NRNC(0)N(RN)-, -C(O)O-, -OC(O)- , -OC(O)O-, -OC(O)N(RN)-, -NRNC(O)O-, -C(O)S-, -SC(O)-, -C(=NRN)-, -C(=NRN)N(RN)- , -NRNC(=NRN)-, -NRNC(=NRN)N(RN)-, -C(S)-, -C(S)N(RN)-, -NRNC(S)-, -NRNC(S)N(RN)- , -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(RN)S(O)-, -S(O)N(RN)-, -N(RN)S(O)N(RN)-, -OS(O)N(RN)-, -N(RN)S(O)O-, -S(O)2-, -N(RN)S(O)2- -S(O)2N(RN)-, -N(RN)S(O)2N(RN)-, -OS(O)2N(RN)- or -N(RN)S(O)2O-; 131986-7101 each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;
[0693] Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2.
[0694] In certain embodiments, the compound of Formula (VII) is a PEG-OH lipid (ie., R3is -OR°, and R° is hydrogen). In certain embodiments, the compound of Formula (VII) is of Formula (VII-OH):
[0695] (VII-OH), or a salt thereof.
[0696] In certain embodiments, D is a moiety obtained by click chemistry (e.g., triazole). In certain embodiments, the compound of Formula (VII) is of Formula (VII-a-1) or (VII-a-2):
[0697] (VII-a-1) (VII-a-2), or a salt thereof.
[0698] In certain embodiments, the compound of Formula (VII) is of one of the following formulae: or a salt thereof, wherein s is O, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
[0699] In certain embodiments, the compound of Formula (VII) is of one of the following formulae:
[0700] I l l 131986-7101 or a salt thereof.
[0701] In certain embodiments, a compound of Formula (VII) is of one of the following formulae: or a salt thereof.
[0702] In certain embodiments, a compound of Formula (VII) is of one of the following formulae, wherein r is 1-100: 131986-7101 or a salt thereof.
[0703] In certain embodiments, D is a moiety cleavable under physiological conditions (e.g., ester, amide, carbonate, carbamate, urea). In certain embodiments, a compound of Formula (VII) is of Formula (VII-b-1) or (VII-b-2):
[0704] (VII-b-1) (VII-b-2), or a salt thereof. In certain embodiments, a compound of Formula (VII) is of Formula (VII-b-l-OH) or
[0705] (VII-b-2-OH):
[0706] (VII-b-l-OH) (VII-b-2-OH), or a salt thereof. In certain embodiments, the compound of Formula (VII) is of one of the following formulae: 131986-7101 or a salt thereof.
[0707] In certain embodiments, a compound of Formula (VII) is of one of the following formulae: or a salt thereof.
[0708] In certain embodiments, a compound of Formula (VII) is of one of the following formulae: or a salt thereof.
[0709] In certain embodiments, a compound of Formula (VII) is of one of the following formulae: p ), 131986-7101 or salts thereof.
[0710] In certain embodiments, a PEG lipid useful in the present invention is a PEGylated fatty acid. In certain embodiments, a PEG lipid useful in the present invention is a compound of Formula (VIII). Provided herein are compounds of Formula (VIII):
[0711] (VIII), or a salts thereof, wherein:
[0712] R3is-OR°;
[0713] R° is hydrogen, optionally substituted alkyl or an oxygen protecting group; r is an integer between 1 and 100, inclusive;
[0714] R5is optionally substituted C10-40 alkyl, optionally substituted C10-40 alkenyl, or optionally substituted C10-40 alkynyl; and optionally one or more methylene groups of R5are replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N(RN)-, -O-, -S-, -C(O)-, -C(O)N(RN)- -NRNC(O)-, -NRNC(O)N(RN)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(RN)- , -NRNC(O)O-, -C(O)S-, -SC(O)-, -C(=NRN)-, -C(=NRN)N(RN)-, -NRNC(=NRN)-, -NRNC(=NRN)N(RN)-, -C(S)-, -C(S)N(RN)- -NRNC(S)-, -NRNC(S)N(RN)-, -S(O)-, -OS(O)- , -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(RN)S(O)-, -S(O)N(RN)-, -N(RN)S(O)N(RN)-, -OS(O)N(RN)- -N(RN)S(O)O-, -S(O)2-, -N(RN)S(O)2-, -S(O)2N(RN)-, -N(RN)S(O)2N(RN)-, -OS(O)2N(RN)-, or -N(RN)S(O)2O-; and each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group.
[0715] In certain embodiments, the compound of Formula (VIII) is of Formula (VIII-OH):
[0716] (VIII-OH), or a salt thereof.
[0717] In certain embodiments, a compound of Formula (VIII) is of one of the following formulae: (Compound 419), 131986-7101 or a salt thereof. In some embodiments, r is 45.
[0718] In certain embodiments, a compound of Formula (VIII) is of one of the following formulae: or a salt thereof. In some embodiments, r is 45. In yet other embodiments the compound of Formula (VIII) is: 131986-7101 (Compound 427), or a salt thereof.
[0719] In some embodiments, the compound of Formula (VIII) is .
[0720] In certain embodiments, the PEG lipid is one of the following formula: or a salt thereof. In some embodiments, r is 45.
[0721] PEG-lipids useful in the present invention include PEGylated lipids described in International Publication No. WO2012099755, the contents of which is herein incorporated by reference in its entirety.
[0722] Any of the PEG-lipids described herein may be modified to comprise one or more hydroxyl group on the PEG chain (OH-PEG-lipids) or one or more hydroxyl group on the lipid (PEG-lipid- OH). In some embodiments, the PEG-lipid is an OH-PEG-lipid that comprises one or more hydroxyl groups on the PEG chain (e.g., an OH-PEG-lipid). In some embodiments, the OH-PEG- lipid comprises a hydroxyl group at the terminus of the PEG chain.
[0723] In some embodiments, the PEG-lipids described herein may be modified to comprise one or more alkyl group on the PEG chain (alkyl-PEG-lipid). In some embodiments, the alkyl-PEG- lipid is a methoxy-PEG-lipid.
[0724] In some embodiments, the LNP comprises about 0.1 mol% to about 5.0 mol%, about 0.5 mol% to about 5.0 mol%, about 1.0 mol% to about 5.0 mol%, about 1.0 mol% to about 2.5 mol%, about 0.5 mol% to about 2.0 mol%, or about 1.0 mol% to about 1.5 mol% of PEG-lipid. In some embodiments, the LNP comprises about 1.5 mol % or about 3.0 mol % PEG-lipid.
[0725] Certain of the LNPs provided herein comprise no or low levels of PEG-lipid. Some LNPs comprise less than 0.5 mol % PEG-lipid. 131986-7101
[0726] In some embodiments, PEG is used as a stabilizer. In some embodiments, the PEG stabilizer is a PEG-lipid. In some embodiments, the LNP comprises less than 0.5 mol% PEG stabilizer.
[0727] Other non-limiting examples of PEG lipids can be found in, e.g., International PCT Application Publication Nos. WO 2020 / 061284, published March 26, 2020; and WO 2020 / 061295, published March 26, 2020, the entire contents of each of which (including any generic or specific structures disclosed therein) is incorporated herein by reference.
[0728] In general, some of the other lipid components (e.g., PEG lipids) of various formulae, described herein may be synthesized as described International Patent Application No. PCT / US2016 / 000129, filed December 10, 2016, entitled “Compositions and Methods for Delivery of Therapeutic Agents,” which is incorporated by reference in its entirety.
[0729] 9In some embodiments, the lipid nanoparticle comprises a molar ratio of 0.5-15% PEG- modified lipid relative to the other lipid components. For example, the lipid nanoparticle may comprise a molar ratio of 0.5-10%, 0.5-5%, 1-15%, 1-10%, 1-5%, 2-15%, 2-10%, 2-5%, 5-15%, 5-10%, or 10-15% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% PEG-modified lipid.
[0730] In some embodiments, the lipid nanoparticle comprises 1-5% PEG-modified lipid, optionally 1-3 mol%, for example 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol%. In some embodiments, the lipid nanoparticle comprises 0.5-15 mol% PEG-modified lipid. For example, the lipid nanoparticle may comprise 0.5-10 mol%, 0.5-5 mol%, 1-15 mol%, 1-10 mol%, 1-5 mol%, 2-15 mol%, 2-10 mol%, 2-5 mol%, 5-15 mol%, 5-10 mol%, or 10-15 mol%. In some embodiments, the lipid nanoparticle comprises 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% PEG-modified lipid.
[0731] Some embodiments comprise adding PEG to a composition comprising an LNP encapsulating a nucleic acid (e.g., which already includes PEG in the amounts listed above). In embodiments comprise adding about 0.5mo% or more PEG to an LNP composition, such as about lmol%, about 1.5mol%, about 2mol%, about 2.5mol%, about 3mol%, about 3.5mol%, about 4mol%, about 5mol%, or more after formation of an LNP composition (e.g., which already contains PEG in amount listed elsewhere herein). 131986-7101
[0732] In some embodiments, a lipid nanoparticle comprises a first PEG-modified lipid in a core of the LNP, and a second PEG-modified lipid outside of the core of the LNP. The first and second PEG-modified lipids of the core and outside the core may the same PEG-modified lipids (z.e., have the same structure), or be different PEG-modified lipids (z.e., have different structures). In some embodiments, both PEG-modified lipids are 134-hydroxy-
[0733] 3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84,87,90,93,96,9
[0734] 9,102,105,108,111,114,117,120,123,126,129,132-tetratetracontaoxatetratriacontahectyl stearate. In some embodiments, both PEG-modified lipids are PEG-DMG. In some embodiments, the first PEG-modified lipid is PEG-DMG and the second PEG-modified lipid is 134-hydroxy-
[0735] 3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84,87,90,93,96,9
[0736] 9,102,105,108,111,114,117,120,123,126,129,132-tetratetracontaoxatetratriacontahectyl stearate. In some embodiments, the first PEG-modified lipid is 134-hydroxy-
[0737] 3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84,87,90,93,96,9
[0738] 9, 102, 105, 108, 111, 114, 117,120, 123,126, 129, 132-tetratetracontaoxatetratriacontahectyl stearate and the second PEG-modified lipid is PEG-DMG. In some embodiments, 0.25 mol% to 1.0 mol% (as a percentage of lipids in the LNP) of the first PEG-modified lipid is in the core of the lipid nanoparticle. In some embodiments, 0.25 mol% to 0.50 mol% of the first PEG-modified lipid is in the core of the lipid nanoparticle. In some embodiments, 0.25 mol%, 0.50 mol%, 0.75 mol%, or 1.0 mol% of the first PEG-modified lipid is in the core of the LNP. In some embodiments, 2.0 mol% to 2.75 mol% of the second PEG-modified lipid is outside the core of the LNP. In some embodiments, 2.0 mol%, 2.25 mol%, 2.5 mol%, or 2.75 mol% of the second PEG-modified lipid is outside the core of the LNP. In some embodiments, the LNP comprises 3.0 mol% PEG-modified lipids.
[0739] LNPs having certain amounts of a PEG-modified lipid in the core and certain amounts of a PEG-modified lipid outside of the core, and methods of producing the same, are disclosed in PCT Publication No. WO 2023 / 018773, which is incorporated by reference herein to the extent it discloses lipid nanoparticles and methods of producing lipid nanoparticles.
[0740] In some embodiments, the lipid nanoparticle (LNP) comprises 20-60 mol% ionizable lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and 0.5-15 mol% PEG-modified lipid. In some embodiments, a LNP comprises an ionizable lipid of Compound (1-18), wherein the non-cationic lipid is DSPC, the structural lipid that is cholesterol, and the PEG-modified lipid is DMG-PEG. In some embodiments, a LNP comprises 20-60 mol% ionizable lipid of Compound (1-18), 5-25 mol% DSPC, 25-55 mol% cholesterol, and 2-4 mol% DMG-PEG. 131986-7101
[0741] In some embodiments, a LNP comprises an ionizable lipid of Compound (1-25), wherein the non-cationic lipid is DSPC, the structural lipid that is cholesterol, and the PEG-modified lipid is DMG-PEG. In some embodiments, a LNP comprises 20-60 mol% ionizable lipid of Compound (I- 25), 5-25 mol% DSPC, 25-55 mol% cholesterol, and 2-4 mol% DMG-PEG. In some embodiments, the LNP comprises 50% ionizable lipid, 10% non-ionizable lipid, 38.5% sterol, and 1.5% PEG- modified lipid, wherein the ionizable lipid is Compound 1-25 as disclosed herein, the non-ionizable lipid is distearoylphosphatidylcholine (DSPC), the sterol is cholesterol, and the PEG-modified lipid is PEG-DMG.
[0742] In some embodiments, a LNP comprises an ionizable lipid of Compound (1-301), wherein the non-cationic lipid is DSPC, the structural lipid that is cholesterol, and the PEG-modified lipid is DMG-PEG. In some embodiments, a LNP comprises 20-60 mol% ionizable lipid of Compound (1-301), 5-25 mol% DSPC, 25-55 mol% cholesterol, and 2-4 mol% DMG-PEG.
[0743] In some embodiments, a LNP comprises an ionizable lipid of Compound (11-6), wherein the non-cationic lipid is DSPC, the structural lipid that is cholesterol, and the PEG-modified lipid is DMG-PEG. In some embodiments, a LNP comprises 20-60 mol% ionizable lipid of Compound (11-6), 5-25 mol% DSPC, 25-55 mol% cholesterol, and 2-4 mol% DMG-PEG.
[0744] In some embodiments, a LNP comprises an ionizable lipid of Compound (IL**), wherein the non-cationic lipid is DSPC, the structural lipid that is cholesterol, and the PEG-modified lipid is DMG-PEG. In some embodiments, a LNP comprises 20-60 mol% ionizable lipid of Compound (IL**), 5-25 mol% DSPC, 25-55 mol% cholesterol, and 2-4 mol% DMG-PEG.
[0745] In some embodiments, a LNP comprises an ionizable lipid of any of Formula (IL*), a phospholipid comprising DSPC, a structural lipid, and a PEG-modified lipid comprising PEG- DMG. In some embodiments, a LNP comprises 20-60 mol% ionizable lipid of Formula (IL*), 5- 25 mol% phospholipid comprising DSPC, 25-55 mol% structural lipid, and 2-4 mol% PEG- modified lipid comprising DMG-PEG.
[0746] In some embodiments, a LNP comprises an ionizable lipid of any of Formula (IL*), a phospholipid comprising DSPC, a structural lipid, and a PEG-modified lipid comprising a compound having Formula (PII). In some embodiments, a LNP comprises 20-60 mol% ionizable lipid of Formula (IL*), 5-25 mol% phospholipid comprising DSPC, 25-55 mol% structural lipid, and 2-4 mol% PEG-modified lipid comprising a compound having Formula (PII).
[0747] In some embodiments, a LNP comprises an ionizable lipid of Formula (IL*), a phospholipid comprising a compound having Formula (HI), a structural lipid, and the PEG-modified lipid 131986-7101 comprising a compound having Formula (PI) or (PII). In some embodiments, a LNP comprises 20- 60 mol% ionizable lipid of Formula (IL*), 5-25 mol% phospholipid comprising a compound having Formula (HI), 25-55 mol% structural lipid, and 2-4 mol% PEG-modified lipid comprising a compound having Formula (PI) or (PII).
[0748] In some embodiments, a LNP comprises an ionizable lipid of Formula (IL*), a phospholipid comprising a compound having Formula (HI), a structural lipid, and the PEG-modified lipid comprising a compound having Formula (PI) or (PII). In some embodiments, a LNP comprises 20- 60 mol% ionizable lipid of Formula (IL*), 5-25 mol% phospholipid comprising a compound having Formula (HI), 25-55 mol% structural lipid, and 2-4 mol% PEG-modified lipid modified lipid comprising a compound having Formula (PI) or (PII).
[0749] In some embodiments, a LNP comprises an ionizable lipid of Formula (IL*), a phospholipid having Formula (HI), a structural lipid, and a PEG-modified lipid comprising a compound having Formula (PII). In some embodiments, a LNP comprises 20-60 mol% ionizable lipid of Formula (IL*), 5-25 mol% phospholipid having Formula (HI), 25-55 mol% structural lipid, and 2-4 mol% PEG-modified lipid comprising a compound having Formula (PII).
[0750] In some embodiments, the lipid nanoparticle comprises 49 mol% ionizable lipid, 10 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% DMG-PEG.
[0751] In some embodiments, the lipid nanoparticle comprises 49 mol% ionizable lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG.
[0752] In some embodiments, the lipid nanoparticle comprises 48 mol% ionizable lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% DMG-PEG.
[0753] In some embodiments, a LNP comprises an N:P ratio of from about 2: 1 to about 30: 1.
[0754] In some embodiments, a LNP comprises an N:P ratio of about 6:1.
[0755] In some embodiments, a LNP comprises an N:P ratio of about 3: 1, 4: 1, or 5: 1.
[0756] In some embodiments, a LNP comprises a wt / wt ratio of the ionizable lipid component to the RNA of from about 10: 1 to about 100: 1.
[0757] In some embodiments, a LNP comprises a wt / wt ratio of the ionizable lipid component to the RNA of about 20: 1.
[0758] In some embodiments, a LNP comprises a wt / wt ratio of the ionizable lipid component to the RNA of about 10: 1.
[0759] Some embodiments comprise a composition having one or more LNPs having a diameter of about 150 nm or less, such as about 140 nm, 130 nm, 120 nm, 110 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, or 20 nm or less. Some embodiments comprise a composition 131986-7101 having a mean LNP diameter of about 150 nm or less, such as about 140 nm, 130 nm, 120 nm, 110 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, or 20 nm or less. In some embodiments, the composition has a mean LNP diameter from about 30nm to about 150nm, or a mean diameter from about 60nm to about 120nm.
[0760] In some embodiments, an LNP further comprises one or more cargo molecules, including but not limited to nucleic acids (e.g., mRNA, plasmid DNA, DNA or RNA oligonucleotides, siRNA, shRNA, snRNA, snoRNA, IncRNA, etc.), small molecules, proteins, and peptides.
[0761] Effective in vivo delivery of nucleic acids represents a continuing medical challenge. Exogenous nucleic acids (ie., originating from outside of a cell or organism) are readily degraded in the body, e.g., by the immune system. Accordingly, effective delivery of nucleic acids to cells often requires the use of a particulate carrier (e.g., lipid nanoparticles). The particulate carrier should be formulated to have minimal particle aggregation, be relatively stable prior to intracellular delivery, effectively deliver nucleic acids intracellularly, and illicit no or minimal immune response. To achieve minimal particle aggregation and pre-delivery stability, many conventional particulate carriers have relied on the presence and / or concentration of certain components (e.g., PEG-modified lipid). However, it has been discovered that certain components may decrease the stability of encapsulated nucleic acids (e.g., mRNA molecules). The reduced stability may limit the broad applicability of the particulate carriers. As such, there remains a need for methods by which to improve the stability of nucleic acid (e.g., mRNA) encapsulated within lipid nanoparticles.
[0762] In some embodiments, a LNP comprises one or more ionizable molecules (e.g., amino lipids or ionizable lipids). The ionizable molecule may comprise a charged group and may have a certain pKa. In certain embodiments, the pKa of the ionizable molecule may be greater than or equal to about 6, greater than or equal to about 6.2, greater than or equal to about 6.5, greater than or equal to about 6.8, greater than or equal to about 7, greater than or equal to about 7.2, greater than or equal to about 7.5, greater than or equal to about 7.8, greater than or equal to about 8. In some embodiments, the pKa of the ionizable molecule may be less than or equal to about 10, less than or equal to about 9.8, less than or equal to about 9.5, less than or equal to about 9.2, less than or equal to about 9.0, less than or equal to about 8.8, or less than or equal to about 8.5. Combinations of the above referenced ranges are also possible (e.g., greater than or equal to 6 and less than or equal to about 8.5). Other ranges are also possible. In embodiments in which more than one type of ionizable molecule are present in a particle, each type of ionizable molecule may independently have a pKa in one or more of the ranges described above. 131986-7101
[0763] In general, an ionizable molecule comprises one or more charged groups. In some embodiments, an ionizable molecule may be positively charged or negatively charged. For instance, an ionizable molecule may be positively charged. For example, an ionizable molecule may comprise an amine group. As used herein, the term “ionizable molecule” has its ordinary meaning in the art and may refer to a molecule or matrix comprising one or more charged moiety. As used herein, a “charged moiety” is a chemical moiety that carries a formal electronic charge, e.g., monovalent (+1, or -1), divalent (+2, or -2), trivalent (+3, or -3), etc. The charged moiety may be anionic (ie., negatively charged) or cationic (z.e., positively charged). Examples of positively charged moi eties include amine groups (e.g., primary, secondary, and / or tertiary amines), ammonium groups, pyridinium group, guanidine groups, and imidizolium groups. In a particular embodiment, the charged moieties comprise amine groups. Examples of negatively charged groups or precursors thereof, include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like. The charge of the charged moiety may vary, in some cases, with the environmental conditions, for example, changes in pH may alter the charge of the moiety, and / or cause the moiety to become charged or uncharged. In general, the charge density of the molecule and / or matrix may be selected as desired.
[0764] In some cases, an ionizable molecule (e.g., an amino lipid or ionizable lipid) may include one or more precursor moieties that can be converted to charged moieties. For instance, the ionizable molecule may include a neutral moiety that can be hydrolyzed to form a charged moiety, such as those described above. As a non-limiting specific example, the molecule or matrix may include an amide, which can be hydrolyzed to form an amine, respectively. Those of ordinary skill in the art will be able to determine whether a given chemical moiety carries a formal electronic charge (for example, by inspection, pH titration, ionic conductivity measurements, etc.), and / or whether a given chemical moiety can be reacted (e.g., hydrolyzed) to form a chemical moiety that carries a formal electronic charge.
[0765] The ionizable molecule (e.g., amino lipid or ionizable lipid) may have any suitable molecular weight. In certain embodiments, the molecular weight of an ionizable molecule is less than or equal to about 2,500 g / mol, less than or equal to about 2,000 g / mol, less than or equal to about 1,500 g / mol, less than or equal to about 1,250 g / mol, less than or equal to about 1,000 g / mol, less than or equal to about 900 g / mol, less than or equal to about 800 g / mol, less than or equal to about 700 g / mol, less than or equal to about 600 g / mol, less than or equal to about 500 g / mol, less than or equal to about 400 g / mol, less than or equal to about 300 g / mol, less than or equal to about 200 g / mol, or less than or equal to about 100 g / mol. In some instances, the molecular weight of an 131986-7101 ionizable molecule is greater than or equal to about 100 g / mol, greater than or equal to about 200 g / mol, greater than or equal to about 300 g / mol, greater than or equal to about 400 g / mol, greater than or equal to about 500 g / mol, greater than or equal to about 600 g / mol, greater than or equal to about 700 g / mol, greater than or equal to about 1000 g / mol, greater than or equal to about 1,250 g / mol, greater than or equal to about 1,500 g / mol, greater than or equal to about 1,750 g / mol, greater than or equal to about 2,000 g / mol, or greater than or equal to about 2,250 g / mol. Combinations of the above ranges (e.g., at least about 200 g / mol and less than or equal to about 2,500 g / mol) are also possible. In embodiments in which more than one type of ionizable molecules are present in a particle, each type of ionizable molecule may independently have a molecular weight in one or more of the ranges described above.
[0766] In some embodiments, the percentage (e.g., by weight, or by mole) of a single type of ionizable molecule (e.g., amino lipid or ionizable lipid) and / or of all the ionizable molecules within a particle may be greater than or equal to about 15%, greater than or equal to about 16%, greater than or equal to about 17%, greater than or equal to about 18%, greater than or equal to about 19%, greater than or equal to about 20%, greater than or equal to about 21%, greater than or equal to about 22%, greater than or equal to about 23%, greater than or equal to about 24%, greater than or equal to about 25%, greater than or equal to about 30%, greater than or equal to about 35%, greater than or equal to about 40%, greater than or equal to about 42%, greater than or equal to about 45%, greater than or equal to about 48%, greater than or equal to about 50%, greater than or equal to about 52%, greater than or equal to about 55%, greater than or equal to about 58%, greater than or equal to about 60%, greater than or equal to about 62%, greater than or equal to about 65%, or greater than or equal to about 68%. In some instances, the percentage (e.g., by weight, or by mole) may be less than or equal to about 70%, less than or equal to about 68%, less than or equal to about 65%, less than or equal to about 62%, less than or equal to about 60%, less than or equal to about 58%, less than or equal to about 55%, less than or equal to about 52%, less than or equal to about 50%, or less than or equal to about 48%. Combinations of the above referenced ranges are also possible (e.g., greater than or equal to 20% and less than or equal to about 60%, greater than or equal to 40% and less than or equal to about 55%, etc.). In embodiments in which more than one type of ionizable molecule is present in a particle, each type of ionizable molecule may independently have a percentage (e.g., by weight, or by mole) in one or more of the ranges described above. The percentage (e.g., by weight, or by mole) may be determined by extracting the ionizable molecule(s) from the dried particles using, e.g., organic solvents, and measuring the quantity of the agent using high pressure liquid chromatography (i.e., HPLC), liquid 131986-7101 chromatography-mass spectrometry (LC-MS), nuclear magnetic resonance (NMR), or mass spectrometry (MS). Those of ordinary skill in the art would be knowledgeable of techniques to determine the quantity of a component using the above-referenced techniques. For example, HPLC may be used to quantify the amount of a component, by, e.g., comparing the area under the curve of a HPLC chromatogram to a standard curve.
[0767] It should be understood that the terms “charged” or “charged moiety” does not refer to a “partial negative charge" or “partial positive charge" on a molecule. The terms “partial negative charge" and “partial positive charge" are given their ordinary meaning in the art. A “partial negative charge" may result when a functional group comprises a bond that becomes polarized such that electron density is pulled toward one atom of the bond, creating a partial negative charge on the atom. Those of ordinary skill in the art will, in general, recognize bonds that can become polarized in this way. In some embodiments, the composition comprises a liposome. A liposome is a lipid particle comprising lipids arranged into one or more concentric lipid bilayers around a central region. The central region of a liposome may comprise an aqueous solution, suspension, or other aqueous composition.
[0768] In some embodiments, the composition comprises a lipoplex. A lipoplex is a lipid particle comprising a cationic liposome and a nucleic acid (e.g., mRNA). Lipoplexes may be formed by contacting a liposome comprising a cationic lipid with a nucleic acid. A lipoplex may comprise multiple concentric lipid bilayers, each concentric bilayer separated by one or more nucleic acids. The central region of the lipoplex may comprise an aqueous solution, suspension, or other aqueous composition.
[0769] In some embodiments, the composition comprises a lipopolyplex. A lipopolyplex is a lipid particle comprising a lipid bilayer surrounding a complex of a cationic polymer and a nucleic acid (e.g., mRNA). See Midoux & Pichon, Expert Rev Vaccines. 2015. 14(2):221-234. A lipopolyplex may be formed by contacting a cationic liposome (e.g., liposome comprising a cationic lipid) with the complex of nucleic acid and cationic polymer. The central region of the lipopolyplex may comprise an aqueous solution, suspension, or other aqueous composition.
[0770] In some embodiments, the composition comprises a cationic nanoemulsion. A cationic nanoemulsion comprises a cationic lipid, hydrophilic surfactant, and hydrophobic surfactant.
[0771] A liposome, lipoplex, lipopolyplex, or cationic nanoemulsion may comprise a sterol. A liposome, lipoplex, lipopolyplex, or cationic nanoemulsion may comprise a neutral lipid. A liposome, lipoplex, lipopolyplex, or cationic nanoemulsion may comprise a PEG-modified lipid. 131986-7101
[0772] Stabilizing Compounds
[0773] Some embodiments of the compositions described herein are stabilized compositions (e.g., stabilized pharmaceutical compositions). Various non-viral delivery systems, including nanoparticle formulations, present attractive opportunities to overcome many challenges associated with mRNA delivery. Lipid nanoparticles (LNPs) have drawn particular attention in recent years as various LNP formulations have shown promise in a variety of pharmaceutical applications. However, lipids have been shown to degrade nucleic acids, including mRNA, and lipid nanoparticle formulations undergo rapid loss of purity when stored as refrigerated liquids. Moreover, the storage stability of mRNA encapsulated within LNPs is lower than that of unencapsulated mRNA.
[0774] A class of compounds has been found to stabilize nucleic acids within a lipid carrier such as an LNP, an unexpected and unprecedented discovery which enables applications including extended refrigerated liquid shelf-life, extended in-use periods at room temperature, and extended in-use stability at physiological temperatures up to higher temperatures such as 40°C. Such stabilizing compounds solve a critical problem, as current manufacturing processes and formulations experience a 5-10% purity loss during LNP formation and processing that is typical with current large-scale LNP production.
[0775] In some embodiments, the stabilized pharmaceutical composition comprises a nucleic acid formulation comprising a nucleic acid and a stabilizing compound (e.g., a compound of Formula (I), of Formula (II), or a tautomer or solvate thereof). In some embodiments, the stabilized pharmaceutical composition comprises a nucleic acid formulation comprising a nucleic acid and a lipid, and a compound of Formula (I): or a tautomer or solvate thereof, wherein:
[0776] = is a single bond or a double bond;
[0777] R1is H; R2is OCH3, or together with R3is OCH2O; R3is OCH3, or together with R2is OCH2O; R4is H; R5is H or OCH3; R6is OCH3; R7is H or OCHs; R8is H; R9is H or CH3; and X is a pharmaceutically acceptable anion, e.g., a halide such as chloride.
[0778] In some embodiments, the compound of Formula (I) has the structure of: 131986-7101 or a tautomer or solvate thereof.
[0779] In some embodiments, the stabilized pharmaceutical composition comprises a nucleic acid formulation comprising a nucleic acid and a lipid, and a compound of Formula (II): or a tautomer or solvate thereof, wherein:
[0780] R10is H; R11is H; R12together with R13is OCH2O; R14is H; R15together with R16is OCH2O; R17is H; and X is a pharmaceutically acceptable anion, e.g., a halide such as chloride.
[0781] In some embodiments, the compound of Formula (II) has the structure of: or a tautomer or solvate thereof.
[0782] Stabilizing compounds of Formulas (I), (la), (lb), (Ic), (II), and (Ila) are described in International Patent Application No. PCT / US2022 / 025967, which is incorporated by reference herein in its entirety.
[0783] In some embodiments, the nucleic acid formulation comprises lipid nanoparticles. In some embodiments, the nucleic acid is mRNA.
[0784] In some embodiments, the stabilizing compound (“the compound”) has a purity of at least 70%, 80%, 90%, 95%, or 99%. In some embodiments, the compound contains fewer than lOOppm of elemental metals. In some embodiments, the stabilized pharmaceutical composition (“the composition”) comprises a pharmaceutically acceptable metal chelator, e.g., EDTA (ethylenediaminetetraacetic acid) or DTPA (diethylenetriaminepentaacetic acid).
[0785] In some embodiments, the composition is an aqueous solution. In some embodiments, the compound is present at a concentration between about O. lmM and about lOmM in the aqueous 131986-7101 solution. In some embodiments, the aqueous solution has a pH of or about 5 to 8, including pH of about 5, 5.5, 6, 6.5, 7, 7.5, or 8. In some embodiments, the aqueous solution does not comprise NaCl. In some embodiments, the aqueous solution comprises NaCl in a concentration of or about 150mM. In some embodiments, the aqueous solution comprises a phosphate buffer, a tris buffer, an acetate buffer, a histidine buffer, or a citrate buffer.
[0786] In some embodiments, microbial growth in the composition is inhibited by the compound.
[0787] In some embodiments, the composition is characterized as having a mRNA purity level of greater than 60%, greater than 70%, greater than 80%, or greater than 90% main peak mRNA purity after at least thirty days of storage. In some embodiments, the composition comprises a mRNA purity level of greater than 50% main peak mRNA purity after at least six months of storage. In some embodiments, the storage is at room temperature.
[0788] In some embodiments, the composition comprises a lipid nanoparticle encapsulating a mRNA, and the composition comprises less than 50%, less than 60%, less than 70%, less than 80%, less than 90%, or less than 95% RNA fragments after at least thirty days of storage. In some embodiments, the storage temperature is greater than room temperature. In some embodiments, the storage temperature is about 4°C.
[0789] In some embodiments, the compound interacts with the nucleic acid comprised within a lipid nanostructure (e.g., a lipid nanoparticle, liposome, or lipoplex), e.g., via pi-pi stacking and / or by changing backbone helicity of the nucleic acid. In some embodiments, the compound intercalates with a nucleic acid. In some embodiments, the compound binds with a nucleic acid, e.g., reversible binding, and / or binding to the stranded regions of the nucleic acid. In some embodiments, the compound self-associates, binds to nucleic acid ribose contacts, and / or binds to nucleic acid base contacts. In some embodiments, the compound does not substantially bind to nucleic acid phosphate contacts. In some embodiments, the positive charge of the compound contributes to nucleic acid binding. In some embodiments, the interacts with the nucleic acid with a binding affinity defined by an equilibrium dissociation constant of less than 10'3M (e.g., less than 10'4M, less than 10'5M, less than 10'5M, less than 10'7M, less than 10'8M, or less than 10’9M).
[0790] In some embodiments, the compound interacts with a nucleic acid and provides shielding from solvent, e.g., water. In some embodiments, the compound shields ribose from solvent more than the compound shields the phosphate groups of the nucleic acid. In some embodiments, the solvent exposure is measured by the solvent accessible surface area (SASA). In some embodiments, a stabilizing compound decreases the solvent accessible area of ribose to about 5- 131986-7101
[0791] 10 nm2. In some embodiments, a stabilizing compound decreases the solvent accessible area of ribose to about 6-8 nm2. In some embodiments, a stabilizing compound decreases the solvent accessible area of phosphate to about 9-12 nm2. In some embodiments, a stabilizing compound decreases the solvent accessible area of phosphate to about 10-11 nm2.
[0792] In some embodiments, a nucleic acid that is conformationally stabilized by the compound exhibits thermal unfolding temperatures (measured by circular dichroism or DSC, for example) that are higher than in the absence of the compound. In some embodiments, the compound confers increased stability, e.g., thermal stability, to the nucleic acid in a folded structure, e.g., relative to its unfolded or less folded or more linear form. In some embodiments, the compound causes compaction of the nucleic acid upon interaction with the nucleic acid. In some embodiments, the compound causes a decrease in the hydrodynamic radius of the nucleic acid molecule upon interaction with the nucleic acid. In some embodiments, a stabilizing compound causes compaction or a decrease in the hydrodynamic radius of a nucleic acid molecule by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more. In some embodiments, a stabilizing compound causes compaction or a decrease in the hydrodynamic radius of a nucleic acid molecule when the compound is in a concentration of 1 pM, 2 pM, 3 pM, 4 pM, 5 pM, 6 pM, 7 pM, 8 pM, 9 pM, 10 pM, 15 pM, 20 pM, 25 pM, 30 pM, 35 pM, 40 pM, 45 pM, 50 pM, 60 pM, 70 pM, 80 pM, 90 pM, or 100 pM.
[0793] Methods of Treatment
[0794] Provided herein are compositions (e.g., pharmaceutical compositions), methods, kits, and reagents for prevention and / or treatment of NSCLC in humans (e.g , subjects or patients) and other mammals. Nucleic acid individualized neoantigen vaccines may be used as therapeutic or prophylactic agents in medicine to prevent and / or treat NSCLC. In exemplary aspects, the individualized neoantigen vaccines are used to provide prophylactic protection from NSCLC recurrence. Prophylactic protection from cancer recurrence can be achieved following administration of an adjuvant therapy described herein (e.g., including an individualized neoantigen vaccine). It may also be desirable to administer the vaccine to a subj ect having N SCLC to achieve a therapeutic response. Dosing may need to be adjusted accordingly.
[0795] The individualized neoantigen vaccine may be administered by any route. In some embodiments, the vaccine is administered by an intradermal, intramuscular, intravascular, intratumoral, and / or subcutaneous route. In some embodiments, the individualized neoantigen vaccine is administered intramuscularly (IM). 131986-7101
[0796] In some embodiments, an individualized neoantigen vaccine may be administered in combination with an additional anti-cancer therapeutic agent (e.g., an immune checkpoint inhibitor). In some embodiments, the individualized neoantigen vaccine is administered prior to initiation of the additional anti-cancer therapeutic agent treatment. In some embodiments, the individualized neoantigen vaccine is administered 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 1 week, 2 weeks, 3 weeks 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, or more, prior to initiation of the additional anti-cancer therapeutic agent treatment. In some embodiments, the individualized neoantigen vaccine is administered after initiation of the additional anti-cancer therapeutic agent treatment. In some embodiments, the individualized neoantigen vaccine is administered 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 1 week, 2 weeks, 3 weeks 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, or more, after initiation of the additional anti-cancer therapeutic agent treatment. In some embodiments, the individualized neoantigen vaccine is administered within 8 weeks, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week from the initiation of the additional anti-cancer therapeutic agent treatment. For example, in some embodiments, the individualized neoantigen vaccine is administered within about 6 weeks (e.g., within 4 weeks, within 5 weeks, within 6 weeks, within 7 weeks, or within 8 weeks) following the first administration of the additional anti-cancer therapeutic agent.
[0797] At any point in the treatment the subject may be examined to determine whether the mutations in the vaccine are still appropriate. Based on that analysis the vaccine may be adjusted or reconfigured to include one or more different neoepitopes or to remove one or more neoepitopes. This may be done according to a method of optimizing an individualized neoantigen vaccine, as provided herein.
[0798] In exemplary embodiments, an individualized neoantigen vaccine comprising one or more mRNA polynucleotides as described herein can be administered to a subject (e.g., a mammalian subject, such as a human subject), and the mRNA polynucleotide is translated in vivo to produce an antigenic polypeptide.
[0799] The individualized neoantigen vaccines may be induced for translation of a polypeptide (e.g., antigen or immunogen) in a cell, tissue or organism. In exemplary embodiments, such 131986-7101 translation occurs in vivo, although there can be envisioned embodiments where such translation occurs ex vivo, in culture or in vitro. In exemplary embodiments, the cell, tissue or organism is contacted with an effective amount of a composition containing an individualized neoantigen vaccine that contains a polynucleotide that has at least one a translatable region encoding an antigenic polypeptide.
[0800] Individualized neoantigen vaccines may be administered prophylactically or therapeutically as part of an active immunization scheme to healthy individuals or early in cancer or during active cancer after onset of symptoms. In some embodiments, the amount of vaccine provided to a cell, a tissue or a subject may be an amount effective for immune prophylaxis.
[0801] Individualized neoantigen vaccines may be administered to a subject identified as having or being likely to have high responsiveness to another cancer therapy, e.g., an immune checkpoint modulator therapy. In some embodiments, an individualized neoantigen vaccine may be administered to a subject having characteristics associated with high responsiveness to immune checkpoint modulator therapy, e.g., immune checkpoint inhibitor therapy, such as anti-PD-1 therapy. For example, in some embodiments, an individualized neoantigen vaccine may be administered to a subject having biomarker(s) associated with high responsiveness to immune checkpoint modulator therapy. In some embodiments, an individualized neoantigen vaccine may be administered to a subject having previously received an immune checkpoint modulator therapy to which the subject demonstrated a high responsiveness, e.g., as determined through a clinical metric such as a laboratory or radiological test. In some embodiments, administration of an individualized neoantigen vaccine to such a subject results in greater responsiveness to the immune checkpoint modulator therapy, relative to the responsiveness if the therapy was given without the individualized neoantigen vaccine.
[0802] Individualized neoantigen vaccines may be administered to a subject identified as having or being likely to have a low responsiveness to another cancer therapy, e.g., an immune checkpoint modulator therapy. In some embodiments, an individualized neoantigen vaccine may be administered to a subject having characteristics associated with low responsiveness to immune checkpoint modulator therapy, e.g., immune checkpoint inhibitor therapy, such as anti-PD-1 therapy. For example, in some embodiments, an individualized neoantigen vaccine may be administered to a subject having biomarker(s) and / or biomarker level(s) associated with a low responsiveness to immune checkpoint modulator therapy. In some embodiments, an individualized neoantigen vaccine may be administered to a subject having previously received an immune checkpoint modulator therapy to which they demonstrated a low responsiveness, e.g., as 131986-7101 determined through a clinical metric such as a laboratory or radiological test. In some embodiments, administration of an individualized neoantigen vaccine to such a subject results in greater responsiveness to the immune checkpoint modulator therapy, relative to the responsiveness if the therapy was given without the individualized neoantigen vaccine.
[0803] Individualized neoantigen vaccine may be administered to a subject having low or undetectable levels of metastatic tumor cells. For example, in some embodiments, an individualized neoantigen vaccine may be administered to a subject having received results of a medical diagnostic test (e.g., a radiological study / studies and / or a laboratory test(s)) indicating that no metastatic foci and / or cells were detected in the subject. In some embodiments, an individualized neoantigen vaccine may be administered to a subject having fewer than 10 (e.g., fewer than 9, fewer than 8, fewer than 7, fewer than 6, fewer than 5, fewer than 4, fewer than 3, fewer than 2, 1, or no) detectable metastatic foci.
[0804] Individualized neoantigen vaccines may be administered to a subject having detectable or high levels of metastatic tumor cells. For example, in some embodiments, an individualized neoantigen vaccine may be administered to a subject having received results of a medical diagnostic test (e.g., a radiological study / studies and / or a laboratory test(s)) indicating that metastatic foci and / or cells were detected in the subject. In some embodiments, an individualized neoantigen vaccine may be administered to a subject having greater than 1 (e.g., greater than 2, greater than 3, greater than 4, greater than 5, greater than 6, greater than 7, greater than 8, greater than 9, greater than 10, or more) detectable metastatic foci.
[0805] The individualized neoantigen vaccines may be utilized in various settings depending on the severity of the cancer or the degree or level of unmet medical need. As a non-limiting example, the individualized neoantigen vaccines may be utilized t...
Claims
131986-7101What is claimed is:
1. A method of treating non-small cell lung cancer (NSCLC) in a subject, the method comprising:(a) identifying a subject with NSCLC that has received a neoadjuvant therapy prior to undergoing a surgical resection of a tumor; and(b) administering to the subject an effective amount of an adjuvant therapy after the surgical resection, wherein the adjuvant therapy comprises administering an immune checkpoint inhibitor and administering an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle.
2. A method of treating non-small cell lung cancer (NSCLC) in a subject, the method comprising:(a) administering to the subject a neoadjuvant therapy prior to a surgical resection of a tumor in the subject; and(b) administering to the subject an effective amount of an adjuvant therapy after the surgical resection, wherein the adjuvant therapy comprises administering an immune checkpoint inhibitor and administering an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle.
3. The method of any one of claims 1-2, wherein the NSCLC is resectable Stage II, IIIA, or IIIB (N2) NSCLC.
4. The method of any one of claims 1-3, wherein the NSCLC is squamous cell NSCLC or non-squamous cell NSCLC.
5. The method of any one of claims 1-4, wherein the tumor of the subject does not comprise a tumor-activating epidermal growth factor receptor (EGFR) mutation.131986-71016. The method of any one of claims 1-5, wherein the tumor of the subject has a tumor proportion score (TPS) of < about 50%.
7. The method of any one of claims 1-5, wherein the tumor of the subject has a TPS of > about 50%.
8. The method of any one of claims 1-7, wherein the neoadjuvant therapy is administered at three-week intervals; optionally wherein the neoadjuvant therapy is administered for about 2-6 cycles.
9. The method of any one of claims 1-8, wherein the neoadjuvant therapy comprises chemotherapy and administering the immune checkpoint inhibitor.
10. The method of claim 9, wherein the chemotherapy is platinum-based doublet chemotherapy.
11. The method of any one of claims 9-10, wherein the chemotherapy comprises administering one or more chemotherapeutic agents selected from the group consisting of: cisplatin, carboplatin, pemetrexed, gemcitabine, and paclitaxel.
12. The method of claim 11, wherein:(i) if the subject has non-squamous cell NSCLC, the chemotherapeutic agents comprise (a) cisplatin and pemetrexed or (b) carboplatin and pemetrexed; or(ii) if the subject has squamous cell NSCLC, the chemotherapeutic agents comprise (a) cisplatin and gemcitabine or (b) carboplatin and gemcitabine.
13. The method of claim 12, wherein the chemotherapeutic agents comprise (a) cisplatin and paclitaxel or (b) carboplatin and paclitaxel.
14. The method of any one of claims 2-13, wherein the method further comprises the surgical resection and surgical resection is performed within about 20 weeks of administering a first dose of the neoadjuvant therapy and within 8 weeks after administering a last dose of the neoadjuvant therapy.131986-710115. The method of any one of claims 1-14, wherein the surgical resection is an RO resection or an R1 resection.
16. The method of claim 1-15, wherein the surgical resection is an R1 resection and the subject is administered radiation therapy.
17. The method of any one of claims 1-16, wherein the subject has not achieved a pathological complete response (pCR) following the surgical resection.
18. The method of any one of claims 1-17, wherein the subject does not have apparent disease in an image taken after the surgical resection.
19. The method of any one of claims 1-18, wherein the immune checkpoint inhibitor is an anti-PD-1 antibody, optionally wherein the anti-PD-1 antibody comprises:(i) light chain complementarity determining regions (CDRs) comprising a sequence of amino acids as set forth in SEQ ID NOs: 43, 44 and 45 and heavy chain CDRs comprising a sequence of amino acids as set forth in SEQ ID NOs: 48, 49 and 50;(ii) a light chain variable region comprising SEQ ID NO:46 and a heavy chain variable region comprising SEQ ID NO:51; and / or(iii) a light chain comprising SEQ ID NO: 47 and a heavy chain comprising SEQ ID NO:52.
20. The method of claim 19, wherein the immune checkpoint inhibitor is pembrolizumab.
21. The method of any one of claims 9-20, wherein the immune checkpoint inhibitor of the neoadjuvant therapy is administered to the subject at a dose of about 100-300 mg per administration.
22. The method of claim 21, wherein the immune checkpoint inhibitor of the neoadjuvant therapy is administered to the subject at a dose of about 200 mg per administration.131986-710123. The method of any one of claims 21- 22, wherein the immune checkpoint inhibitor of the neoadjuvant therapy is administered every three weeks.
24. The method of any one of claims 9-23, wherein the chemotherapeutic agents comprise cisplatin, and wherein about 30 to about 80 mg / m2cisplatin is administered every three weeks.
25. The method of claim 24, wherein about 38, about 56 or about 75 mg / m2cisplatin is administered.
26. The method of any one of claims 9-25, wherein the chemotherapeutic agents comprise pemetrexed, and wherein about 200 to about 600 mg / m2pemetrexed is administered every three weeks.
27. The method of claim 26, wherein about 250, about 375 or about 500 mg / m2pemetrexed is administered.
28. The method of any one of claims 9-27, wherein the chemotherapeutic agents comprise carboplatin, and wherein AUC of about 2 to about 7 mg / mL-min carboplatin is administered once every three weeks.
29. The method of claim 28, wherein AUC of about 2.5, about 3, about 3.75, about 4.5, about 5 or about 6 mg / mL-min carboplatin is administered.
30. The method of any one of claims 9-29, wherein the chemotherapeutic agents comprise gemcitabine, and wherein about 500 to about 1300 mg / m2gemcitabine is administered every three weeks.
31. The method of claim 30, wherein about 500, about 600, about 750, about 900, about 1000 or about 1250 mg / m2gemcitabine is administered.
32. The method of any one of claims 9-31, wherein the chemotherapeutic agents comprise paclitaxel and wherein about 50 mg / m2to about 300 mg / m2paclitaxel is administered every three weeks.131986-710133. The method of claim 32, wherein about 100, about 150, about 175 or about 200 mg / m2paclitaxel is administered.
34. The method of any one of claims 12, and 14-23, wherein the subject has non-squamous cell NSCLC, wherein the chemotherapeutic agents comprise cisplatin and pemetrexed, and wherein about 75 mg / m2cisplatin and about 175 or about 200 mg / m2pemetrexed are administered every three weeks.
35. The method of any one of claims 12, and 14-23, wherein the subject has non-squamous cell NSCLC, wherein the chemotherapeutic agents comprise carboplatin and pemetrexed, and wherein AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 175 or about 200 mg / m2pemetrexed are administered every three weeks.
36. The method of any one of claims 12, and 14-23, wherein the subject has squamous cell NSCLC, wherein the chemotherapeutic agents comprise cisplatin and gemcitabine, and wherein about 75 mg / m2cisplatin and about 1000 mg / m2or about 1250 mg / m2gemcitabine are administered every three weeks.
37. The method of any one of claims 12, and 14-23, wherein the subject has squamous cell NSCLC, wherein the chemotherapeutic agents comprise carboplatin and gemcitabine, and wherein about AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 1000 mg / m2or about 1250 mg / m2gemcitabine are administered every three weeks.
38. The method of any one of claims 13-23, wherein the chemotherapeutic agents comprise cisplatin and paclitaxel, and wherein about 75 mg / m2cisplatin and about 175 mg / m2or about 200 mg / m2paclitaxel are administered every three weeks.
39. The method of any one of claims 13-23, wherein the chemotherapeutic agents comprise carboplatin and paclitaxel, and wherein about AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 175 mg / m2or about 200 mg / m2paclitaxel are administered every three weeks.131986-710140. The method of any one of claims 1-39, wherein the immune checkpoint inhibitor and the chemotherapy of the neoadjuvant therapy are administered for about 4 cycles.
41. The method of any one of claims 9-20 and 24-39, wherein the immune checkpoint inhibitor of the neoadjuvant therapy is administered to the subject at a dose of about 300-500 mg per administration.
42. The method of claim 41, wherein the immune checkpoint inhibitor of the neoadjuvant therapy is administered to the subject at a dose of about 400 mg per administration.
43. The method of any one of claims 41-42, wherein the immune checkpoint inhibitor is administered every six weeks.
44. The method of any one of claims 1-43, wherein the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject at a dose of about 300-500 mg per administration.
45. The method of claim 44, wherein the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject at a dose of about 400 mg per administration.
46. The method of any one of claims 1-45, wherein the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject every six week.
47. The method of any one of claims 1-46, wherein the immune checkpoint inhibitor of the adjuvant therapy is administered for about 5-10 cycles.
48. The method of claim 47, wherein the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject for about 7 cycles.
49. The method of any one of claims 1-43, wherein the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject at a dose of about 100-300 mg per administration.
50. The method of claim 49, wherein the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject at a dose of about 200 mg per administration.131986-710151. The method of any one of claims 49-50, wherein the immune checkpoint inhibitor of the adjuvant therapy is administered to the subject every three weeks.
52. The method of any one of claims 49-51, wherein the immune checkpoint inhibitor of the adjuvant therapy is administered for about 10-20 cycles.
53. The method of claim 52, wherein the immune checkpoint inhibitor of the adjuvant therapy is administered for about 14 cycles.
54. The method of any one of claims 1-53, wherein the individualized neoantigen vaccine is administered to the subject every three weeks.
55. The method of any one of claims 1-54, wherein a total of about 5-15 doses of the individualized neoantigen vaccine are administered to the subject.
56. The method of claim 55, wherein a total of about 9 doses of the individualized neoantigen vaccine are administered to the subject.
57. The method of any one of claims 1-56, wherein the individualized neoantigen vaccine and the immune checkpoint inhibitor are each administered separately and each administered via an intradermal, intramuscular, intravascular, intratumoral, and / or subcutaneous route.
58. The method of claim 57, wherein the individualized neoantigen vaccine is administered intramuscularly and the immune checkpoint inhibitor is administered intravenously.
59. The method of any one of claims 1-58, wherein the open reading frame of the mRNA polynucleotide comprises nucleosides selected from the group consisting of Nl- methylpseudouridine, adenosine, guanosine, and cytidine.
60. The method of any one of claims 1-59, wherein the lipid delivery vehicle comprises a lipid nanoparticle, a liposome, or a lipoplex.131986-710161. The method of any one of claims 1-60, wherein the lipid delivery vehicle comprises a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG- modified lipid.
62. The method of claim 61, wherein the ionizable amino lipid comprises a compound of Formula (I):whereinRi is selected from the group consisting of C5-30 alkyl, C5-20 alkenyl, and -R"M'R';R2 and R3 are independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;R4 is -(CH2)nQ, wherein Q is -OR, and n is selected from 1, 2, 3, 4, and 5; each Rs is H; each Re is H;M and M' are independently selected from -C(O)O- and -OC(O)-;R7is H;R is H;R' is selected from the group consisting of Ci-18 alkyl and C2-18 alkenyl;R" is selected from the group consisting of C3-14 alkyl and C3-14 alkenyl; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.
63. The method of claim 62, wherein the compound of Formula (I) comprises Compound (I-25):(Compound 1-25).
64. The method of any one of claims 59-61, wherein the neutral lipid comprises 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol comprises cholesterol, and the PEG- modified lipid comprises 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG).131986-710165. A method of treating non-small cell lung cancer (NSCLC) in a subject having NSCLC, the method comprising:(a) administering to the subject a neoadjuvant therapy comprising administering about 200 mg of pembrolizumab every three weeks for at least two cycles and a platinum-based doublet chemotherapy prior to a surgical resection of a tumor in the subject; and(b) administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises administering about 400 mg pembrolizumab every size weeks for at least five cycles and administering about 1 mg of an individualized neoantigen vaccine every three weeks for at least five cycles, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid.
66. A method of treating non-small cell lung cancer (NSCLC) in a subject having NSCLC, the method comprising:(a) administering to the subject a neoadjuvant therapy comprising administering about 400 mg of pembrolizumab every six weeks for at least two cycles and a platinum-based doublet chemotherapy prior to a surgical resection of a tumor in the subject; and(b) administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises administering about 400 mg pembrolizumab every six weeks for at least five cycles and administering about 1 mg of an individualized neoantigen vaccine every three weeks for at least five cycles, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid.
67. A method of treating non-small cell lung cancer (NSCLC) in a subject having NSCLC, the method comprising:131986-7101(a) administering to the subject a neoadjuvant therapy comprising administering about 400 mg of pembrolizumab every six weeks for at least two cycles and a platinum-based doublet chemotherapy prior to a surgical resection of a tumor in the subject; and(b) administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises administering about 200 mg pembrolizumab every three weeks for at least five cycles and administering about 1 mg of an individualized neoantigen vaccine every three weeks for at least five cycles, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid.
68. A method of treating non-small cell lung cancer (NSCLC) in a subject having NSCLC, the method comprising:(a) administering to the subject a neoadjuvant therapy comprising administering about 200 mg of pembrolizumab every three weeks for at least two cycles and a platinum-based doublet chemotherapy prior to a surgical resection of a tumor in the subject; and(b) administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises administering about 200 mg pembrolizumab every three weeks for at least five cycles and administering about 1 mg of an individualized neoantigen vaccine every three weeks for at least five cycles, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid.
69. The method of any one of claims 63-66, wherein:(a) at least one of the neoepitopes are MHC class I epitopes;(b) at least 10% of the neoepitopes are MHC class I epitopes;(c) at least 50% of the neoepitopes are MHC class I epitopes;(d) at least 70% of the neoepitopes are MHC class I epitopes;(e) at least one of the neoepitopes are MHC class II epitope;(f) at least 30% of the neoepitopes are MHC class II epitopes;131986-7101(g) each of the neoepitopes is 20-50 amino acids in length;(h) each of the neoepitopes comprises 25-35 amino acids,(i) the neoepitopes are T cell epitopes;(j) each of the neoepitopes comprises an antigenic region and an MHC stabilizing region;(k) two or more of the neoepitopes are connected directly to one another;(l) two or more of the neoepitopes are connected to one another through a linker that is not a cleavage sensitive site;(m) each of the neoepitopes includes a centrally located mutation encoded by a single nucleotide polymorphism (SNP);(n) the mRNA polynucleotide comprises at least 30 neoepitopes; and / or(o) the open reading frame of the mRNA polynucleotide comprises nucleosides selected from the group consisting of N1 -methylpseudouridine, adenosine, guanosine, and cytidine.
70. The method of any one of claims 65-69, wherein the ionizable amino lipid comprises Compound (1-25):(Compound 1-25).
71. The method of any one of claims 65-70, wherein the neutral lipid comprises 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol comprises cholesterol, and the PEG- modified lipid comprises 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG).
72. The method of any one of claims 65-71, wherein the lipid nanoparticle comprises 20-60 mol% ionizable cationic lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and 0.5-15 mol% PEG-modified lipid; the lipid nanoparticle comprises about 45-55 mol% ionizable cationic lipid, about 5-15 mol% non-cationic lipid, about 35-40 mol% sterol, and about 1-2 mol% PEG- modified lipid; or the lipid nanoparticle comprises about 50 mol% ionizable cationic lipid, about 10 mol% non-cationic lipid, about 38.5 mol% sterol, and about 1.5 mol% PEG-modified lipid.131986-710173. The method of any one of claims 65-72, the platinum-based doublet chemotherapy comprises administering one or more chemotherapeutic agents selected from the group consisting of: cisplatin, carboplatin, pemetrexed, gemcitabine, and paclitaxel.
74. The method of claim 73, wherein:(i) if the subject has non-squamous cell NSCLC, the chemotherapeutic agents comprise(a) cisplatin and pemetrexed or (b) carboplatin and pemetrexed; or(ii) if the subject has squamous cell NSCLC, the chemotherapeutic agents comprise (a) cisplatin and gemcitabine or (b) carboplatin and gemcitabine.
75. The method of claim 74, wherein:(a) the chemotherapeutic agents comprise cisplatin, and about 30 to about 80 mg / m2cisplatin is administered every three weeks, optionally, about 38, about 56 or about 75 mg / m2cisplatin is administered;(b) the chemotherapeutic agents comprise pemetrexed, and wherein about 200 to about 600 mg / m2pemetrexed is administered every three weeks, optionally, about 250, about 375 or about 500 mg / m2pemetrexed is administered;(c) the chemotherapeutic agents comprise carboplatin, and wherein AUC of about 2 to about 7 mg / mL-min carboplatin is administered once every three weeks, optionally, AUC of about 2.5, about 3, about 3.75, about 4.5, about 5 or about 6 mg / mL-min carboplatin is administered;(d) the chemotherapeutic agents comprise gemcitabine, and wherein about 500 to about 1300 mg / m2gemcitabine is administered every three weeks, optionally, about 500, about 600, about 750, about 900, about 1000 or about 1250 mg / m2gemcitabine is administered; and / or(e) the chemotherapeutic agents comprise paclitaxel and wherein about 50 mg / m2to about 300 mg / m2paclitaxel is administered every three weeks, optionally, about 100, about 150, about 175 or about 200 mg / m2paclitaxel is administered.
76. The method of any one of claims 74-75, wherein:(a) the subject has non-squamous cell NSCLC, the chemotherapeutic agents comprise cisplatin and pemetrexed, and about 75 mg / m2cisplatin and about 175 or about 200 mg / m2pemetrexed are administered every three weeks;131986-7101(b) the subject has non-squamous cell NSCLC, the chemotherapeutic agents comprise carboplatin and pemetrexed, and AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 175 or about 200 mg / m2pemetrexed are administered every three weeks;(c) the subject has squamous cell NSCLC, the chemotherapeutic agents comprise cisplatin and gemcitabine, and about 75 mg / m2cisplatin and about 1000 mg / m2or about 1250 mg / m2gemcitabine are administered every three weeks;(d) the subject has squamous cell NSCLC, the chemotherapeutic agents comprise carboplatin and gemcitabine, and about AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 1000 mg / m2or about 1250 mg / m2gemcitabine are administered every three weeks;(e) the chemotherapeutic agents comprise cisplatin and paclitaxel, and about 75 mg / m2cisplatin and about 175 mg / m2or about 200 mg / m2paclitaxel are administered every three weeks; or(f) the chemotherapeutic agents comprise carboplatin and paclitaxel, and about AUC of about 5 mg / mL-min or AUC of about 6 mg / mL-min carboplatin and about 175 mg / m2or about 200 mg / m2paclitaxel are administered every three weeks.
Citation Information
Patent Citations
RNA cancer vaccines
WO2020097291A1
Personalized cancer vaccines
WO2024151811A1