Identification of inhibitors of the catalytic RNA subunit of rnase p

WO2026064652A9PCT designated stage Publication Date: 2026-06-04OHIO STATE INNOVATION FOUND +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
OHIO STATE INNOVATION FOUND
Filing Date
2025-09-19
Publication Date
2026-06-04

Smart Images

  • Figure IMGF000002_0001
    Figure IMGF000002_0001
  • Figure IMGF000003_0001
    Figure IMGF000003_0001
  • Figure IMGF000003_0002
    Figure IMGF000003_0002
Patent Text Reader

Abstract

The present invention demonstrates the utility of small-molecule microarray (SMM) screening method used to identify novel small-molecule scaffolds that bind to long non-coding RNAs (lncRNAs), thereby expanding the possibilities for RNA-targeted therapeutics. RNase P is a ribozyme that is essential for 5'-maturation of precursor tRNAs. Disclosed herein is an inhibitor of the Methanobrevibacter smithii RNase P RNA (Msm RPR). The inhibitor comprises of a diaryl-piperidine compound, termed M1, to inhibit Msm RPR. Given the similarity of Msm RPR to RPRs from similar archaea in the rumen, the present invention provides support for the idea of mitigating methane production by altering rumen tRNA metabolism.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Docket No. 103362 -O31W01

[0002] IDENTIFICATION OF INHIBITORS OF THE CATALYTIC RNA SUBUNIT OF R ASE P

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] This application claims benefit of U. S. Provisional Application No. 63 / 696,950, filed September 20, 2024, incorporated herein by reference in its entirety.

[0005] SEQUENCE LISTING STATEMENT

[0006] A. Sequence Listing conforming to the rules of WIPO Standard ST.26 is hereby incorporated by reference. Said Sequence Listing has been filed as an electronic document via PatcntCenter encoded as XML inUTF-8 text. The electronic document, created on September 18, 2025, is entitled ‘T0046-609W01 ST26.xmr', and is 20,595 bytes in size.

[0007] FIELD

[0008] Disclosed herein are methods for decreasing enteric methane emission from ruminants by inhibiting RNase P, a tRN A biogenesis enzyme.

[0009] BACKGROUND

[0010] Drug discovery efforts have traditionally focused on only a few human protein families because most of the protcome is not easily druggable. However, the finding that 98% of the human genome is transcribed to non-coding (tic.) RNAs, which play essential roles in diverse cellular processes, has inspired a rethink that drug development should include ncRNA targets. This shift is gaining momentum with the growing appreciation that either ncRNA deregulation or ncRNA variants are associated with many diseases, including cancer and neurodegeneration.

[0011] While RNA tertiary folds that include well-defined clefts (like proteins) should be draggable with small molecules that exhibit favorable binding characteristics, the ability of RNAs to sample a structural ensemble with similar stabilities is a key challenge for drug discovery. Thus, the rugged folding landscape of RNAs has led to low hit rates from high- throughput screening (HTS) methods and.rendered difficult in silica docking approaches. Nevertheless, various fluorescence- / mass spectrometry-based screening methods have identified ligands that bind with varying affinities (-15 nM to 50 mM) to diftcrent target RNAs implicated in genetic and infectious diseases. Also, an analysis of the physicochemical properties of several bioactive RNA binders versus RNA binders with no bioactivity and FDA- approved drugs led to the finding of privileged structural (c.g„ rod-like shapes) and chemical Docket No, 103362 -O31 01

[0012] (c,g., hetero-atom-containing.rings, aromatic rings, few stereocenters) features in the active RNA ligands. These exciting RNA targeting efforts are exemplified in the recent identification of an indazole-benzimidazole compound with a Kfo of 400 tiM to the 431 -nt RepA element in the 17-kbXist.

[0013] RNase P is an essential and ubiquitous enzyme that catalyzes the Mg2'-dependent 5’ maturation of precursor tRNAs (prc-tRNAs), Aminoglycosides (puromycin, neomycin) and their derivatives (e.g., guanyl / lysyi / argmyl-modified versions) were shown to inhibit bacterial RNase P. Phenothiazine and pyronine G derivatives were tested and found to inhibit the activity of bacterial RPRs with low-pM inhibition constants (Ki). Unlike aminoglycosides, inhibition of RPRs by toluidine blue O or thionine (both phenothiazines) was weakened modestly but not alleviated at 100 mW Mg2*, However, both aminoglycosides and phenothiazines are promiscuous binders and exhibit low target RNA selectivity'. Thus, despite many candidates leads, promiscuity and protein-mediated aggregation considerations motivate efforts to expand the chemical space and repertoire of functional modulators of RNase P.

[0014] What is needed in the art is method of reducing or inhibiting maturation of precursor iRNAs within methanogenic archaea. Also needed are methods of iden tifying such molecules.

[0015] SUMMARY

[0016] In some aspects, disclosed herein is a method of reducing or inhibiting maturation of precursor tRNAs within methanogenic archaea, the method comprising exposing RNase P RNA from methanogemc archaea to an RNase P inhibitor, wherein said RNase P inhibitor interacts with RNase P and prevents it from catalyzing maturation of precursor tRNAs within the methanogenic archaea.

[0017] In some embodiments, the said interaction is between the inhibitor and the RN A subunit of the RNase P ribouucleoprotein,

[0018] hi some embodiments, the said method takes place m vivo or fo vitro.

[0019] hi some embodiments, the said method takes place within a vertebrate, wherein the vertebrate is aruminant

[0020] In some embodiments, the methanogenic archaea belong to

[0021]

[0022] genus and species.

[0023] In some embodiments, the inhibitor is a small molecule (Ml) which is a diaryl- piperidinc compound.

[0024] In some embodiments, the inhibitor comprises the following structure: Docket No. W3362-031WQ1

[0025]

[0026] In some aspects, disclosed herein is a method of.reducing enteric methane production in ruminant livestock, the method comprising administering to the ruminant livestock an inhibitor of RNase. P in methanogenic archaea within the gastrointestinal tract of the livestock, wherein said inhibitor prevents RNase P from catalyzing maturation of precursor tRNAs, thereby reducing growth and thus enteric methane production by the ruminant livestock.

[0027] In some embodiments, the said interaction is between the inhibitor and the RNA subunit of the RNase P ribonucleoprotein.

[0028] In some embodiments, the methanogens comprise rumen methanogen community e.g.

[0029]

[0030] (an order that includes the

[0031]

[0032] and fe / Amtosphaera genera) and Metbawmas^iicoceales’, with minor contributions also from Meihatnmncr bnim and eiham)$artirwi genera.

[0033] In some embodiments, the Inhibitor is given daily, weekly, or monthly via oral means added to the livestock feed.

[0034] In some aspects, disclosed herein is a composition comprising a small molecule inhibitor of RNase P from methanogenic archaea, wherein the small molecule inhibitor has active stereoisomers.

[0035] In some embodiments, the small molecule inhibitor comprises; three aryl rings, two hydrogen bond donors, and one hydrogen bond acceptor.

[0036] In some embodiments, the structure of the small molecule inhibitor comprises a piperidine cote with diary l rings attached to the 2,6 positions of the piperidine core.

[0037] In some aspects. disclosed herein is a method of identifying an inhibitor for reducing or inhibiting RNase P R A, the method comprising;

[0038] a) exposing a small molecule to RNase P RNA; and b) detecting interaction between the small molecule and RNase P RN A;

[0039] and Docket No. 103362 -O31 01

[0040] c) determining that the small molecule can reduce or inhibit maturation of precursor tRNAs, thereby identifying a small molecule inhibitor or RNase P R A.

[0041] hi some embodiments, the inhibitor is an Ml analog.

[0042] BRIEF DESCRIPTION OFFIGURES

[0043] The accompanying figures, which arc incorporated in and constitute a part of this specification, illustrate several aspects described below.

[0044] Figures 1A, I B. and 1C show a small molecule microarray (SMM) screen with Cy5- labeled Methanobr vibacter sifibhii (Msm) RNase P RNA (RPR), Figure 1A shows the secondary structure of Msm RPR with 5' and 3* extensions (referred to as Mwt RPR in the text). In this depiction, P corresponds to the paired regions in the RPR labeled in consecutive order of appearance during transcription, and L corresponds to the loop regions. A Cy5-labeled PNA oligo complementary to the 5* extension was used to generate the fluor-labeled AA / » RPR for subsequent use in the SMM screen. Figure IB shows the effect of Mg " on the pre-tRNA processing activity of Msm RPR. Representative denaturing polyacrylamide [10% (w / v) / 7 M urea] gel showing the cleavage of 5'~[-5:?P]-la'belcd fhermus lhermaphilus (Trit) pre-tRNAi>’ by M RPR in the presence of either 10 M or 400 mM Mg:monitored over a period of 1 h at 37SC. Figure IC shows scatter plot of Z-scorcs showing the comparison of SMM screening results in the presence of 400 mM or 10 mM Mg2". The data points in bine represent the hits that show binding preference at 400 m Mg2+over 1.0 mM Mg2", The dotted red fine corresponds to aZ-score value of 3, and small molecules with a Z-score > 3 were considered selective binders. The sequence found in the figures is represented by SEQ ID NO: 9.

[0045] Figures 2A and.2B depict the characterization of Af RPR small molecule binders to identify functional modulators. Figure 2 A shows the relative activity of Msm RPR in. the presence of small molecule binders identified.from the SMM screen. Cleavage assays were performed in 50 mM Tris-HCl (pH 7.5 at22°C), 2 M ammonium acetate, and 400 mM MgC12. Each reaction contains 1 u. M Msm RPR, 20 uM 7? / ? pre- tRN A<iiy; and 100 gM of the respective small molecule binder. The reaction was monitored for an hour at 37°C, and time points were taken at 30 min and 60 min after the addition of the substrate to calculate an estimated turnover number. Data from two independent measurements were used to calculate the average relative activity and the associated mean absolute error. The dotted grey line in the figure indicates the activity of uninhibited sm RPR. Figure 2B shows representative denaturing polyacrylamide Docket No, 103362 -031W01

[0046] [10%(w / v / 7 M urea] gel showing ths cleavage of 5’-',2P-labeled fh pre-tR A ^' by szn RPR in the presence of 0, 50 pM, or 100 pM conunercidly purchased Ml (Ml comm).

[0047] Figures 3 A, 3.8, 3C and 3D depict the detennination of the inhibition constant ( l) and apparent binding affinity

[0048]

[0049] of synthetic Ml (Mlsyn). Figure 3 A shows a representative progress curve plot of M RPR in the presence of increasing concentration of Mlsyn, Cleavage assays were performed in 50 inM Tris-HCl (pH 7.5 at 22VC), 2 M ammonium acetate, and 400 mM MgCl?. Each reaction contains 1 pM M R. PR, 20 pM Tih pre-tRNA(’ and increasing concentrations of Mlsyn in 2.5% (v / v) DM SO. The reaction was monitored over 90 min. The data were analyzed as described in the Materials and Methods section. Data from two independent trials were used to calculate the average and mean absolute error for the reported KI Figure 3B shows profile likelihood plot of the KI value obtained for Mlsyn from two independent trials. The x-axis is in the natural logarithmic scale. Figure 3C shows representative surface plasmon resonance and imaging (SPRi) sensogram to determine the binding affinity of Mlsyn on Mwn RPR. Increasing concentration of Msm RPR ((1,625 pM - 2(1 g. M) was flown through lsyn- immobilized chip to obtain the SPRi sensogram and the corresponding binding curve Figtae 3D shows steady state. Data from three independent trials were used to calculate the a verage and standard deviation of the KD(app) value reported. Docket No, 103362-031W01

[0050] Figure 4 shows the summary of structure-activity relationship analy sis performed with MI analogs. The inhibition constants (Ki) for inhibition of Mw RPR by and the apparent binding affinity to the RPR of the Ml analogs are reported. Changes made to the methyl group in the piperidine ring are highlighted in blue, changes made to the nitrogen atom in the piperidine ring are highlighted in pink, and the changes made to the diaryl rings connected to the piperidine ring are highlighted in green. Except Ml -ethyl, all the other analog compounds were synthesized. The average and mean absolute error for the Ki value of each analog was determined from two independent trials. The average and standard deviation for the Afo(apPvalues were calculated from three independent trials. Abbreviations used: ND, not determined; NA, not applicable.

[0051] Figures 5 A, 5B and 5C depict selectivity of the inhibiti on by Ml and its analogs. AlphaFold 3 models of Figure 5 A w and Figure 5B Pfu RPR. The conserved catalytic core is highlighted in the two RPRs and comprises the P1-P4-P5 and P8»P9 stacked helices. The less conserved regions in the two RPRs are faded out in the figure. Figure 5C shows relative activity of P RPR in the presence of Ml and analogs. The cleavage assays were performed under the same buffer conditions as Mw RPR activity assays: I gM Pfu RPR, 20 pM Tth pre RNAy, and 100 u. M Isyn / 200 M Mlcomm or analogs in 50 »M Tris-HCl (pH 7.5 at 22°C), 2 M ammonium acetate, 400 mM MgC12, and 2.5% (v / v) DM SO. The reaction was monitored at 37 °C over a period of 90 min. Data from two independent trials were used to calculate the average relative activity and the associated mean absolute error.

[0052] Figure 6 shows Michaelis-Menten kinetic analysis of pre-tRuiycleavage by Mw RPR (the variant with 5* and 3‘ extensions). The initial velocity (v») at each substrate concentration was obtained from two independent trials. The average and mean absolute error of the kinetic parameters are reported. The curve-fit error for kea>. and KM values in each trial was <30%.

[0053] Figures 7 A and 7B depict microscale therrnophoresis assays to determine the binding affinity of Cy5-oligo to Msm RPR at Figure 7 A which shows 10 mM Mg!iand Figure 7B which shows 400 m Mg2*. The mean and standard deviation of K» value in each case was determined from four independent trials. The curve-fit error for the Ku value in each case was <37%.

[0054] Figure 8 depicts the effect of addition of the Cy5-oligo on the activity of M RPR, The Cy5~oligo was added post-refolding of the RPR, The average from two independen t trials and the Docket No, 103362-031W01

[0055] associated mean absolute error of the product formed over time in the presence or absence of the oligo is depicted here.

[0056] Figures 9A and 9B show a small molecule microarray screen with Mxm RPR. Figure 9A shows fluorescence i mages of the S'MM slides incubated with buffer, Cy5-oligo, or Cy5 -labeled A / sffj RPR in the presence of 10 mM or 400 mM Mg". Figure 9B shows Venn diagram analysis of the small-molecule binders obtained for the C 5- oligo and RPR (-K.'y5-oligo) in the presence of 400 mM Mg '\ and binders of M RPR(- 'y5>oligo) screened in the presence of 10 mM or 400 m. M Mg":.

[0057] Figure 10 shows the effect of DMSO on the activity of Afern RPR. Data represent the average from two independent trials and the- associated mean absolute error of the relative activity of Mw RPR in the presence of 1 %, 2.5%, or 5% (v / v) final DMSO.

[0058] Figure 11 shows the selectivity profiling of Ml based on previously compiled SMM data. Ml shows binding preference to vn RPR in 400 M Mg^ over 10 M: Mg2* and other DNA / RNA structures [G4 (quadruplex), 3WJ ( three- wa unction), SL (Stem loop), pseudoknot].

[0059] Figure 12 shows the progress curve for product formation by Jto RPR in the presence of Data is from two independent trials. The Kt and the global-fit w value obtained for each trial is indicated in the corresponding progress curve plot The profile likelihood plot of the Ki values from two independent trials is depicted. The x-axis in the profile likelihood plot is in natural logarithmic scale.

[0060] Figures 13 A, 13B and 13C depict synthetic schemes of Ml and its analogs. Figure 13 A shows in scheme I the synthesis of M l and analogs using (a) ammonium acetate, ethanol, reflux, 18 h, 24%. Figure 13B shows in scheme 2 the synthesis of analogs Ml and analogs (Ml yn, Ml- NMe, Mil-desMeNMe, and Ml-desMedesdiaryl) using (a) THF, reflux, 2 h, 59%; (b) 4: HCl dioxane, it, 1 h, 80%, Figure 13C shows in scheme 3 the synthesis oTMl-desMe and Ml-desMe- N-allyl using (a) L -proline, MeOH, rt, 18 h,46%; (b) 1 M (2-rnetho.xyphenyl) magnesium bromide, THF, reflux, 2 h, 45%; (c) Grubbs catalyst (I), toluene, reflux, 18 h, 18%.

[0061] Figure 1.4 shows WATER-LOGSY MR data to characterize the binding of synthesized Ml (MhvJ toM RPR.

[0062] Figures 15 A and 15B show progress curves for product formation, Figure.15 shows the progress curve of RPR in the presence of Mlsyti and analogs (Ml -desMe and Ml -desMe~N- allyl), The Ki and the global-fit vO value obtained for each trial is indicated in the corresponding Docket Me, 103362-031 WO1

[0063] progress curve plot. The profile likelihood plot of the Ki values obtained from the two trials is depicted. The x-axis in the profile likelihood plot is in. natural logarithmic scale. Figure 15B shows progress curve of Ufa RPR. in the presence of lsyn and analogs (MI- Me, Ml-desMe -NMe, Ml -ethyl, and Ml-de Me-desdiaryl). The Ki and the global-fit vQvalue obtained for each trial is indicated in the corresponding progress curve plot. The profile likelihood plot of the KI values obtained from the two trials is depicted. The x-axis in the profile likelihood plot is in natural logarithmic scale. As Ml -desMe-desdiaiy l is an activator, a Ki value is not applicable (denoted as “NA”).

[0064] Figures 16 A, 16B, 16C, and 16D depict SPRi-based estimation of the apparent binding affinity (KD< W>) of Mlsyn to wt RPR and 'fit RPR, Figure 16A shows three SPRi sensorgrains depicting the binding of Mlsyn to increasing concentrations of wn RPR, and the corresponding binding curves are shown in Figure 168. Figure 16C shows three SPRi sensorgrams depicting the binding of Mfonto increasing concentrations of P / u RPR, and the corresponding binding curves are shown in Figure 16D. Data from three independent trials were used to calculate the average and standard deviation of the Krx^r) value reported. In the figure, ND corresponds to “not determined” due to the weak binding signal from SPRi assay and poor curve fit of the steady state binding curve.

[0065] Figures 1.7A, 17B, 17C and 17D depict SPRi-based estimation of the apparent binding affinity (Knew)) of Ml comm to Afw RPR and Pfii RPR. Figure 17 A shows three SPRi sensorgrams depicting the binding of Ml «mmto increasing concentrations of Mm RPR, and the corresponding binding curves are shown in Fi ure 17B, Figure 17C shows three SPRi sensorgrams depicting the binding of M I co m to increasing concentrations of Pfu RPR, and the corresponding binding curves are shown in Figure 17D. Data from two only independent trials were used to calculate the average and mean error of the Krx^i) value reported. In the figure, ND corresponds to “not determined” due to the weak binding signal from SPRi assay and poor curvefit of the steady state binding curve. In trial 2, the SPRi Sensorgram indicates no binding event between ATrtw RPR and MIMMB. This variability could be due to inefficient immobilization of the MIc«mm on the SPRi chip.

[0066] Figures 18A, 18B and 18C depict SPRi-based estimation of the apparent binding affinity (Kivap l) of Ml-desMe-desdiaryl to Msm RPR and PJu RPR. Figure ISA shows three SPRi sensorgrams depicting the binding of MI-desMe-desdiaryl to increasing concentrations of Afcm RPR, and the corresponding binding curves are shown in Figure 18B. Figure I8C shows three Docket No, 103362-031 WO1

[0067] SPRi sensorgrams obtained for Ml-des. Me-desdiarylin the presence of increasing concentrations of Ffo RPR. Data from three independent trials were used to calculate the average and standard deviation of the

[0068]

[0069] value reported.

[0070] Figures 19 A, 19B and 19C show SPRi-based estimation of the apparent binding affinity ( txwjj of Ml-desMe to w RPR and Pfu RPR. Figure 19A shows three SPRi sensorgrams depicting the binding of Ml-desMe to increasing concentrations of Msm RPR, and the corresponding binding curve are shown in Figure 19B shows. Figure 19C shows three SPRi sensorgrams obtained for MI -des. Me in the presence of increasing concentrations of Pfu RPR. Data from three independent trials were used to calculate the average and standard deviation of the Kxap ) value reported.

[0071] Figures 20 A, 2 OB and 20C show SPRi -based estimation of the apparent binding affinity (Krxapp)) of l-desMe> N-a11yl to Afem RPR and Pfu RPR. Figure 20A shows three SPRi sensorgrams depicting the binding of Ml-desMe-N-aUyl to increasing concentrations of Mw RPR, and the corresponding binding curves are shown in Figure 20B. Figure 20C shows three SPRi sensorgrains obtained for. Ml-desMe-N-ailyl in the presence of increasing concentrations of Pfu RPR. Data from only two independent trials were used to calculate the average and mean error of the Ku( > value reported. In the figure, ND corresponds to “not determined” due to the weak binding signal from SPRi assay and poor curvefit of the steady state binding curve. In trial 2, the SPRi sensogram indicates no binding event between to RPR and. Ml-desMe-N-ariyl. This variabil ity could be due to inefficient immobilization of the M l-desMe-N-allyl on the SPRi chip.

[0072] Figures 21 A, 21B and 21C show SPRi-based estimation of the apparent binding affinity (Kiwapp)) of M I -ethyl to Af RPR and Pfu RPR, Figure 21 A shows three SPRi sensorgrams depicting the binding of Ml -ethyl to increasing concentrations ofAfon RPR, and the corresponding binding curves are shown in Figure IB. Figure 21C shows three SPRi sensorgrams obtained for Ml -ethyl in the presence of increasing concentrations of Pfu RPR. Data from three independent trials were used to calculate the average and standard deviation of the Kn(spp) value reported.

[0073] Figures 22 A, 22B and 22C show SPRi-based estimation of the apparent binding affinity (KCKW)) of M I-desMe-NMe to Afem RPR and Pfu RPR. Figure 22A shows three SPRi sensorgrams depicting the binding of Ml-desMe-NMe to increasing concentrations of Msm RPR, and the corresponding binding curves are shown in Figure 22B. Figure 22C shows three SPRi sensorgrams obtained for Ml-desMe-NMein the presence of increasing concentrations of Pfu RPR. Data from Docket o, 103362-031W01

[0074] three independent trials were used to calculate the average and standard deviation of die Kryapp) value reported.

[0075] Figures 23A, 23B and 23C show SPRi-based estimation of the apparent binding affinity (Kt wt) of Ml-NMe to vn RPR and P / h RPR. Figure 23 A shows three SPRi sensorgrams depicting the binding of M? I-NMe to increasing concentrations of RPR, and the corresponding binding curves are sho wn in Figure 23B. Figure 23C shows three SPRi sensorgrams obtained for Ml-NMe in the presence of increasing concentrations of PJu RPR. Data from only two independent trials were used to calculate the average and mean error of the Kt w) value reported. In the figure, ND corresponds to “not determined” due to the weak binding signal from SPRi assay and poor curvefit of the steady state binding curve. In trial 2, the SPRi sensogram indicates no binding event between Msm RPR and l-N-Me. This variability could be due to inefficient immobilization of t he Ml-N-Me on the S PRi chip.

[0076] Figures 24A and 24B show stacked-plot depictions of the secondary structure of Figure 25A which is btethanobrevibacter snnlhii (Msm) and Figure 25B which is Pymcoccus furwsus (Pfii) RPR (SEQ ID NOS 9 and 10 in 24A and 24B, respectively)

[0077] Figures 25A and 25'B show die effect of Ml and its analogs on the activity of Pfif RPR. Progress curve data from two independent trials are depicted here.

[0078] Figure 26A-B shows the stacked-plot depictions of the secondary structure of Mefhan brevibacfer smitkii ( Msm, 26A) and Methanabrevibacier sp. RUG 13115, While the work on Mefbanobrevibacfey smitbii in the context of the catle rumen is supportive, metageuomic (16S rRNA-based) analysis indicates that close relatives of tins organism belonging to the same genus (Mei aHobrevIbacter, 26B) comprise about 70% of the rumen methanogen population. These related organisms have RPRs that are highly identical (-90%) to the Methambrevibacter Mnithii RPR. Therefore, the RPRs

[0079]

[0080] in species resident in the rumen are likely to be inhibited by Ml, SEQ ID NOS'. 9 and 11 are depicted in Figures 26A and B, respectively.

[0081] Figure 27 shows growth of M^lhanobrevibacter smithii PS in the absence and presence of Ml-syn. smPbii PS was cultured in a rubber stopper- and aluminum crimp-sealed 160 ml., serum bottle containing 25 ml anaerobic RM02 growth medium with 5% (v / v) clarified rumen fluid (1) and a 135 nil, headspace filled with a mixture of Ha and CO? (80:20, v / v) at an absolute pressure of 2.07 MO5Pa. The culture was grown at 37°C with shaking at 75 rpni for the first 15 h, then at 150 rpm for the next. 12 h in a Barnstead / Lab-Line Max Q 4000 A -Class orbital shaker Docket No, 103362-031W01

[0082] (Lab-Line Instruments, Inc., Melrose Park, IL), with pressurization every 3 h with the above- mentioned gas mixture to keep the pressure constant Optical density of a culture at 600 n (ODeoo) was measured by using a Genesys’^ 50 spectrophotometer (ThermoFisher Scientific,. Waltham, MA) with a -"500 pL sample in a polystyrene semi-micro cuvette with a 1 -cm light path (Millipore Sigma, St. Louis, MO). MLl-syn was dissolved in DMSO and added to a culture at the final concentrations and the time as indicated by the sign “‘Addition” and a bent arrow, d ahofe / b / - rh<? C'XOtfot plots: *, replicates; -, average of two independent measurements. The color codes for the Ml-syn concentrations are presented in the inset,

[0083] Figure 28 shows total RNA from M. smithii cells grown in the presence of either DMSO (i.e., no inhibitor) or with 50, 100 or 200 mM Isy«(in DMSO) (see Fig, 27) were subjected to automated capillary electrophoresis (CB) to separate and quantitate the different cellular RNAs. While there were two no-inhibitor samples, all other measurements were from biological triplicates. The 16S rR A, 23S rRNA, and total tRNAs were prominent, as was a putative tRNA precursor (in the M l syn- treated samples) that migrated slower than the mature tRNA. The ProSize Data Analysis software (Agilent) was used to quantitate each species based on their abundance. By using the 168 rRNA as a normalization control, the mean values of a precursor(pre)-tRNA were determined for the biological replicates. The CE was performed twice (technical replicates) and the measurements were averaged from two independent CE runs to calculate the average and mean absolute error shown.

[0084] DETAILED DESCRIPTION

[0085] Those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain ci rcumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof. Docket Me, 1Q3362-031WO1

[0086] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Terminology

[0087] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term "comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and areopen, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of5and “consisting of5can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this disclosure and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context, dictates otherwise.

[0088] The following definitions are provided to fully understand the terms used in this specification.

[0089] The terms "about." and ’’approximately” are defined as being “close to” as understood by one of ordinary skill in the art. In one non-limiting embodiment, the terms are defined to be within 10%. In another non-limiting embodiment the terms are defined to be within 5%, In still another non-limiting embodiment the terms are defined to be within I %.

[0090] As used herein, the terms "may,” "optionally," and "may optionally1' are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation ’’may include an excipient'’ is meant to include cases in which the formulation includes an excipient, as well as cases in which the formulation does not include an excipient

[0091] “'Composition” refers to any agent that has a beneficial biological effect. The terms also encompass pharmaceutically acceptable, pharmacologically act i ve deri vati ves of beneficial agents specifically mentioned herein, including, but not. limited io, a vector, polynucleotide, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “composition” is used, then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically Docket No, 103362-031 WO1

[0092] acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0093] The term “comprising”, and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Aidtough the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of’ and “■consisting of’ can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed.

[0094] An "increase" can refer to any change that results in a greater amount of a composi tion, condition, or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 23, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100%, or more increase so long as the increase is statistically significant.

[0095] A "decrease" can refer to any change that results in a smal ler amount of a composition, condition, or activity. A decrease can be a change in the symptoms such that the symptoms are less than previously observed, A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 23, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant,

[0096] By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic. It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. A “reduction” can mean a decrease by I %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%), 20%, 21%, 22%, 23%, 24%, 23%, 26%, 27%, 26%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0097] By “prevent” or other forms of the word, such as “preventing’' or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the de velopment or progression of a particular event or characieristic, or to minimize the chances that a particular event or characteristic Docket o, 103362-031W01

[0098] will occur. Prevent does not require comparison to control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise. something could be prevented but not reduced, but something that is pre ented could also be reduced. It is understood that where reduce or ■prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.

[0099] As used herein, "‘dose,” “unit dose,” or “dosage” can refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of a disclosed compoundand / or a pharmaceutical composition thereof c alculated to produce the desired response or responses in association with its administration.

[0100] As used herein, the term “inhibit" refers to a partial or whole decrease in function. For example, inhibition of gene transcription or expression refers to any level of downregulation of these functions, including complete elimination of these functions. Modulation of protein activity refers to any decrease in activity, including complete elimination of activity. Inhibition can mean a complete decrease in function, or a partial decrease in function. Inhibition can be, for example, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%,9%, 10%, 11%, 12%, 13%, 14%, 15%, 10%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 23%, 26%, 27%, 26%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83”v, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0101] The term “administering” refers to an administration that is oral.

[0102] As used herein, the term “effective amount” refers to an amount that is sufficient to achieve the desired modification of a physical property of the composition or material. For example, an “effective amount” of an agent refers to an amount that is sufficient to achieve the desired improvement in the property modulated by the formulation component, e.g., desired reduction in methane. The specific level.in terms o i% in a composition required as an effective amount will depend upon a variety of factors, incl uding the amount and type of agent.

[0103] As used herein, the term “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired result or to have an effect an undesired symptoms but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any Docket No, 103362-031 WO1

[0104] particular subject will depend upon a variety of factors, including the specific composition employed; the age, body weight, general health, sex, and diet of the subject; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors within the knowledge and expertise of the health practitioner and which may be well known in the art. Progress / effectiveaess can be monitored by routine diagnostic methods known to one of ordinary skill in the art. The desired response to treatment can also be delaying the onset or even preventing the onset.

[0105] The term “interaction” refers to an action that occurs as two or more objects have an effect on one another, either with or without physical contact Tn terms of biological interactions, cells, proteins, and other macromolecules can have said effects on one another to impact biological functions.

[0106] The term '"■screening5’ refers to a method especially used in drug discovery' in which data pfocessing / control software, liquid handling devices, and sensitive detectors can allow for quick conductions of chemical, genetic, or pharmacological tests, This process allows one to quickly recognize active compounds that modulate a particular bioinolecular pathway. The results of these processes provide starting points for drug design.

[0107] The term “ruminant livestock” refers to a mammal of the order rirrtotfecwte that digests plant-based food by initially softening it within the animal’s stomach (rumen) first, then regurgitating the semi-digested mass, now known as cud, and chewing it again.

[0108] The term “methane” refers to the greenhouse gas whose concentration in the atmosphere has doubled over the last century and continues to increase alarmingly. Ruminants are the major Contributors to biogenic methane formation, and it has been estimated that the prevention of methane formation from.ruminants would almost stabilize atmospheric methane concentrations.

[0109] The process of chewing the cud again to break down plant matter further and stimulate digestion is called “ruminating,”

[0110] The term “animal feed compositions” and “feed addi fives” comprising the small molecule inhibitor refers to any compound, preparation, mixture, or composition suitable for or intended for intake by an animal.

[0111] Methods of Reducing Methane Production Docket No, 103362-031W01

[0112] Over a 100-year period, the greenhouse gas methane is capable of a ~30>fold higher warming potential than CO2. In the US, -23% of the total methane emission is.from fanned cows, sheep, and goats. To dampen enteric methane-generating fermentation in ruminants, archaeal RNase P can be inhibited.

[0113] RNase P is an essential and ubiquitous endoribonuclease that catalyzes the. Mg(ll)- dependent 5 processing of precursor-tRNAs (pre-tRNAs). The ribonucleoprotein form of this enzyme comprises a catalytic RNase P RNA (RPR) and a variable number of RNase P protein cofactors: one in bacteria, <5 in archaea, and < 10 in eukaryotes. This structural diversity of RNase P was leveraged across the three domains of life to identify drugs that exclusively target the archaeal version (Example 1),

[0114] Disclosed herein is a method of reducing or inhibiting maturation of precursor tRNAs within methanogenic archaea, the method comprising exposing RNase P RNA from methanogenic archaea to an RNase P inhibitor, wherein said RNase P inhibitor interacts with RNase P an d preven ts it from catalyzing maturation of precursor tRN As within the methanogenic archaea. By reducing or inhibiting methane production in methanogenic archaea, methane gas production can be reduced or inhibited.

[0115] In some embodiments, the said interaction between the inhibitor and the RNA subunit of the RNase P ribonucleoprotein.

[0116] The disclosed method can take place b? vfw or z« vz / ro, For example, m vivo, the method can take place in a living organism, such as a ruminant. Types of organisms are described below. Alternatively, the method can take place in vitro. When said inhibition takes place in vitro, it can be done in an assay to determine effectiveness. For example, an in vitro assay to detect the mteract.ion between RNase P and the inhibitor can involve the preparation of RNase P and its substrate. As disclosed herein, Mw RPR (Methanobrevibac r smithii RNase P RNA) and Pfu RPR / nrnnv / v RNase P RNA) can be prepared by in vitro transcription (IVT) using DNA templates generated via PCR.

[0117] Also disclosed herein is a method of reducing enteric methane production in ruminant livestock, the method comprising administering to the ruminant livestock an inhibitor of RNase P in methanogenic archaea within the gastrointestinal tract of the livestock, wherein said inhibitor prevents RNase P from catalyzing maturation of precursor tRNAs, thereby reducing growth and thus enteric methane production by the ruminant livestock Figure 27 depicts an approximately Docket No, 103362-031 WO1

[0118] two-fold growth retaidation after 27 hours growth in the presence of 0,1 mM Mlsya, an inhibitor ofRNase P (the examples provide more detail regarding M!«>»)* These data demonstrate that this compound enters the cell and impairs growth. Moreover, total RNA has been isolated from cells grown in the presence of either DM SO (i.e,, no inhibitor) or with 50, 100 or 200 rnM Mhyti (in DMSO), An Agilent Fragment Analyzer, an automated capillary electrophoresis instrument, was used to examine changes in the total RNA profile. From this analysis, it became evident that there is an approximately two-fold decrease in the mature (RNA and an eight-fold increase in at least one species that appears to be a precursor ( Fig. 28). Northern blotting and / or quantitative RT- PCR can be used for more in-depth analysis.

[0119] The disclosed methods and compositions can also be used in human treatment There are increasing reports of association between w m and various intestinal disorders and obesity. Classical strategies for inhibiting methanogenic archaea include using compositions such as rifaximin or metronidazole, which can reduce methanogen load but often lack selectivity and may disrupt beneficial microbiota, Therefore, also disclosed herein are treatment modalities that target methanogenic archaea such

[0120]

[0121] as M in the human gut using the compositions disclosed herein.

[0122] The rumen is home to a vast array of ciliate protozoa, anaerobic fungi, anaerobic bacteria and archaea. Methane is produced as a natural consequence of anaerobic fermentation, which represents an energy loss to the host animal as well as emission of methane. Ruminants comprises cattle, goats, sheep, giraffes, American Bison, European bison, yaks, water buffalo, deer, camels, alpacas, llamas, wildebeest, antelope, pronghorn, and nilgai. Specifically, the term “cattle” includes all production kinds of cattle, particularly dairy cows and beef cattle.

[0123] Methane production in an indi vidual archaea using the methods disclosed herein can be reduced by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or completely after the use of the inhibitor. Ideally, reduction is by at least 30%.

[0124] In particular, providing to ruminants a small molecule inhibitor can bring about reduction of methane in the raminant. An example of such an inhibitor includes the compound.referred to herein as “M I.” (See Figure 4, for example). M l or an analog thereof can comprise a piperidine core with diary! rings attached to the 2,6 positions of the piperidine core or three aryl rings, two hydrogen bond donors, and one hydrogen bond acceptor is effective for reducing the production of methane emanating from the digesti ve activities of ruminants by interacting with RNase P in Docket Me, 103362-031W01

[0125] the methanogenic archaea in the ruminant gut and preventing it from catalyzing maturation of precursor tRN As within the methanogenic archaea. This formula is provided in more detail below.

[0126] As used herein, in some embodiments, the methanogenic archaea, or methanogens, are a group of archaea that produce methane as a byproduct of their metabolism. All methanogenic archaea have RNase P.

[0127] Methane emission following intake of the small molecule inhibitor by a ruminant can result in at least a 30%, 40%, 50%, 60%, 70%, 80% or 90% or more decrease in methane emission from the ruminant. Ideally, at least a 30% reduction in methane emission will occur in the ruminant.

[0128] Administration can be carried out using therapeutically effective amounts of foe small molecule inhibitors described herein for periods of time effecti ve to decrease methane production or inhibit methanogenic RNase P RNA. The effective amount may be determined by one of ordinary skill in the art and includes exemplary dosage amounts for cattle of from about 0.5 to about 200 mg / kg of body weight of active diaryl-piperidine compound per day, which may be administered in a single dose or in the form of indi vidual divided doses, such as from 1 to 4 times per day. Alternatively, the dosage amount can be from about 0,5 to about 150 mg / kg of body weight of active diatyl-piperidine compound per day, about 0.5 to 100 mg / kg of body weight of active diaryl-piperidine compound per day, about 0,5 to about 75 mg / kg of body weight of active diaryl-piperidine compound per day, about 0,5 to about 50 mg / kg of body weight of active diaryl- piperidine compound per day, about 0.5 to about 23 mg / kg of body weight of active diaryl- piperidine compoun per day, about 1 to about 20 mg / kg of body weight of active diaryl-piperidine compound per day, about 1 to about 10 mg / kg of body weight of active diaryl-piperidine compound per day, about 20 mg / kg of body weight of active diaryl-piperidine compound per day, about 10 mg / kg of body weight of active diaryl-piperidine compound per day, or about 5 mg / kg of body weight of acti ve diatyi-piperidine compound per day.

[0129] The small molecule can be administered via parenteral routes, which include subcutaneous, intravenous, intramuscular, intrahepatic injections, or infusion techniques.

[0130] The invention further provides a method for reducing the production of methane emanating from the digestive activities of ruminants comprising orally, administering a sufficient amount of a small molecule inhibitor or analogs thereof

[0131] In some embodiments, the small molecule inhibitor is administered via different modes. The small molecule inhibitors can be incorporated into the cattle’s diet through direct inclusion in Docket No, 1Q3362-031WO1

[0132] feed or feed supplements, wherein the inhibitors are mixed homogeneously with the regular feed components to ensure consistent intake. In addition, the inhibitors can be administered via oral boluses or capsules, which allow for controlled release of the inhibitor over a specified period, ensuring sustained activity within the rumen.

[0133] Methods of Screening

[0134] The method further comprises using small-molecule micro rray (SMM) screening to identify at least one small molecule inhibitor of RNase P RNA to reduce or inhibit maturation of precursor tRNAs in methanogenic archaea in ruminant gut. Also disclosed are molecules identified by this method. Small molecule microarrays can be found, for example, in Connelly, C. M Abulwerdi, F. A. and Schneekloth, JIS., Jr. (2017) Discovery of RNA binding small molecules using small molecule microarrays. Methods Mol. Biol,, 1518, 157-175, which is herein incorporated by reference in its entirety. More details on screening methods are provided in Example 1.

[0135] Compositions

[0136] Disclosed herein is a composition comprising a small molecule inhibitor of RNase. P from methanogenic archaea, wherein the small molecule inhibitor has active stereoisomers.

[0137] An example of a small molecule inhibitor which can be used with the presently claimed methods is referred to herein as “Ml” and can be seen in Figure 4, wherein the small molecule inhibitor Ml is a iaryl-piperidine compound.

[0138] As disclosed herein, M l comprises' three aryl rings, two hydrogen bond donors, and one hydrogen bond acceptor.

[0139] In some embodiments, the Ml structure comprises; Docket No. 103362-031W01

[0140]

[0141] Further, the structure comprises a piperidine core with diaryl rings attached to the 2,6 positions of the piperidine core.

[0142] “Inhibitors” or “antagonist” of expression or of activity are used to refer to inhibitory molecules, respectively, identified using in vitro and in vivo assays for expression or activity of a described target protein, e.g., l igands, antagonists, and their homologs and mimetics. Inhibitors are agents that, e.g., inhibit expression or bind to, partially or block stimulation or activity, decrease, prevent, delay activation, inactivate, desensitize, or down-regulate the activity of the described target protein, e.g., antagonists. Control samples (untreated with inhibitors) are assigned a relative activity value of 100%. inhibition of a described target protein is achieved when the activity value relative to the control is about 80% or less.

[0143] Tire composition of the present invention can be manufactured in. principle according to synthetic methods known per se for piperidine core-based and aryl rings attached small molecules as described in Figure 4.

[0144] As used herein, unless otherwise indicated, the term ’’aryl" alone or in combination refers to a monovalent aromatic hydrocarbon radical having six to ten carbon atoms forming a carbocyclic, ring and, where specified, optionally substituted with one to three suitable substituents as defined above. Illustrati ve examples of aryl groups include but are not limited to, phenyl, naphthyl, tetrahydroaaphthy L or indanyl. Preferred aryl groups are phenyl and naphthyl, optionally mono- or disubstituted by identical or different suitable substituents selected from halo, cyano, Csub. l-C.sub,3 alkyl, Csub,3-C.sub.6 cycloalkyl, difluorometh l, tiriilnoromethyl, C.sub.l- C.sub.3 alkoxy, difluoroniethoxy and trifluoro etlioxy.

[0145] In some embodiments, the small molecule inhibitor, such as Ml, can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 23, 26, 27, 26, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, Docket No, 103362-031 WO1

[0146] 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more times to a ruminant. In some embodiments, the small molecule inhibitor is administered daily. In some embodiments, the small molecule inhibitor is administered every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, or more. In some embodiments, the small molecule inhibitor is administered every week, every 2 weeks, every 3 weeks, every 4 weeks, or more. In some embodiments, the small molecule inhibitor is administered every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 1.1 months, every 12 months, or more. In some embodiments, the small molecule inhibitor is administered every year, every 2 years, every 3 years, every 4 years, every 5 years, or more.

[0147] The compounds disclosed herein can be administered as a feed additive or in a variety of other manners discussed above.

[0148] Appropriate methods to purify the small molecule can be chosen by those skilled in the art, i.e., by column chromatography. It can be isolated and purified by methods known per se, e.g., by adding a solvent such as diethyl-ether or ethyl acetate to induce the separation of the crude product from the mixture after reaction and drying over a2SO4 of the collected crude product.

[0149] It will be apparent to those skilled in the art that various modifications and variations can. be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with the true scope and spirit, of the invention being indicated by the following claims.

[0150] EXAMPLES

[0151] The following examples are sei forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not.intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art.

[0152] Example 1: SMM screens to identify eunformation-specifie binders of large. Docket No, 1Q3362-031WO1

[0153] structured RNA drug targets

[0154] Disclosed herein is a small molecule microanay (SMM) screen, to identify small molecule inhibitors of the Meihanobrevibacier smithii (M ) RPR, a target choice dictated by a few reasons. First, Msm RPR catalyzes pre-iRNA cleavage in vitro in the absence of its cognate protein cofactors.; thus permitting functional assays to bin and score the SMM hits as active inhibitors. Second, because Ms is a mesophile, the SMM screen and activity / binding assays can be performed at temperatures between

[0155]

[0156] Third, M® is a methanogenic archaeon predominantly found in cattle rumen. Identifying inhibitors of Tfon RPR can aid ongoing efforts to identify inhibitors of methanogens as a potential modality to decrease greenhouse gas emissions from cattle. From an SMM screen of 7,300 compounds, 48 molecules were identified that explicitly bound to the Mm RPR, When these hits were tested in precursoiMRNA cleavage assays: Ml, a diary l-piperidine compound, was discovered as an inhibitor of w RPR (KI, 174 1 pM), The inhibition constant was independently cross-validated through a surface plasmon resonance- base 'binding assay (KD(app), 843 p'M). MI has favorable drug-like chemical properties: it has three aryl rings, two hydrogen bond donors, one hydrogen bond acceptor, and a mass of 401 Da. An initial structure-activity relationship analysis performed with synthesized M l analogs provided insights into the functional groups required for its ability to inhibit M m RPR.

[0157] A small molecule microarray (SMM) was used in our high-throughput screen. In the SMM approach, a fluor-labeled R A of interest is incubated with small molecules printed on isocyanate- coated glass slides to identify binders. The unbiased nature of the SMM compound library enhances the likelihood of uncovering new privileged scaffolds that target RNA. Indeed, SMM screens have uncovered ligands with different chemotypes (e.g., thienopyridme) that bind various small RNAs (< 60 nt): a hairpin loop in HIV- 1 TAR RNA, PRE-Q.1 riboswitch, miRNA-21, and MALAT-1 IncRNA triple helix.

[0158] Disclosed herein is a method used to identify a lead using the SM. M approach, even with large RNAs that are likely to exhibit increased conformational dynamics. RNase P RNA (RPR) ribozyme was chosen as a target. Although RNase P can use either RNA- or protein-based (RNA- free) active sites, the focus here is on the former. In the ribonucleoprotein (RNP) form of RNase P, the catalytic activity resides in the RNA subunit (RPR) as exemplified by protein-independent pre-tRNA cleavage in vitro in the presence of suitable [NH4+] and [. Mg2+], The RNase P Protein (RPP) cofactors in the RNP version are essential tor RNase P function in viva and vary in number Docket Me, 103362-031W01

[0159] across the three domains of life: one in bacteria, up to five in archaea, and up to ten in eukarya. Biochemical assays and high-resolution cryo-EM / crystal structures have highlighted uniformity-' in the conserved catalytic core and di fferences in the peripheral elements of the RPR. across the three domains of life. This RPR structural diversity (together with the varying number of RPPs), essentiali ty, and low copy number make the RNP form of RNase P an ideal drug target.

[0160] (a) Generating a floor-labeled Jta RPR

[0161] To conduct the SMM screen, the WK RPR needs to be fluor-labeled. For single-molecule fluorescence studies different archaea! RPRs with 5’ and 3‘ extensions were prepared. The ready in-house availability of these RPRs led us to leverage the Mwn RPR with the 5-3’ extensions (Figure IA) for SMM studies, because the annealing of a fluor-labeled oligonucleotide complemen tary' to either the 5* or 3fextensi on would allow us to detect b inding of the R PR to small molecules in the SMM array. Before proceeding with the SMM screen, the extension-bearing Msw RPR was characterized for pre-tRNA processing. From Michaelis-Menten kinetic analysis, foa and KM values of 0.32 ± 0.03 min*1and 70 ± 19 gM respectively, were determined for wn RPR variant using HA pre-tRNAUIyas the substrate (Figure 6; the average and mean absolute error were determined using data from two independent trials). Since the kc K ratio for Mao RPR was only - 2- fold lower than the un modified version and the extension provided a convenient route for introducing the fluor, the studies described here were conducted with the extension variant which for the sake of convenience it is referred to as “IKw RPR”.

[0162] Tire RPR in all three domains of life is modular and is composed of two independently folded domains: the catalytic (C) domain is responsible for cleavage while the specificity (S) domain promo tes substrate binding. Conserved tertiary' interactions juxtapose the C and S domains to generate a conformation optimal for pre-tRN cleavage. In the absence of cognate RPPs, >200 mM Mg2’ is required to establish these tertiary struts obligatory for function. Ensemble FRET analysis with Pfit RPR, where the donor and acceptor fluorophores were incorporated in the C and S domains, respectively, indicated that the RPR is in an ‘open, inactive’ confonnation (low FRET and no pre-tRNA processing) at 10 M Mg21' and transitions to a ‘closed, active’ confonnation (high FRET and pre-fRNA-processing competent) between -200 mM - 400 M. The activity of Mw RPR at 10 mM and 400 mM Mg2’ was tested and it was observed that RPR resembles Pfu RPR in that it is inactive at IO mM and and active at 400 mM Mg'’’ (Figure IB). Given this Docket No, 103362-031W01

[0163] finding, the SMM screen was conducted with the w RPR at 10 «M and 400 mM Mg2’ to identify small molecule binders that are specific for the RPR’s functional tertiary structure.

[0164] A Cy5-labeled DNA oligonucleotide (Cy5-ohgo) complementary to the 5* extension in Msm RPR was used to generate a fluor- labeled M RPR. To determine the binding affinity of Cy5-oligo to the 5!-extension in Mtm RPR, microscale thermophoresis assays were used. The binding affinity of the Cy5-oligo to sw RPR at 10 mM or 400 mM Mg2 swas determined and a Ko of 7 2 nM or 17 ±4 nM, respectively was obtained. The mean and standard deviation were determined from four independent measurements (Figure 7). This low-nM binding affinity of the Cy5-olig to $?» RPR at either 10 M or 400 M Mg '’ allow 100% RPR labeling efficiency even at the low RPR concentrations used in the SMM experiment. Because this near-complete labeling efficiency is difficult to achieve with any widely used 5'- or ^-labeling method. Importantly, pre-tR A cleavage assays indicated that annealing of the Cy5-oligo to Afv RPR post-refolding had no effect on the RPR’s turnover number (Figure 8). This finding allays any concerns that the Cy5-oligo may inexplicably disrupt function by binding to its complement (i.e., 5‘-extension) or elsewhere on the RPR (off-target).

[0165] (b) SMM screens to identify selective binders of Msm RPR

[0166] Tire SMM screen was performed with the buffer, Cy5-oligo, or the Cy5-iabeled Msm RPR at 10 mM or 400 mM Mg2’ (Figure 9 A). Compounds with a Z-score >3 were considered as selective for our target (Figure 1C). Additionally, the Z-scores for small molecules binders from the SMM dataset for Mwn RPR were compared with the Z-scores for the same compounds against previously screened unrelated DNA / RNAs. Compounds that show binding only to Msm RPR and not the other DNAs / RN s (e.g,, DNAZRNA G4 quadruplex, RNA three-way junction (3W. J). stem-loop (SL), and pseudoknot) structures were then classified as “hits”. The SMM screen with Cy5~labeled Mim RPR yielded 48 hits at 400 mM Mg2’ (0.7% hit rate) and 58 hits at 10 mM Mg:(0.9% hit rate) with only eight, compounds that overlap between these two screening conditions (Figure 9B). Thus, the SMM screen clearly yielded distinct set of binders for die ‘open' and ‘ closed’ c formations of the Afmt RPR. Moreover, it was established that the 48 compounds that bound the vm RPR at 400 mM Mg2’' were not artefacts arising from use of the CyS-oligo. None of the 55 binders obtained with the Cy5-o1igo-oniy control (0.7% hit rate) were identified as hits Docket No, 103362-031W01

[0167] with the Cy5~Iabeled Msm RPR screened at 400 mM Mg2* (Figure 9B), Incidentally, the hit rates that are reported here with the SMM screen (0.7%-0»9%) are within the expected range (~.r%).

[0168] (c) RN ase P assay to identify functional modulators among the binders Since 22 of the 48 compounds identified as. RPR binders were commercially available, the compounds are used to assess if the compounds modulate the activity of Mm RPR (Table 2 lists the 22 compounds tested). Because all these compounds were solubilized in 100% (v / v) DMSO, their addition in an RNase P assay would entail the presence of some DMSO. Therefore, before proceeding with the activity screen, the effect of DMSO on Afcm RPR activity was examined as this solvent is known to inhibit bacterial RNase P (44-46). Afon RPR activity decreased by -24%, 38%, and 62%, respectively, in 1%, 2.5%, and 5% (v / v) DMSO (Figure 10). Hence, assays were conducted at < 2.5% (v / v) DMSO, a concentration that was expected would ensure compound solubility without engendering significant, loss of RPR function.

[0169] For the initial Alw RPR activity screen, 22 compounds that bound sw RPR at 400 M Mg2' were tested. While compounds M I -M 19 were specific for Afw. RPR, Cl and C2 also bound Pfit RPR at 400 mM Mg2' and C3 binds Msm RPR even at 10 mM Mg2'. From the activity assays, 17 activators, 2 inhibitors, and 3:null effectors of Msm RPR were identified (Figure 2A). Compounds Ml and M10 inhibited the activity by -30% and 12%, respectively. Furthermore, the selectivity profiling analysis showed that M l preferentially binds Afen? RPR at 400 mM Mg2* over 10 mM Mg2* (Z«score < 3), and that it does not bind the Pfif RPR or other DNAs / RNAs screened previously (Figure 11). Therefore M l was considered for further characterization.

[0170] (d) Characterisation of the inhibition of M.sm RPR by Ml.

[0171] Tire activity of $T» RPR decreased with increasing concentration of Mlcomm indicating that it is a tow de inhibitor (Figure 2. B); the commercially purchased MI is.referred to as M i Analysis of the reaction progress curves indicated that M lemma is a slow-onset binding.inhibitor, as is evident from the absence of product versus time linear relationship observed in the case of the DM SO control (Figure 1 ). Assessing product formation in the presence of increasing [MleommJ revealed an initial burst followed by a slower steady state where product formation is asymptotic. To ensure that the slow-onset binding inhibition is not an artefact of possible impurities present in the commercially purchased compound. Ml was synthesized ( L™; Figure Docket Me, 103362-031W01

[0172] .13) and NMR characterization was performed to validate the purity of Ml ^. Moreover, the WATER-LOGS Y N. M. R analysis qualitatively validated the binding of M 1syato wn RPR (Figure 14). There was no positive phasing with Ml alone (i.e., in the absence of Msm RPR; Figure 14). When a small molecule binds an RNA, NMR peaks phase positively; similar phasing is expected when a compound aggregates (even in the absence of an R A target) because colloid-like behavior would parallel (at least with respect to cross-relaxation rates) the interactions between RNAs and ligands* Importantly, our kinetic analysis indicated that I«yn, like Mkm, is a slow-onset binding inhibitor of wn RPR (Figure 3 A; Figure 15).

[0173] The product formed over time in the presence of a slow-onset binding inhibitor is fit to a non-linear exponential equation that is a function of the initial velocity (v;)5steady state velocity (Vs), and the frequency constant (k^») that determines the transition rate from Vi to vsfor each inhibitor concentration. The kinetic data were fit to the slow-onset binding progress curve equation to obtain best-fit values of vg vs, and k«ssdetermining the inhibition constant. While the goodness- of-fit values for the curve-fits generated by Kaleidagraph (curve-fitting software) were good, high individual curve-fit errors were observed for the v!vs, and k bs values in some instances. Additionally, the best fit values depended on the initial input guesses which provided for curve¬ fitting. Regardless, this analysis yielded Kt values of 62 ± 5 gM and 19 ± 3 gM for

[0174]

[0175] and Mhyn, respectively.

[0176] To obtain a more reliable and unbiased determinatiou of Kt values with confidence intervals and to overcome drawbacks associated with curve fitting based on gradient functions, a statistical approach entailing a differential evolution algorithm was adopted. When the kinetic data were analyzed using this approach, the Ki value of 49 ± 13tuM and 17 T 1 pM for Mlewm and MLya, respectively was determined (Figure 3A; Figures.13 and 17). The profile likelihood scores provide the confidence intervals for the Kt values determined through this approach [Figure 3B (Ml5ya), Figure 13 (Ml

[0177]

[0178] It was observed that M Lyn had -3-fold higher potency compared to M I The gain is atributed to the fact that ML«mmis likely a racemic mixture of 16 possible stereoisomers (four stereogenic centers), while MLyn is composed of only 4 stereoisomers (synthesized to have only two stereogenic centers). Moreover, the Ki values from independent approaches were similar.

[0179] (e) SPRi analysis to determine the binding affinity of Ml to Msm RPR Docket No, 103362-031 WO1

[0180] SPRi was used as an orthogonal method to cross- vali ate the Kr values obtained for Ml an and Mlsyn. For these binding assays, the compounds were immobilized on the SPR chip as their binding to m RPR will lead to a drastic change in mass (Am, from 400 Da to - 110 kDa) and cause significant changes in the refractive index. By immobilizing the small molecules on the chip using an 8 x 8 array, high-throughput is possible as several small molecules are tested in parallel. Because the diazirine-based iminobilization depends o» the covalent attachment to different sites in the small molecules, the SPRi signal reflects averaged binding and therefore the data obtained showed apparent binding affinities J W))- fe p) was determined for binding of MLyn and

[0181]

[0182] M lc<w» to RPR to be 8 3 gM (Figures 3C and 3D; Figures 18 A and 18B) and 39 3 gM, respectively (Figures I9A and 19B). These Kt w) values mirror the inhibition constants (&), and bolster our contention that the diastereo-Zenantiomerically purer MLyn is more potent than M 1 evmm.

[0183] (f) Structure-activity (SAR) relationship analysis with Ml analogs

[0184] To gain insights into the functional groups in Ml that contribute to its inhibitory activity, an SAR analysis was initiated with one commercially available (Ml -ethyl) and five synthesized (M 1 -desMe-desdiaryt Ml-desMe, Ml-desMe- -allyl, Ml -desMe-NMe and Mi-N-Me) Ml analogs (Figure 4; Figures 13 A and 13B). The purity of the synthesized Ml analogs were validated through NMR analysis (Figures 15D-15Q). Post-structural characterization, these analogs were tested using the same activity (Figures 17A and 17B) and binding assays (Figures 20-23) that were performed with die parental Ml.

[0185] Ml-desMe-desdiaiyd represents the core scaffold of M l. SPRi assays indicated that Mw RPR can bind Ml-desMe-desdiaryl with a weaker affinity {KD(W)> ^0 ± 17 gM; Figure 1.8) compared to Mfon. Surprisingly, pre-tRNA cleavage assays indicated that M 1-desMe-desdiaiyl weakly activates the function of wn RPR (Figure 4), thus ruling out determination of any Ki value in this case.

[0186] Ml-desMe (Rix^, 39 ± 16 M; Figures 21 A and 21B) and Ml-desMe- -allyl (Ktxw), 33 - 6 uM; Figures 22 and 22B) have 4- to 5-fold weaker binding affinities compared to MlSy». A K.t of 102 * 22 uM for inhibition of Msm RPR by Ml -desMe was observed, which corresponds to a 6-fold weaker inhibitory potency compared to MRyn (Kt of 17 pM). The Kt value of 321 ± 59 p.'M calculated for Ml-desMe-N-allyl suggests that the lower potency resulting from loss of the Docket No, 1Q3362-031WO1

[0187] C5-methyl group in the central piperidine core is worsened by a further 3 -fold on account of the additional allyl modification to the nitrogen in the piperidine ring.

[0188] In addition to changes to the piperidine core. Ml -ethyl (KJ K 23 ± 7 pM). Ml-desMe- N’Me (Kuiapp), 39 ± 6 pM), and Ml-NMe (Kt wh 1^9 ± 23 pM) (Figures 23, 24, 23 A and 23B) also lack the methyl groups that are present in the diaryl rings attached to the 2,6 positions of the piperidine ring. Ml -ethyl was commercially purchased and is likely a racemic mixture akin to Mlecmta. Ml -ethyl has comparable binding affinity to Mlwmm but exhibits a 4-fold weaker inhibitory potency (Ml-ethyl: Kt, 202 * 22 pM; Ml«sw«: Kr, 4.9 -A 13 y. M). This difference is because the methyl groups present in the diaryl rings are essential for inhibition. The Ki value for Ml-desMe-NMe was not confidently determined (Figure 4; denoted as “ND”) as it spans a wide range of values in the three trials (maximum profile likelihood scores were poor compared to the other analogs). Ml-N-Me was the weakest binder amongst all the analogs and correspondingly exhibited weak inhibitory' activity (average Ki> 500 gM). For Ml-NMe and Ml-desMe-NMe, three trials were performed for kinetic characterization and for both the compounds.

[0189] («) Selectivity analysis using fit RPR activity assays

[0190] During the SMM screen, the compounds that bound RPR were compared for their ability to bind other RNAs / DNAs and this information was used as a. filter for selectivity. As addi tiona l e vidence for selectivity of M I for. Ito RPR, the effect of M I and i ts analogs was tested on another structurally similar archaeal (. Pfn) RPR. The Ffo RPR, like wn RPR, is -330 nt and is active under in vitro conditions without its protein cofactors. The AlphaFold 3 server predicted highly similar models for the three-dimensional structures of Ato and Pfu RPRs, especially the catalytic core comprising the P1-P4-P5 and P8-P9 stacked helices (Figures 5 and 5B) and the tertiary struts that hold together the C and S domains. There are differences, however; for example, 7-y'n RPR has a longer Pl 2 stem compared to Msm RPR (Figures 5A and 5B; Figure 25). Thus, Pfu RPR is a good model R A to test the selectivity of M l for Msm RPR.

[0191] The SPRi analysis indicated that Ml and its various analogs do not bind to PPt RPR (Figures 18, 19C and 19D; Figures 20- 23D). Consistent with this finding, when these compounds were tested at the highest concentrations used to inhibit Ato RPR under the same assay conditions and with the same pre-tRNA substrate, none of them inhibited

[0192]

[0193] RPR (Figure 5C; Figure 24). Docket No, 1Q3362-031WO1

[0194] Discussfon

[0195] This work demonstrates the value of the SMM platform for initial screening of ligands that bind large, structured RNAs together with the use of functional assays to narrow down active inhibitors. Based on the.findings from this drug discovery study, ideas on the mechanism of inhibition of Mm RPR by Mil, the attributes of M 1 and Mwn RPR that account for selectivity of inhibition, and finally the implications of the SMM approach for target RNA-based drug design are discussed.

[0196] Mechanism of inhibition ofMw RPR by Ml

[0197] Various lines of evidence from the study lend confidence to establishing M as a hmmyttfe and specific inhibitor of Mm RPR. / rer, given the importance of Mg; J:for RPR folding and function, displacement of Mg3" by Ml would be a simple, if non-specific, mechanism for inhibits on of RPR activity. A precedent in this regard is the Mg21-mediated reversal of the inhibition of RNase P by positively-charged aminoglycosides. Two observations suggest that this scenario is unlikely with Ml: it has only one basic amine (that is, it lacks an overall positive charge), and it was identified from a screen that favored binders at 400 over 10 mM Mg2" (Figure 11).

[0198]

[0199] self¬ aggregation of M 1 could sequester the pre-tRN A substrate and thereby inhibit processing by RPR. Two findings rule out this possibility. The WaterLogsy NMR data does not provide any evidence for Ml aggregation in the absence of M m RPR (Figure 16). More importantly, even with the same pre-tRNA substrate and identical assay conditions. Ml does not inhibit Pfif RPR., which is structurally related to Mw RPR (Figure 5),

[0200] Several findings suggest that Ml is unlikely to be a competitive inhibitor and that it might be an allosteric inhibitor of RPR activity. First, the potency of inhibition by. Ml was not affected when the substrate concentration was increased. Second. although high-resohition structures of Mm and Pffi RPRs are not available AlphaFold 3 models (Figure 5) indicate conservation of the catalytic core in these RPRs. Thus, it eems likely that Ml might be binding to less conserved regions and not the active site. Third, results from the kinetic analyses indicate that Ml is a slow-onset binding inhibitor of Mm RPR. Either the coiiformatioual change triggered by or the kinetics of Ml binding to the enzymeZen yme-substrate complex must be slow. Ziavz, the findings with Ml analogs reveal that binding alone is insufficient for inhibition, i.e., all binders need not be functional modulators (Figure 4). For example, Ml -ethyl mirrors M1M»* with respect to A'lvapps Docket No, 103362-031W01

[0201] but is 4~fold weaker as an inhibitor of Msm RPR, A.reasonable explanation is that mere occupancy of the allosteric site does not trigger structural changes that are obligatory for inhibition and the presence of essential functional groups at appropriate positions are required for establishing interactions in the binding pocket that trigger a conformational change. An alternative justification is that to RPR.is structurally heterogeneous, comprising both active and inactive tertiary folds, and that Ml -ethyl selectively binds the inactive conformation fraction but with similar affinity as Ml for the active conformation.

[0202] With the available data, on the basis of allosteric inhibition it has been determined that the structures of bacterial, archaeal, and eukaryotic RPRs indicate their conserved substrate recognition mechanism. The bacterial / archaeal RPR recognizes the pre-tRNA through a dual¬ anchor mechanism entailing interactions with the C and S domains. The Gw-Cbc; bp in the pre- tRNA T C loop interacts with an interdigitated T-loop structure in the RPR’s S domain and secures the pre-tRNA elbow to the RPR. In the C-do am, recognition of the first base pair (bh- bfe.) in the pre-tRNA acceptor stem orients the 5* leader and positions the scissile bond in the RPR’s active site to license cleavage. An exciting prospect is that binding of Ml to to RPR induces a conformational change that interferes with the long-distance, inter-domain crosstalk between the RPR’s C and S domains that is mandatory for pre-tR A cleavage. Binding of Ml could also impair holoenzyme (RPR + RPP) assembly.

[0203] To further verify if the bindin g of M

[0204]

[0205] to the S domain triggers a conformational change in the C domain, we used the SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension).method. A solution of folded A&m RPR, without or with MISy«, was subjected to modification with 1 -meth.yl-7-nitroisatoic anhydride (1M7) or a control solvent (DMSO), Nucleotides that are unconstrained by RN A-R A or RNA-ligand interactions are more susceptible to 1M7 and are thus more reactive. The lM7-modified and control RNA samples were then subjected to RT-mediated primer extension, which is blocked by 1M7 adducts and the resulting cDN As used to generate a reactivity measure to map the ligand-binding site and structural changes. Such an analysis provides support for the idea that the binding of MUyn to the Afeu? RPR triggers a conformational change that is the likely basis for inhibition.

[0206] The notion, that, binding of a small molecule to an. R A triggers a conformational change and alters function has precedents. For example, differences in the PlA" -cleavage patterns in the RPR s C and S domains upon binding of tol uidine blue O led to the proposal that inhibition of / ?.’. Docket No, 103362-031W01

[0207] cofi RPR by toluidine blue O is.mediated by a confomiationai change. Another example pertains to a benzimidazole inducing a conformational change in subdomain II of the 5' UTR ofhepatitis C viral RNA genome. Because this conformational change affects the L-shaped orientation of subdomain II, which is required for association with the 40S ribosomal subunit, this structural change was proposed to underlieinhibition of viral protein translation by this ligand*

[0208] Binding determinants in Ml that are essential for its inhibitory activity

[0209] The selectivity of MI (1,e., ability to inhibit. but not Pfo RPR) must be dictated by its physico-chemical features and the RPR-binding.pocket. MI is a drug-like, diaryl-piperi ine derivative that is 401 Da, has one H-bond acceptor, two hydrogen bond donors, and three ring- atached methyl groups. wt? and Pfu RPRs are structurally similar (Figure 5, Figure 25) but have different AU content (Msm RPR, 60%; Pfi RPR 36%), 'Derivatives of dicationic diaryldiamidine, diaryl pyrimidines, and diaryl triazines 'bind DNA tightly by interacting with AT-rich sequences. SAR analyses indicate that these deri vatives bind the minor groo ve of AT-rich sequences and that the torsion angle between the diaryl rings and the heterocyclic core influence the ability' to bind the DNA, Thus, the AU -rich to RPR could provide a binding pocket that optimally complements the twist angle between the rings in MI,

[0210] Albeit limited in scope, the SAR analysis provides some key Insights. Firat, while it is conceivable that the diary! rings could promote non-specific stacking interactions with the RPR and thereby dictate biiK ng / 'hihi bition, the weak / no inhibition by M I -NMe (Figure 4) suggests that these aromatic rings are insufficient for the inhibitory activity. This conclusion is also supported by the Pfi RPR data (Figures 26), SAvmd, the C5-mefhyl in the central piperidine ring in M I is essential for binding and inhibition, as Ml-desMe exhibits a 5- to 6-fold increase in Afo(aPp>and An respectively (Figure 4), Third, the secondary amine in the piperidine is important for inhibition as introducing an N-allyl modification to Ml-desMe elicited an additional 3-fold increase in the A3 (Figure 4). / .art, the methyl groups on the aryl rings appear to contribute to binding / inhibition. Both desolvation. effects and binding energy from hydrophobic interactions could account for the gains afforded by the three methyl groups in Ml. Together, the data strongly suggest that shape complementarity of M l to a specific pocket in the APm RPR together with appropriate positioning of functional groups is essential for its inhibitory activity. Docket No, 103362-031W01

[0211] Implications for RNase P-centered inhibitor development

[0212] The SAR analysis of M I was restricted to aliphatic chain addition or deletions (electron donating groups) as they were accessible through minor modifications to the scheme used to synthesize Ml. Addition of electron withdrawing groups (e.g., halogens) or aromatic moieties to Ml, which would drastically change the electronic properties, merit exploration to improve the inhibitory potency of Ml; similar changes improved the efficacy of 3,5-diatnino-piperidine derivatives to inhibit bacterial translation. Further studies that characterize the binding of M l to w RPR could provide insights for structural optimization and future synthetic chemistry efforts.

[0213] M l binds the

[0214]

[0215] RPR with a modest

[0216]

[0217] of 8 gM but its potency could be enhanced by converting it into a double-headed target RNA degrader through either the ribonuclease targeting chimera (RIBOTAC) or proximity-induced nucleic acid degrader (PINAD) approach. By covalent attachment of M l via a PEG linker to an RNase L binding ligand (RIBOTAC) or an imidazole moiety (PINAD), the target-RNA degrading activity of Ml would render it a multiple¬ turnover agent and decrease the dose required for its bioactivity.

[0218] When the diaryt-piperidine scaffold is optimized to selectively target the AU-rich RPRs in archaeal methanogens resident in cattle rumen ( without affecting bacteriaVanimal RNase P), such an inhibitor as a feed additive offers a modality to reduce methane emissions from cattle.

[0219] Materials and. Methods

[0220] (a) Cloning and synthesis of RPR (with 5 ’ extensions), Pfa RPR (with

[0221]

[0222] extensions), and Tth pre-tRNA^"

[0223] Cl mfjs f 'Msm RPR For the small molecule microarray (SMM) screening, an Mw RPR variant was used that had both 5’ and 3' extensions. The sequence coding for Afeto RPR was amplified by PCR using Ms RPR-F and Msm RPR-R as primers and M m genomic DN as the template. The reverse primer has an & RI site to facilitate directional cloning into pBT7. The PCR amplicon was digested with / icoRI and then ligated (using T4 DNA ligase) to pBT7, which had been digested with AcoRI and 5'twl; the SmI site is just downstream of the T7 RN A polymerase promoter in pBT7. Cloning was confirmed by automated Sanger sequencing at the Genome Resources Facility (OSU Comprehensive Cancer Center), and this plasmid was referred as pBT7~ Afon RPR. Docket No, 1Q3362-031WO1

[0224] Hie DNA template to synthesize anAfon RPR, variant with 5’ and 3' extensions was created using two PCR reactions with Phusion DNA polymerase. The first PCR entailed use of F ext Msm RPR and R ext Msm RPR as the primers and pBTZ- RPR as the DNA template; these two primers incorporate the coding sequence necessary to generate 23-nt 5’ and 3' extensions of the rin RPR. The amplicon from the first PCR was employed as the DNA template in a second PCR designed to add the 17 promoter sequence to the 5' end to facilitate m v / zro run-off transcription (IVT) reaction; for the second PCR, T7_Fext_Msm RPR and R_ext_Msm RPR were used as primers.

[0225] The amplicon obtained from the second PCR was used as the DNA template in an IVT reaction to generate RPR with 5*-3‘ extensions. The IVT reaction was composed of lx IVT buffer [40 tnM 1’ris-HCl (pH 7.6), 24 mM MgCb, 2 mM spermidine, 0.01% (v / v) Triton X-100, 10 mM D'FT], 5 M final concentration of each rNTP, PCR amplicon (100 ng / 100-pL IVT), 0.002 U thermostable inorganic pyrophosphatase, and T7 RNAP (purified in-house). The IVT reaction was incubated at 37°C for 4-5 h, followed by DNase I (10 U / 100-uL IVT; RNase-free DNase, Roche, Basel, Switzerland) treatment for 30 min at 37°C. After DNase I treatment, the IVT reaction was subject to phenol-chloroform extraction and the aqueous phase dialyzed against double distilled water (4 L ddH’ O each change; two changes during the first two hours and one change overnight) using an 8-kDa MWCO dialysis membrane (Biodesign, Carmel, NY), The dialysate was then subject to ethanol precipitation using 3 M sodium acetate (pH 5.1) and ethanol. The final pellet was washed twice with 75% (v / v) ethanol and then left to dry' at 22°C for 10-15 min to get rid of the residual ethanol. The final pellet was then resuspended in autoclaved ddFhO and stored at ~20°C until further use. The concentration of the Mw RPR with the 5' and 3' extensions was determined by measuring the absorbance at 260 nm with a NanoDrop (ThermoFisher, Waltham, MA) and using an extinction coefficient of 3,454,400 L mole cm (IDT Oligo Analyzer). The Msrm. RPR with the with the 5' and 3' extensions was used for all the experiments below and will henceforth be denoted as " TAm RPR". Note The IVT reaction as well as the subsequent processing steps described above for the wn RPR were also used for the following RNAs.

[0226] dwdiesfe of Ffo JRPK with 5' and 3' exienxioHW P / t RPR with 5’ and 3!extensions (denoted as P / b RPR henceforth) was used to assess the selectivity of the inhibitory effect exhibited by Ml and its analogs. The synthesis of Pfii RPR has been described previously. The DNA template used Docket No, 103362-031W01

[0227] in the IVT to synthesize this P RPR. was generated by PCR using F-ext and R-ext as primers and pBT7- / y« mP'l ext as the DNA template. The PCR amplicon was then, digested with EcoRI and then used as the DNA template for IVT, The concentration of the Pfii RPR was determined by measuring the absorbance at 260 nm with a NanoDrop and using an extinction coefficient of 3,664,400 L mole’’ cm4(IDT Oligo Analyzer).

[0228]

[0229] dwAerfs of 7% For RNase P activity assays, Tih preftRNAiiiywas used as the substrate. The DNA template for use in an IVT to synthesize this pre-tRNA was generated by PCR using F-ext and R-ext as primers and pBT7-'D7i pGly as the DNA template. The amplicon was then digested with b’ml-HF and used as the DNA template for IVT. The concentration of Tih pre-tRNA0*' was determined by measuring the absorbance at 260 nm with a NanoDrop and using an extinction coefficient of 896,800 L mole'1cm"’ (IDT Oligo Analyzer).

[0230] (b) RNase P activity assays

[0231]

[0232] Jgrnite the effect of on the activiiy of Msm RPR: Ensemble FRET studies performed with a dual-labeled Pfu RPR indicated that the RPR adopts an open, non- unctional conformation at 10 mM Mg+and transitions to a closed, functional conformation at 400 mM Mg* \ To test the idea if the Aftvn RPR might bind different small molecules at 10 mM and 400 M Mg~\ Before proceeding to the SMM screen at two different

[0233]

[0234] to assess if the observation made with the Pfii RPR also holds with the w RPR; the pre-tRN A cleavage activity of RPR was tested at. I 0 M and 400 M Mg ". svn RPR was refolded. Two pL of 10 j.iM refolde w RPR was incubated at 37 C for 10 min with either 10 pL " Mg assay buffer” [50 mM Tris-Cl (pH 7.5 at 22°C), 3.2 M NH OAc), 790 mM MgCbJ or 10 gL "low Mg assay buffer" [50 mM Tris-Cl (pH 7.5 at.22%.'), 3.2 M IRfOAc), 1.0 M MgCh] buffer and 6 pl... of 1x refolding buffer. The Tih pre-tRNA*'’55’ (200 pM in lx refolding buffer) was incubated at 37%i for 5 min prior to its addition, to initiate the cleavage reaction. The final 20-pL assay contained 1. pM ww RPR and 20 pM Tih pre-tRNA0^ in lx assay buffer [50 mM Tris-Cl (pH 7.5 at 22°C), 2 M ammonium acetate, 10 M or 400 mM MgCh’]. After addition of the substrate, the reaction was quenched at 15, 30, 45, and 60 min by aliqiiotiug 5 pL of the assay reaction and mixing it with 15 pL denaturing / quench dye [0*05%(w v) bromophenol blue, 0,05%(w / v) xylene cyanol, 7 M urea, 5 M EDTA], The cleavage products were analyzed on 10% (w / v ) polyacrylamide / ? M urea gels, Docket No, 103362-031W01

[0235] Functional efoaraclcnizatioit ofMsM RPR: Before proceeding to the SMM screen, the Mvw RPR was assessed for its pre-tRNA cleavage activity through Michaelis-M eaten kinetic analysis. Two,uL of 10 pM refolded RPR [50 mM Tris-Cl (pH 7.5 at 22°C), 800 mM NF OAc), 10 mM MgCb] was incubated for 10 min at 37°C in amixture of 10 gL Mg2' assay buffer [50 mM Tris- Cl (pH 7.5 at 22°C), 2 M NHftOAc), 790 mM MgCfr] and 4 pL lx refolding buffer. Six substrate concentrations (10, 0, 40, 60, 90, and 1 0 pM) were tested in these kinetic studies. The substrate mix for the assay was prepared by diluting Tlh pre-tR A':'7 containing trace amounts of5 ~[J”P]- Tth pre-tRNAc'iyin lx refolding buffer to a final concentration of 50, 100, 00, 300, 450, or 600 gM (five-fold higher than the final desired concentfations). The substrate mix in lx refolding buffer was incubated at 37°C for 5 min. Substrate cleavage was initiated by adding 4 pL of the respective working stocks of the substrate to the 16-gL assay mix containing the RPR. The final 20-p. L assay contained 1 pM Ms tn RPR and 10 - 120,uM 77 / ? pre-tRNAGl;' in lx assay buffer [50 mM Tris-Ci (pH 7.5 at 223C), 2 M ammonium acetate, 400 mM MgCh]. After the addition of the substrate, the reaction mixture was briefly vortexed and ceutriftiged for a few seconds before returning to the thermal cycler. At defined time intervals, 5-pL aliquots were withdrawn from each reaction and the reaction terminated using 1 pL denaturing / quenc dye (Table 3 A). The cleavage products were analyzed on a 10% (w / v) polyacrylamide / ? M urea gel.

[0236] Data analysis'. The denaturing polyacrylamide gels were scanned using the Typhoon RGB imager (Cytiva) under the phosphor screening setting. The image was then quantitated using ImageQuant (Cyti va) to calculate the intensity of the precursor and leader in each reaction. The ratio of the leader intensity relative to the total intensity was used to calculate the percent product formed in each reaction, Time courses were designed to ensure -30 - 40% cleavage to maintain linearity in product fbrmation. In one or two reactions, this threshold was marginally exceeded, however, foe linearity in product formation was always maintained and the correlation coefficients of foe slopes (R?) were > 0.96. The k;3t and K values for Msm RPR were obtained from two independent trials and their average with mean absolute error is reported. The curve-fit errors for k«at and KM.in each trial was less than 30%.

[0237] Assessing effect of oligo an ih aciiyilyafMsmJlPR: To generate the fluor- labeled

[0238]

[0239] RPR for the SMM screen, a Cy5~labeled DNA oligonucleotide (Cy5~oligo) complementary to the 5’ extension was used in the Msm RPR. To assess if addition of the complementary oligonucleotide affects the function, Mv» RPR activity was tested in foe presence and absence of the Cy5-oligo. Docket No, 103362-031W01

[0240] Twenty pM of refolded Afeu RPR was mixed with either an equal volume of 20 pM cyS-oligo in lx refolding buffer or an equal volume of 1.x refolding buffer and was incubated at 37°C for 5 min. Two,uL of 10 |iM Msm RPR with and without the 10 gM Cy5-oligo was added to the respective test reaction tubes containing 10 gL Mg assay buffer and 6 gL lx refolding buffer. The RPR ( Cy 5 -oligo) was incubated in the assay buffer for 10 mm at 37°C, The 7'fo pre-tRNAoi-' (200 M in lx refolding buffer) was incubated at 37°C for 5 min prior to its addition to initiate the cleavage reaction. The final 20-gL assay volume contained 1. pM Mxm RPR, 20 pM Tih pre~iR Aij!y, and 1 uM Cy5-oligo (when present) in lx assay buffer [50 m, M Tris-CI (pH 7,5 at 22°C), 2 M ammonium acetate, 400 M MgCh], After addition of the substrate, the reaction was quenched at 15, 30, 45, and 60 min by aliquoting 5 pL of the assay reaction and mixing it with 15 pL denaturing / quench dye. The cleavage products were analyzed on 10% (w / v) polyacrylamide / 7 M' urea gels, and the gels were scanned and data analyzed as described above. The average and mean absolute error of the turnover number of Msm RPR ± Cy5-oligo was determined from two independen t trials,

[0241] yygxsfog.. / fe. efey q / . WSO. on..foe, ofefey. f

[0242]

[0243] : All the small molecules that were dissolved in DMSO were tested to yield a final concentration of 10 mM, Thus, any assay to assess the effect of these compounds on RP. activity will entail carryover of some DMSO. Therefore, the maximum [DMSO] that would minimally diminish the activity of w RPR was investigated. Two pL of 10 gM refolded Msm RPR was incubated for 10 min at 37°C in a 0,65- ml, PCR tube containing 10 pL Mg assay buffer and 4 pL 1.5X refolding buffer. At this stage, 2 p. L of 0% (v / v), 10% (v / v), 23% (v / v), or 50% (v / v) DMSO in lx refolding buffer was added to the RPR and the reaction incubated at

[0244]

[0245] for 20 min. Addition of 2 pL of 200 pM Tfh pre- tRNA!j!yin lx refold buffer to the RPR-DMSO mixture initiated the cleavage reaction. The final 20-pL assay volume contains 1 pM Msm RPR and 20 pM Tih pre-tRNAlyin lx assay buffer [50 mM Tris-CI (pH 7.5 at 22<?C), 2 M ammonium acetate, 400 m. M MgCh, with 0%, 1%, 2.5%, or 5% (v / v) DMSO]. After addition of the substrate, the reaction was quenched at. 15, 30, 45, and 60 min by aliquoting 5 gL of the assay reaction and mixing it with 15 pl, denaturing / quench dye. The cleavage products were analyzed on 10% (w / v) polyacrylamide / 7 M urea gels, and the gels were scanned, and data analyzed as described above, The relative activity of Msm RPR in the presence of DMSO was determined using as reference the no DMSO control as 100%, The average relative Docket No, 103362-031W01

[0246] activity and mean absolute error of Msm RPR ± DMSO was calculated from two independent trials.

[0247] DeieminaMm Mike K / fouw for i / afMsmPPR bv svn h&ic Ml (Ml and Ml ana / ass: MI and analogs (except Ml -ethyl which is commercially available) were synthesized.

[0248]

[0249] Ten «iM stocks of ML™ and its analogs were prepared in neat DMSO. The activity response curves for MLy» and its analogs were performed like the M M experiment with minor differences. First, the working stocks of Ml-syn and its analogs were prepared in 100%(v / v) DMSO. The final concentration range of M. Ly»and its analogs span between 0-200,uM in 2.5% (v / v) DMSO (Table 38 and 3C for the concentration ranges tested for ML™ and the analogs). For the inhibition assays, 4 pL of the 10 pM refolded RPR was added to a 0.65-mL PCR tube containing 20 pL Mg4* assay buffer[50 mM Tris-CI (pH7.5 at 22'’JC), 3.2 M ammonium acetate, 790 M MgCb] and 11 pL 1 x refolding buffer [50 mM Tris-CI (pH7,5 at 22°C), 800 mM ammonium acetate, 10 mM MgCb]. The RPR was incubated in the above assay conditions for 10 mm at 37°C. Following the 10-miu incubation, 1 pL of each of the working stocks of MLy« or the analogs was added to the appropriate test reaction. In parallel, a control reaction was set up with the RPR and 1 pL of 100%(v / v) DMSO, instead of M Lyn or the analogs. The RPR and ML™ or its analogsZDMSO was incubated at 37°C for 20 min. Substrate cleavage was initiated by adding 4 pL of 200 pM refolded Tth pre-tRNA°lyto the assay buffer containing the RPR and varying concentrations of M Lyn or its analogs. The final 40-p. L assay contains I g. M Msm RPR and 20 pM Tih pre~tRNA!jiy, and 0-200 gM M ls>eor its analogs in 1 X assay buffer [50 mM Tris-CI (pH 7.5 at 22°CX 2 M ammonium acetate, 400 mM MgCh], and 2.5% (v / v) DMSO, At defined time intervals, 4,5-pL aliquots were removed from each of the reaction tube and the reactions terminated using 15.5 pl. denaturing quench dye. The cleavage products were quautifoted to determine the percent product formed o ver time as described above.

[0250]

[0251] Mubd / an af Pin RPR by MPS* and MPancdass: The activity of fi RPR was tested in the presence of the highest concentration of MLomm (200 pM), Mlsyn (100,uM) and Ml analogs (200 pM) used for the Afos? RPR assay. For the assay, 4 pl.. of 10 pM refolded Pfo RPR was added to a 0.65-mL PCR tube containing 20 jiL Mg assay buffer and 11 pL lx refolding buffer and incubated for 10 min at 37°C. Following this incubation, I gLof4 M M l -syn in I00%(v / v) DMSO or 1 til. of 8 M M cmm / Ml analogs in 100%(v / v) DMSO was added to the respective assay tube. In parallel, a control reaction was set up by mixing the RPR with 1 gL of 100% (v / v) Docket No, 103362-031W01

[0252] DMSO instead of Ml or its analogs. The RPR and Ml / analogs / DMSO was incubated at 37°C for 20 min. Substrate cleavage was initiated by adding 4 gL of the 200 g. M 7 h pre-tRNA,yin 1x refold buffer to the assay buffer containing the RPR and Ml / analogs / DMSO. The final 40 gL assay contained 1 gM Pfu RPR and 20 gM Tth pre-tR AGly, and 0 or 100, M Ly« or 200 gM Mleomm / analogs in lx assay buffer (50 M Tris-Ci (pH 7.5 at 22CC), 2 M ammonium acetate, 400 mM MgCh, and 2.5% ( v) DMSO]. At defined time intervals of 15, 30, 45, 60, 75, and 90 min, 6- L aliquots were withdrawn and the reaction terminated by mixing with 14 gL denaturing / quench dye. The product formed during this time course assay with Pfti RPR was determined as described above and the linear slope was used to calculate the turnover number. The relative activity of Pfu RPR in the presence of Ml / analogs was determined using the DMSO control as the reference (i.e., 100% activity). The average relative activity of Pfy RPR ± Ml / Ml analogs and the mean absolute 1 error was calculated from two independent trials.

[0253] (e) MST assays to determine the binding affinity of Cy5-oligo to Msm RPR

[0254] MST assays were performed to determine the binding affinity of Cy5-oligo to Msm RPR at 10 mM and 400 mM Mg2* prior to proceeding with the SMM screen. Mw RPR was refolded as described in the main text (Materials and Methods section). The refolded RPR was diluted to I gM in lx refolding buffer. To generate an RPR serial dilution series with a total of 10 RPR concentrations, RPR was first diluted to 200 nM in. l refolding buffer and 0.2 mg / mL. BSA, and then diluted 1:1 in 1 x refolding buffer arid 0.2 mg / mL BSA. A working stock of the Cy5~oligo was prepared by diluting the 50 gM stock to I gM in autoclaved ddHtO. A 23 nM working stock of CyS-oligo was then prepared by diluting the oligo in binding buffer containing 50 mM Tris-HCl, pH 7.5; 3.2 M ammonium acetate; and 10 or 790 mM MgCl;. Then, a binding reaction master mix was prepared by diluting Cy5-oligo to a final concentration of 2 nM in binding buffer containing 1.0 or 790 mM MgCh. The master mix was aliquoted into 10 tubes. To initiate the binding reactions, an equal volume of the RPR dilutions in lx refolding buffer was transferred to the aliquots ofCy5-oligo binding master mix. The final concentrations of relevant species were -0.2- 100 nM RPR, 1 nM Cy5-oligosand 10 or 400 mM MgCh, 0.1 mg / mL BSA. The mixed binding reactions were loaded into standard MST capillaries and placed on the capillary tray that was subsequently loaded into the MST instrument and incubated at 22°C for 10 min before measurements were started. For each round of measurements, the MST power was set to medium. Docket No, 103362-031W01

[0255] and the excitation power was set to 50%. Initial fluorescence was read for 5 s before the infrared laser was turned on for 30 s and then turned back off. The fluorescence was recorded for an additional 5 s after the infrared laser was turned aft'.

[0256] For data analysis, AFao was plotted against [Mw RPR] using Kaleidagraph and was fit to hyperbolic binding isothenns inorder to determine the Ko. Mean and standard deviation of the Ko value at each Mg2' concentration was determmed from four independent trials and the curvefit error for Kn in each case did not exceed 37%.

[0257] (d) Use of Kaleidagraph to estimate the Ki for inhibition of w RPR by

[0258]

[0259] and Mlsya

[0260] The progress curves of w RPR in the presence of each concentration of Ml«» or M lSyu was fit to the following slow-onset binding inhibition equation:

[0261] P ~ Vst + ™ (1 — e~k°bst)

[0262]

[0263] ^•obs

[0264] where vi is the initial vetocity, v« is the steady stale velocity, and fobs is the frequency constant. To fit the progress curve to the above equation using Kaleidagraph, it is necessary to provide initial input guesses for each parameter and they were determined through the linear regression approach using excel. In this approach, the slopes for the initial burst and the following steady-state phase (m the progress curve) was determined and used as estimates for the vi and vy values, respectively. For the fobs value, the reciprocal of the time of incubation corresponding to the intersection point of the two slopes (i.e., the initial burst and the steady state phase) was used as die estimate. The initial guesses were accordingly modified until the curvefit error for each of the parameters were within acceptable range. The Ki values were then determined using the equation — ~ — ( 1 + ~~ I by plotting i / v» aeainst [I], where vo is the velocity of uninhibited Tfcai

[0265]

[0266] RPR, The slope of the plot was used to determine the Kt value. Only the linear range of the plot was considered while calculating the slope. The slope of the DMSO control curve was used to determine the v\ value at [I]:::0 (as ideally in this case, vs ~ vs). Data from two independent trials

[0267]

[0268] ofMUw and Ml were used to determine the average and mean absolute error for the estimated Kt value. (See section j below that outlines a second approach used to determine the Ki values.)

[0269] (e) Synthesis of Ml and analogs Docket Me, 103362-031W01

[0270] Genend Materia and Synthefic Praeeditre^: Unless otherwise stated, all reagents and solvents were purchased from commercial vendors and used without further purification. Glass- backed silica gel, F234 plates were utilized for all thin-layer chromatography (TLC) experiments, A CombiFlash Rf purification system with RediSep Silver flash silica gel columns were used for all column chmmatography experiments. All reported * H and NOESY nuclear magnetic resonance (N'MR) spectra were measured at 500 MHz, and the complementaryJSC NMR frequency was 126 MHz ReportedlH NMR chemical shifts are in parts per million with the sol vent resonance as an internal standard (CDsOD: 3.31 ppm). Reportedt3C NMR chemical shifts are in parts per million with the solvent resonance as the internal standard (CDtOD; 49.00 ppm). NMR data were processed, annotated, and reported in the following format: chemical shift (multiplicity (s ~ singlet, br s™ broad singlet, d=sdoublet, t~ triplet, q ™ quartet, m™ multiplet), coupling constants (Hz), Integration) using MestReNova. High-resolution mass spectrometry (HRMS) data were obtained with an LC-MS time-of -flight mass spectrometer by electrospray ionization (ESI).

[0271]

[0272] To a solution of THF (0.2M) and the appropriate 4-piperidmone analogue (1.0 equiv) under an Ns blanket, a solution of ('2-methoxyphenyl)nKign^ium bromide (1.0 M in THF, 2.5 equiv) was added dropwise. The resulting mixture was then stirred vigorously and heated to 50°C for 2 h. The reaction progress was monitored by TLC. Subsequently, the resulting solution was partitioned between EtOAc and ice-cold water. Using additional EtOAc, the aqueous solution was washed three times, and the combined organic layers were collected, dried over NasSCrt, filtered, aud concentrated via vacuum. The resulting concentrate was purified by silica gel chromatography. Following chromatography, intermediates were then dissolved in a solution of HC1 (4 M in dioxane. 20.0 equiv) aud stirred at room temperature for I h. Last, the organic mixture was concentrated via vacuum and triturated with diethyl ether to afford the corresponding analogue as an HC1 salt.

[0273] Synthesis af (E)--4-'(p-'t(dyl)biif'3ten--2--(me intermediate: To a solution of acetone (20 equiv) was added / >-tolualdehyde (1.0 equiv) followed by blanketing with nitrogen gas and the mixture was chilled to 0°C. Next, using an addition funnel, 1 M NaOH was added dropwise to the reaction over the course of 5 minutes and left to stir for 10 minutes. The reaction mixture was then allowed to warm up to room temperature and stirred for 2 h. The reaction progress was monitored by TLC and LCMS. Subsequently, the resulting solution was partitioned between EtOAc anti brine Docket No. 1033624)31 WO1

[0274] solution. Using additional EtOAc, the brine solution was washed three limes, and the combined organic layers were dried over NaiSOj, filtered, and concentrated via vacuum. The resulting concentrate was purified by silica gel chromatography to yield ( / •.')-4-( / ?-tolyl)but-3-en-2-one as a yellow crystalline solid.

[0275] Synthesis of (21<,6S)-I- llyl-2,6Mi- -lolyl ii>riifm-4-one intermediate: To a solution of methanol (0.2 M ) was added / ^-tolualdehyde ( 1.0 equiv) followed by blanketing with nitrogen gas. Next, allyl amine (1.1 equiv) was added to the reaction mixture followed by L-proline (0.2 equiv) and the reaction mixture was left to stir at room temperature for 5 min. After, (A')-4-( / >-tolyl)but- 3-en-2-one (4.0 equiv) was added and the resulting solution was left to stir at room temperature overnight. The reaction progress was monitored by TLC and LCMS. Afterward, the resulting mixture was then concentrated x ia vacuum and then purified via silica gel chromatography to yield the desired product.

[0276]

[0277] renciion): To a solution of ethanol (0.2 M) and ammonium acetate ( 1.0 equix ) was added butanone ( 1.0 equix ) followed by / ?- tolualdeh de (2.0 equiv). The resulting solution was blanketed with nitrogen gas and refluxed at 85°C overnight. The reaction progress was monitored by TLC and LCMS. Subsequently, the resulting mixture was then concentrated xia xacuum and then purified via silica gel chromatography to yield the desired product.

[0278] (0 WATER-LOGSY XMR experiment to validate binding of Ml„„ to Uxw RPR

[0279] A reference ID-'H and ID Water-LOGSY spectrum of 100 pM N-methyl-L-valine and 100 pM compound was collected, followed by a separate sample containing 5 pM Msm RPR, 100 pM N-methyl-L-x aline. and 100 pM

[0280]

[0281] ForNMR sample preparation. Msm RPR in RNase-free water was folded by incubating at 50°C for 50 min and then 37°C for 10 min. Subsequently, an equal amount of 2.x phosphate-buffered saline containing 10 mM MgCL was added, and the sample was incubated at 37'C for 30 min. A sample of 100 pM M Lyn and 100 pM N-methyl-L-valine. was prepared in lx phosphate-buffered saline [pH 7.0, containing 10 mM MgC12 and 5% (x \ ) DMSO-d6j. and I D reference proton and Water-LOGSY spectra with and xvithout Msm RPR were recorded. These spectra were recorded at 20°C on a Broker A VANCE 111 500 MHz spectrometer equipped with a TCI cryogenically cooled probe. The "zgesgp" excitation Docket No. 1033624)31 WO1

[0282] sculpting water suppression pulse sequence from Broker was used for data acquisition with 126 scans. All data were processed and visualized with MestReNova software (Version 8.1.2-1 1880).

[0283] (g) Cloning and synthesizing,l / .vw RPR with 5’-3' extension

[0284] The Msm RPR needs to be labeled with a fluor for its use in the SMM screen. A fluor¬ labeled DNA oligo was opted that is complementary to a 23 -nt extension that was appended to the Msm RPR Details regarding cloning of Msm RPR into pBT7. For convenience, the Msm RPR with the 5'-3‘ extensions is referred to as " A / .vw RPR". All RNAs were synthesized by run-off in vitro transcription reaction (I VT) using T7 RN polymerase (T7 RNAP) and PCR amplicons containing the T7 RNAP promoter and appropriate coding region as the DNA template. The Pfu RPR with 5'-3' extension (denoted as '77» RPR" in this study) and Ihermus thermophihts (Till) pre-tRN1’1' were prepared as described elsewhere. The RNA stocks were stored at -20T until further use.

[0285] (h)SMM screen to identify binders of J / sw RPR

[0286] To perform high-throughput SMM screening, the microarray slides were prepared as described previously. Briefly, in each slide 7,300 commercially purchased compounds were printed in duplicate spots using a robotic microarray printer (Arrayjet, Roslin. UK), forming a high-density microarray. Prior to screening. SMM slides were pre-wet with PBST buffer in a Nunc 4-well plate. In parallel, the AZvw RPR was thawed and diluted to 10 pM in autoclaxed ddH2O. The Msm RPR was refolded by incubating at 50°C for 50 min followed by a 10 min incubation at 37°C. The Msm RPR was then diluted in equal volume of 2X refolding buffer [100 mM Tris-HCl (pH 8 at 23 C). 1.6 NlUOAc. 20 mM MgCl. resulting in a final concentration of 5 pM. The RPR was further incubated at 37" C for 30 min. A 5 pM dilution of the Cy5-labeled DNA oligonucleotide complementary to the 5' extension of Msm RPR (denoted henceforth as Cy5-oligo) was prepared. Then, an equal volume of 5 pM Cy5-oligo was added to the refolded RPR and incubated at 23eC for another 10 min. The RPR+Cy5-oligo was further diluted in SMM buffer [50 mM Tris-HCl (pH 7.5). 2 M NH4OAc, 0.005% (w) Tween-20. 0.1% (w / v) BSA, either 10 or 400 mM MgCl2, RNase- free 1120] to obtain a final concentration of 50 nM. As control, the Cy5-oligo alone in the SMM buffer was also prepared for the SMM screen to determine non-specific binding. Additionally, a slide incubated with PBST buffer was used for background reference. Thus, a total of four slides were screened at the same time. For screening, the slides were immersed in the target Docket No. 103362-031W01

[0287] solutions and kept on a shaker for 2 h. After the incubation, the SMM slides were gently washed with PBST. PBS. and ddH2O (three times each), and dried by centrifugation (1,700 g. 2 min), Finally, the microarrays were imaged for fluorescence with an InnoScan 1100 AL fluorescence scanner (Innopsys, Carbonne. France) at a 5-pm resolution (635 nm excitation. 665 nm emission). The scanned image was aligned with the corresponding GenePix Array List (GAL) file to identify individual features, and the hits were identified based on the quantified fluorescence intensity of each spot. After quantifying the fluorescence intensity of each spot, Z-scores for SMM screens were plotted and compared.

[0288] Hits were identified based on the signal-:.o-noise ratio at 635 nm (SNR635). defined as (mean foreground - mean background ^'standard deviation (SD) of background. The Z-score is defined as: Z = [mean SNR635(compound) - mean SNR635(library)] / [SD SNR635( library)] based on the following criteria: (i) SNR635 ' • 0. (ii) Z-score "■ 3, (iii) coefficient of variance (CV) of replicate spots <100, (iv) SNR635 of negative control slide <1 and (v) visual comparison of intensity with other nucleic acid structures screened. To further measure selectivity, the Z-score for each selected compound was compared across different SMM screens.

[0289] (i) RNase P assays to determine the small molecule binders that also modulate function Rcfoklinn of RPR: All refolding steps and activity assays were performed in an MJ Research thermocycler ( Bio-Rad, Hercules, CA; formerly MJ Research Inc.). Msm RPR and fii RPR were refolded prior to their use in activity assays. Buffers used for activity assays were sterilized using 0.22 pm syringe filters (VWR International, Radnor, PA). For refolding, the RPR was incubated in autoclaved double-distilled water (ddH2O) for 50 min at 50' C and then for 10 min at 7 C. Subsequently, an equal volume of2X refolding buffer [lOOmM Tris-HCI (pH 7.5 at 22°C). 1.6 M NH OAC, 20 mM MgCL] was added to the RPR. The RPR in IX refolding buffer [50 mM Tris-HCI (pH 7.5 at 22°C). 800 mM NH4OAc. 10 mM MgCL] was then incubated at 37 for 30 min.

[0290] S'-J.aheHnu of Tih pre-iRNff’h: Radioactivity-based, discontinuous pre-tRNA cleavage

[0291]

[0292] assays were used to identify and characterize small molecule inhibitors of A / .w RPR. To prepare 5'- [;P]-7fo pre-tRNAG1\ 230 pmol of in vitro transcribed Tih pre-tRNAlywas first dephosphorylated by treating with alkaline calf intestine phosphatase [New England Biolabs (NEB)] for 2 h at 37°C. This reaction was then subjected to phenol-chloroform extraction followed Docket No. 103362-031W01

[0293] by ethanol precipitation. The resulting pellet was resuspended in autoclaved ddH2O, and the concentration of the dephosphorylated Tth pre-tRNA1'1- was calculated by measuring absorbance at 260 nm using a NanoDrop spectrophotometer (ThermoFisher. Waltham. MA) and an extinction coefficient of 896,800 MGcm ' (IDT Oligo Analyzer).

[0294] The dephosphorylated Tth pre-tRNAGI> was incubated with y-f;Pj-ATP (PerkinElmer. Shelton, CT) and T4 polynucleotide kinase (NEB) at 37CC for 45 min. The labeling reaction was then quenched by adding denaturing quench dye [0.05% (w / v) bromophenol blue. 0.05% (w / v) xylene cyanol, 7 M urea, 5 mM EDTA] and then subjected to denaturing urea gel [ 10° 6 (w / v) polyacrylamide. 7 M urea) electrophoresis. The labeled tRNA was identified by autoradiography, excised and eluted from the gel, and subjected to ethanol precipitation. The final pellet was dissolved in autoclaved ddH2O to yield a 200,000 dpm / pL stock.

[0295] Msm RPR activity assays to identify small molecule inhibitors'. Msm RPR was refolded as described above. The Msm RPR small molecule binders were dissolved in neat DMSO (Sigma-Aldrich. St. Louis, MO) to a final concentration of 10 mM. To prepare working stocks for the activity assay, the 10 mM stocks were diluted to I mM in LX refolding buffer. For the activity assay, 1.1 pL of the 10 pM refolded RPR was added to a 0.65-mL PCR tube (VWR or Axygen) containing 5.5 pL high Mg-' buffer [50 mM Tris-Cl (pH7.5 at 22°C), 3.2 M ammonium acetate, 790 mM MgC12] and 2.2 pL 1 X refolding buffer. The RPR was then incubated in the above assay¬ conditions for 10 mm at 37" C before addition of I. I pL of each of the I mM small molecule binder [in 10% (\ '\j DMSO], In parallel, a control reaction was set up, in which 10% (vw) DMSO in IX refolding buffer without the small molecule was added to the RPR. The RPR and small molecule DMSO were incubated together at 37,?C for 20 min. The substrate mix for the assay was prepared by diluting Tilt pre- tRNAlvcontaining trace amounts of 5'-[ P]-77 / ? pre-tRNAGIin IX refolding buffer to a final concentration of 200 pM. The substrate mix in IX refolding buffer was incubated at 37°C for 5 min. Substrate cleavage was initiated by adding 1.1 pL of the 200 pM substrate to the assay containing the RPR and small molecule / DMSO: the reaction mixture was briefly vortexed and centrifuged fora few seconds before returning the reaction tube to the thermal cycler set at 37eC. The final 11-pL assay contains 1 pM Msm RPR. 20 pM 77 / ? pre-tRNAGh, and 100 pM of each of the small molecule binder in I X assay buffer [50 mM Tris-Cl (pH 7.5 at 22 C).

[0296] 2 M ammonium acetate. 400 mM MgC12] and 1% (vX ) DMSO.

[0297] Five-pL aliquots were removed from each reaction at 30 min and 60 min post-substrate addition and quenched using 15 pL denaturing quench dye. Tth pre-tRNAGi>processed by Docket No. 103362-031W01

[0298] Escherichia eoli (Eco) RPR under the same assay conditions was used as the positive control for comparing the size of the 5'-leader product. The substrate mix incubated for 60 min in the assay buffer alone (i.e.. no RPR) served as a negative control. The cleavage products in all reactions were analyzed on a 10% (w. v ) polyacry lamide / 7 M urea gels.

[0299] The denaturing polyacr lamide gels were scanned using the Typhoon RGB imager (Cytiva) under the phosphor imaging setting. The image was then quantitated using ImageQuant (Cytiva) to calculate the intensity of the precursor and leader bands in each reaction. The ratio of the 5' leader intensity relative to the total intensity (5* leader t- precursor) was used to calculate the °o product formed at each time point. Although only two timepoints were used, we employed this first-pass approach to obtain a rough estimate of the turnover number and inhibitory potency: the correlation coefficients (R ) for plots of product formed versus time were > 0.96. Time courses were designed to ensure ■ 30-40° o cleav age to maintain linearity in product formation. The relati \ e activity of Msm RPR in the presence of 100 pM of each of the small molecule binders was calculated by using as reference the activity of Msm RPR in the presence of 1% (v ) DMSO alone. The average relative activity of Msm RPR in the presence of the small molecules and mean absolute error were calculated from two independent trials.

[0300] Petermimuiou of the Ei value for inhihhion of Msm RPR by commercially purchased Mi (MJ Acti ity assays to estimate Ki values of M I comm were performed similar to the method described above with minor differences. Six concentrations of M I comm (23. 50, 75. 100. 150. or 200 pM ) were used to estimate the Ki value, which were diluted from 10-fold higher working stocks in 20° o ( vv) DMSO. In each activity assay, 3 pL of the 10 pM refolded RPR was added to a 0.65- mL PCR tube containing 15 pL high Mg?buffer and 6 pL 1.5X refolding buffer [75 mM Tris-CI (pH7.5 at 22CC). 1.2 M ammonium acetate. 1 mM MgCl_>]. The RPR was incubated in the above assay conditions for 10 min at 37°C before addition of 3 pL of one of the M Icomm working stocks to the appropriate test reaction. In parallel, a DMSO-only control reaction was set up with the RPR and 3 uL of 20% (v / v) DMSO instead of M Icomm- The RPR and small molecufoDMSO were incubated at 37°C for 20 min. Substrate cleavage was initiated by adding 3 pL of the 200 pM Tth pre-tRN AGt>(in I X refolding). The final 30-pL assay contains 1 pM Msm RPR and 20 pM Uh pre- tRNA<;l>. and 0-200 pM M Icomm in IX assay buffer, and 2% (v / v) DMSO. After addition of the substrate. 3.5-pL aliquots were withdrawn at 20. 40. 60. 80. 100. 120. 140 and 180 min. and the reactions were terminated by addition of 16.5 pL denaturing quench dye. The cleavage products Docket No. 103362-031W01

[0301] were quantitated to determine the percent product formed over time as described above

[0302] (,i ) Data analysis of slow-onset binding inhibition kinetics

[0303] Analysis of product progress curves indicated that M I is a slow-onset binding inhibitor. Inhibitors that exhibit slow-binding kinetics do not adhere to traditional Michaelis-Menten assumptions. When enzyme and inhibitor are pre-equilibrated prior to addition of substrate, dissociation of enzyme from pre-formed enzyme-inhibitor complexes can result in initially faster product formation. This counter-intuitive idea is based on the reasoning that inhibitor unbinding could help toggle the enzyme to a faster catalytic state. To adjust for both effects of slow-binding and depletion of substrate during the reaction, a two-step exponential function was derived to describe expected product formation.

[0304] in

[0305]

[0306] l-fo

[0307] where [P]fis the product formation at time i. [5]0is the initial concentration of substrate. [ / ] is the total concentration of inhibitor. The model includes learned parameters u0that describes the uninhibited velocity, Ktas the dissociation constant between enzyme and inhibitor, and a unique k parameter for each concentration of [ / ] that modulate the rate of transition from v0at time 0 to^f at time

[0308]

[0309] Maximum likelihood estimates of model parameters were fit assuming logit-

[0310]

[0311] 1+«7 ' -:

[0312] normalized Gaussian errors and optimized by a differential evolution algorithm in Scipy. Confidence intervals of Ktwere estimated by profile likelihood estimation, and models with a maximum profile likelihood score of <0.01 were rejected from further analysis.

[0313] (k) Surface plasmon resonance imaging (SPRi) assays to assess the binding affinity of Ml or its analogs to Msm RPR and Pfit RPR

[0314] The interactions between Ml or its analogs and RPRs were quantitatively assessed by SPRi (PlexArray HT, Plexera, USA), an array-based and label-free optical sensor. In brief, an SPRi chip with photo-cross-linking (PCL) surface chemistry was used for microarray preparation, as described previously. M 1 or its analogs ( 10 niM in DMSO) were primed onto the chip surface in an 8 x 8 array format using the machine integrated within the SPRi system. Each Docket No. 103362-031W01

[0315] compound was printed in triplicate spots. Then, the chip was dried under vacuum for 8 h in dark, followed by UV irradiation at 365 nm for 15 min. After thorough washing (DMSO, methanol, and ddH? O). the slide was assembled with a flow cell and placed into the machine for testing. Meanwhile, the RPR sample, as the flowing phase, was refolded as described above (see section on activity assays). The optical position was adjusted based on the running buffer [50 mM Tris- HCl (pH7.5 ), 2 M NHJOAC, 400 mM MgCb], and the experiment was performed after ensuring a stable baseline. For detecting binding, the folded RPR was injected into the flow cell, with a 300-s association and a 300-s dissociation at a flow rate of 2 pL, s. To obtain a full titration. RPR concentrations ranging from 0.156 pM to 20 pM (2-fold serial dilution from 20 pM). The binding results were collected and analyzed by Plexera SPR Data Analysis software and GraphPad Prism 10. The average and standard deviation of Ki)S;wifor Ml and its analogs were calculated from three independent trials. Docket No. 103362-031W01

[0316] References

[0317] Altman, S, (2000) The road to RNase P. Nul Struct Biol. 7, 827-826.

[0318] Baer, M. F., Wesolowski. D. and Altman. S. ( 1989) Characterization in vitro of the defect in a temperature-sensitive mutant of the protein subunit of RNase P from Escherichia coli. J Bacterial, 171. 6862-6866.

[0319] Chamberlain, J. R., Lee, Y„ Lane, W. S. and Engelke. D R. (1998) Purification and characterization of the nuclear RNase P holoenzyme complex reveals extensive subunit overlap with RNase MRP. Genes Dev. 12. 1678-1690.

[0320] Chen, Y.. Liu, X.. Wu, N. and Fierke. C. A. (2017) Fluorescence-Based Real-Time Actix ity Assays to Identify RNase P Inhibitors. Methods Mol Biol. 1520. 201-223. Childs-Disney, J. L., Yang, X.. Gibaut, Q M R., Tong, Y.. Batey, R. T. and Disney, M. D. (2022) Targeting RNA structures with small molecules. Nat Rev rii Discow 21, 736-

[0321] Connelly, CM.. Boer, R. E., Moon, M. H.. Gareiss, P. and Schneekloth, J. S., Jr. (2017) Discovery of Inhibitors of MicroRNA-21 Processing Using Small Molecule Microarrays. ACS ('hem Biol. 12, 435-443.

[0322] Connelly. CM.. Numata, T., Boer, R. E., Moon, M. H., Sinniah, R. S., Barchi. J. J., Ferre-D'Amare, A. R. and Schneekloth, J. S.. Jr. (2019) Synthetic ligands for PreQ(l ) riboswitches provide structural and mechanistic insights into targeting RNA tertiary structure. Nat ('ommim, 10, 1501. Cryo-electron microscopy structure of an archaeal ribonuclease P holoenzyme. Nat ( 'ommim, 10, 2617.

[0323] Danielsson. R.. Dicksved. J., Sun. L., Gouda. FL. Muller. B., Schnurer. A. and Bertilsson. J. (2017) Methane Production in Dairy Cows Correlates with Rumen Methanogenic and Bacterial Community Structure, l-’ront Microbiol. 8. 226.

[0324] Dong. H., Kirsebom, L. A. and Nilsson. L. ( 1996) Growth rate regulation of 4.5 S RNA and I RNA the catalytic subunit of Escherichia eoli RNase P.. / Mol Biol, 261, 303-308.:

[0325] Ellis, J. C. and Brown. J. W. (2009) The RNase P family. RNA Biol, 6. 362-369.

[0326] Esakova, O. and Krasilnikov. A. S. (2010) Of proteins and RNA: the RNase P / MRP family. Rna. 16. 1723- 1747.

[0327] Eubank. T. D.. Biswas, R., Jovanovic, M., Litovchick. A., Lapidot. A. and Gopalan, V. Docket No. 103362-031W01

[0328] (2002) Inhibition of bacterial RNase P by aminoglycoside-arginine conjugates. EEBS Leiters. 51 k 107-112.

[0329] Guerrier-Takada, C,. Gardiner, K., Marsh, T.. Pace, N. and Altman. S. ( 1983) The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. ( 'ell, 35, 849-857.

[0330] Hopkins. A. L. and Groom. C. R. (2002). Nat Rev Drati Discov. England, Vol. I. pp. 727-730.

[0331] Kawamoto, S. A.. Sudhahar. C. G., Hatfield, C. L., Sun, J.. Behrman. E. J. and Gopalan. V. (2008) Studies on the mechanism of inhibition of bacterial ribonuclease P by aminoglycoside derivatives. Nucleic acids research, 36, 697-704. < Kikovska, E.. Svard. S. G. and Kirsebom. L. A. (2007) Eukaryotic RNase P RNA mediates cleavage in the absence of protein. Prac Nad Acad Sei U S A. 104, 2062-2067. Kumar, A., Rhodes, R„ Spychala, J., Wilson. W.. Boykin. D._ Tidwell, R.. Dykstra. C.. Hall, J., Jones. S. and Schinazi, R. ( 1995) Synthesis of dicationic diarylpyridines as nucleic- acid binding agents. Ear J Med ( 'hem, 30. 99- 106.

[0332] Lai, L. B., Vioque. A., Kirsebom, L. A. and Gopalan. V. (2010) Unexpected diversity of RNase P. an ancient tRNA processing enzyme: challenges and prospects. I EPS Lett, 584.267-296.

[0333] Lei. B„ He, A., Chen, Y.. Cao. X.. Zhang. P., Liu, J., Ma. X., Qian, L. and Zhang, W. (2019) Long non-coding RNA RPPHI promotes the proliferation, invasion and migration of human acute myeloid leukemia cells through down-regulating miR-330-5p expression. Excli j, 18. 824-837.

[0334] Liang.

[0335]

[0336] / I m H -v, Wang. E -w. Xiong.

[0337]

[0338] I... / lion, t. Hu. 1 He. \.-w \\ u X Xie, D. Wu. X.-r. el al. (2019) LncRNA RPPHI promotes colorectal cancer metastasis by interacting with TUBB3 and by promoting exosomes-mediated macrophage M2 polarization. ( 'ell Heath A Disease. 10. 829.

[0339] Liu. \\. Yao. Q.. Su. X.. Deng 5. Yang. XL. Peng. B. Zhao. I.. Du. C.. / hang. X.. Zhu, J. et al. (2023) Molecular insights into Spindlinl-HBx interplay and its impact on HBV transcription from eccDNA minichromosome. Nature ('oiitintitiicaiioiis, 14, 4663. Lyon, S.. and Gopalan. V. (2018) A T7 RNA polymerase mutant enhances the yield of 5'-thienoguanosine-initiated RNAs. Chctnhiochem, I9. 142-146.

[0340] Marathe I. A. Lai. S. M. Zahurancik. XV. J. Poirier. M G. Wysocki. X' H.. and Docket No. 103362-031W01

[0341] Gopalan. V. (2021 ) Protein cofactors and substrate influence Mg2+-dependent structural changes in the catalytic RNA of archaeal RNase P. Nucleic Acids Res., 4, 9444-0458. Mikkelsen, N. E.. Brannvall. M.. Virtanen. A. and Kirsebom, LA. ( 1999) Inhibition of RNase P RNA cleavage by aminoglycosides. Proc Nad Acad Sei I ' SA, 96. 6155-6160, Mikkelsen, N. E.. Brannvall. M., Virtanen, A. and Kirsebom. L. A. (1999) Inhibition of RNase P RNA cleavage by aminoglycosides. Proceedings of the National Academy of Sciences. 96, 6155-6160.

[0342] Mikkelsen. N. E.. Johansson, K.. Virtanen. A. and Kirsebom. L. A. (2001 ) Aminoglycoside binding displaces a divalent metal ion in a tRN A- neomycin B complex. Nature Structural Hiology. 8. 51 -514.

[0343] Palangi, V. and Lackner, M. (2022) Management of enteric methane emissions in ruminants using feed additives: A review. Animals. 12. 3452.

[0344] Pannucci. J A.. Haas. E S.. Hall. LA.. Harns. J K. and Brown. J. W. ( 1999, RNase P RNAs from some Archaea are catalytically activ e. Proc Natl Acad Sei I ' A, 96. 7803- 7808.

[0345] Phan. H. D., Lai, L. B.. Zahurancik. W. J. and Gopalan, V. (2021) The many f ces of RNA- based RNase P, an RNA-vvorld relic. Trends Hiochem Sei. 46. 976-991.

[0346] Phan, H. D.. Norris. A S., Du. C, Stachovvski, K., Khairunisa, B. H., Sidharthan, V., Mukhopadhyay. B.. Foster, M. P.. Wysocki. V. H. and Gopalan. V. (2022) Elucidation of structure-function relationships in Meihanocalducoccus jannaschii RNase P. a multi-subtin it catalytic ribonucleoprotein. Nucleic Acids Res, 50. 8154-8167.

[0347] Pulukkunat, D. K. and Gopalan. V. (2008) Studies on Meihanocaldococciis jannaschii RNase P rev eal insights into the roles of RN and protein cofactors in RNase P catalysis. Nucleic Acids Res. 36. 4172-4180.

[0348] Reiter. NJ.. Osterman. A.. Torres-Larios. A.. Swinger. K. K.. Pan. I. and Mondragon. A. (2 10) Structure of a bacterial ribonuclease P holoenzyme in complex w ith tRNA.

[0349] Nature, 468. 784-789.

[0350] Schencking. I.. Schafer. 1. Al Scanlan..1 H W. W enzel. B M. Emmerich, R L.

[0351] Steinmetzer. T.. Diederich, W. E.. Schlitzer, M. and Hartmann. R. K. (2021 ) RNase P Inhibitors Identified as Aggregators. Aniimicroh Agents ( jiemother. h5, e0030021. Spvchala. L Bovkm. D._ Wilson. W. Zhao L Tidwell R. Dvkstra. G Hall. J. Jones.

[0352] SO Docket No. 103362-031W01

[0353] S, and Schinazi, R ( 1994) Synthesis of dicationic diaryltriazines nucleic acid binding agents. Enrd Med ( 'hem, 29. 363-367.

[0354] Storn. R. and Price. K. ( 1997) Differential Foolution - A Simple and Efficient Heuristic for global Optimization over Continuous Spaces. Journal of(dobal Opiimi ation, 1 1. 341-359.

[0355] Sztuba-Solinska, J.. Shenoy. S. R., Gareiss. P., Krumpe. L. R., Le Grice. S. F., O'Keefe, B. R. and Schneekloth. J. S.. Jr. (2014) Identification of biologically active. HIV TAR RNA- binding small molecules using small molecule microarrays.. / Am ( ‘hem Soc, 136, 8402- 8410. / ;

[0356] Jong. Y Lee. Y.. Liu X. Childs-Disney J. L. Suresh. B. M., Benhamou. R. I.. Yang. (

[0357] Li, W., Costales. M. G., Haniff, H. S. ct cd. (2023) Programming inactive RNA-binding small molecules into bioactive degraders. Naiiire, 618. 169-179.

[0358] Torres-Larios, A., Swinger. K. K., Krasilnikov, A. S., Pan, T. and Mondragon. A. (2005) Crystal structure of the RNA component of bacterial ribonuclease P. Nature, 437. 584-587,

[0359] Vicens, Q. and Westhof. E. (2003) RNA as a drug target: the case of aminoglycosides. Chemhiochem, 4, 1018-1023.

[0360] Vioque. A. ( 1989) Protein synthesis inhibitors and catalytic RNA. Effect of puromycin on tRN A precursor processing by the RNA component of Escherichia col i RNase P. EEES ken. 246. 137-139.

[0361] Walter. F., Vicens, Q. and Westhof. E. ( 1999) Aminoglycoside RNA interactions.

[0362] ( 'HITCH! opinion in chemical biology, 3, 694-704.

[0363] Wan, F„ Wang, Q., Tan, J„ Tan. M.. Chen, J._ Shi, S._ Lan, P._ Wu, J. and Lei, M. (2019) Wang. J. han. L. Li. X and / hang. Y. (2022) Noncoding RNAs Emerging as Drugs or Drug Targets: Their Chemical Modification. Bio-Conjugation and Intracellular Regulation.. W / CCM / CX, 10.3390 / molecules27196717.

[0364] Willkomm. D. K.. Gruegelsiepe. H., Goudinakis, 0., Kretschmer-Kazemi Far. R.. Bald, R., Erdmann, V. A. and Hartmann. R. K. (2003 ) Evaluation of bacterial RNase P RNA as a drug target. Chemhiochem, 4, 1041-1048.

[0365] u., L. Niti, S., Tan. NL. Huang. C._ Li. M. Song. Y. Wang Q.. Ch.cn. J Shi. S., Lan. Docket No. 103362-031W01

[0366] P. et al. (2018) Cryo-EM Structure of the Human Ribonuclease P Holoenzyme. ( 'ell, 175. 1393-1404. e! 11.

[0367] Wu, S.. Mao. G. and Kirsebom, L. A. (2016) Inhibition of Bacterial RNase P RNA by Phenothiazine Derivatives. Hiomolccides, 6.

[0368] Zhou. Y.. Sun. 7... Froelich. J. M.. Hermann, T. and Wail D. (2006) Structure -activity relationships of novel antibacterial translation inhibitors: 3. 5-diamino-piperidinyl triazines. Hioori>anic A medicinal chemistry letters, 16. 5451-5456.

[0369] W edlock DN. Pedersen (.. Dems M. Dex' D Janssen PI 1. Buddle BX I 2010 Development of a vaccine to mitigate greenhouse gas emissions in agriculture:

[0370] Vaccination of sheep with methanogen fractions induces antibodies that block methane production in vitro. New Zealand Veterinary Journal 58:29-36. Docket No. 103362-031W01

[0371] T BLES

[0372] Table 1: Names and sequences of oligonucleotides used in this study

[0373] Name;Sequence (S' to 3') Purposc / Notes F-cxt Primer CGACGTTGTAAAACGACGGCCAG (SEQ ID Universal pBlucscripl NO: 1 ) f primers (for use in PCR R-exl Primer GG A A AC AGCTATG ACC ATG ATTACGCC A AG and DNA sequencing):

[0374] (SEQ ID NO: 2)

[0375] Msm RPR-I primer ATGGCAAGTTAAAGACAGCTGTTGG For cloning of the Msm (SEQ ID NO: 3) RPR gene into pBT7 ( 1 ) Msm RPR-R primer CAGAATTCATGGCATGTTAAGAGTAACC

[0376] (SEQ ID NO: 41;:

[0377] F ext Msm RPR GGCA A ATG A ACCTA ATACTTAG ACAATGGC For use in a PCR designed primer AAGTTAAAGACAGCTGTTGG ' to generate the DNA (SEQ ID NO: 5) > template for an IVT R ext Msm RPR GGAAGATATAGTTTACGATACTCATGGCATG reaction used to primer TTAAGAGTAACCCAC synthesize Msm RPR (sec (SEQ ID NO: 6) i Figure IA)

[0378] T7 Fext_Msm RPR ATGCCTAATACGACTCACTATAGGCAAATGA

[0379] primer ACCTAATACTTAG ACAATGGC AAG >:

[0380] (SEQ ID NO: 7) f:

[0381] (\ 5-oligo FGTCTAAGTATTAGGTTCATTTG-Cy5 For non-covalent (SEQ ID NO: K) " j attachment of the Cy5 fluor to the Msm RPR (SMM studies)

[0382] Msm RPRMW 5'-, The 5' and 3* extension ggcaaaugaaccuaauacuuagacaAUGGCAAGU:sequences in Msm and Meihimohrevihacle UAAAGACAGCUGUUGGUUUUUUAACUAA Pfu RPR are in r smilhii GGAAACUCCGCCCAUCGUUACAGACUAU lowercase and GGCGUUGAAAAACGUAUACUGAGAGGUA underlined.

[0383] UGACUCUGGAGCAGAAACGACACGUCUU UUAAUGGUUGACUAUGAUAUUUAAUUGA

[0384]

[0385] GGACAUUGAAAGAAUCGGUGAAACGGCC Docket No. 103362-031W01 AUUCCAUAGGAUGCAAGAACAAAAAAUGC UGAUGACUACUGUAAGAGGCAAAAGUAG UUCGCUAAGAUGAAUGCUGUUAAACAGAA GGUGGGUUACUCUUAACAUGCCAUqaqua UCfluaaacuauaucuucc-S^ (SEQ ID NO. 9)

[0386] Pfil RPRSMVM 5'- ggcaaaucaagcuaaaacuuacacaGGCGAGG The 5’ and 3’ extension GGGCUGGGGGCUGUCGGGCUCGUGCCC

[0387] Pymcocciis sequences in Msm and GAGGAAGUUCCGCCCACCGCACCGGGGC fifu RPR are in fitridsus CGCGGUGCCGUAAGGCACCGGCCGAGAG lowercase and GCCGGGCAACGGCACAGAAACGACACGU underlined.

[0388] CCCUCGGGGGAUGUGGAUGAAAGCGGUG AAGGCUCCCGGUGACGGGAGCCGAGUUA ACCCGCAGACAAUCCCGAGGGGAGCGGU GAAACGGCCGUCCCGCGGGGUGCAAGGC CGAGUUAGGGCCGAUGAGUUCCCGGUGU GAGGCCCGUGGUAGGCCGCUUAGUCGAA UGCUCCCGUAGUACAGAAGGCGGGCUAU AGCCCCCUCGCCaaaaua^^

[0389] Ucaaauu-3' (SEQ ID NO: 10)

[0390] Metluinobrevibinter 5'- RI G 13115 RPR GCAAGUUAAAGACAGCUACUGGUUUU AUUUAAACUAAGGAAACUCCGCACAU CAAUACAGAACUAUGGCGUUGAAAAA CGUAUACUGAGAAGUAUGACUCUGGA GCAGAAACGACACGUCUUUUAAUGAA UGACAAUGAUAUUUAAUUGAGGACAU UAAAAAGAAUCGGUGAAACGGCCAUU CCAUAGGAUGCAAGAACAAAGAUGCU GAUGAUCACCUGUUGUAGGCAAGGUA GUUCGCUAAGAUGAAUGCUGUUAAAC AGAAUGUGGGUUACUCUUAACAUGC- 3’ (SEQ ID NO: 11)

[0391]

[0392] pocket «». 103362-P31WO1

[0393] lable 2: I ist ot clicny-picked compounds Irom the initial SMM screen that were tested in RNase I* activ tty assays

[0394] < (impound < ompound II) cN«mes v Structure / .-score' Relative reference m-thity t SEM” Cl ’ini i-ss, S.4o 121 > K ( hv drove mcihv 1 iphenv 1 lacetv 1 >-4- ( VmelhoxvplKiiy l i-pvuolidine- 's- iN'ty '*

[0395] carboyv lic acid i

[0396]

[0397] * - Hits wav Identified based on Mgnal-to-noise ratio at <>35 mil I SNR, o). defined as (mean foivgiound mean background ) standard dev iation of background / -seine is defined as / (mean SNR....(compound) mam SNR..y hbuuy )) ( Si ) SNR635ihbmty )) w ith the follow ing eiitena- (i ) SNR.,:< ■ I), (u I / -score ■ 3. ini) coeilietenl of variance (CV ) of replicate spots • 100. m 1 SNR„>< of negative conn ol slide ■ I and (vt visual comparison of intensity w ith other mtcleic aetd structures screened Io further measure selectivity. the / -score for each selected compound is compel cd aci oss ntanv dit fet cut SMM sei ecus *• - Relative activ ity ictets to the pie-lRNA"hcleavage activ ity of A / .w RPR observed tn the presence of each compound compared to a comtol (no additive). values repoitcd aic the averages and the absolute arm of the mean Horn two sepaiate mcasinemeiits. ‘ KtbChcni compound II)11ClicmBndec compound ID

[0398]

[0399] Docket No. 103362 031W01

[0400] C2 Vi us i- 2 - am i n i i-.l -et h y 1 -N -( ( 4 -nu I In 1 - 1 I I S > I I I

[0401] v lUnethx 1 1- d;iA>| 4 S.

[0402] b|pyi idine-(>-carboxamiJc:

[0403] 4

[0404] : " M. \;

[0405] .

[0406] (. t 3OSX5ST1 '' ( l -( 2-hyih<>xu-tM h- l l l- t o I I I ‘ 12

[0407] : i 1

[0408] bcuzo| d]iniidazol-5-y h(4-(3- I. «u M

[0409] mclhylpy riditi-2-y 1 jpipera / i n- 1 - i

[0410] t l mieihimone

[0411] Ml 4-12-nielliow phctn i l- '' -n ict h \ 1 t,?

[0412] 2.<>-di-p-toly lpipei idm-4-»l HU. - ’l

[0413]

[0414]

[0415] Docket No. 103362 031W01

[0416] M2 2-i 2-hy dt«\\ ethy 1 )- S-( p\ i ulm-2- «. k 1

[0417] \linetlnhpyiidi>|4.3- I i f '

[0418] h]j l.6|iMphthyndme-l 9(211. Mh- dione

[0419] M3 2< MOXS06 1 -< I -phenyl- 1 H-tcl i a / oI-5 -y 1 ) *3.. I 2 124 IO r.-r-dihydn-. VIl- spno|pipehdinc-4.2Mjuinoxalm|- 1

[0420] i'-onc

[0421] M4 '20MI'< T l-(( 3-13-chloiot'ai / vl)- 1 -(2- 0 t l l'> ■ 11

[0422] 1

[0423] h\dn>\\cthyh-lll-l.2,4-iriu / o|-3.

[0424] \ 1 imethy 1 )-5-mcth\ Ipy i imidine- 2Ji 1 ILMh-dioiw

[0425] T ■-- > uH

[0426] k*M» ' '"’n

[0427]

[0428]

[0429] Docket No. 103362 031W01

[0430] M' 1X294716'" 2-( ophcnv I )-2-ln drove A- 1 4 140 < (< iiiethv I-N-K2-( thiophcn-2- yl )ihwzo|-4-yl nnelhv 1 ) acetamide

[0431] ivH

[0432] l?2 ' "

[0433] M6 W2t(.9s’’!-t2-(2-liy diovy ethovv whyh 112 7 pipeia / m- 1 -vb( imidu / o| 2.1 •

[0434] h|llna / ol-<>-\ bmethanone

[0435] M7 70721522" 2-(5-amtno-3-melhyl- 111-pyruzol-, 9 121 ■ 1

[0436] 1 -J)A-(( 5-isobuly 1-5.6. ’. S- " A '

[0437] tetialndio-4II-pyia / olo[ 1.5- a || 1 4|dia / epin-2- vl imet In 1 tacetamule

[0438]

[0439] _ _

[0440]

[0441] £

[0442] i

[0443] Docket No. 103362 031W01

[0444] \ 5=

[0445] MS t-u. Ml-diriK-lho\\puiihn-2-1

[0446] H7-?, O O •

[0447] )limcthvl)-l-o\a-.>.x- \ /

[0448] dia / aspir<>|4 > |sU'c;m-2 -<’Hv... i L_ _ — 1. 1

[0449] M«> 44X00614'" 6-ainiiu'-N-nK-ihM-N-((t- > 4 106 1

[0450] \\.5

[0451] (pwdtii-2-\h -l.2.4-<>xadiaz<>l-5- HZ

[0452] yljnielh) Ijnicotinaiuide fc

[0453] 7 V

[0454] w,

[0455] Min MC. U-’r" S-id-tdmKlhylamm.o-t-t t- w “i XS 1.

[0456] In droxy pu-py 1 ipipcndme- 1 - carbon} 11- 1 -meth) Ip) t imidmc- L

[0457] 2.4( 111 Mh-dmne

[0458] N ■* " ■>

[0459] HO^

[0460]

[0461]

[0462] «T2

[0463] Docket No. 103362 031W01

[0464] (T

[0465] MH (■4244297’ j; 4 (> 99 ‘ 2 innd;izo| 4,5-b ]py i uime4.- c;nbvnyh-2. '-dimethyl- 4 > (■ 7- i

[0466] letnihydro-4II-pyrmli'|3.4- d]py iimidin-4-onc

[0467] M12 W«5217* 4-( 7-( bcnzi>| d (oxa zol-2-v 11- i 4 1 129. "

[0468] 5.6.7. S-tetrahy dro-41 I- n i / pwazoli'l 1 5-:tj[ 1 4 |dia / epm-2- k "

[0469] HN H tW

[0470] Ui-N-(2- hy diwyethy 1 ipropaninmdc

[0471] OK

[0472] Ml > 7-1' U92' l-((2,5- ""''O 4 7 112 ■ 5 dmieiboey phony 1 Mil loin 1

[0473] hydri'xyetliyllpipciidine-.'- •k

[0474] r ’ii °

[0475] carboMinnde X- 1 0"

[0476] 1 Cf 1 H

[0477] 0^ 0 1 I

[0478]

[0479] _ _

[0480]

[0481] Docket No. 103362 031W01

[0482] M I4 - toxel l X-(2-ctbow<(\-(2- OH n “ ' hvdioxyelhx 1 MilfairuA 1 iplu-m 1 la

[0483] ^‘Luiiok

[0484] H ILNH

[0485] YlX

[0486] )

[0487] MI 5: l-((5-chloio-2- oQ / : 4 lx I2o • h> metlv<\\ phem Ihullonx 1 )-N-f 2- * OH

[0488] hx droxx ethyl ipiperidine-d- r 'r' «

[0489] caihoxjintde? r L L

[0490] LyJ

[0491] M io ¥0X0-0045 2-t 1 -( 2-( 2-melhox\ phenoxv ) M,2 131 S et hv 11- 111-heiw»|d(imida / ol-2- J " Il % —

[0492] xl lelhan-l-ol LS XL-NV--°"

[0493] r

[0494] L - -<

[0495]

[0496]

[0497] Docket No. 103362-031W01

[0498] M 17: V0SP-005'' 12 ’ 2 > bfn / o|d|iiniilit / ol-l -\ h-N-: f j

[0499] inellivl-N-phcin hwelmnidc i

[0500] M i s W 1- 1061 N -bm> l-2-( 2-( Ip dtini nK-lln 1 p S O I I H ' lb i OH

[0501] l i l-ben / <>|il|iintJa7ol- l-yl)-N- 1

[0502] melhylaccianiiik

[0503] 0 = / /

[0504] M I9 2 W-W N-U-lliu'io-bmcthvIphenvb-S- u, I B M methyl-l l,2.4 ]it!a / oh>[ 1.5-;

[0505] hFL

[0506] a|p\ i imidiH-7-:mnneXN'X^'N

[0507] kAKAJk

[0508] H

[0509]

[0510]

[0511] Docket No. 103362-031PV1

[0512] Tables 3, 3B ami 3C: Details of timepoints used in discontinuous RNase P assays

[0513] A. Studies io determine the Michaelis-Mcnten kinetic parameters of M m RPR under v arying concentrations of Tlh pre-tRN1'1'

[0514] \ lfh pre-tR JtM Time-points, min

[0515] Ilf 20 15. 30. 45, 60

[0516] 40. 60 20, 40, 60, 80

[0517] 90. 120 30. 60. 90, 120

[0518]

[0519] B. Studies to determine the K| value for M l,1-mediaicd inhibition ofpre-tRNA cleavage by Msm RPR |Ml-sytt|. pM Timepoints. min

[0520] 0 15. 30. 45. 60. 75, 90

[0521] 2.5 1 5. 30. 45. 55. 65. 70, 80. 90

[0522] 5. 10 15. 30. 45. 50. 61. 70. 80. 90

[0523] 23 1 5, 30. 40. 47.5, 55. 65. 75, 90

[0524] 50. 75. 100 10, 20. 30. 37.5, 45. 57.5. 72.5, 90 f

[0525]

[0526] 0. Studies to determine the Ki value for M l analog-mediated inhibition of pre-tRNA cleav age by Afew RPR

[0527] Compound Concentration, pM Timepoints. min

[0528] MesMe-desdiaryl 0 10. 20. 30, 40. 50.5. 60, 75. 90

[0529] 23. 50. 100, 150. 200 j 15. 30. 40. 47.5, 55. 65, 75. 90 M l -desMc (Trial 1 ) r 0;v 10. 20, 30. 40, 50.5, 60. 75. 90

[0530] 10. 23 15, 30. 45. 55. 60. 65. 75. 9(1 50, 75, 100 15. 30. 40, 47.5. 55. 65, 75, 90 M l -desMe (Trial 2 ) 0 A?J 10. 20. 30, 40. 50.5. 60, 75. 90

[0531] 23. 50. 100. 150. 200 j 15, 30, 40. 47.5. 55, 65. 75, 90 M 1 -desMe-N-allyl 0 10. 20. 30, 40. 50.5, 60, 75. 90

[0532] 23. 50. 100. 150. 200 v 15, 30. 40. 47.5. 55. 65, 75. 90 M l -ethyl 0 10, 20. 30. 40, 50.5. 60. 75. 9(1

[0533] 23. 50. 100, 150. 200 15. 30. 40. 47.5, 55. 65. 75. 90 M l-desMe-NMc 0 i 10. 20. 30, 40. 50.5. 60, 75. 90

[0534] 23, 50. 100. 150, 200 15. 30. 40. 47.5, 55. 65. 75, 90

[0535]

[0536] Docket No. 1O3362-O31PV1

[0537] M I-X'Me; 0 10, 20. 30. 40, 50.5. 60. 75. 90

[0538] 23, 50. 100. 150. 200 15. 30. 40, 47.5. 55. 65, 75. 90

[0539]

Claims

1. Docket No. 10336 -031PV12.CLAIMS3.What is claimed is:

1. A method of reducing or inhibiting maturation of precursor tRNAs within methanogenic archaea, the method comprising exposing RNase P RNA from methanogenic archaea to an RNase P inhibitor, wherein said RNase P inhibitor interacts with RNase P and prevents it.from catalyzing maturation of precursor tRNAs within the methanogenic archaea.

2. The method of claim 1, wherein said interaction occurs between the inhibitor and the RNA subunit of the RNase P ribonucleoprotein.

3. The method of claims 1 or claim 2, wherein said method takes place m vivo or in vitro.

4. Tile method of claim 3, wherein said method takes place within a vertebrate.

5. The method of claim 4, wherein said vertebrate is a ruminant6. The method of any one of claims 1 -5, wherein the methanogenic archaea belong to11.

12. genus.

7. The method of claim 6, wherein the archaea belong to M^thunobrevibacter species.

8. The method of any one of claims 1-7, wherein the inhibitor is a small molecule.

9. The method of claim 8, wherein the small molecule inhibitor is a diaryl-piperidine compound.

10. The method of any one of claims 1-9, wherein the inhibitor is Ml or an analog thereof, as depicted in Figure 4.

11. The method of claim 10, wherein the inhibitor comprises the following structure:

18.

12. A method of reducing enteric methane production in ruminant livestock, the method comprising administering to the ruminant livestock an inhibitor of RNase P inDocket No. 103362-031PV121.methanogenic archaea within the gastrointestinal tract of the livestock, wherein said inhibitor prevents RNase P from catalyzing maturation of precursor tRNAs, thereby reducing enteric methane production by the ruminant livestock.

13. 'The method of claim 12, wherein said interaction is between the inhibi tor and the RN A subunit of the RNase P ribonucleoprotein.

14. The method of claim 12 or 13, wherein the methanogenic archaea belong to25.

26. genus.

15. The method of claim 14, wherein the archaeon belongs to28.

29. smi i.

16. The method of any one of claims 1 -15, wherein the inhibi tor is a small mo lecule.

17. The method of claim 1, wherein the small molecule inhibitor is a diaryl -pipers dine compound (Ml).

18. The method of any one of claims 12-17, wherein the inhibitor is Ml or an analog thereof, as depicted in Figure 4.

19. The method of claim 18, wherein the inhibitor comprises the fol lowing structure:

35.

20. The method of any one of claims.12-1, wherein the inhibitor is given orally.

21. The method of claim 20, wherein the inhibitor is given via li vestock feed.

22. The method of claim 20 or 21. wherein the inhibitor is given daily, weekly, or monthly.

23. A composition comprising a small molecule inhibitor of RNase P from methanogenic archaea, wherein the small molecule inhibi tor has active stereoisomers.

24. The composition of claim 23, wherein the inhibitor is capable of in teracting with the RNA subunit of the RNase P ribonucleoprotein.

25. The composition of claims 23 or 24, wherein the small molecule inhibitor is a diaryl- piperidine compound (Ml ).Docket No. 10336T031PV126. Hie composition of claim 25, wherein the inhibitor is Ml or an analog thereof, as depicted in Figure 4,27. The composition of any one of claims 23-26, wherein the small molecule inhibitor comprises: three aryl rings, two hydrogen bond donors, and one hydrogen bond acceptor.

28. The composition of claim 24, wherein the small molecule inhibitor structure comprises:

47.

29. The composition of any one of claims 23-28, wherein the structure comprises a piperidine core with diary l rings attached to the 2,6 positions of the piperidine core,30. The composition of claim 29, wherein the small molecule inhibitor is in a feed additive, 31. A method of identifying an inhibitor for reducing or inhibiting RNase P RNA, the method comprising:51.a. exposing a small molecule to RNase P RNA; and52.b. detecting interaction between the small molecule and RNase P RNA; and c. determining that the small molecule can reduce or inhibit maturation of precursor tRNAs, thereby identifying a small molecule inhibitor or RNase P RNA,.

32. The method of claim 31, wherein the inhibitor is an M 1 analog.

33. The method of any one of claims 31-32, wherein the small molecule inhibitor comprises;55.three aryl rings, two hydrogen bond donors, and one hydrogen bond acceptor.

34. The method of any one of claims 31-33, wherein the small molecule inhibitor structure comprises:Docket No. W3362-031PV158.

35. The method of any one of claims 31 -34, wherein the structure comprises a piperidine core with diaryl rings attached to the 2,6 positions of the piperidine core.