Compositions and methods related to nucleic acid nanopores
Nucleic acid nanopore sensors with a complementary toehold sequence enable lysis-free, real-time monitoring and sensitive detection of target nucleic acids by increasing channel size for signal amplification, addressing the limitations of existing methods.
Patent Information
- Application Number
- PCT/US2025/047349
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-20
- Filing Date
- 2025-09-22
- Publication Date
- 2026-03-26
AI Technical Summary
Existing methods for detecting target molecules, particularly nucleic acids, often cause cell damage (lysis), lack sensitivity, and are not suitable for real-time monitoring due to irreversible processes.
Nucleic acid nanopore sensors that utilize a complementary toehold sequence to induce a branch migration process, increasing the nanopore channel size and allowing for lysis-free detection of target nucleic acids, enabling real-time monitoring and signal amplification.
The sensors maintain cell integrity, provide sensitive and reversible detection of specific nucleic acid sequences, and allow for rapid signal amplification without disrupting cells.
Smart Images

Figure US2025047349_26032026_PF_FP_ABST
Abstract
Description
SKYSG-43816.601COMPOSITIONS AND METHODS RELATED TO NUCLEIC ACID NANOPORESSTATEMENT OF RELATED APPLICATIONS
[0001] This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 697,321, filed September 20, 2024, the entire contents of which are incorporated herein by reference for all purposes.STATEMENT REGARDING FEDERAL FUNDING
[0002] This invention was made with government support under CA278558 awarded by the National Institutes of Health. The government has certain rights in the invention.FIELD
[0003] The present disclosure provides compositions and methods related to nucleic acid nanopore sensors. In particular, the present disclosure provides nucleic acid sensors that function as nanopores responsive to specific target nucleic acids through a complementary toehold sequence. The binding of a target nucleic acid to the sensor leads to an increase in the size of the nanopore channel in a cell membrane, allowing for the entry or exit of various molecules. These novel nucleic acid nanopore sensors enable lysis-free sensing, which maintains cell integrity and allows for real-time monitoring of target nucleic acids.BACKGROUND
[0004] Detection of target molecules is an essential component of assays and is fundamental to the understanding of biological systems. However, methods of detecting the target can be hindered by damage to cells (e.g. cell lysis), lack of sensitivity, lack of rapid signal, and / or are irreversible and thereby prevent ongoing use of a sample. Accordingly, improved methods of lysis-free detection of intracellular targets with rapid signal amplification and high sensitivity are needed.SUMMARY
[0005] The present disclosure provides compositions and methods related to nucleic acid nanopore sensors. In particular, the present disclosure provides nucleic acid sensors thatM25-099Lf'-PRl-aSKYSG-43816.I01 function as nanopores responsive to specific target nucleic acids through a complementary toehold sequence. The binding of a target nucleic acid to the sensor induces a branch migration process that leads to an increase in the size of the nanopore channel in a cell membrane, allowing for the entry or exit of various molecules such as fluorophores. These novel nucleic acid nanopore sensors enable lysis-free sensing, which maintains cell integrity and allows for real-time monitoring of target nucleic acids.
[0006] In some embodiments, the present disclosure provides a nucleic acid sensor containing two or more amphiphilic moieties that facilitate insertion of the sensor into cell membranes, creating a nanopore channel between the sensor and a moiety of the cell membrane (e.g. a phospholipid of the cell membrane). The nucleic acid sensor is thus designed to function as a nanopore when inserted into the cell membrane. This nanopore channel is initially closed, but opens when target nucleic acids, such mRNA or an miRNA molecules, bind to a complementary toehold sequence present on sensor, resulting in a branch migration process that opens the hairpin domain of the sensor and increases the size of the nanopore channel, allowing for the entry of molecules (e.g. fluorescent molecules) (FIG. 1). Detection of a fluorescent signal is thus indicative of the presence of a target nucleic acid.
[0007] In some embodiments, the nanopore is constructed using structure with a hairpin region, a double-stranded stem portion comprising a Holliday junction, and a toehold domain for nucleic acid binding. Two amphiphilic moieties (e.g. cholesterol molecules) are strategically placed on opposite sides of the double-stranded stem portion to anchor the sensor in the membrane. When the toehold domain binds to a complementary target nucleic acid strand (target strands like mRNA or miRNA), it triggers a branch migration reaction across the Holliday junction that opens the hairpin. This branch migration increases the size of the nanopore channel, permitting extracellular fluorophores to enter the cell. The fluorescence signal can then be detected. In some embodiments, cells with a fluorescent signal (e.g. cells that contain the target nucleic acid) can be isolated using Fluorescence-Activated Cell Sorting (FACS). The nanopore can be removed post-sensing by introducing cyclodextrin, which binds to cholesterol. Target-mediated opening of the hairpin sensor on the cell membrane increases the nanopore channel size transiently, but the channel rapidly constricts again after branch migration across the membrane, effectively closing the nanopore.
[0008] In accordance with these embodiments, the present disclosure provides a novel sensor that serves as a nanopore capable of selective opening in response to binding target nucleic acids, such as mRNA or miRNA. The opening of the nanopore channel after binding of a target to the sensor allows extracellular fluorescent molecules to enter the cell forM25-099Lf'-PRl-aSKYSG-43816.I01 subsequent detection, thus enabling sensitive detection of specific nucleic acid sequences without disrupting the cell (e.g. without cell lysis). The reversible nature of this system provides further control, making it an ideal platform for molecular sensing and signal amplification. Advantages of this system include: (1) lysis-free detection of target nucleic acids while preserving cell integrity; (2) fast signal amplification kinetics enabled by the nanopore's structural design; and (3) reversible removal of the nanopore from membranes, providing additional system control. As described further herein, an advantage of the present system is the ability to sense intracellular nucleic acids without lysing the cells, allowing for real-time monitoring and preserving cell function. The signal amplification mechanism ensures a highly sensitive detection system, where a single binding event leads to the influx of multiple fluorophores. The reversible nature of the nanopore allows for greater flexibility and control in experimental setups, enhancing its utility in biosensing applications.BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1 shows an exemplary mechanism by which the sensors described herein enable detection of target nucleic acids. The sensor comprises a hairpin region, a double-stranded stem region that forms a Holliday junction, two hydrophobic moieties positioned on opposing sites of the double-stranded stem region, and a toehold domain that is complementary to a target nucleic acid. The hydrophobic moieties facilitate insertion of the sensor within a cell membrane, thus forming a nanopore channel between the sensor and a moiety of the cell membrane. In the embodiment shown, the hairpin region is positioned extracellularly with respect to the cell membrane, and the toehold domain is positioned intracellularly with respect to the cell membrane. Such an arrangement is suitable for detection of intracellular targets. It is understood that detection of extracellular targets can be achieved by the opposite arrangement, wherein the hairpin region is positioned intracellularly, and the toehold domain is positioned extracellularly with respect to the cell membrane. As shown in the left panel, in the absence of the target nucleic acid the nanopore channel is closed. As shown in the middle panel, binding of the target nucleic acid (e.g. “biomarker”) to the toehold domain of the sensor induces branch migration across the Holliday junction. The exchange of nucleic acid strands that occurs during this branch migration process increases the size of the nanopore channel, thereby enabling fluorescent molecules to pass through the channel into the cell. Multiple fluorescent molecules enter a single cell during this branch migration process. This opening of the nanopore channel and resulting passage of multiple fluorescent moieties into the cell isM25-099Lf'-PRl-aSKYSG-43816.I01 thus described herein as “signal amplification”. As shown in the right panel, completion of the branch migration results in an open hairpin region of the sensor, incorporation of the target nucleic acid into the sensor (e.g. into the double-stranded stem portion of the sensor) and closing of the channel.10010] FIGS. 2A-2G shows branch migration and signal amplification in Giant Unilamellar Vesicles (GUV) in the presence of a target nucleic acid. GUV were contacted with a sensor described herein and binding to a target and subsequent signal amplification was assessed. In this example, target conjugated to Cy-3 (green channel) was used as a positive control to verify binding of the target nucleic acid to the sensor. Effective delivery of two different fluorescent agents (e.g. one hydrophilic agent and one hydrophobic agent) was evaluated. FIGS. 2A-2D show results for the experiments conducted using the hydrophilic agent. As shown in FIG. 2A, Cy-3 (green) signal was observed indicating successful binding of the target to the sensor. FIG. 2B shows effective delivery of the hydrophilic fluorescent agent ATTO488 (blue) to cells expressing the sensor. FIG. 2C shows bright field images that verify the structure of the GUV. FIG. 2D shows an overlay of the Cy3 signal (showing target binding to the sensor) and the ATTO488 signal (showing delivery of the fluorescent agent to the cells). As shown in FIG. 2D, numerous cells were observed with a Cy3 signal (green channel) on the cell membrane and an intracellular ATTO488 signal (blue channel). These results verify that binding of the target to the sensor results in branch migration and opening of the nanopore channel, such that the nanopore channel opens and extracellular ATTO488 (blue channel) is able to pass through the open nanopore channel and into the cell. Numerous blue fluorophores are able to enter the cell, leading to GUVs filled with fluorophores. FIG. 2E-2G show results for the experiments conducted using the hydrophobic agent. As shown in FIG. 2E, Cy-3 (green) signal was observed indicating successful binding of the target to the sensor. FIG. 2F shows effective delivery of the hydrophobic fluorescent agent Cy-5 (red channel) to cells expressing the sensor. FIG. 2G shows bright field images that verify the structure of the GUV. These results confirm that target-binding induced branch migration and permitted many red fluorophores into the cell, leading to GUV filled with fluorophores such as the cells highlighted with boxes. These experiments establish that binding of the target nucleic acid to the sensor herein opens the nanopore channel and permits passage of hydrophilic and hydrophobic moieties into the cell, enabling fluorescence-based detection of the target. FIG. 2H shows results of a negative control experiment conducted using GUV containing the target but lacking the sensor. FIG. 21 shows results of a negative control experiment conducted using GUV containing the sensor but lacking the target. As shown in FIG. 2H and FIG. 21, no binding of the target to the sensorM25-099Lf'-PRl-aSKYSG-43816.I01 occurred, as evidenced by a lack of Cy3 signal. As such, the nanopore channel did not open and no movement of fluorescent molecules into the cells occurred, as evidenced by the lack of ATTO488 signal within the cell.
[0011] FIGS. 3A-3F show delivery of fluorescent actin stain (e.g. Alexa 488-labeled actin stain) via open nanopore channels in HEK293 cells. HEK293 cells were contacted with a sensor described herein and binding to the target and signal amplification were assessed. Microscopy images demonstrating the successful delivery of Alexa 488-labeled actin stain through open nanopore channels are shown in FIGS. 3A-3D. FIG. 3A shows a bright field image showing the overall structure of the HEK293 cells. In this example, the target conjugated to Cy-3 (green channel) was used as a positive control to verify binding of the target nucleic acid to the sensor. FIG. 3B shows the Cy3-target image that confirms successful binding of the target to the nanopore sensor. FIG. 3C shows detection of intracellular Alexa488-labeled actin stain. FIG. 3D shows an overlay of the Cy3 signal (indicative of target binding to the sensor) and the Alexa-488 signal (indicative of delivery of the fluorescent agent into the cell). As shown in FIG. 3D, numerous cells were observed with a Cy3 signal (green channel) on the cell membrane and an intracellular Alexa-488 signal (blue channel). These results verify that binding of the target to the sensor results in branch migration and opening of the nanopore channel, such that Alexa 488-labeled actin is able to pass through the open nanopore channel and into the cell. FIG. 3E shows a line profile of actin filaments. FIG. 3F shows results of the negative control experiment demonstrating the absence of stain delivery without opening of the nanopores. Three microscopy images show no delivery of Alexa 488- labeled actin stain in the absence of open nanopore channels (e.g. in cells lacking the sensor, or in cells lacking the target). The left image shows a bright field image showing the overall structure of HEK293 cells. The middle image shows the Cy3-target image showing the absence of the target molecule binding to the sensor. The right image shows the Alexa 488- labeled actin stain image demonstrating the absence of actin staining within the vesicle, confirming the necessity of open nanopores for successful delivery.
[0012] FIG. 4 shows results from flow cytometry experiments verifying nanopore-mediated delivery of Alexa-488 labeled actin into cells. Alexa-488 was only observed in cells containing the sensor and the target (shown in the top graph, labeled “nanopore”). With only Alexa-488 (e.g. no sensor and no target), no sensor, or no target, no Alexa-488 signal was observed.M25-099Lf'-PRl-aSKYSG-43816.I01DETAILED DESCRIPTION
[0013] The present disclosure provides compositions and methods related to nucleic acid nanopore sensors. In particular, the present disclosure provides nucleic acid sensors that function as nanopores responsive to specific target nucleic acids through a complementary toehold sequence. Binding of the target nucleic acid to the toehold sequence triggers a branch migration process that leads to an increase in the size of the nanopore channel in a cell membrane, allowing for the entry or exit of various molecules. These novel nucleic acid nanopore sensors enable lysis-free sensing, which maintains cell integrity and allows for realtime monitoring of target nucleic acids.
[0014] Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting.Definitions|0015] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.10016] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of” and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.
[0017] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6- 9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
[0018] The term “single-stranded” oligonucleotides generally refers to those oligonucleotides that contain a single covalently linked series of nucleotide residues.M25-099Lf'-PRl-aSKYSG-43816.I01
[0019] “Complementary” refers to the characteristic of two or more structural elements (e.g., peptide, polypeptide, nucleic acid, small molecule, etc.) of being able to hybridize, dimerize, or otherwise form a complex with each other. For example, a “complementary peptide and polypeptide” are capable of coming together to form a complex. Complementary elements may require assistance to form a complex (e.g., from interaction elements), for example, to place the elements in the proper conformation for complementarity, to co-localize complementary elements, to lower interaction energy for complementation, etc.
[0020] When used in reference to polynucleotides (e.g., a sequence of nucleotides such as all or a portion of a nucleic acid molecule or a target nucleic acid), the terms “complementary” or “complementarity” are used in reference to polynucleotides related by the base-pairing rules. For example, the sequence “5’-A-G-T-3’“ is complementary to the sequence “3’-T-C-A-5’.” Complementarity may be “partial,” in which only some of the nucleic acids’ bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids. Either term may also be used in reference to individual nucleotides, especially within the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be noted for its complementarity, or lack thereof, to a nucleotide within another nucleic acid strand, in contrast or comparison to the complementarity between the rest of the oligonucleotide and the nucleic acid strand.
[0021] In some contexts, the term “complementarity” and related terms (e.g., “complementary,” “complement”) refers to the nucleotides of a nucleic acid sequence that can bind to another nucleic acid sequence through hydrogen bonds, e.g., nucleotides that are capable of base pairing, e.g., by Watson-Crick base pairing or other base pairing. As an example, nucleotides that can form base pairs, e.g., that are complementary to one another, include the pairs: cytosine and guanine, thymine and adenine, and adenine and uracil. The percentage complementarity need not be calculated over the entire length of a nucleic acid sequence. The percentage of complementarity may be limited to a specific region of which the nucleic acid sequences that are base-paired, e.g., starting from a first base-paired nucleotide and ending at a last base-paired nucleotide. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5’ end of one sequence is paired with the 3’ end of the other, is in “antiparallel association.” Certain bases not commonly found in natural nucleic acids may be included inM25-099Lf'-PRl-aSKYSG-43816.I01 the nucleic acids of the present disclosure and include, for example, inosine and 7- deazaguanine. Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs.
[0022] Thus, in some embodiments, “complementary” refers to a first sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the complement of a second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more nucleobases, or that the two sequences hybridize under stringent hybridization conditions. “Fully complementary” means each nucleobase of a first nucleic acid is capable of pairing with each nucleobase at a corresponding position in a second nucleic acid. For example, in certain embodiments, an oligonucleotide wherein each nucleobase has complementarity to a nucleic acid has a nucleobase sequence that is identical to the complement of the nucleic acid over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more nucleobases.
[0023] The term “domain of complementarity” as used herein refers to a region of one structural element (e.g., nucleic acid molecule) that is complementary relative to a specified other structural element (e.g., target nucleic acid).
[0024] As used herein, a “double-stranded nucleic acid” may be a portion of a nucleic acid, a region of a longer nucleic acid, or an entire nucleic acid. A “double-stranded nucleic acid” may be, e.g., without limitation, a double- stranded DNA, a double-stranded RNA, a doublestranded DNA / RNA hybrid, etc. A single-stranded nucleic acid having secondary structure (e.g., base-paired secondary structure) and / or higher order structure comprises a “double- stranded nucleic acid”. For example, triplex structures are considered to be “double-stranded.” In some embodiments, any base-paired nucleic acid is a “double- stranded nucleic acid.”
[0025] As used herein, the term “nucleic acid molecule” refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA. The term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl) uracil, 5-fluorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1 -methyladenine, 1 -methylpseudouracil, 1-methylguanine,M25-099Lf'-PRl-aSKYSG-43816.I011 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5- methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine,5 ’ -methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5 -oxy acetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5 -methyluracil, N- uracil-5 -oxy acetic acid methylester, uracil-5 -oxyacetic acid, pseudouracil, queosine, 2- thiocytosine, and 2,6-diaminopurine.
[0026] As used herein, the terms “nucleotide sequence identity” or “nucleic acid sequence identity” refers to the presence of identical nucleotides at corresponding positions of two polynucleotides. Polynucleotides have “identical” sequences if the sequence of nucleotides in the two polynucleotides is the same when aligned for maximum correspondence (e.g., in a comparison window). Sequence comparison between two or more polynucleotides is generally performed by comparing portions of the two sequences over a comparison window to identify and compare local regions of sequence similarity. The comparison window is generally from about 20 to 200 contiguous nucleotides. The “percentage of sequence identity” for polynucleotides, such as about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99 or 100 percent sequence identity, can be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can include additions or deletions (i.e., gaps) as compared to the reference sequence for optimal alignment of the two sequences. In some embodiments, the percentage is calculated by: (a) determining the number of positions at which the identical nucleic acid base occurs in both sequences; (b) dividing the number of matched positions by the total number of positions in the window of comparison; and (c) multiplying the result by 100. Optimal alignment of sequences for comparison can also be conducted by computerized implementations of known algorithms, or by visual inspection. Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST) and ClustalW / ClustalW2 / Clustal Omega programs available on the Internet (e.g., the website of the EMBL-EBI). Other suitable programs include, but are not limited to, GAP, BestFit, Plot Similarity, and FASTA, which are part of the Accelrys GCG Package available from Accelrys, Inc. of San Diego, Calif., United States of America. See also Smith & Waterman, 1981; Needleman & Wunsch, 1970; Pearson & Lipman, 1988; Ausubel et al., 1988; and Sambrook6 Russell, 2001.M25-099Lf'-PRl-aSKYSG-43816.I01
[0027] The term “Holliday junction” refers to a four- way junction of nucleic acid strands.
[0028] As used herein, “toehold-mediated strand displacement (TMSD)” refers to a process in which a DNA strand in a DNA helix structure called the protector strand can be displaced and replaced by an invader strand that is complementary to the other strand in the original helix structure. The other strand in the original helix structure is called the original strand, which has an overhang called a “toehold” that assists the invading strand in dislodging and replacing the protector strand. Yurke et al introduced the concept of TMSD to the field of DNA nanotechnology where they constructed a nanomolecular machine powered by DNA (Yurke et al, 2000). The TMSD process has many applications such as DNA nanotechnology, DNA molecular machines, DNA computing, DNA sensing, and programmable DNA nanostructures, among others.
[0029] The term “toehold domain” as used herein refers to a region of a nucleic acid molecule that can function as a toehold in a TMSD process. In some embodiments, the toehold domain is complementary relative to at least a portion of a specified other nucleic acid molecule (e.g., a target nucleic acid).
[0030] The term “branch migration” refers to a process by which base pairs on homologous nucleic acids are consecutively exchanged at a Holliday junction, moving the junction along the nucleic acid sequences. In the sensors and methods herein, branch migration is induced by binding of a target nucleic acid to the toehold domain, and is thus an exemplary toehold- mediated strand displacement process.Nucleic Acid Nanopore Sensors, Systems, and Methods
[0031] The present disclosure provides compositions, systems, and methods related to nucleic acid sensors and uses thereof for detection of extracellular or intracellular nucleic acid targets. In particular, the present disclosure provides nucleic acid sensors that, when inserted into a cell membrane, function as nanopores responsive to specific target nucleic acids. The nucleic acid sensors herein are thus referred to as “nucleic acid nanopore sensors”.
[0032] In some aspects, provided herein are sensors comprising a hairpin region, a doublestranded stem region adjacent to the hairpin region, a toehold domain adjacent to the double- stranded stem region, and two or more amphipathic molecules coupled to the double-stranded stem region. In some aspects, provided herein are systems comprising a sensor described herein and a cell. In some embodiments, the sensor is inserted into the cell membrane. In some embodiments, the amphipathic molecules are positioned in the double-stranded stem region to facilitate insertion of the sensor into a cell membrane, such that the hairpin region is positionedM25-099Lf'-PRl-aSKYSG-43816.I01 either intracellularly or extracellularly with respect to the cell membrane, and the toehold domain is positioned in the opposite location (e.g. when the hairpin is positioned intracellularly, the toehold domain is positioned extracellularly, or when the hairpin region is positioned extracellularly, the toehold domain is positioned intracellularly). Insertion of the sensor into a cell membrane creates a nanopore channel between the sensor and a moiety in the cell membrane. For example, in some embodiments insertion of the sensor into the cell membrane creates a nanopore channel between the sensor (e.g. the double-stranded stem portion of the sensor) and a phospholipid of the cell membrane. In some embodiments, the nanopore channel is closed in the absence of a target nucleic acid. The term “closed” indicates that the passage of molecules through the channel is substantially impeded. In some embodiments, a “closed” channel prevents passage of fluorescent molecules into the cell, resulting in a lack of detectable signal from the fluorescent molecule in the cell. The binding of a target nucleic acid to the sensor (e.g. to the toehold domain of the sensor) results in a branch migration process in the sensor that leads to an increase in the size of the nanopore channel, allowing for the entry or exit of various molecules, such as fluorescent molecules, into the cell. An increase in the size of the nanopore channel is also referred to as “opening” the channel. An “open” channel refers to a channel through which molecules can pass and enter the cell. In some embodiments, an open channel permits passage of fluorescent molecules through the channel and into the cell. In some embodiments, multiple fluorescent molecules enter a single cell, resulting in signal amplification of the fluorescent signal within the cell. These novel nucleic acid nanopore sensors enable lysis-free sensing, which maintains cell integrity and allows for real-time monitoring of target nucleic acids. In some aspects, provided herein are methods of detecting a target using the sensors or systems herein, wherein detection of an intracellular fluorophore signal is indicative of the presence of the target nucleic acid.
[0033] In some embodiments, the sensor comprises a hairpin region. In some embodiments, the hairpin region is positioned extracellularly with respect to the cell membrane. In some embodiments, the hairpin region is positioned extracellularly and the toehold domain is positioned intracellularly. In some embodiments, the hairpin region is positioned intracellularly with respect to the cell membrane. In some embodiments, the hairpin region is positioned intracellularly and the domain is positioned extracellularly. The hairpin region may comprise any suitable number of nucleotides. In some embodiments, the hairpin region comprises 3 to 50 nucleotides. For example, in some embodiments the hairpin region comprises 3 to 50 nucleotides, 3 to 45 nucleotides, 3 to 40 nucleotides, 3 to 35 nucleotides, 3M25-099Lf'-PRl-aSKYSG-43816.I01 to 30 nucleotides, 3 to 25 nucleotides, 4 to 20 nucleotides, or 5 to 15 nucleotides. In some embodiments, the hairpin region includes 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides.
[0034] In some embodiments, the sensor comprises double-stranded stem region adjacent to the hairpin region. In some embodiments, the double-stranded stem region comprises at least two amphiphilic moieties. In some embodiments, the amphiphilic moieties comprise cholesterol. In some embodiments, the amphiphilic moieties are positioned on opposite strands of the double-stranded stem region to facilitate insertion into the cell membrane. In some embodiments, at least a portion of the double- stranded stem region is inserted into the cell membrane, e.g. via the amphiphilic moieties. In some embodiments, the double-stranded stem region comprises a Holliday junction. In some embodiments, the Holliday junction of the double-stranded stem region is positioned within the cell membrane, e.g. is neither extracellular nor intracellular with respect to the cell membrane. The double-stranded stem region may comprise any suitable number of nucleotides. In some embodiments, the double-stranded stem region comprises 10 to 100 nucleotides. For example, in some embodiments the doublestranded stem region comprises 10 to 100 nucleotides, 10 to 90 nucleotides, 10 to 80 nucleotides, 10 to 70 nucleotides, 10 to 60 nucleotides, 15 to 50 nucleotides, 20 to 40 nucleotides, or 25 to 35 nucleotides. In some embodiments, the double-stranded stem region comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides.
[0035] In some embodiments, the sensor comprises a toehold domain. In some embodiments, the toehold domain is positioned intracellularly with respect to the cell membrane. In some embodiments, the toehold domain is positioned extracellularly with respect to the cell membrane. In some embodiments, the toehold domain is complementary to a target nucleic acid. The target nucleic acid may be a target extracellular nucleic acid or a target intracellular nucleic acid. In some embodiments, the toehold domain is positioned extracellularly for methods of detecting an extracellular target nucleic acid. In some embodiments, the toehold domain is positioned intracellularly for methods of detecting an intracellular nucleic acid.
[0036] The toehold domain may comprise any suitable number of nucleic acids. In some embodiments, the toehold domain comprises 3 to 50 nucleic acids. In some embodiments, the length of the toehold domain is similar to the length of the hairpin. For example, in some embodiments the length of the toehold domain differs from the length of the hairpin by at most 10 nucleotides. In some embodiments, the toehold domain comprises 3 to 50 nucleotides, 3 to 45 nucleotides, 3 to 40 nucleotides, 3 to 35 nucleotides, 3 to 30 nucleotides, 3 to 25 nucleotides,M25-099Lf'-PRl-aSKYSG-43816.I014 to 20 nucleotides, or 5 to 15 nucleotides. In some embodiments, the toehold domain includes 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides.
[0037] In some embodiments, binding of a target nucleic acid strand to the toehold domain induces a branch migration process that opens the hairpin structure and increases the size of (e.g. opens) the nanopore channel. This is shown schematically in FIG. 1. In some embodiments, the toehold domain is complementary to a portion of the target nucleic acid and at least a portion of one of the strands in the double- stranded stem portion is complementary to a different portion of the target nucleic acid, such that upon binding of the target nucleic acid to the toehold domain, the ensuing branch migration process results in incorporation of the target nucleic acid into the double-stranded stem structure, displacement of the opposing strand, and opening of the hairpin. This branch migration transiently increases the size of the nanopore channel, thereby opening the channel. In some embodiments, molecules such as fluorescent molecules pass through the open nanopore channel and enter the cell. In some embodiments, multiple fluorescent molecules pass through the open nanopore channel and enter a single cell, a process referred to as “signal amplification”. In some embodiments, the channel rapidly constricts again after branch migration is complete, effectively closing the nanopore channel. In some embodiments, the sensor is removed from the cell after detecting a fluorescent signal (e.g. removed post-sensing), for example by introducing a moiety that binds to the amphiphilic moieties and displaces the sensor from the cell membrane. For example, the sensor may be removed from the cell by addition of cyclodextrin, which binds to cholesterol.
[0038] In accordance with these embodiments, the present disclosure provides a novel nucleic acid nanopore sensor capable of selective opening in response to binding target nucleic acids, such as mRNA or miRNA. The sensor can be used to amplify signals by allowing numerous extracellular fluorescent molecules to enter the cell after binding to the target, thus enabling sensitive detection of specific nucleic acid sequences without disrupting the cell. The reversible nature of this system provides further control, making it an ideal platform for molecular sensing and signal amplification.
[0039] The nucleic acid sensors of the present disclosure can be any combination of natural and modified nucleic acid bases and phosphorothioate backbone (e.g., DNA, LNA, PNA, RNA, and the like). In some embodiments, the nucleic acid sensor is a DNA molecule, a locked nucleic acid (LNA) molecule, or combinations thereof. In some embodiments, the nucleic acid sensor is a peptide nucleic acid (PNA) molecule or a combination of PNA and DNA molecule. In some embodiments, the nucleic acid sensor is an RNA molecule.M25-099Lf'-PRl-aSKYSG-43816.I01
[0040] In some embodiments, the target nucleic acid is a DNA molecule or an RNA molecule. In some embodiments, the target nucleic acid is an mRNA, miRNA, or IncRNA molecule.
[0041] Embodiments of the present disclosure also include a system for sensing a target nucleic acid comprising a sensor as described herein and a cell. In some embodiments, the sensor is inserted into the cell membrane. In some embodiments, the system further comprises at least one of: (i) a solution comprising one or more fluorophores; (ii) a solution comprising one or more agents configured to bind amphipathic molecules; and (iii) a control nucleic acid. In some embodiments, the amphipathic molecule is cholesterol, and the agent that binds amphipathic molecules is cyclodextrin. In some embodiments, the control nucleic acid is complementary to the toehold domain of the nucleic acid sensor.
[0042] Embodiments of the present disclosure also include a kit comprising any of the sensors described herein, and instructions for detecting a target nucleic acid. In some embodiments, the kit further comprises at least one reporter nucleic acid, wherein the at least one reporter nucleic acid comprises a sequence that is complementary to at least a portion of a nucleic acid molecule of the sensor. In some embodiments, the kit further comprises a neutralizing nucleic acid, wherein the neutralizing nucleic acid comprises a sequence that is complementary to at least a portion of the target nucleic acid.
[0043] Embodiments of the present disclosure also include a composition comprising any of the nucleic acid sensors described herein.
[0044] In some aspects, provided herein are methods of detecting a target nucleic acid using any of the sensors, systems, compositions, or kits herein. In some embodiments, the target nucleic acid is located within a membranous vesicle or cell. In some embodiments, the method comprises detecting the target nucleic acid without lysis of the membranous vesicle or cell. In some embodiments, the target nucleic acid is DNA or RNA.|0045] In some embodiments, a method of detecting a target nucleic acid comprises use of a neutralizing nucleic acid that is applied externally to the vesicle or cell. In some embodiments, the neutralizing nucleic acid comprises a sequence that is complementary to at least a portion of the target nucleic acid.
[0046] In some aspects, provided herein are methods of detecting a target nucleic acid comprising providing a system containing a sensor described herein, a cell, and a potential target nucleic acid, contacting the system with a fluorophore, and detecting an intracellular signal from the fluorophore. Detection of an intracellular signal is indicative of the presence of the target nucleic acid in the system. As described above, the sensor comprises a hairpinM25-099Lf'-PRl-aSKYSG-43816.I01 region positioned externally or internally with respect to a cell membrane of the cell, a doublestranded stem region adjacent to the hairpin region and comprising a Holliday junction, a toehold domain adjacent to the double-stranded stem region, and two or more amphipathic molecules coupled to the double-stranded stem region that facilitate insertion of the sensor within the cell membrane, thereby forming a nanopore channel between the sensor and a moiety of the cell membrane. In some embodiments, the toehold domain comprises a sequence that is complementary to the target nucleic acid.
[0047] In some embodiments, the nanopore channel is closed in the absence of the target nucleic acid. In some embodiments, binding of the target nucleic acid to the toehold domain of the sensor induces branch migration at the Holliday junction, thereby opening the hairpin region and increasing a size of the nanopore channel such that the fluorophore passes through the nanopore channel and into the cell. The fluorophores can then be detected by any suitable means. Detection of intracellular fluorophores indicates successful opening of the nanopore channel mediated by binding of the target nucleic acid to the toehold domain on of the sensor, and is thus indicative of the presence of the target nucleic acid in the system. In some embodiments, the toehold domain is positioned intracellularly with respect to the cell membrane, the hairpin region is positioned externally with respect to the cell membrane, and the target nucleic acid is an intracellular target. In some embodiments, the toehold domain is positioned extracellularly with respect to the cell membrane, the hairpin region is positioned intracellularly with respect to the cell membrane, and the target nucleic acid is an extracellular target.Sequences
[0048] The nucleic acid nanopore sensors of the present disclosure can be comprised of different nucleic acid sequences, as would be recognized by one of ordinary skill in the art. Numerous sensors containing a variety of different sequences (e.g. for the hairpin region, the double-stranded stem portion, and the toehold domain) are functional when complementarity is preserved, a Holliday junction is present, and upon binding of the target nucleic acid to the toehold domain branch migration is induced (see, e.g., FIG. 1). A sufficient degree of complementarity between base-pairs in the two complementary nucleic acid strands of the double-stranded stem domain is needed to initially form the desired double-stranded stem portion of the sensor with the Holliday junction. A sufficient degree of complementarity between the toehold domain and a portion of the target sequence is needed for sensor functionality. Moreover, complementarity between a different portion of the target sequenceM25-099Lf'-PRl-aSKYSG-43816.I01 and one strand of the double-stranded stem region facilitates branch migration at the Holliday junction and resulting incorporation of the target nucleic acid into the sensor, opening of the hairpin region, and opening of the nanopore channel. Exemplary, non-limiting sequences are provided below.|0049] HS31-2C sequence: CGG AGG TTG AGA GTG GAT GGA GT / iCholTEG / G AGT T / iCholTEG / GA ATG AGT GGA TGA ATC TAA CCG CAT CCA CTC ATT CAA CTC ACT CCA TCC ACT C (SEQ ID NO: 1).
[0050] Cy3 target:CATCCACTCATTCAACTCACTCCATCCACTCTCAACCTCCG / 3Cy3Sp / (SEQ ID NO: 2).
[0051] It is understood that the foregoing detailed description and accompanying examples are merely illustrative and are not to be taken as limitations upon the scope of the disclosure, which is defined solely by the appended claims and their equivalents.
[0052] Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications, including without limitation those relating to the chemical structures, substituents, derivatives, intermediates, syntheses, compositions, formulations, or methods of use of the disclosure, may be made without departing from the spirit and scope thereof.
[0053] Embodiments
[0054] The disclosure is further described by the following exemplary embodiments:
[0055] Embodiment 1: A nucleic acid nanopore sensor comprising: a) a hairpin region; b) a double-stranded stem region adjacent to the hairpin region, wherein the doublestranded stem region comprises a Holliday junction; c) a toehold domain adjacent to the double-stranded stem region; and d) two or more amphipathic molecules coupled to the double- stranded stem region.
[0056] Embodiment 2: The sensor of embodiment 1, wherein the double- stranded stem region comprises between 10 and 50 base pairs.
[0057] Embodiment 3: The sensor of embodiment 1 or embodiment 2, wherein the toehold domain comprises between 5 and 15 base pairs.
[0058] Embodiment 4: The sensor of any one of embodiments 1-3, wherein the toehold domain comprises a sequence that is complementary to a target nucleic acid.|0059] Embodiment 5: The sensor of embodiment 4, wherein the target nucleic acid is an extracellular target nucleic acid or an intracellular nucleic acid.M25-099Lf'-PRl-aSKYSG-43816.I01
[0060] Embodiment 6: The sensor of any one of embodiments 1-5, wherein the two or more amphipathic molecules comprise cholesterol.
[0061] Embodiment 7: A system comprising the sensor of any one of embodiments 1-6 and a cell.10062] Embodiment 8: The system of embodiment 7, wherein the two or more amphipathic molecules coupled to the double-stranded stem region facilitate insertion of the sensor within the cell membrane, thereby forming a nanopore channel between the sensor and a moiety of the cell membrane.
[0063] Embodiment 9: The system of embodiment 8, wherein the hairpin region of the sensor is positioned externally with respect to the cell membrane and the toehold domain is positioned internally with respect to the cell membrane.
[0064] Embodiment 10: The system of embodiment 8, wherein the hairpin region of the sensor is positioned internally with respect to the cell membrane and the toehold domain is positioned externally with respect to the cell membrane.
[0065] Embodiment 11 : The system of any one of embodiments 8-10, wherein the nanopore channel is closed in the absence of a target nucleic acid.
[0066] Embodiment 12: The system of any one of embodiments 8-11, wherein the nanopore channel opens in the presence of a target nucleic acid.
[0067] Embodiment 13: The system of any one of embodiments 7-12, further comprising at least one of:(i) a solution comprising one or more fluorophores ;(ii) a solution comprising one or more agents configured to bind amphipathic molecules; and(hi) a control nucleic acid.
[0068] Embodiment 14: The system of embodiment 13, wherein the amphipathic molecule is cholesterol, and wherein the agent that binds amphipathic molecules is cyclodextrin.
[0069] Embodiment 15: The system of embodiment 13 or embodiment 14, wherein the control nucleic acid is complementary to the toehold domain of the sensor.
[0070] Embodiment 16: A method for detecting a target nucleic acid using the sensor of any one of embodiments 1-6 or the system or any one of embodiments 7-15.
[0071] Embodiment 17: A method of detecting a target nucleic acid, comprising: a) providing a system comprising a nucleic acid nanopore sensor, a cell, and a potential target nucleic acid, wherein the nucleic acid nanopore sensor comprises:M25-099Lf'-PRl-aSKYSG-43816.I01 i) a hairpin region positioned externally or internally with respect to a cell membrane of the cell; ii) a double- stranded stem region adjacent to the hairpin region, wherein the double-stranded stem region comprises a Holliday junction; iii) a toehold domain adjacent to the double-stranded stem region, wherein the toehold domain comprises a sequence that is complementary to the target nucleic acid; and iv) two or more amphipathic molecules coupled to the double-stranded stem region that facilitate insertion of the sensor within the cell membrane, thereby forming a nanopore channel between the sensor and a moiety of the cell membrane; b) contacting the system with a fluorophore; and c) detecting an intracellular signal from the fluorophore, wherein detection of an intracellular signal is indicative of the presence of the target nucleic acid in the system.
[0072] Embodiment 18: The method of embodiment 18, wherein the nanopore channel is closed in the absence of the target nucleic acid.
[0073] Embodiment 19: The method of embodiment 18 or embodiment 19, wherein the target nucleic acid, if present in the system, binds to the toehold domain of the sensor and induces branch migration at the Holliday junction, thereby opening the hairpin region and increasing a size of the nanopore channel such that the fluorophore passes through the nanopore channel and into the cell.
[0074] Embodiment 20: The method of any one of embodiment 17-19, wherein the toehold domain is positioned intracellularly with respect to the cell membrane, the hairpin region is positioned externally with respect to the cell membrane, and the target nucleic acid is an intracellular target, or wherein the toehold domain is positioned extracellularly with respect to the cell membrane, the hairpin region is positioned intracellularly with respect to the cell membrane, and the target nucleic acid is an extracellular target.
Claims
M25-099Lr'-PRl-aSKYSG-43816.I01CLAIMSWhat is claimed is:
1. A nucleic acid nanopore sensor comprising: a) a hairpin region; b) a double-stranded stem region adjacent to the hairpin region, wherein the doublestranded stem region comprises a Holliday junction; c) a toehold domain adjacent to the double-stranded stem region; and d) two or more amphipathic molecules coupled to the double-stranded stem region.
2. The sensor of claim 1, wherein the double- stranded stem region comprises between 10 and 50 base pairs.
3. The sensor of claim 1, wherein the toehold domain comprises between 5 and 15 base pairs.
4. The sensor of claim 1 , wherein the toehold domain comprises a sequence that is complementary to a target nucleic acid.
5. The sensor of claim 4, wherein the target nucleic acid is an extracellular target nucleic acid or an intracellular nucleic acid.
6. The sensor of claim 1 , wherein the two or more amphipathic molecules comprise cholesterol.
7. A system comprising the sensor of any one of claims 1-6 and a cell.
8. The system of claim 7, wherein the two or more amphipathic molecules coupled to the double-stranded stem region facilitate insertion of the sensor within the cell membrane, thereby forming a nanopore channel between the sensor and a moiety of the cell membrane.
9. The system of claim 8, wherein the hairpin region of the sensor is positioned externally with respect to the cell membrane and the toehold domain is positioned internally withM25-099Lr'-PRl-aSKYSG-43816.I01 respect to the cell membrane.
10. The system of claim 8, wherein the hairpin region of the sensor is positioned internally with respect to the cell membrane and the toehold domain is positioned externally with respect to the cell membrane.
11. The system of claim 8, wherein the nanopore channel is closed in the absence of a target nucleic acid.
12. The system of claim 8, wherein the nanopore channel opens in the presence of a target nucleic acid.
13. The system of claim 7, further comprising at least one of:(i) a solution comprising one or more fluorophores;(ii) a solution comprising one or more agents configured to bind amphipathic molecules; and(iii) a control nucleic acid.
14. The system of claim 13, wherein the amphipathic molecule is cholesterol, and wherein the agent that binds amphipathic molecules is cyclodextrin.
15. The system of claim 13, wherein the control nucleic acid is complementary to the toehold domain of the sensor.
16. A method for detecting a target nucleic acid using the sensor of any one of claims 1-6 or the system or any one of claims 7-1 .
17. A method of detecting a target nucleic acid, comprising: a) providing a system comprising a nucleic acid nanopore sensor, a cell, and a potential target nucleic acid, wherein the nucleic acid nanopore sensor comprises: i) a hairpin region positioned externally or internally with respect to a cell membrane of the cell; ii) a double-stranded stem region adjacent to the hairpin region, wherein the double-stranded stem region comprises a Holliday junction;M25-099Lr'-PRl-aSKYSG-43816.I01 iii) a toehold domain adjacent to the double-stranded stem region, wherein the toehold domain comprises a sequence that is complementary to the target nucleic acid; and iv) two or more amphipathic molecules coupled to the double- stranded stem region that facilitate insertion of the sensor within the cell membrane, thereby forming a nanopore channel between the sensor and a moiety of the cell membrane; b) contacting the system with a fluorophore; and c) detecting an intracellular signal from the fluorophore, wherein detection of an intracellular signal is indicative of the presence of the target nucleic acid in the system.
18. The method of claim 18, wherein the nanopore channel is closed in the absence of the target nucleic acid.
19. The method of claim 18, wherein the target nucleic acid, if present in the system, binds to the toehold domain of the sensor and induces branch migration at the Holliday junction, thereby opening the hairpin region and increasing a size of the nanopore channel such that the fluorophore passes through the nanopore channel and into the cell.
20. The method of any one of claims 17-19, wherein the toehold domain is positioned intracellularly with respect to the cell membrane, the hairpin region is positioned externally with respect to the cell membrane, and the target nucleic acid is an intracellular target, or wherein the toehold domain is positioned extracellularly with respect to the cell membrane, the hairpin region is positioned intracellularly with respect to the cell membrane, and the target nucleic acid is an extracellular target.
Citation Information
Patent Citations
Transmembrane nanosensor arrays for rapid, ultra-sensitive and specific digital quantification of internal micro-RNA content of intact exosomes
US20230374607A1
Nucleic acid constructs and related methods for nanopore readout and scalable DNA circuit reporting
WO2021021592A1
Compositions and methods related to nucleic acid sensors
WO2023172911A2