Humanized animal model incorporating retinoschisis gene variant

A humanized animal model with a RS1 gene mutation replicates X-linked retinoschisis, enabling effective treatment evaluation and functional restoration of retinal detachment.

WO2026071470A1PCT designated stage Publication Date: 2026-04-02SEOUL NAT UNIV HOSPITAL +2
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/012144
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-30
Filing Date
2025-08-11
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Current treatments for X-linked retinoschisis, a genetic condition causing retinal detachment and visual impairment, are limited to preserving remaining vision and lack a specific cure, making it difficult to treat surgically or pharmacologically.

Method used

A humanized animal model is developed with a c.422G>A (p.R141H) mutation in the RS1 gene, mimicking the human condition, allowing for the evaluation of therapeutic agents and treatments through gene editing using AAV-based base editors.

Benefits of technology

The humanized animal model effectively replicates human retinal detachment and restores eye function, providing a preclinical model for testing therapies and predicting clinical outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025012144_02042026_PF_FP_ABST
    Figure KR2025012144_02042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a humanized animal model incorporating a retinoschisis gene variant found in human patients and, specifically, to a humanized animal model carrying a c.422G>A (p.R141H) variant identified in the RS1 gene of human patients with retinoschisis, a use thereof, and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Humanized animal model with applied retinal interlayer separation gene mutation

[0001] The present invention relates to a humanized animal model incorporating a gene mutation of retinal tectonics, and more specifically, to a humanized animal model having the c.422G>A (p.R141H) mutation found in the RS1 gene of human patients with retinal tectonics, and to the use thereof.

[0002] The present invention claims priority based on Korean Patent Application No. 10-2024-0132815 filed on September 30, 2024, and all contents disclosed in the specification and drawings of said application are incorporated by reference.

[0003] Retinoschisis is a condition that causes visual impairment due to the abnormal separation of the neurofibroma layer, one of the ten layers that make up the retina. While retinoschisis can occur due to aging, hereditary retinoschisis is induced by a genetic defect on the X sex chromosome and is therefore also referred to as X-linked retinoschisis or congenital retinoschisis. X-linked retinoschisis primarily affects male children, and vision decline progresses continuously during the first 10 to 20 years after birth. It is known that serious complications, such as retinal detachment and vitreous hemorrhage, occur in 5 to 12% of all patients. Since the detachment generally involves the inner layers of the retina, it is difficult to treat surgically, and there are no specific medications available for treatment. Consequently, current treatment for retinoschisis aims only to preserve remaining vision as much as possible, and there is currently no specific cure available.

[0004] Meanwhile, a humanized animal model refers not merely to the expression of human genes within the body, but to a model in which human-derived genetic factors are reconfigured within the animal model to exhibit human biological functions. Because these humanized animal models represent human biological functions, they offer significantly higher predictability of therapeutic responses compared to conventional animal models. Furthermore, research on this topic is currently being actively conducted because they can be applied at the preclinical stage to the development of therapies that were difficult to apply to existing models, such as personalized treatments and treatments for human-specific diseases, and because they can contribute to shortening the development cycle of new therapies by predicting more accurate clinical outcomes.

[0005] Accordingly, the inventors have completed the present invention as a result of diligent research to develop a humanized animal model of retinal interlayer separation that can be applied to the development of a therapeutic agent and / or treatment method for retinal interlayer separation for which no special treatment method exists.

[0006] The present invention was devised to solve the problems of the prior art as described above, and aims to provide a humanized animal model in which the 141st amino acid of the Retinoschisin (RS1) protein, or a corresponding amino acid, is knocked in with histidine (H), a method for manufacturing the same, and uses thereof.

[0007] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art to which the present invention belongs from the description below.

[0008] The present invention provides a humanized animal model in which the 141st amino acid of a retinoschisin (RS1) protein, or a corresponding amino acid, is knocked in with histidine (H). The RS1 protein may preferably be a mouse RS1 protein or a human RS1 protein (SEQ No. 12), and may be an RS1 protein possessed by other species, e.g., rats, hamsters, rabbits, horses, cattle, pigs, dogs, cats, monkeys, sheep, goats, etc. The term "corresponding amino acid" refers to an amino acid at a position corresponding to the 141st amino acid of the human RS1 protein when the amino acid sequence of the human RS1 protein and the amino acid sequence of the RS1 protein of another species are compared using any various algorithms in commercial computer programs such as BLASTP, Gap BLAST, and PSI-BLAST. More preferably, the humanized animal model means that the 141st amino acid of the RS1 protein is mutated to histidine, identical to the human interlayer separation gene mutation, and that the surrounding amino acid sequence and gene sequence are identical to the sequence derived from the human patient.

[0009] In one embodiment of the present invention, the animal model is preferably an animal model that reproduces a retinal separation disease, but is not limited thereto if it is a disease induced when the 141st amino acid of the RS1 protein is dissolved in histidine, that is, when a normal gene is substituted with histidine.

[0010] In another embodiment of the present invention, the 141st amino acid is preferably arginine (R) before dissolution, but is not limited to an amino acid at a position corresponding to the 141st amino acid of the RS1 protein.

[0011] In another embodiment of the present invention, the animal model is preferably one in which the 422nd nucleotide of the gene encoding the RS1 protein is mutated from G to A, and all or part of the adjacent 327 to 522nd base sequences, or the corresponding base sequences (e.g., 330 to 510th base sequences, 340 to 500th base sequences, 350 to 490th base sequences, 360 to 480th base sequences, 370 to 470th base sequences, 380 to 460th base sequences, or 390 to 450th base sequences, but is not limited thereto if it is a part including a mutation of the 422nd base sequence within the 327 to 522nd base sequences) is modified to be identical to a normal human base sequence, or the 141st amino acid of the RS1 protein, or the corresponding amino acid, may be substituted with histidine. If it is a variation, it is not limited to this.

[0012] In another embodiment of the present invention, the animal model is characterized by expressing an RS1 polypeptide containing an R141H substitution.

[0013] In another embodiment of the present invention, the animal model may be a hemizygote in the case of a male or a homozygote in the case of a female.

[0014] In another embodiment of the present invention, the animal model may be a mammal other than a human, such as a mouse, rat, hamster, rabbit, horse, cow, pig, dog, cat, monkey, sheep, chicken, frog, zebryfish, goat, etc., and more preferably a rodent such as a mouse, rat, or hamster, but is not limited thereto as long as it is an animal expressing an RS1 protein similar to the human RS1 protein.

[0015] In addition, the present invention provides a method for selecting a substance for the prevention or treatment of interlayer separation, comprising the step of administering a test substance to the humanized animal model. The selection method may further include the step of measuring the recovery of visual function in the animal model administered the test substance, and the step of selecting a test substance among the test substances in which visual function has recovered as a substance for the prevention or treatment of interlayer separation.

[0016] In one embodiment of the present invention, the test substance may be a gene therapy vector, a base editing vector, a nucleotide, DNA, RNA, an amino acid, an aptamer, a protein, a compound, a natural product, a natural extract, a cell, etc., but is not limited thereto.

[0017] Furthermore, the present invention provides a method for preparing a humanized animal model of retinal interlayer separation, comprising the step of introducing a guide RNA and donor DNA into a fertilized egg of a non-human animal, the guide RNA and donor DNA targeting the substitution of arginine (R), the 141st amino acid of the Retinoschisin (RS1) protein or its corresponding amino acid, with histidine (H). However, this is merely one example, and RS1, which is the cause of retinal interlayer separation in humans R141H A method for manufacturing an RS1 mutant animal model containing the mutation is not limited thereto.

[0018] In one embodiment of the present invention, the guide RNA may be a single guide RNA (sgRNA) or a double guide RNA (dgRNA), and preferably, may include a single guide RNA that recognizes or specifically binds to the target nucleotide sequence of SEQ ID NO. 1. Since the guide RNA can induce a gene mutation simply by recognizing the target nucleotide sequence of SEQ ID NO. 1, there are no limitations if it is constructed to recognize the target nucleotide sequence of SEQ ID NO. 1 or a variant thereof using a program known to those skilled in the art. The variant of the nucleotide sequence may include a nucleotide sequence having sequence homology of 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, and most preferably 98% or more with respect to the nucleotide sequence of SEQ ID NO. 1. In this specification, “% of sequence homology” is determined by comparing a comparison region with an optimally arranged sequence using any various algorithm in commercial computer programs such as BLASTN, BLASTP, Gap BLAST, and PSI-BLAST, where a portion of the nucleotide sequence or amino acid sequence in the comparison region may include additions or deletions (i.e., gaps) compared to a reference sequence (without additions or deletions) for the optimal arrangement of the sequence. However, it is not limited to a guide RNA that targets a substitution from G to A for the 422nd nucleotide of the gene encoding the RS1 protein.

[0019] In another embodiment of the present invention, the donor DNA may include the nucleotide sequence of SEQ ID NO. 4, preferably as donor DNA for mutating the 422nd nucleotide of the gene encoding the RS1 protein from G to A, and all or part of the 327th to 522nd base sequences adjacent to the 422nd nucleotide, or the corresponding base sequences, and variants thereof may be included within the scope of the present invention. Specifically, it may include a nucleotide sequence having sequence homology of 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, and most preferably 98% or more with the nucleotide sequence of SEQ ID NO. 4. However, the donor DNA is not limited to any sequence that has the same base sequence as humans, as long as the entire RS1 gene or a part thereof has a sequence that has the same base sequence as humans, serving the role of correcting the 422nd nucleotide of the gene encoding the RS1 protein and its adjacent sequences to have the same base sequence as humans.

[0020] The humanized animal model according to the present invention is RS1, which is the cause of interlayer separation in humans. R141H This invention was completed by confirming that humanized animal models can be constructed by creating animal models containing mutations, thereby producing disease phenotypes similar to humans—that is, anatomically and functionally similar phenotypes. Furthermore, it was confirmed that when point mutations in the humanized animal model of the present invention were replaced with normal genes using an AAV-based base editor, the retinal detachment was treated and eye function was restored. Through this, it is expected that the humanized animal model for retinal detachment of the present invention can be widely used as a preclinical animal model for conducting clinical trials targeting patients with retinal detachment, such as verifying the effects of gene and cell therapy, developing novel therapeutic agents, and evaluating toxicity.

[0021] FIG. 1 is a diagram briefly illustrating the process of producing a humanized retinal layer separation animal model according to one embodiment of the present invention.

[0022] FIG. 2 is a diagram showing histological images (top and middle) and OCT data (bottom) of a 6-week-old humanized retinal interlayer separation animal model prepared according to an embodiment of the present invention. The scale bar at the top is 500 μm, and the middle and bottom are 100 μm.

[0023] FIG. 3 is a diagram showing the results of electroretinogram (left and middle) and visual-motor response to rotational visual stimulation (right) of a 6-week-old humanized interlayer-separated retinal animal model produced according to an embodiment of the present invention. **** indicates that the P-value is less than 0.0001.

[0024] FIG. 4 is a diagram showing a group of candidates for sgRNA for gene editing according to one embodiment of the present invention.

[0025] FIG. 5 is a diagram showing two gene-editing AAV vectors according to one embodiment of the present invention. CbH represents a cleaved chimeric CMV / chicken-beta-actin hybrid promoter, NLS represents a nuclear localization signal, ITR represents an inverted terminal repeat, W3 represents a woodchuck hepatitis virus post-transcriptional regulatory element, bGH represents a bovine growth hormone polyA signal, and U6 represents a mouse U6 promoter.

[0026] FIG. 6 is a diagram briefly illustrating the screening experiment process for confirming gene editing efficiency according to one embodiment of the present invention.

[0027] Figure 7 is a figure showing the results of confirming the gene editing efficiency in vitro according to one embodiment of the present invention.

[0028] Figure 8 is a figure showing the results of confirming the gene editing efficiency in vivo according to one embodiment of the present invention.

[0029] FIG. 9 is a diagram showing the results of confirming the therapeutic effect through gene editing according to one embodiment of the present invention at the transcriptome level.

[0030] Figure 10 is a diagram showing the results of confirming the therapeutic effect through gene editing according to one embodiment of the present invention via imaging of retinal tissue. The scale bar of the OCT data and H&E image is 50 μm, and the scale bar of the fluorescence immunostaining image is 25 μm.

[0031] FIG. 11 is a diagram showing the results of confirming the therapeutic effect through gene editing according to one embodiment of the present invention using electroretinograms (left and middle) and visual motor responses to rotational visual stimuli (right). * indicates a P-value less than 0.05, ** indicates a P-value less than 0.01, *** indicates a P-value less than 0.001, and **** indicates a P-value less than 0.0001.

[0032] It was confirmed that the humanized animal model of the present invention exhibits a disease phenotype similar to that of humans by applying a direct gene mutation that induces interlayer separation in humans—namely, the Rs1c.422G>A mutation—and modifying its adjacent nucleotide sequence to be identical to that of humans. Furthermore, by verifying the therapeutic effect using an AAV-based base editor with the constructed human animal model, it was confirmed that the interlayer separation was treated and eye function was restored. This demonstrates that the humanized animal model of the present invention can be effectively utilized in various fields, including methods for treating interlayer separation, novel therapeutic agents, and toxicity evaluations.

[0033]

[0034] In this specification, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.

[0035] In this specification, terms of degree such as “approximately,” “substantially,” etc., are used to mean at or near the value when inherent manufacturing and material tolerances are presented in the sense mentioned, and are used to prevent unscrupulous infringers from unfairly exploiting the disclosure regarding precise or absolute values ​​mentioned to aid in understanding the invention. Furthermore, in this specification, “a step of” or “a step of” does not mean “a step for”.

[0036] In this specification, the term “combination thereof” included in a Markush-type expression means one or more mixtures or combinations selected from a group consisting of components described in the Markush-type expression, and means including one or more selected from the group consisting of said components.

[0037] In this specification, the description "A and / or B" means "A or B, or A and B".

[0038] In this specification, the term "active ingredient" refers to any substance used interchangeably with active drugs, active ingredients, active formulations, drugs, and therapeutic formulations, and used to prevent, alleviate, improve, or treat a target disease.

[0039] In this specification, "Retinoschisin (RS1) protein" refers to a protein encoded by a small gene of about 32.4 kb in length containing 6 exons and 5 introns located on chromosome Xp22.2, which translates into 224 precursor polypeptides. The RS1 protein is expressed as a monomer containing four distinct domains: an N-terminal signal sequence (23 amino acids) directing the translocation of the protein out of the cell; an intrinsic Rs1 domain (a highly conserved sequence motif of 39 amino acids in length); a discoydin domain (157 amino acids) contributing to the adhesion function of RS1 to preserve retinal cell structure and establish proper synaptic connectivity; and a C-terminal segment (5 amino acids). The RS1 protein is assembled in the endoplasmic reticulum and is primarily expressed within the retina, most notably in the rod and cone segments, bipolar cells, and the pineal gland. The human RS1 protein has about 97% high sequence homology with the RS1 proteins of mice, rats, and rabbits, which is substantially identical.

[0040] In this specification, "substantial identity" is generally considered to be "substantially identical" when, when comparing homology between amino acid sequences or nucleic acid sequences using any various algorithms in commercial computer programs such as BLASTN, BLASTP, Gap BLAST, and PSI-BLAST, two sequences contain the same residue at corresponding positions, preferably having sequence homology of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

[0041] In this specification, the term "vector" refers to a DNA fragment, nucleic acid molecule, etc., delivered into a host cell, and is a general term for a vector capable of expressing a peptide or protein encoded by a heterogeneous nucleic acid inserted into the vector. Preferably, it refers to a vector having the form of an expression vector capable of expressing a polynucleotide contained in the vector within a cell or within the body of a human or an animal other than a human. The vector can replicate DNA and be independently remanufactured in a host cell, and may be used interchangeably with the term "carrier."

[0042] In this specification, "operatively linked" refers to a form in which a desired coding sequence is linked in sequence with appropriate nucleic acid sequences in an expressible form, and there are no restrictions on the sequence and structure. The appropriate nucleic acid sequences mentioned above are not limited thereto, but include, for example, promoter sequences that are transcription initiation factors to which RNA polymerase binds (e.g., CMV (cytomegalovirus) promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, HSV tk promoter, RSV promoter, EF1 alpha promoter, metallothionein promoter, beta-actin promoter, human IL-2 gene promoter, human IFN gene promoter, human IL-4 gene promoter, human lymphotoxin gene promoter, human GM-CSF gene promoter for expression in eukaryotic cells; tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pL promoter, pR promoter, rac5 promoter, amp promoter, recA It may include a promoter, SP6 promoter, trp promoter, T7 promoter, etc.), any operator sequence for regulating transcription, an enhancer sequence for regulating expression levels, a start codon sequence coding for a suitable mRNA ribosome binding site, a stop codon sequence for regulating the termination of transcription and translation, a polyadenylation signal sequence (e.g., bovine growth hormone terminator, SV40-derived polyadenylation sequence, etc.), a selectivity marker sequence for selection (e.g., antibiotic resistance gene, drug resistance gene, nutritional requirement gene, etc.), a tagging sequence for easily isolating the expressed recombinant protein, etc., but may additionally include all elements contained in commercially available vectors.As vectors, any commonly used delivery vehicle, such as plasmids, phages, cosmids, chromosomes, or viruses, may be used. An example, though not limited to, is the adeno-associated virus genome (AAV genome). AAV is a replication-deficient parvovirus, and its single-stranded DNA genome is approximately 4.7 kb in length and contains two 145-nucleotide inverted terminal repeats (ITRs). In this specification, the term "AAV genome" is used interchangeably with terms such as AAV delivery vector, AAV, AAV delivery plasmid, and AAV serotype. There are numerous serotypes of AAV, including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank accession number NC_002077; The complete genome of AAV-2 is provided in GenBank accession number NC_001401; the complete genome of AAV-3 is provided in GenBank accession number NC_1829; the complete genome of AAV-4 is provided in GenBank accession number NC_001829; the genome of AAV-5 is provided in GenBank accession number AF085716; the complete genome of AAV-6 is provided in GenBank accession number NC_001862; and at least parts of the genomes of AAV-7 and AAV-8 are provided in GenBank accession numbers AX753246 and AX753249, respectively. Cis-action sequences directing viral DNA replication (rep), encapsulation / packaging, and integration into the host cell chromosome are contained within the AAV ITR. Three AAV promoters (named p5, p19, and p40 for relative map positions) drive the expression of two AAV internal open read frames encoding the rep and cap genes.Two rep promoters (p5 and p19) combined with differential splicing of a single AAV intron (nucleotides 2107 and 2227) generate four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. Rep proteins possess multiple enzymatic properties responsible for viral genome replication. The cap gene is expressed from the p40 promoter and encodes three capsid proteins: VP1, VP2, and VP3. Alternative splicing and a non-common translation initiation site are involved in the production of these three related capsid proteins. A single common polyadenylation site is located at map position 95 of the AAV genome. AAV possesses unique characteristics that make it a suitable candidate as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cultured cells is non-cytotoxic, and natural infections in humans and other animals are silent and asymptomatic. Furthermore, AAVs infect many mammalian cells, allowing for the potential to target many different tissues in vivo. Moreover, AAVs transduce slow-dividing and non-dividing cells and can essentially persist as transcriptionally active nuclear episomes (extrachromosomal elements) for the duration of these cells' lifespan. The AAV proviral genome is inserted into DNA cloned into a plasmid, which makes the construction of a recombinant genome feasible. Additionally, since signals directing AAV replication and genomic encapsidation are contained within the ITR of the AAV genome, part or all of the internal approximately 4.3 kb of the genome (encoding the replication and structural capsid proteins rep-cap) can be replaced with foreign DNA. To generate an AAV vector, the rep and cap proteins can be provided in trans form.

[0043] In this specification, "introduction" is a collective term for transformation and, in particular, any form of electroporation, conjugation, infection, transduction, transfusion, etc., in which a specific gene is introduced into a cell, tissue, or animal.

[0044] In this specification, "Cas9 protein" is a major protein component of the CRISPR / Cas system and is a protein capable of forming an activated endonuclease or nicase. For example, the Cas protein is a Cas protein derived from Streptococcus sp., e.g., Streptococcus pyogenes, e.g., Cas9 protein (e.g., SwissProt Accession number Q99ZW2(NP_269215.1)); a Cas protein derived from the genus Campylobacter, e.g., Campylobacter jejuni, e.g., Cas9 protein; a Cas protein derived from the genus Streptococcus, e.g., Streptococcus thermophiles or Streptococcus aureus, e.g., Cas9 protein; The Cas protein derived from Neisseria meningitidis, e.g., Cas9 protein; the Cas protein derived from the genus Pasteurella, e.g., Pasteurella multocida, e.g., Cas9 protein; the Cas protein derived from the genus Francisella, e.g., Francisella novicida, e.g., Cas9 protein, etc., may be one or more selected from the group consisting of, but not limited thereto. Additionally, the above Cas9 protein may be a mutated form. The above mutated form may mean a mutation that causes the loss of endonuclease activity for cleaving DNA double strands, for example, a mutation that causes the loss of endonuclease activity and the possession of nicaise activity, or a mutation that causes the loss of both target-specific nuclease and endonuclease activity and nicaise activity.In the case of having nickase activity, a nick may be introduced in the strand where the base conversion occurred or the opposite strand (e.g., the opposite strand of the strand where the base conversion occurred) simultaneously with or sequentially regardless of the order of the base conversion by the deaminase (e.g., conversion of cytidine to uradin) (e.g., in the opposite strand of the strand where PAM is located, a nick is introduced at a position corresponding to between the 3rd and 4th nucleotides in the 5' direction of the PAM sequence). Such a mutation (e.g., amino acid substitution, etc.) may occur at least in the catalytic active domain of the nuclease (e.g., the RuvC catalytic domain in the case of Cas9). In another example, it may be a Cas9 protein mutated to recognize a PAM sequence different from that of the wild-type Cas9 protein. For example, one or more of the aspartic acid (D1135) at the 1135th position, arginine (R1335) at the 1335th position, and threonine (T1337) at the 1337th position of the Cas9 protein derived from Streptococcus pyogens may be substituted with other amino acids, such as all three, and may be mutated to recognize an NGA (where N is any base selected from A, T, G, and C) that is different from the PAM sequence (NGG) of wild-type Cas9.

[0045] In this specification, "target" refers to the intended, that is, binding to DNA where a mutation exists, or binding to DNA at a site where a mutation is to be induced, or interacting with or hybridizing with it. "Target site" refers to a site where a mutation (substitution, cleavage, insertion, and / or deletion) is to be introduced using the recombinant vector or base editing vector of the present invention, and may be arbitrarily selected according to the purpose and may exist not only within the coding sequence of a specific gene but also in a non-coding DNA sequence that does not produce a protein.

[0046] In this specification, the term "humanized animal model" refers to a model that is not human but in which human-derived genetic factors are reconstructed within the animal model to exhibit human biological functions. Preferably, it refers to an animal model that exhibits a disease phenotype very similar to that of a human disease. The humanized animal model may be xenotransplanted into human cells or engineered to express human genes and / or proteins, and may be capable of replacing human experiments when used in experiments. In particular, in this specification, the term "humanized animal model" may preferably refer to a case in which the 141st amino acid of the RS1 protein, or a corresponding amino acid, is knocked in with histidine (H), identical to the human interlayer separation gene mutation, and the adjacent nucleotide sequence is identical to the nucleotide sequence derived from a human patient. Preferably, it refers to an animal such as a rat, mouse, chicken, frog, or zebryfish in which the amino acid sequence of the RS1 protein is identical to that of a human, and the 141st amino acid, or a corresponding amino acid, is mutated from R to H, but is not limited thereto.

[0047] In this specification, "normal animal" refers to a normal animal expressing an RS1 protein that has not undergone mutation, for example, the RS1 of the present invention R141H It may be an animal of the same species as the animal model expressing the mutant protein, and may be an animal of the same species as the animal model raised in the same or similar environment.

[0048] In this specification, "therapeutic effective dose" refers to an amount that produces a response greater than that of a negative control, and preferably means an amount sufficient to treat or prevent retinal separation.

[0049] In this specification, "prevention" refers to any act of inhibiting interlayer separation or delaying onset by administering a composition according to the present invention. Preferably, it includes both primary prevention, which prevents onset beforehand, and secondary prevention, which detects onset early and treats it in a timely manner.

[0050] In this specification, "treatment" refers to a broad concept of addressing the occurrence of retinal separation, and refers to any act in which the symptoms of retinal separation are improved or beneficially altered by the administration of a composition according to the present invention.

[0051] In this specification, "subject" refers to a target to which the composition of the present invention may be administered, preferably a mammal including humans, but there are no limitations on the target. "Subject in need thereof" may preferably mean a subject having a retinal separation disease and requiring treatment, but is not limited thereto if the subject has a disease that can be treated by editing the 141st amino acid of the RS1 protein back to R.

[0052] In this specification, the term "pharmaceutical composition" may be characterized as being in the form of a capsule, tablet, granule, injectable, ointment, powder, or beverage, and the pharmaceutical composition may be characterized as being intended for humans. The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. For oral administration, the pharmaceutically acceptable carrier may use a binder, lubricant, disintegrant, excipient, solubilizer, dispersant, stabilizer, suspending agent, colorant, flavoring agent, etc.; for injectables, it may use a mixture of a buffer, preservative, analgesic, solubilizer, isotonic agent, stabilizer, etc.; and for topical administration, it may use a base, excipient, lubricant, preservative, etc. The formulation of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with the pharmaceutically acceptable carrier as described above. For example, for oral administration, it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injectables, it can be manufactured in the form of unit dosing ampoules or multiple dosing ampoules. Additionally, it may be used in formulations such as coated tablets, gels, pills, powders, granules, suppositories, topical preparations, solutions, suspensions, sustained-release formulations, slurries, etc. Meanwhile, examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. Additionally, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, etc. may be additionally included.

[0053] The administration route of the pharmaceutical composition according to the present invention is not limited to these, but ocular, intravitreal, oral, or parenteral administration is preferred, and includes, for example, oral, intravenous, intramuscular, intra-articular, intrasynovial, intra-articular, intramedullary, intradural, intracardiac, transdermal, intradermal, subcutaneous, intraperitoneal, intranasal, intestinal, local, sublingual, rectal, intrasternal, intralesional, intracranial, etc.

[0054] The dosage of the pharmaceutical composition of the present invention may vary depending on several factors including the activity of the specific compound used, age, body weight, general health, gender, diet, time of administration, route of administration, elimination rate, drug combination, and the severity of the specific disease to be prevented or treated, and may be appropriately selected by a person skilled in the art, depending on the patient's condition, body weight, degree of disease, drug form, route of administration, and duration, and may be administered at a dose of 0.0001 to 500 mg / kg or 0.001 to 500 mg / kg per day. Administration may be administered once a day or divided into several doses. The above dosage does not limit the scope of the present invention in any way.

[0055] Other pharmaceutically acceptable carriers may be referenced as described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995). Additionally, the pharmaceutical composition of the present invention may be formulated using methods known in the art to provide rapid, sustained, or delayed release of the active ingredient after administration to mammals.

[0056] Preferred embodiments are presented below to aid in understanding the present invention. However, the following embodiments are provided merely to facilitate a better understanding of the invention, and the scope of the invention is not limited by the following embodiments.

[0057]

[0058] [Example]

[0059] Example 1: Confirmation of genetic variation in retinal interlayer separation

[0060] To identify specific gene mutations associated with retinoschisis, a representative inherited retinal disease, the clinical phenotypes of all patients were primarily assessed. To measure the clinical phenotype of each patient, visual acuity measurements and the Optos retinal imaging system (optos   Fundus photographs were obtained using a ) and optical coherence tomography (OCT) data were acquired using a Heidelberg Spectralis OCT instrument (Heidelberg Engineering GmbH). All clinical protocols were conducted with the approval of the Institutional Review Board of Seoul National University Hospital and the Seoul National University College of Medicine (No. 1912-143-1092).

[0061] Subsequently, to confirm genetic mutations in each patient, genomic DNA (gDNA) was obtained from the peripheral blood of the patient and available parents or siblings using the RBC solution, cell lysis solution, and protein precipitation solution provided by iNtRON Biotechnology, Inc., in accordance with the manufacturer's instructions. The integrity of the obtained gDNA was confirmed by agarose gel electrophoresis, and the gDNA was quantified using Qubit (Invitrogen). Then, sequencing libraries were prepared to be 500 to 600 bp using the TruSeq DNA Nano Library Prep Kit (Illumina, Inc.) in accordance with the manufacturer's instructions, and the prepared libraries were quantified using the TapeStation 4200 instrument (Agilent Technologies) and the KAPA Library Quantification Kit (Kapa Biosystems, Inc.). Then, to generate clusters, the system was applied to an Illumina flow cell, and the nucleotide sequences were analyzed using the 150bp paired-end reads method with an Illumin NovaSeq 6000 (Illumina, Inc.) sequencer. The procedure was performed according to the manufacturer's instructions, and the average sequencing depth of the library was 30x.

[0062] VCF files were generated from binary alignment maps (BAMs) and raw unmapped reads using the GATK best practice pipeline. The human reference genome GRCH37 / hg19 was used to align sequences using the Burrows-Wheeler Aligner (BWA-MEM) algorithm. To remove low-quality single nucleotide variants (SNVs), filters were applied with a depth of coverage (DP) of 5 or higher and a genotype quality (GQ) of 20 or higher. Variants were annotated using ANNOVAR software. To identify rare variants that had not yet been analyzed, variants were filtered from the genome aggregation database (gnomAD) using minor allele frequency (MAF) with a cutoff of 0.01. Variants were ranked using various in silico prediction scores, and segregation analysis was performed using Sanger sequencing analysis of DNA samples obtained from families.

[0063] Copy Number Variants (CNVs) were loaded using the coverage-based caller CNVator (v0.4.1, default options), with the window size set to 100, and segmentation based on the mean-shift technique. CNVs exceeding 1 KB in length were retained as detected CNVs, and alignment was verified using the Integrative Genomics Viewer (IGV, v2.13.2). Cryptographic splice variants (CSVs) were detected using SpliceAI (spliceai-1.2.1), and splice variant candidates were selected using a SpliceAI prediction score cutoff of 0.8. The variants were analyzed using known genetic pattern analysis and additionally filtered using allele frequencies. Mitochondrial variants were identified using the GATK mitochondrial short variant discovery pipeline (https: / gatk.broadinstitute.org / hc / en-us / articles / 4403870837275-Mitochondrial-short-variant-discovery-SNVs-Indels) and filtered with a cutoff of 0.01 using gnomAD's MAF.

[0064] Through this, a mutation of c.422G>A (p.Arg141His; pR141H) in the conserved sequence of exon 5 of the Rs1 (Retinochisin 1) gene located on the X chromosome was identified in a number of male patients with retinal interlayer separation.

[0065]

[0066] Example 2: Preparation of an animal model of retinal interlayer separation with genetic mutations

[0067] To determine whether the genetic variant of retinal interlayer separation identified through the method of Example 1 induces retinal interlayer separation, a male mouse model having the Rs1c.422G>A variant (RS1 R141H ) was constructed using the Crispr-Cas9-induced homology-directed repair method (Fig. 1). For gene editing, a single-stranded guide RNA (sgRNA) was selected that recognizes and operates on the sequence GTCTATGTCACAGCGTCCTTGGG (Sequence No. 1), which is a combination of the target region (or protospacer) of the mouse Rs1 gene and the PAM (Protospacer Adjucent Motif) sequence. This specific guide RNA sequence was selected using Benchling software, and possible off-target sites were also identified. To synthesize the above sgRNA, the oligomers 5'-taggGTCTATGTCACAGCGTCCTT-3' (SEQ No. 2) and 5'-aaacAAGGACGCTGTGACATAGAC-3' (SEQ No. 3), synthesized by Macrogen, Inc., were cloned into the BsaI site of the pUC57-sgRNA expression vector (Addgene), and the sgRNA was prepared using the MEGAshortscript T7 kit (Ambion) according to the instructions provided by the manufacturer.  It was synthesized in vitro using ) and purified by phenol / chloroform extraction, and finally dissolved in diethylpyrocarbonate (DEPC)-treated RNase-free infusion buffer (0.25 mM EDTA, 10 mM Tris, pH 7.4). The recombinant Cas9 nuclease protein of Streptococcus pyogenes (M0386T) was purchased from New England BioLabs, and a single strand oligodeoxynucleotide (ssODN) was synthesized by Integrated DNA Technologies as a donor template for replacement with a human-identical base sequence. The sequence of the synthesized ssODN is 5′-atcaggacagcagccagtggttacagatagatttgaaggagatcaaggtgatttcggggatcctgacccaGggGcActgtgacatCgaTgagtggAtgaccaagtacagtgtgcagtataggactgatgagcgcctgaactggatctactataaggatcagaccgg-3′ (Sequence No. 4).

[0068] C57BL / 6NTac mice for obtaining fertilized eggs and ICR mice to be used as foster mothers were purchased from JA Bio, Inc. and OrientBio, Inc., respectively. To deliver a gene editing mixture containing recombinant Cas9 protein, guide RNA, and ssODN, mouse zygotes were engineered using a super electroporator NEPA 21 (Nepa Gene Co., Ltd.) equipped with 1 mm spaced platinum metal plates (CUY5001P1-1.5). The genotypes of all mice used in the experiment, including the founder and offspring, were confirmed through Sanger sequencing by Macrogen, Inc., and the data were analyzed using SnapGene software (Ver. 7.0.2, SnapGene). For Sanger sequencing of mice, 525-bp genomic DNA fragments of the target region of the Rs1 gene were amplified using 5'-AACACATCCCTGCATCCCTG-3' (SEQ No. 5) and 5'-CGGACAGCAGGAACATAGGG-3' (SEQ No. 6) primers, and the sequence of the amplified target region was analyzed using 5'-CCCGATTGTTTCCGGTCTGA-3' (SEQ No. 7) primer. To eliminate the rd8 mutation in the Crb1 gene present in all downlines of C57BL / 6N, wild-type C57BL / 6J mice purchased from The Jackson Laboratory were backcrossed with mutant mice before use in the experiment. The clinical phenotypes of the constructed mice were confirmed in the same manner as in Example 1, and sequencing analysis was performed to verify whether the point mutant mice were constructed normally.

[0069] As a result of DNA sequencing analysis, the R in RS1 was changed to H, and the adjacent sequence was mutated into a sequence identical to that of humans as shown in Fig. 1, so RS1 R141HIt was confirmed that the humanized animal model was produced successfully.

[0070] To determine whether retinal detachment occurred due to induced point mutations, OCT data and H&E staining were used. For H&E, denuclearized eyes were extracted, fixed with a 4% paraformaldehyde solution at 4°C, paraffin sections were prepared, and stained with hematoxylin and eosin solutions, after which stained images were acquired using an optical microscope (Leica). The results of the OCT data and H&E staining showed that 6-week-old mutant mice (RS1 R141H In ) control normal mice (RS1 WT It was confirmed that, unlike ) but in the same form as human retinal interlayer separation, it exhibited intraretinal division (Fig. 2).

[0071] In addition, to determine whether ocular function was reduced in animal models in the same way as in humans due to retinal detachment caused by mutations, the degree of ocular function was assessed by measuring electroretinography (ERG) responses and optomotor responses to rotating visual stimuli. For the ERG, mice were acclimatized to darkness for 16 hours the day before the test, administered general anesthesia, and their pupils were dilated using Tropherin eye drops containing phenylephrine hydrochloride and tropamide. During the experiment, the mice were placed on a heating pad to maintain their body temperature. The full range of ERGs was measured using the Universal Testing and Electrophysiologic System 2000 (LKC Technologies). Light-induced responses were induced using a 0 dB xenon flash and recorded at 60 Hz with a torch filter and 2 kHz gain. The data was then filtered between 0.1 and 1,500 Hz and converted into graphics. Prism 10 (GraphPad) was used for amplitude estimation; A-wave amplitude was measured from the baseline to the lowest point of the negative voltage, and b-wave amplitude was determined from the lowest point of the a-wave to the peak of the positive b-wave. Visuomotor responses were measured using an OptoMotry system (Cerevral Mechanics, Inc.) according to the manufacturer's instructions. In each experiment, at least three mice were assigned to each experimental group. Subsequently, all experiments were repeated at least three times, and the results were expressed as mean ± standard deviation. Statistical significance was determined using the P-value of a one-way ANOVA including a post-hoc Tukey's test, performed using GraphPad Prism 10.

[0072] As a result of measuring the electroretinogram response and the visuomotor response to rotating visual stimuli, it was confirmed that the synthesized mutant mice showed a significantly reduced electroretinogram amplitude and reduced visuomotor response compared to control normal mice (WT) (Fig. 3). In addition, a negative electroretinogram, which is observed in cases of medial retinal injury, was also observed. Based on the above results, RS1 R141H By utilizing genetic mutations, a humanized animal model of interlayer detachment exhibiting a disease phenotype similar to human interlayer detachment was successfully constructed, and it was confirmed that this model can be used for research on therapeutic agents and treatment methods for interlayer detachment.

[0073]

[0074] Example 3: Construction of plasmid vector for gene editing and verification of efficiency

[0075] In order to confirm whether genetic retinal interlayer separation in a humanized animal model prepared in the same manner as in Example 2 can be treated by gene editing—specifically, by modifying the c.422G>A mutation in the Rs1 gene where the mutation exists—HEK293T cells (HEK-RS1) containing the mutation were first used to confirm editing efficiency in vitro. R141H Manufactured ). HEK-RS1 R141HA lentivirus was produced using a lentivirus shuttle vector derived from a hygromycin reporter plasmid containing the nucleotide sequence of the target site (5'-ATCCACTCATCGATGTCACAGTGCCCCTGGGTGAGGATCCCTGAAATC-3', SEQ ID NO. 8), and transfected into HEK293T cells at an MOI (multiplicity of infection) of 0.3. Untransfected cells were removed by adding 2 μg / mL of hygromycin to the culture medium. In order to construct an efficient vector for base editing, three types of single guide RNA (sgRNA) candidates were constructed based on the target sites of the adenine base editor (ABE8e), an adenosine deaminase, and A4 sgRNA, which specifically binds to 5'-GGCACTGTGACATCGATGAG-3' (SEQ No. 9), A6 sgRNA, which specifically binds to 5'-GGGGCACTGTGACATCGATG-3' (SEQ No. 10), and A8 sgRNA, which specifically binds to 5'-GAGGGGCACTGTGACATCGA-3' (SEQ No. 11), were selected (Fig. 4). In addition, to identify the type of adenosine deaminase for the efficient treatment of retinal detachment, the editing efficiencies of ABE8eW and ABE8.17mW, derived from TadA8e (tRNA-specific adenosine deaminase), were compared. To deliver the gene editing vector in vivo, adeno-associated viruses (AAVs) approved by the U.S. Food and Drug Administration (FDA) for therapeutic use were selected as carriers, specifically AAV8. In the case of AAV8, the capacitance size is approximately 4.Since the ABE used for gene editing is 8kb and its size exceeds 5kb, the ABE was divided into two fragments using intein, each was loaded into AAV8, and subsequently designed to be expressed as a single protein within the delivered cells (Fig. 5). Although the vector used in this invention was constructed by dividing it into two vectors due to the limitations of the loading size of the AAV carrier, it can be constructed as a single vector if the carrier is of a type capable of carrying the entire vector. To construct the AAV-based base editor, the pAAV-ABE-N vector (ABE-N) was first prepared by cleaving the Cbh_v5 AAV-ABE N-terminal plasmid (#137177, Addgene) using restriction enzyme Agel and BspEI (New England Biolabs; NEB), treating with 1 μL of quick calf intestinal alkaline phosphate (NEB), and reacting at 37°C for 30 minutes. Then, only the linear plasmid was purified using the MEGAquick-spin Total Fragment DNA Purification Kit (iNtRON Biotechnology, Inc.) according to the instructions provided by the manufacturer. IDT was applied to the purified linear plasmid. TMThe synthesized TadA8.17mW-encoding sequence or TadA8eW-encoding sequence was conjugated into a linear plasmid using the NEBuilder HiFi DNA assembly kit (NEB). Finally, it was constructed to include the N-terminus of NG-ABE8eW fused to the 5'-terminus of the CbH promoter and Npu-N phosphate, followed by NLS and W3-bGH terminators. Then, for the pAAV-ABE-C-Rs1sgRNA vector (ABE-C-Rs1sgRNA), the Cbh_v5 AAV-ABE C-terminal plasmid (#137178, Addgene) was first cleaved using SacI and EcoRI restriction enzymes (NEB), and the linear plasmid form was purified in the same manner as for ABE-N. In addition, to identify the type of Cas9 effective for treatment, nucleotides encoding SpCas9, or its variant SpG targeting NGN PAMs, SpCas9-NG targeting NG PAMs, and SpCas9-VRQR targeting NGA PAMs were respectively bound to truncated linear plasmids. The Cas9 C-terminal sequences of nSpCas9, NG-Cas9 (nSpCas9-NG), SpG-Cas9 (nSpG), and VRQR-Cas9 (nSpCas9-VRQR) were amplified from nSpCas9 (#171691, Addgene), pSpCas9-NG (#138566, Addgene), pCMV-T7-SpG-P2A-EGFP (#139988, Addgene), and VRQR-ABEmax (#119811, Addgene), respectively, and used. Phosphorylated sgRNA was annealed and ligated to a linear ABE-C plasmid cleaved with BsmBI restriction enzyme (NEB) using T4 ligase (NEB). Finally, ABE-C-RS1sgRNA was constructed to contain the C-terminus of NG-ABE8 fused to the 3'-terminus of Npu-C phosphate and the CbH promoter, and an sgRNA operated by the U6 promoter.

[0076] The constructed gene AAV-based base editors were prepared by mixing equal amounts of ABE-N and ABE-C-RS1 sgRNA and mixing them with the AAV8-capsid plasmid and helper plasmid, respectively, to create HEK-RS1 R141H After treating the cells and culturing them for 3 days, gDNA was extracted from the cells and deep sequencing was performed to confirm the editing efficiency, confirming that adenine was normally edited to guanine. gDNA extraction was performed using the Wizard genomic DNA purification kit (Promega) according to the instructions provided by the manufacturer. TM It was extracted using ), and deep sequencing Phusion   After amplification using High-Fidelity DNA polymerase (NEB), the base sequences were analyzed and verified using the MiniSeq (Illumina, Inc.) and MiSeq (Illumina, Inc.) platforms. Base editing efficiency was calculated by aligning the amplified target sequences with a reference sequence using BE-Analyzer and determining the frequencies of target editing, bystander editing, indels, and other allelic modifications as a percentage of "number of desired target edits / total number of aligned sequences." The experimental method is briefly illustrated in Figure 6.

[0077] As a result of verifying the editing efficiency within cells, the combination of ABE8eW, SpCas9, and A4 sgRNA showed the lowest average editing efficiency of 15.9%, while the combination of ABE8eW, SpCas9-NG, and A8 sgRNA showed the optimal editing efficiency of 38.9% (Fig. 7). However, it was confirmed that all combinations exhibited an editing efficiency of 15% or higher. Additionally, for the combination of ABE8eW, SpCas9-NG, and A8 sgRNA (A8-NG-ABE8eW), the bystander editing value, which edits non-target adenine, was found to be the lowest at an average of 2.3%. Subsequent experiments were conducted using the combination of ABE8eW, SpCas9-NG, and A8 sgRNA as a representative example. The vector as a representative example contained the genes for ITR (Sequence No. 13), CbH promoter (Sequence No. 14), NLS (Sequence No. 15), Tad8eW (Sequence No. 16), linker (Sequence No. 17), NT-SpCas9-NG (Sequence No. 18), Npu-N (Sequence No. 19), W3-bGH (Sequence No. 20), Npu-C (Sequence No. 21), CT-SpCas9-NG (Sequence No. 22), U6 promoter (Sequence No. 23), and sgRNA (Sequence No. 11).

[0078]

[0079] Example 4: Confirmation of therapeutic effect on retinal separation in vivo

[0080] Experiments were conducted to determine whether treatment for retinal detachment via gene editing is possible using an animal model of retinal detachment constructed in the same manner as in Example 2. To confirm the therapeutic effect through gene editing using a vector constructed in the same manner as in Example 3, a total of 4.5 x 10⁶ per eye were applied to an animal model of retinal detachment 14 days after birth (P14). 9Two AAV8-ABEs were evenly mixed and injected into the vitreous humor to administer the viral genomes. For 7 weeks after injection, OCT imaging, electroretinography (ERG), and visual motor responses were measured in the same manner as in Example 2. Additionally, for further analysis, the mice were euthanized 8 weeks after administration, and ocular tissue was obtained.

[0081] gDNA was obtained from retinal cells (retina) and retinal pigment epithelial cells (RPE) acquired from ocular tissue, and deep sequencing was performed in the same manner as in Example 3 to confirm the specific editing efficiency of target genes where adenine was edited to guanine. gDNA and total RNA were extracted using the Allprep DNA / RNA mini kit (Qiagen) according to the instructions provided by the manufacturer. As a result of confirming the editing efficiency, it was confirmed that RPE cells showed an editing efficiency of 9.2 to 11.6%, and retinal cells showed an editing efficiency of 30.1 to 45.5% without bystander editing (Fig. 8). Since gene editing occurred normally in RPE cells as well, it was confirmed that AAV8-ABE passed through the retina via intravitreal injection and was successfully delivered to the entire ocular tissue. Additionally, to confirm whether the normal Rs1 transcript was transcribed after gene editing was induced, sequencing analysis was performed after RT-PCR, and it was confirmed that 37.6 to 68.6% of the pathogenic adenine variants in mice treated with AAV8-ABE were changed to guanine (Fig. 9).

[0082] The acquired tissue was then examined through OCT imaging and immunohistochemistry. OCT imaging and H&E staining were performed in the same manner as in Example 2, and for immunofluorescence staining, a portion of the acquired tissue was [treated] with Hartman's Fixative solution (Sigma-Aldrich   The tissue was fixed for 24 hours using ). Then, after preparing 4 μm thick paraffin sections, the paraffin was removed by immersing the sections in sodium citrate buffer (pH 6.0) and heating for 10 minutes to facilitate antigen recovery. Subsequently, the paraffin-removed tissue was exposed to anti-RS1 antibody (Proteintech), anti-Cas9 antibody (Cell Signaling Technology), or anti-Opsin antibody (Sigma-Aldrich).   After treating with a primary antibody diluted to a ratio of 1:100 using PBlec buffer and incubating overnight at 4°C, the unbound primary antibody was removed by washing, and a secondary antibody (Thermo Fisher Scientific Inc.) was treated and reacted at room temperature for 1 hour. Then, the unbound secondary antibody was removed by washing again, stained with DAPI solution at room temperature for 15 minutes, washed, and observed using a fluorescence microscope. As a result, in the experimental group administered with the AAV8-ABE of the present invention via intravitreal injection, Cas9 expression was observed as green fluorescence throughout the retinal layer, confirming that AAV8-ABE was effectively delivered to the entire retinal layer, inducing normal gene editing, and thereby the retinal layer of the animal model histologically exhibiting a morphology nearly similar to that of a normal mouse (Fig. 10).

[0083] To confirm whether eye function was restored to normal by treating retinal detachment through gene editing therapy in which abnormal genes were edited into normal genes, the degree of eye function was assessed by measuring the electroretinogram response and the visual motor response to rotating visual stimuli in the same manner as in Example 2. As a result, it was confirmed that both the electroretinogram and the visual motor response were significantly restored (Fig. 11). Through this, it was confirmed that retinal function was improved by increasing the electrical response of the retina to light stimulation, and visual acuity was increased by increasing the visual motor response to rotating visual stimuli. Through this, it was confirmed that retinal detachment was effectively treated and eye function was restored.

[0084]

[0085] Through the above results, it was confirmed that an effective humanized animal model can be constructed using the Rs1c. 422G>A mutation for studying retinal detachment. By constructing the humanized animal model using a direct gene mutation that induces retinal detachment in humans, it was confirmed that the model operates similarly to the biological functions of humans with expressed retinal detachment, exhibiting a disease phenotype similar to humans—that is, a phenotype that is anatomically and functionally similar. Additionally, it was confirmed that by using the humanized animal model constructed by the method of the present invention and applying the AAV-based base editor of the present invention, effective gene editing can be induced in patients with diseases caused by point mutations, thereby editing the mutated gene into a normal gene and effectively treating the disease. Through this, it was confirmed that the retinal detachment humanized animal model of the present invention can be widely used as a preclinical animal model for conducting clinical trials targeting patients with retinal detachment, such as verifying the effects of gene and cell therapy, developing novel therapeutic agents, and evaluating toxicity.

[0086]

[0087] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

[0088] The humanized animal model according to the present invention is RS1, which is the cause of interlayer separation in humans. R141HThis invention was completed by confirming that by constructing an animal model containing mutations, it is possible to produce a humanized animal model exhibiting a disease phenotype similar to humans—that is, a phenotype that is anatomically and functionally similar. Furthermore, it was confirmed that when a point mutation in the humanized animal model of the present invention was replaced with a normal gene using an AAV-based base editor, the retinal detachment was treated and eye function was restored. Through this, it is expected that the humanized animal model for retinal detachment of the present invention can be widely used as a preclinical animal model for conducting clinical trials targeting patients with retinal detachment, such as verifying the effects of gene and cell therapy, developing novel therapeutic agents, and evaluating toxicity; thus, it possesses industrial applicability.

Claims

1. A humanized animal model in which the 141st amino acid of the retinoschisin (RS1) protein, or the corresponding amino acid, is knocked in with histidine (H).

2. In Paragraph 1, The above animal model is a humanized animal model that reproduces retinal separation disease.

3. In Paragraph 1, A humanized animal model in which the 141st amino acid is arginine(R) before dissolution.

4. In Paragraph 1, The above animal model is a humanized animal model in which the 422nd nucleotide of the gene encoding the RS1 protein is mutated from G to A, and all or part of the adjacent 327th to 522nd base sequences are modified to be identical to the base sequence of a normal human.

5. In Paragraph 1, The above animal model is a humanized animal model expressing an RS1 polypeptide containing an R141H substitution.

6. In Paragraph 1, The above animal model is a humanized animal model in which the male is a hemizygote or the female is a homozygote.

7. In Paragraph 1, The above animal model is a humanized animal model that is a mouse, rat, hamster, rabbit, horse, cow, pig, dog, cat, monkey, sheep, chicken, frog, zebryfish, or goat.

8. A method for screening a substance for the prevention or treatment of retinal separation, comprising the step of administering a test substance to a humanized animal model according to any one of claims 1 to 7.

9. In Paragraph 8, The above test material is a gene therapy vector, base editing vector, nucleotide, DNA, RNA, amino acid, aptamer, protein, compound, natural product, natural extract, or cell, screening method.

10. A method for preparing a humanized retinal interlayer separation animal model, comprising the step of introducing guide RNA and donor DNA, which target the substitution of arginine (R), the 141st amino acid of the retinoschisin (RS1) protein, or its corresponding amino acid, with histidine (H), into a fertilized egg of a non-human animal.

11. In Paragraph 10, A method for manufacturing the above guide RNA, which is a single guide RNA or a double guide RNA.

12. In Paragraph 10, A method of manufacturing in which the guide RNA comprises a guide RNA that recognizes the target nucleotide sequence of SEQ ID NO. 1.

Citation Information

Patent Citations

  • Paste apparatus for making bread

    KR1020210039693A

  • Composition for electron transporting layer and method for manufacturing of display device comprising the same

    KR1020240020330A

  • Methods and compositions for treating genetically linked diseases of the eye

    WO2019144077A1

  • Methods and compositions for the ADAR-mediated editing of retinoschisin 1 (RSI)

    WO2021231691A1

  • Cell lines that produce human retinoschisin proteins and uses thereof

    WO2022011081A1