Compounds and methods for reducing PACS1 expression

Oligomeric agents targeting PACS1 RNA and protein expression provide a therapeutic approach to manage PACS1-NDD by reducing symptoms like intellectual disability and autism spectrum disorder.

WO2026073228A1PCT designated stage Publication Date: 2026-04-02IONIS PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/048719
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-30
Filing Date
2025-09-30
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

There is a lack of effective therapies for neurodevelopmental disorders associated with PACS1, such as PACS1-NDD, which are characterized by symptoms including intellectual disability, autism spectrum disorder, epilepsy, and various physical anomalies.

Method used

The development of oligomeric agents, particularly modified oligonucleotides and antisense oligonucleotides, to reduce PACS1 RNA and protein expression, which are administered to subjects to ameliorate symptoms of PACS1-NDD.

Benefits of technology

These agents effectively reduce PACS1 expression and activity, leading to amelioration of symptoms such as developmental delay, intellectual disability, and other neurological and physical abnormalities associated with PACS1-NDD.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000007_0001
    Figure IMGF000007_0001
  • Figure IMGF000014_0001
    Figure IMGF000014_0001
  • Figure IMGF000015_0001
    Figure IMGF000015_0001
Patent Text Reader

Abstract

Provided are oligomeric agents, methods, and pharmaceutical compositions for reducing the amount or activity of PACS1 RNA in a cell or a subject, and in certain instances reducing the amount of PACS1 protein in a cell or a subject. Such oligomeric agents, methods, and pharmaceutical compositions are useful to treat PACS1 neurodevelopmental disorder (PACS1-NDD).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] BIOL0482WO

[0002] COMPOUNDS AND METHODS FOR REDUCING PACS1 EXPRESSION

[0003] Sequence Listing

[0004] The present application is being filed with a Sequence Listing in electronic format. The Sequence Listing is 5 provided as a file entitled BIOL0482SEQ.xml, created on September 29, 2025, which is 207 KB in size. The contents of the electronic format of the sequence listing are incorporated herein by reference in their entirety.

[0005] Field

[0006] Provided herein are oligomeric agents, compositions, and uses thereof, including methods for modulating the 10 amount and / or activity of phosphofurin acidic cluster sorting protein 1 (PACS1) expression, PACS1 RNA, and / or PACS1 protein, as well as methods for treating PACS1-neurodevelopmental disorder (PACS1-NDD), and in certain embodiments, ameliorating at least one symptom of PACS1-NDD.

[0007] Background

[0008] 15 The gene encoding phosphofurin acidic cluster sorting protein 1 (PACS1) is highly expressed during the development of the fetal brain and is maintained at low levels after birth. PACS1 is a multi-functional protein which facilitates localization of trans-Golgi network (TGN) membrane proteins containing phosphorylated acidic cluster sorting motifs (e.g., furin, mannose-6-phosphate receptor), and interacts with multiple other proteins having various roles in vesicle trafficking, ion transport (e.g., regulation of calcium flux), and gene expression (e.g., DNA replication 20 repair, export of viral transcripts, RNA binding, and regulation of chromatin stability; Rylaarsdam et al, Nat. Comm., 2024, 15:827; Arnedo et al, Int J Mol Sci.2022 Sep; 23(17): 9649). PACS1 mRNA has been detected in all areas of the brain, with greatest levels observed in the cerebellum. Cellular expression of PACS1 mRNA has been observed in neurons, astrocytes, oligodendrocytes, and microglial cells, with the greatest levels of expression observed in excitatory neurons.

[0009] 25 PACS1-neurodevelopmental disorder (PACS1-NDD), also known as Schuurs-Hoeijmakers Syndrome (SHMS) or PACS1 disorder, is a moderately severe, autosomal dominant neurodevelopmental disorder resulting from a recurrent, de novo, gain-of-function mutation in the PACS1 gene. In particular, the primary pathogenic mutation results in an arginine to tryptophan (R203W) substitution in the PACS1 protein (Van Nuland et al, Orphanet J Rare Dis., 2021, 16:386; Rylaarsdam et al, Nat. Comm., 2024, 15:827; Arnedo et al, Int J Mol Sci.2022 Sep; 23(17): 9649).

[0010] 30 PACS1-NDD is primarily an intellectual disability syndrome with a prominent autism component, and individuals affected by PACS1-NDD have different combinations of signs and symptoms with varying severity. Symptoms of PACS1-neurodevelopmental disorder (PACS1-NDD) include, for example, developmental delay, intellectual disability, speech disability (e.g., limited language to no speech development), hypotonia, feeding / gastrointestinal issues (e.g., gastroesophageal reflux, constipation, oral aversion, preference for soft foods), epilepsy (e.g., partial 35 and / or tonic seizures, with early or infantile onset), behavioral features (e.g., autism spectrum disorder, temper tantrums, aggression, anxiety), motor disturbances (e.g., gait disturbances such as poor balance and coordination), congenital heart anomalies (e.g., atrial septal defect, ventral septal defect, patent ductus arteriosus, bicuspid aortic

[0011] 1 BIOL0482WO

[0012] valve, dysplastic aortic and pulmonary valves, patent foramen ovale), ocular abnormalities (e.g., coloboma of iris, retina, and / or optic nerve, as well as myopia, strabismus, or nystagmus), brain abnormalities (e.g., hypoplasia or partial agenesis cerebellar vermis, mild colpocephaly, ventriculomegaly / hydrocephalus ex vacuo, thin corpus callosum, frontal cortical dysplasia, paucity of cerebral white matter, mild delay in myelination, and hyperintensity of 5 periventricular white matter), and microcephaly ( (see Van Nuland et al, Orphanet J Rare Dis., 2021, 16:386; Lusk L, et al., PACS1 Neurodevelopmental Disorder, 2020 Jul 16. In: Adam MP, Feldman J, Mirzaa GM, et al., editors; GeneReviews®; Seattle (WA): University of Washington, Seattle; 1993-2024).

[0013] Currently, there is a lack of acceptable options for treating neurodegenerative diseases and disorders associated with PACS1 such as PACS1-NDD. There thus remains a need for therapies targeting diseases and disorders 10 associated with PACS1. Therapeutics targeting PACS1 may provide a new class of compounds for effective management of PACS1-NDD. It is therefore an object herein to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases and disorders.

[0014] Summary

[0015] 15 Provided herein are oligomeric agents, pharmaceutical compositions, and methods of use for reducing the amount or activity of PACS1 RNA, and in certain embodiments reducing the expression of PACS1 protein, in a cell or a subject. In certain embodiments, the subject has or is at risk for developing a disease associated with PACS1. In certain embodiments, the subject has or is at risk for developing PACS1-neurodevelopmental disorder (PACS1-NDD). In certain embodiments, oligomeric agents, pharmaceutical compositions, and methods reduce the amount or activity 20 of PACS1 RNA and / or expression of PACS1 protein. In certain embodiments, oligomeric agents useful for reducing the amount or activity of PACS1 RNA and / or the expression of PACS1 protein comprise a modified oligonucleotide. In certain embodiments, oligomeric agents useful for reducing the amount or activity of PACS1 RNA and / or the expression of PACS1 protein comprise an oligomeric duplex and / or an antisense oligonucleotide. In certain embodiments, oligomeric agents useful for reducing the amount or activity of PACS1 RNA are antisense 25 oligonucleotides.

[0016] Additionally provided herein are methods for reducing PACS1 expression, PACS1 RNA levels, PACS1 protein levels, and / or PACS1 activity in a cell or subject. In certain embodiments, the methods include contacting a cell or subject with a composition provided herein, comprising an oligomeric agent, a modified oligonucleotide, and / or an oligomeric duplex. In certain embodiments, the subject is a human who has or is at risk of developing a disease 30 associated with PACS1. In particular embodiments, the subject is a human who has or is at risk of having a PACS1- neurodevelopmental disorder (PACS1-NDD). In certain particular embodiments, the subject is a human who has or is at risk of having developmental delay, intellectual disability, speech disability (e.g., limited language to no speech development), hypotonia, feeding / gastrointestinal issues (e.g., gastroesophageal reflux, constipation, oral aversion, preference for soft foods), epilepsy / seizures (e.g., partial and / or tonic seizures, with early or infantile onset), behavioral 35 features (e.g., autism spectrum disorder, temper tantrums, aggression, anxiety), motor disturbances (e.g., gait disturbances such as poor balance and coordination), congenital heart anomalies (e.g., atrial septal defect, ventral septal defect, patent ductus arteriosus, bicuspid aortic valve, dysplastic aortic and pulmonary valves, patent foramen

[0017] 2 BIOL0482WO

[0018] ovale), ocular abnormalities (e.g., coloboma of iris, retina, and / or optic nerve, as well as myopia, strabismus, or nystagmus), brain abnormalities (e.g., hypoplasia or partial agenesis cerebellar vermis, mild colpocephaly, ventriculomegaly / hydrocephalus ex vacuo, thin corpus callosum, frontal cortical dysplasia, paucity of cerebral white matter, mild delay in myelination, and hyperintensity of periventricular white matter), and / or microcephaly.

[0019] 5 Also provided herein are methods of treating a disease (including, for example, a disorder or condition) associated with PACS1 or a mutation in PACS1 in a subject having or at risk of developing a disease associated with PACS1. In certain embodiments, methods provided herein include methods of ameliorating at least one symptom or hallmark of PACS1-NDD. In certain embodiments, methods provided herein include methods of treating PACS1- NDD. In certain embodiments, such methods comprise administering a composition provided herein comprising an 10 oligomeric agent, a modified oligonucleotide, and / or an oligomeric duplex to a subject having or at risk for developing PACS1-NDD. In certain embodiments, such treating results in amelioration of at least one symptom of PACS1-NDD. In certain embodiments, such treating results in amelioration of at least one symptom selected from developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance 15 and / or coordination, congenital heart anomalies (e.g., atrial septal defect, ventral septal defect, patent ductus arteriosus, bicuspid aortic valve, dysplastic aortic and pulmonary valves, patent foramen ovale), ocular abnormalities (e.g., coloboma of iris, retina, and / or optic nerve, as well as myopia, strabismus, or nystagmus), brain abnormalities (e.g., hypoplasia or partial agenesis cerebellar vermis, mild colpocephaly, ventriculomegaly / hydrocephalus ex vacuo, thin corpus callosum, frontal cortical dysplasia, paucity of cerebral white matter, mild delay in myelination, and 20 hyperintensity of periventricular white matter), and microcephaly.

[0020] Detailed Description

[0021] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless 25 specifically stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0022] The section headings used herein are for organizational purposes only and are not to be construed as 30 limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by- reference for the portions of the document discussed herein, as well as in their entirety.

[0023] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry 35 described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.

[0024] 3 BIOL0482WO

[0025] Unless otherwise indicated, the following terms have the following meanings:

[0026] As used herein, a substituent at the “2’-position” means that the substituent is directly attached to the carbon at the 2’-position of a furanosyl sugar moiety.

[0027] As used herein, “2’-deoxynucleoside” means a nucleoside comprising a 2’-deoxyfuranosyl sugar moiety.

[0028] 5 Unless otherwise indicated, the 2’-deoxyfuranosyl sugar moiety is in the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). A 2’-deoxynucleoside or a nucleoside comprising a 2’- deoxyfuranosyl sugar moiety may be abasic, comprise a modified nucleobase, or may comprise an RNA nucleobase (uracil).

[0029] As used herein, “2’-deoxy sugar moiety” means a 2’-H(H) deoxyfuranosyl sugar moiety. Unless otherwise 10 indicated, a 2’-deoxy sugar moiety is a 2’-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl stereochemical configuration as found in naturally occurring deoxyribonucleic acids (DNA).

[0030] As used herein, “2’-MOE” means a 2’-OCH2CH2OCH3group at the 2’-position of a furanosyl sugar moiety. A “2’-MOE sugar moiety” means a sugar moiety with a 2’-OCH2CH2OCH3group at the 2’-position of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the β-D-ribosyl stereochemical configuration.

[0031] 15 “MOE” means O-methoxyethyl.

[0032] As used herein, “2’-MOE nucleoside” or “2’-OCH2CH2OCH3nucleoside” means a nucleoside comprising a 2’-MOE sugar moiety (or 2’-OCH2CH2OCH3furanosyl sugar moiety).

[0033] As used herein, “2’-OMe” or “2’-O-methyl” means a 2’-OCH3group at the 2’-position of a furanosyl sugar moiety. A “2’-OMe sugar moiety” or “2’-O-methyl sugar moiety” means a sugar moiety with a 2’-OCH3group at the 20 2’-position of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-OMe sugar moiety is in the β-D-ribosyl stereochemical configuration.

[0034] As used herein, “2’-OMe nucleoside” means a nucleoside comprising a 2’-OMe sugar moiety. As used herein, “2’-substituted nucleoside” means a modified nucleoside comprising a 2’-substituted furanosyl sugar moiety.

[0035] 25 As used herein, “2’-substituted sugar moiety” or “2’-substituted furanosyl sugar moiety” means a modified furanosyl sugar moiety wherein the 2’-position has at least one 2’-substituent other than H or OH. A 2’-substituted sugar moiety includes a bicyclic sugar moiety where the second ring is joined to the furanosyl ring at the 2’-position.

[0036] 2’-substituted sugar moieties include, but are not limited to, 2’-OMe sugar moieties, 2’-MOE sugar moieties, 2’-F sugar moieties, 2’-NMA sugar moieties, cEt sugar moieties, and LNA sugar moieties.

[0037] 30 As used herein, “3’ stop site” refers to the 3’-most nucleotide of a target nucleic acid which is complementary to an oligonucleotide, when the oligonucleotide is hybridized to the target nucleic acid. As used herein, “5’ start site” refers to the 5’-most nucleotide of a target nucleic acid which is complementary to an oligonucleotide, when the oligonucleotide is hybridized to the target nucleic acid.

[0038] As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached at the 5 position.

[0039] 35 A 5-methylcytosine is a modified nucleobase.

[0040] As used herein, “abasic nucleoside” means a modified nucleoside in which the sugar moiety is not attached to a nucleobase (i.e., the nucleobase is absent).

[0041] 4 BIOL0482WO

[0042] As used herein, “administration” or “administering” means providing a pharmaceutical agent or composition to a subject.

[0043] As used herein, “ameliorate” with reference to a symptom of a disease, means improvement in, or lessening, or preclusion of at least one symptom of the disease. As used herein, “disease” includes disorders, conditions, and 5 injuries. Amelioration may be a reduction in severity or frequency of a symptom or the delayed onset, prevention of occurrence of, or slowing of progression in the severity or frequency of, a symptom. Progression, frequency, or severity indicators may be determined by subjective or objective measures known in the art and / or described herein.

[0044] As used herein, “antisense activity” means any detectable and / or measurable change attributable (whether directly and / or indirectly) to hybridization of an antisense oligonucleotide to a target nucleic acid. For example, 10 compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vitro assay or, for example, compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vivo assay. Antisense activity may be assessed in a standard assay. Herein, antisense activity is a reduction in the amount or expression of a target nucleic acid or a protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the oligonucleotide. 15 As used herein, “antisense agent” means an oligomeric agent comprising an antisense oligonucleotide.

[0045] As used herein, “antisense oligonucleotide” means an oligonucleotide having at least one region (a “targeting region”) that is complementary to a target nucleic acid and is capable of antisense activity. An antisense oligonucleotide may be paired with a second oligonucleotide (herein, a “sense oligonucleotide”) that is complementary to the antisense oligonucleotide (for example, forming an “oligomeric duplex”), may be an unpaired antisense 20 oligonucleotide (herein, a single-stranded antisense oligonucleotide), or may be a “hairpin oligonucleotide” that has at least one region that is self-complementary.

[0046] As used herein, “cell-targeting moiety” means a conjugate moiety or portion of a conjugate moiety that has affinity for a particular cell type or particular cell types. For example, a cell-targeting moiety may have affinity for a surface moiety, such as a surface receptor on a particular cell type.

[0047] 25 As used herein, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF.

[0048] As used herein, “cleavable moiety” means a bond or a group of atoms comprising at least one bond that is cleaved under physiological conditions, that is, in a cell or a subject. For example, a cleavable moiety is cleaved inside 30 a cell or a sub-cellular compartment, such as an endosome or lysosome. A cleavable moiety may be cleaved by endogenous enzymes, such as nucleases.

[0049] As used herein, “complementary nucleobase(s)”, “complementary nucleobase pairs”, or “complementary” in reference to nucleobase(s) means nucleobases that form hydrogen bonds with one another. Complementary nucleobase pairs include, but are not limited to, adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine 35 (G), 5-methylcytosine (mC) and guanine (G), hypoxanthine (I) and thymine (T), hypoxanthine and adenine (A), hypoxanthine (I) and uracil (U), hypoxanthine (I) and cytosine (C), and hypoxanthine (I) and 5-methylcytosine (mC).

[0050] 5 BIOL0482WO

[0051] Hypoxanthine is the nucleobase of the nucleoside inosine. Certain modified nucleobases that are complementary to unmodified nucleobases or to other modified nucleobases are known in the art.

[0052] As used herein, “complementary nucleobase sequence(s)” or “complementary” in reference to a nucleobase sequence(s) refers to two nucleobase sequences in which some, a majority, or all of the nucleobases in the two 5 nucleobase sequences are complementary nucleobases when the sequences are aligned.

[0053] As used herein, “complementary region” in reference to a strand of linked nucleosides (e.g., an oligonucleotide or a target nucleic acid) is a region of the strand of linked nucleosides in which the nucleobase sequence of the region is complementary with the nucleobase sequence of an equal-length region of a separate strand of linked nucleosides (e.g., an oligonucleotide and a target nucleic acid, or an antisense oligonucleotide and a sense 10 oligonucleotide), or the nucleobase sequence of an equal-length region within the strand of linked nucleosides (e.g., in a “hairpin oligonucleotide”). A complementary region of a strand of linked nucleosides may be a portion of a strand of linked nucleosides or may include the entire strand of linked nucleosides. A complementary region may include a mismatch, but the nucleobases of the terminal nucleosides of a complementary region are complementary to the nucleobases of the terminal nucleosides of the equal-length region of the separate strand of linked nucleosides or to 15 the nucleobases of the terminal nucleosides of the equal-length region within the strand of linked nucleosides. A “targeting region” of an oligonucleotide, means a complementary region in which the nucleobase sequence of the region is complementary to the nucleobase sequence of a target region of a target nucleic acid. A targeting region of a strand of linked nucleosides may be a portion of a strand of linked nucleosides or may include the entire strand of linked nucleosides. A “duplexing region” is a complementary region of an oligonucleotide (e.g., an antisense or sense 20 oligonucleotide) having a nucleobase sequence that is complementary to the nucleobase sequence of a second oligonucleotide or region thereof. A duplexing region may be a portion of a strand of linked nucleosides or may include the entire strand of linked nucleosides.

[0054] As used herein, “conjugate group” means a group of atoms that is directly attached to an oligonucleotide. A conjugate group comprises a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the 25 oligonucleotide.

[0055] As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

[0056] As used herein, “conjugate moiety” means a group of atoms that when covalently bound to a molecule (e.g., an oligonucleotide) modifies one or more properties of such molecule compared to the same molecule lacking the 30 conjugate moiety, wherein such properties include, but are not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0057] As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

[0058] 35 As used herein, “deoxy region” means a region of 5-12 contiguous nucleosides, wherein at least 70% of the nucleosides are DNA nucleosides. Each nucleoside of the deoxy region is selected from a 2’-deoxynucleoside and a 2’-substituted nucleoside. A deoxy region supports RNase H activity.

[0059] 6 BIOL0482WO

[0060] As used herein, “DNA nucleoside” means a nucleoside comprising an unmodified DNA sugar moiety. A DNA nucleoside may comprise a modified or unmodified nucleobase. A DNA nucleoside may comprise a uracil nucleobase or a modified nucleobase, or may be an abasic nucleoside.

[0061] As used herein, “DNA sugar moiety” means an unmodified DNA sugar moiety.

[0062] 5 As used herein, “double-stranded” in reference to a strand of linked nucleosides (e.g., an oligonucleotide) or a region thereof, means that the strand of linked nucleosides or region thereof is paired with a complementary strand of linked nucleosides or a region thereof. Paired complementary regions of two separate strands of linked nucleosides form a duplex of the separate strands. Paired complementary regions of a single strand of linked nucleosides form a “hairpin”.

[0063] 10 As used herein, “duplex” means a structure formed by hybridization of complementary base pairs between two strands of linked nucleosides or regions thereof (e.g., two separate oligonucleotides or an oligonucleotide and a target nucleic acid). For clarity, herein a “hairpin oligonucleotide” is a single strand of linked nucleosides that comprises a region that is double stranded and is not considered a duplex.

[0064] As used herein, a “furanosyl sugar moiety" is a group of atoms that comprises a furanose ring, and is 15 numbered according to the structure below, with optional additional substituents at any of the 1’, 2’, 3’, 4’, and 5’ positions.

[0065] mer” means a modified oligonucleotide comprising an internal region positioned

[0066]

[0067] between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region 20 are chemically distinct from the nucleoside or nucleosides comprising the external regions, and wherein the modified oligonucleotide supports RNAse H cleavage. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5’-end of the internal region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In 25 certain embodiments, each nucleoside of the gap is a 2’-β-D-deoxynucleoside. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2’-β-D-deoxynucleosides and wings comprising 2’-MOE nucleosides. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and / or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

[0068] 30 As used herein, “hybridize” or “hybridization” means the process of two complementary regions of strands of linked nucleosides (e.g., oligonucleotides, nucleic acids) annealing together to form a double-stranded region. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0069] 7 BIOL0482WO

[0070] As used herein, “internucleoside linkage” means the covalent linkage between immediately adjacent nucleosides in an oligonucleotide. As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. A “phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside 5 linkage is replaced with a sulfur atom. A “mesyl phosphoramidate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with NS(=O)2CH3. Unless otherwise indicated, for linked nucleosides comprising furanosyl sugar moieties, an internucleoside linkage joins the 3’-carbon of one furanosyl sugar moiety to the 5’-carbon of the other furanosyl sugar moiety.

[0071] 10 As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., nucleosides immediately adjacent to one another, no additional nucleosides are presented between those that are linked).

[0072] As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric 15 compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

[0073] As used herein, a “mismatch” between two aligned strands of linked nucleosides means that the two nucleobases at a specified position of the two aligned nucleobase sequences are not complementary nucleobases.

[0074] As used herein, “modified nucleoside” means a nucleoside where the sugar moiety is modified and / or the 20 nucleobase is modified or absent.

[0075] As used herein, “modified sugar moiety” means a group of atoms, other than an unmodified sugar moiety, that forms the portion of a nucleoside corresponding to the β-D-ribosyl sugar in RNA or the β-D-deoxyribosyl sugar in DNA. A modified sugar moiety is selected from a modified furanosyl sugar moiety, a cyclic sugar surrogate, an acyclic sugar surrogate, or a sugar mimic.

[0076] 25 As used herein, a “modified nucleobase” means a nucleobase other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methylcytosine” (mC) is a modified nucleobase. Inosine (I) is a nucleoside comprising the modified nucleobase hypoxanthine.

[0077] As used herein, “motif” means a pattern of independently unmodified and / or independently modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0078] 30 As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase.

[0079] As used herein “nucleobase sequence” means the order of contiguous nucleobases in a strand of linked nucleosides or a region thereof (e.g., an oligonucleotide or region thereof, or a target nucleic acid or region thereof) independent of any sugar or internucleoside linkage modification. Complementary nucleobase sequences may be nucleobase sequences of two separate strands of linked oligonucleotide subunits or regions thereof (e.g., an 35 oligonucleotide and a region of a target nucleic acid, or an antisense oligonucleotide and its paired sense oligonucleotide) or complementary nucleobase sequences may be nucleobase sequences of two regions of a single strand (e.g., self-complementary regions of a hairpin oligonucleotide). As used herein, when a first strand of linked

[0080] 8 BIOL0482WO

[0081] nucleosides (e.g., an oligonucleotide) or region thereof is described as being complementary to a second strand of linked nucleosides (e.g., a target nucleic acid or another oligonucleotide) it means that the nucleobase sequence of the first strand of linked nucleosides or region thereof is complementary to the nucleobase sequence of the second strand of linked nucleosides or region thereof when aligned. Not every pair of nucleobases in the aligned nucleobase 5 sequences needs to be complementary for the two sequences to be “complementary.” Rather, some mismatches are tolerated. Where nucleobase sequence complementarity is expressed as a percent, such percent represents the percentage of nucleobases within one nucleobase sequence that are complementary to nucleobases within an equal length second nucleobase sequence when the nucleobase sequences are aligned. Unless otherwise specified, “complementary” is assumed to be at least 70%. Complementary nucleobase sequences may be 75%, 80%, 85%, 90%, 10 95%, or 100% complementary. For example, if a nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is 80% complementary to another nucleobase sequence, then 16 of the nucleobase pairs are complementary nucleobases, and there are 4 mismatches when the sequences are aligned. If a nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is at least 80% complementary to another nucleobase sequence, then 16, 17, 18, 19, or 20 of the nucleobase pairs are complementary nucleobases, and there are 0-4 mismatches when the 15 sequences are aligned. As used herein, “fully complementary” or “100% complementary” means that each nucleobase pair of the two nucleobase sequences is complementary when the equal length sequences are aligned.

[0082] As used herein, “the nucleobase sequence of” a reference SEQ ID NO, refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, unless otherwise indicated, includes compounds wherein each sugar moiety and each internucleoside linkage, independently, is modified or unmodified, irrespective of the presence or 20 absence of modifications indicated in the referenced SEQ ID NO.

[0083] As used herein, “nucleoside” means an “unmodified nucleoside” or a “modified nucleoside”.

[0084] As used herein, “nucleoside overhang” or “overhang” refers to unpaired nucleosides at either or both ends of an oligomeric duplex. The nucleosides of an overhang are not part of the “duplexing region” of either of the two strands of linked nucleosides.

[0085] 25 As used herein, “oligomeric agent” means a compound or complex comprising or consisting of at least one modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more additional modified or unmodified oligonucleotides, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate groups, which may be covalently attached directly or indirectly to any oligonucleotide of such oligomeric agent; and (c) one or more terminal groups.

[0086] 30 Herein, where two oligonucleotides are described as being covalently attached to one another, such attachment is other than through a direct internucleoside linkage. Thus, a single, unbranched oligonucleotide comprising only direct internucleoside linkages cannot be described as two separate covalently linked oligonucleotides.

[0087] As used herein, “oligonucleotide” means a strand of linked nucleosides, wherein each nucleoside and / or internucleoside linkage of the strand of linked nucleosides may be independently modified or unmodified. Unless 35 otherwise indicated, oligonucleotides consist of 12-50 linked nucleosides. Unless otherwise indicated, no more than 10% of the nucleosides of an oligonucleotide are abasic nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside and / or internucleoside linkage is modified. As used herein,

[0088] 9 BIOL0482WO

[0089] “unmodified oligonucleotide” means an oligonucleotide consisting of unmodified nucleosides linked by phosphodiester internucleoside linkages. An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide to form an oligomeric duplex, or it may be unpaired.

[0090] As used herein “pharmaceutical composition” means a mixture of substances suitable for administration to a 5 subject. For example, a pharmaceutical composition may comprise an oligomeric agent and a sterile aqueous solution.

[0091] A pharmaceutical composition may show activity in certain cell lines.

[0092] As used herein, “pharmaceutically acceptable diluent” means an ingredient in a pharmaceutical composition suitable for use in administering to a subject. Typically, a “diluent” lacks pharmacological activity but is desirable in preparing a pharmaceutical composition. Examples of pharmaceutically acceptable diluents include water, saline, 10 phosphate-buffered saline, and artificial cerebrospinal fluid. Unless otherwise indicated, the pharmaceutically acceptable diluent is sterile.

[0093] As used herein “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0094] 15 As used herein, “RNA sugar moiety” means an unmodified RNA sugar moiety.

[0095] As used herein, “RNA nucleoside” means a nucleoside comprising an RNA sugar moiety. An RNA nucleoside may comprise a modified or unmodified nucleobase. An RNA nucleoside may comprise a thymine nucleobase or a modified nucleobase or may be an abasic nucleoside.

[0096] As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to 20 modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent modulates the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H.

[0097] 25 As used herein, “RNase H agent” means an antisense agent that acts, at least in part, through RNase H to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNase H agents may be single-stranded or RNase H agents may be double-stranded. RNase H compounds may comprise conjugate groups and / or terminal groups. RNase H agents may modulate the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC / Ago2.

[0098] 30 As used herein, “single-stranded” in reference to a strand of linked nucleosides (e.g., an oligonucleotide) means that the strand or region is unpaired, that is, the strand of linked nucleosides is not part of a duplex or part of a double-stranded region. For clarity, herein a “hairpin oligonucleotide” is not a “single-stranded oligonucleotide”, though it may comprise a portion that is unpaired (e.g., a loop or terminal region) as well as portions that are double- stranded. Single-stranded nucleic acids (e.g., single-stranded oligonucleotides) are capable of hybridizing to 35 complementary nucleic acids to form duplexes, at which point they are no longer single-stranded.

[0099] As used herein, “stabilized phosphate moiety” means a 5’-phosphate analog that is metabolically more stable than a 5’-phosphate as naturally occurs on DNA or RNA.

[0100] 10 BIOL0482WO

[0101] As used herein, “standard cell assay” means the assays described in the Examples and reasonable variations thereof.

[0102] As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following 5 synthesis, for a particular absolute stereochemical configuration at that chiral center. The absolute stereochemical configuration of a chiral center can be controlled by using stereochemically-pure starting materials, e.g., using β-D- ribosyl nucleoside monomers for oligonucleotide synthesis. In contrast, the stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of 10 molecules having the (S) configuration of the stereorandom chiral center may be the same as the number of molecules having the (R) configuration of the stereorandom chiral center (“racemic”). The stereorandom chiral center may not be racemic because one absolute configuration predominates following synthesis, e.g., due to the action of non-chiral reagents near the enriched stereochemistry of an adjacent sugar moiety. The stereorandom chiral center may be at the phosphorous atom of a stereorandom phosphorothioate or stereorandom mesyl phosphoramidate internucleoside 15 linkage.

[0103] As used herein, a “strand” or “strand of linked nucleosides” means contiguous linked nucleosides, nucleoside mimics, and / or abasic subunits connected via internucleoside linkages. A strand of linked nucleosides has a nucleobase sequence.

[0104] As used herein, “subject” means a human or a non-human animal.

[0105] 20 As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety.

[0106] As used herein, “symptom” of a disease means any manifestation, indication, sign, hallmark, or evidence of a disease. Symptoms include subjective and objective indicia of a disease and may be perceived, experienced, detected, observed, measured, and / or quantified. A symptom may be apparent only upon invasive diagnostic testing, including, but not limited to, post-mortem tests. A symptom may be an absence of a feature, such as failing to reach expected 25 developmental milestones. Symptoms may include developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies (e.g., atrial septal defect, ventral septal defect, patent ductus arteriosus, bicuspid aortic valve, dysplastic aortic and pulmonary valves, patent foramen ovale), ocular abnormalities (e.g., coloboma of iris, retina, and / or optic nerve, as 30 well as myopia, strabismus, or nystagmus), brain abnormalities (e.g., hypoplasia or partial agenesis cerebellar vermis, mild colpocephaly, ventriculomegaly / hydrocephalus ex vacuo, thin corpus callosum, frontal cortical dysplasia, paucity of cerebral white matter, mild delay in myelination, and hyperintensity of periventricular white matter), and / or microcephaly.

[0107] As used herein, “target nucleic acid” means a PACS1 nucleic acid that an antisense oligonucleotide is 35 designed to affect. As used herein, “target RNA” means a PACS1 RNA transcript and includes pre-mRNA and / or mRNA unless otherwise specified.

[0108] 11 BIOL0482WO

[0109] As used herein, “target region” means a portion of a target nucleic acid (e.g., PACS1) that is complementary to the targeting region of an antisense oligonucleotide.

[0110] As used herein, “treating,” or “treatment,” with respect to a disease, means administering a compound or an oligomeric agent to a subject having or at risk for developing such disease. Treating a disease may result in 5 amelioration of at least one symptom of such disease. Treatment may reduce, improve, and / or prevent one or more symptom(s) such that a symptom of the disease is diminished or is no longer apparent.

[0111] As used herein, “unmodified nucleobase” means unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G).

[0112] As used herein, an “unmodified nucleoside” means a compound or subunit comprising an unmodified sugar 10 moiety and an unmodified nucleobase.

[0113] As used herein, “unmodified sugar moiety” means a 2’-OH(H) β-D-ribosyl sugar moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties are furanosyl or deoxyfuranosyl sugar moieties in the β-D-ribosyl stereochemical configuration, and have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ 15 position, two hydrogens at the 5’ position and two hydrogens (DNA) or a hydrogen and an OH (RNA) at the 2’ position.

[0114] EMBODIMENTS

[0115] Embodiment 1. An oligomeric agent comprising a modified oligonucleotide according to the following 20 chemical notation:

[0116] AesGeomCeomCeoAesmCdsAdsTdsAdsAdsmCdsmCdsmCdsGdsTdsAeoGeoGesAesmCe(SEQ ID NO: 12), wherein:

[0117] A = an adenine nucleobase,

[0118] mC = a 5-methylcytosine nucleobase;

[0119] 25 G = a guanine nucleobase;

[0120] T = a thymine nucleobase;

[0121] e = a 2’-MOE sugar moiety;

[0122] d = a 2’-β-D-deoxyribosyl sugar moiety;

[0123] s = a phosphorothioate internucleoside linkage; and

[0124] 30 o = a phosphodiester internucleoside linkage; and

[0125] wherein the oligomeric compound optionally comprises a conjugate group and / or a terminal group.

[0126] Embodiment 2. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation:

[0127] N1esGeomCeomCeoAesmCdsAdsTdsAdsAdsmCdsmCdsmCdsGdsTdsAeoGeoGesAesmCe(SEQ ID NO: 13), 35 wherein:

[0128] A = an adenine nucleobase,

[0129] mC = a 5-methylcytosine nucleobase;

[0130] 12 BIOL0482WO

[0131] G = a guanine nucleobase;

[0132] T = a thymine nucleobase;

[0133] e = a 2’-MOE sugar moiety;

[0134] d = a 2’-β-D-deoxyribosyl sugar moiety;

[0135] 5 s = a phosphorothioate internucleoside linkage;

[0136] o = a phosphodiester internucleoside linkage;

[0137] N1= an adenine nucleobase, a modified adenine nucleobase, a hypoxanthine nucleobase, an abasic sugar moiety, a terminal group, or is absent, wherein when N1is absent its sugar and internucleoside linkage are also absent; and wherein the oligomeric compound optionally comprises a conjugate group and / or a terminal group.

[0138] 10 Embodiment 3. The oligomeric agent of embodiment 2, wherein N1is an adenine nucleobase.

[0139] Embodiment 4. The oligomeric agent of embodiment 2, wherein N1is a modified adenine nucleobase. Embodiment 5. The oligomeric agent of embodiment 2, wherein N1is a hypoxanthine nucleobase.

[0140] Embodiment 6. The oligomeric agent of embodiment 2, wherein N1is an abasic sugar moiety.

[0141] Embodiment 7. The oligomeric agent of embodiment 2, wherein N1is a terminal group.

[0142] 15 Embodiment 8. The oligomeric agent of embodiment 2, wherein N1is absent.

[0143] Embodiment 9. The oligomeric agent of any one of embodiments 1-8, consisting of the modified oligonucleotide.

[0144] Embodiment 10. The oligomeric agent of any one of embodiments 1-9, wherein the oligomeric agent comprises a conjugate group.

[0145] 20 Embodiment 11. The oligomeric agent of embodiment 10, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0146] Embodiment 12. The oligomeric agent of claim 11, wherein the conjugate linker is cleavable. Embodiment 13. The oligomeric agent of embodiment 11 or embodiment 12, wherein the conjugate linker consists of a single bond.

[0147] 25 Embodiment 14. The oligomeric agent of any one of embodiments 11-13, wherein the conjugate linker comprises 1-3 linker-nucleosides.

[0148] Embodiment 15. The oligomeric agent of any one of embodiments 11-13, wherein the conjugate linker does not comprise any linker nucleosides.

[0149] Embodiment 16. The oligomeric agent of any one of embodiments 10-15, wherein the conjugate group is 30 attached to the modified oligonucleotide at the 5’-end of the modified oligonucleotide.

[0150] Embodiment 17. The oligomeric agent one of any one of embodiments 10-15, wherein the conjugate group is attached to the modified oligonucleotide at the 3’-end of the modified oligonucleotide.

[0151] Embodiment 18. The oligomeric agent one of any one of embodiments 1 to 17, wherein the oligomeric agent comprises a terminal group.

[0152] 35 Embodiment 19. The oligomeric agent of embodiment 18, wherein the terminal group is an abasic sugar moiety.

[0153] 13 BIOL0482WO

[0154] Embodiment 20. The oligomeric compound of any of embodiments 1-19, wherein the oligomeric compound is a pharmaceutically acceptable salt.

[0155] Embodiment 21. The oligomeric compound of embodiment 20, wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

[0156] 5 Embodiment 22. The oligomeric agent of any one of embodiments 1-21, wherein the oligomeric agent is a singled-stranded oligomeric agent.

[0157] Embodiment 23. A modified oligonucleotide according to the following chemical structure:

[0158] NH2O O

[0159] N N NH NHHO

[0160] 22N2N O O

[0161]

[0162] 10 Embodiment 24. The modified oligonucleotide of embodiment 23, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0163] 14 BIOL0482WO

[0164] Embodiment 25. The modified oligonucleotide of embodiment 24, which is the sodium salt or the potassium salt.

[0165] Embodiment 26. A modified oligonucleotide according to the following chemical structure:

[0166] NH2O O

[0167] 2

[0168] 2

[0169] N

[0170] 2N O O

[0171] 5

[0172]

[0173] Embodiment 27. A population of oligomeric agents of any one of embodiments 1-22 or a population of modified oligonucleotides of any one of embodiments 23-26, wherein each of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

[0174] Embodiment 28. A pharmaceutical composition comprising an oligomeric agent of any one of

[0175] 10 embodiments 1-22, a modified oligonucleotide of any one of embodiments 23-26, or a population of embodiment 27, and a pharmaceutically acceptable diluent.

[0176] Embodiment 29. The pharmaceutical composition of embodiment 28, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, water, or phosphate-buffered saline.

[0177] 15 BIOL0482WO

[0178] Embodiment 30. The pharmaceutical composition of embodiment 28 or embodiment 29, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and artificial cerebrospinal fluid.

[0179] Embodiment 31. The pharmaceutical composition of any one of embodiments 28-30, wherein the 5 pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and phosphate-buffered saline.

[0180] Embodiment 32. A method comprising administering to a subject the oligomeric agent of any one of embodiments 1-22, the modified oligonucleotide of any one of embodiments 23-26, the population of embodiment 27, or the pharmaceutical composition of any one of embodiments 28-31.

[0181] 10 Embodiment 33. The method of embodiment 32, wherein the subject has or is at risk for developing a disease associated with PACS1.

[0182] Embodiment 34. The method of embodiment 32 or embodiment 33, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition ameliorates at least one symptom of a disease associated with PACS1.

[0183] 15 Embodiment 35. The method of embodiment 34, wherein the at least one symptom of the disease associated with PACS1 comprises developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, motor disturbances, congenital heart anomalies, ocular abnormalities, brain abnormalities, or microcephaly.

[0184] 20 Embodiment 36. The method of any one of embodiments 32-35, wherein PACS1 protein levels in the subject are reduced.

[0185] Embodiment 37. The method of any one of embodiments 33-36, wherein the disease associated with PACS1 is a neurodegenerative disease.

[0186] Embodiment 38. The method of embodiment 37, wherein the disease associated with PACS1 is a PACS1-25 neurodevelopmental disorder (PACS1-NDD).

[0187] Embodiment 39. A method of treating a disease associated with PACS1 comprising administering to a subject having or at risk for developing the disease associated with PACS1 a therapeutically effective amount of the oligomeric agent of any one of embodiments 1-22, the modified oligonucleotide of any one of embodiments 23-26, the population of embodiment 27, or the pharmaceutical composition of any one of embodiments 28-31, thereby 30 treating the disease or disorder associated with PACS1.

[0188] Embodiment 40. The method of embodiment 39, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition ameliorates at least one symptom of the disease associated with PACS1.

[0189] Embodiment 41. The method of embodiment 39 or embodiment 40, wherein the at least one symptom of 35 the disease associated with PACS1 comprises developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum

[0190] 16 BIOL0482WO

[0191] disorder, temper tantrums, aggression, anxiety, motor disturbances, congenital heart anomalies, ocular abnormalities, brain abnormalities, or microcephaly.

[0192] Embodiment 42. The method of any one of embodiments 39-41, wherein PACS1 protein levels in the subject are reduced.

[0193] 5 Embodiment 43. The method of any one of embodiments 39-42, wherein the disease associated with PACS1 is a neurodegenerative disease.

[0194] Embodiment 44. The method of embodiment 4432, wherein the disease associated with PACS1 is a PACS1-neurodevelopmental disorder (PACS1-NDD).

[0195] Embodiment 45. The method of any one of embodiments 39-44, wherein the subject is human.

[0196] 10 Embodiment 46. A method of reducing expression of PACS1 in a cell comprising contacting the cell with the oligomeric agent of any one of embodiments 1-22, the modified oligonucleotide of any one of embodiments 23- 26, the population of embodiment 27, or the pharmaceutical composition of any one of embodiments 28-31.

[0197] Embodiment 47. The method of embodiment 46, wherein the cell is a neuron or an oligodendrocyte. Embodiment 48. The method of embodiment 46 or embodiment 47, wherein the cell is a human cell. 15 Embodiment 49. Use of an oligomeric agent of any one of embodiments 1-00, a modified oligonucleotide of any one of embodiments 23-26, a population of embodiment 27, or a pharmaceutical composition of any one of embodiments 28-31 for treating a disease associated with PACS1.

[0198] Embodiment 50. Use of an oligomeric agent of any one of embodiments 1-22, a modified oligonucleotide of any one of embodiments 23-26, a population of embodiment 27, or a pharmaceutical composition of any one of 20 embodiments 28-31 in the manufacture of a medicament for treating a disease associated with PACS1.

[0199] Embodiment 51. The use of embodiment 49 or embodiment 50, wherein the disease associated with PACS1 is associated with an elevated level of PACS1.

[0200] Embodiment 52. The use of any one of embodiments 49-51, wherein the disease or disorder associated with PACS1 is a neurodegenerative disease.

[0201] 25 Embodiment 53. The method of embodiment 52, wherein the disease associated with PACS1 is a PACS1- neurodevelopmental disorder (PACS1-NDD).

[0202] I. Oligomeric Agents

[0203] Provided herein are oligomeric agents comprising or consisting of at least one modified oligonucleotide and 30 optionally one or more additional associated features selected from: (a) one or more additional modified or unmodified oligonucleotide, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate group, which may be covalently attached to any oligonucleotide of such oligomeric agent; and (c) one or more terminal group. In some embodiments, provided herein are oligomeric agents comprising or consisting of a modified antisense oligonucleotide complementary to PACS1 RNA. In certain 35 such embodiments, an oligomeric agent consists of a modified antisense oligonucleotide complementary to PACS1 RNA and a conjugate group attached to the modified antisense oligonucleotide. In some embodiments, provided herein are oligomeric agents comprising an oligomeric duplex comprising or consisting of an antisense oligonucleotide

[0204] 17 BIOL0482WO

[0205] complementary to PACS1 RNA and a sense oligonucleotide complementary to the antisense oligonucleotide, wherein one or both of the antisense and sense oligonucleotides is / are modified. In certain such embodiments, an oligomeric agent consists of an antisense oligonucleotide complementary to PACS1 RNA, a sense oligonucleotide complementary to the antisense oligonucleotide, and a conjugate group and / or terminal group attached to one or both of the antisense 5 oligonucleotide and the sense oligonucleotide. Modified antisense oligonucleotides and / or sense oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase and / or lacking a nucleobase) and / or at least one modified internucleoside linkage. Examples of certain modified nucleosides and modified internucleoside linkages suitable for use in modified antisense and / or sense oligonucleotides are described herein.

[0206] 10 A. Modified Nucleosides

[0207] Modified nucleosides comprise a modified sugar moiety, a modified nucleobase, or a combination thereof. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases may be incorporated into modified antisense oligonucleotides and / or sense oligonucleotides described herein.

[0208] 15 1. Modified Sugar Moieties

[0209] Modified sugar moieties include modified furanosyl sugar moieties, cyclic sugar surrogates, acyclic sugar surrogates, and sugar mimics. In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic modified furanosyl sugar moieties. In certain 20 embodiments, modified sugar moieties are sugar surrogates. Sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

[0210] In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more substituent groups including, but not limited to, substituents at the 2’, 3’, 4’, and / or 5’ positions, as numbered based on ribose:

[0211] 25

[0212] ments, the modified furanosyl sugar moiety is a ribosyl sugar moiety that is not an

[0213]

[0214] unmodified sugar moiety (i.e., an unmodified RNA or unmodified DNA moiety). In certain embodiments, the modified furanosyl sugar moiety is a xylosyl, lyxosyl, or arabinosyl sugar moiety. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.

[0215] 30 In certain embodiments, non-bicyclic modified sugar moieties are 2’-substituted sugar moieties and comprise a substituent group at the 2’-position. Examples of substituent groups suitable for the 2’-position of modified sugar moieties include but are not limited to: F, OCH3(“OMe” or “O-methyl”), and O(CH2)2OCH3(“MOE” or “O- methoxyethyl”). In certain embodiments, 2’-substituent groups are selected from: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10alkoxy, O-C1-C10substituted alkoxy, O-C1-C10alkyl, O-C1-C10substituted alkyl, S-alkyl,

[0216] 18 BIOL0482WO

[0217] N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl, - O(CH2)2ON(CH3)2(“DMAOE”), or -O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”). Synthetic methods for some of these 5 2’-substituent groups may be found, e.g., in Cook et al., U.S.6,531,584; Cook et al., U.S.5,859,221; and Cook et al., U.S.6,005,087. Certain embodiments of these 2'-substituent groups may be further substituted with one or more substituent groups independently selected from: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0218] In certain embodiments, a 2’-substituted sugar moiety comprises a non-bridging 2’-substituent group selected 10 from: F, NH2, N3, OCF3,OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl.

[0219] In certain embodiments, a 2’-substituted sugar moiety comprises a non-bridging 2’-substituent group selected from: F, OCF3,OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, 15 O(CH2)2ON(CH3)2(“DMAOE”), O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”), and OCH2C(=O)-N(H)CH3(“NMA”).

[0220] In certain embodiments, a 2’-substituted sugar moiety comprises a non-bridging 2’-substituent group selected from: F, OCF3,OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3(“NMA”).

[0221] In certain embodiments, a 2’-substituted sugar moiety comprises a 2’-substituent group selected from: OCH320 and OCH2CH2OCH3.

[0222] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by stereochemical configuration. For example, a 2’-deoxyfuranosyl sugar moiety (i.e., 2’-(H)H furanosyl sugar moiety) may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified furanosyl sugar moieties are described in, e.g., WO 25 2020 / 072991, incorporated by reference herein. A 2’-modified furanosyl sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible stereochemical configurations. Modified furanosyl sugar moieties described herein are in the β-D-ribosyl stereochemical configuration unless otherwise specified.

[0223] Certain modified furanosyl sugar moieties are bicyclic sugar moieties and comprise a substituent that bridges 30 two atoms of the furanosyl ring to form a second ring. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4’ to 2’ bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH2-O-CH2- 2’, 4’-CH2-N(R)-2’, 4'-CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof, 4'-C(CH3)(CH3)-35 O-2' and analogs thereof, 4'-CH2-N(OCH3)-2' and analogs thereof , 4'-CH2-O-N(CH3)-2' , 4'-CH2-C(H)(CH3)-2', 4'- CH2-C(=CH2)-2' and analogs thereof , 4’-C(RaRb)-N(R)-O-2’, 4’-C(RaRb)-O-N(R)-2’, 4'-CH2-O-N(R)-2', and 4'-CH2- N(R)-O-2', wherein each R, Ra, and Rbis, independently, H, a protecting group, or C1-C12alkyl. Representative U.S.

[0224] 19 BIOL0482WO

[0225] patents that teach the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., U.S.

[0226] 7,427,672; Swayze et al., U.S.7,741,457; Swayze et al., U.S.8,022,193; Seth et al., U.S.8,278,283; Prakash et al., U.S.8,278,425; and Seth et al., U.S.8,278,426.

[0227] 2. Modified Nucleobases

[0228] 5 In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides contain no abasic nucleosides. In certain embodiments, modified oligonucleotides comprise one or 10 more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). An “unmodified nucleobase” is unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G). A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0229] 15 Unless otherwise indicated, modified adenine has structure (I):

[0230] I

[0231] wherein:

[0232]

[0233] , C1-C6alkyl, substituted C1-C6alkyl, C1-C6thioalkyl, or substituted C1- C6thioalkyl, C1-C6alkyloxy, or substituted C1-C6alkyloxy; R6Ais H, N(Ra)(Rb), oxo, acetyl, formyl, or O-phenyl; Y7Ais N and R7Ais absent or is C1-C6alkyl; or Y7Ais C and R7Ais H, C1-C6alkyl, or N(Ra)(Rb); Y8Ais N and R8Ais 20 absent, or Y8Ais C and R8Ais H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare each independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R2Ais H, and R6Ais NH2(unmodified adenine).

[0234] Unless otherwise indicated, modified guanine has structure (II):

[0235] 25 II

[0236] wherein:

[0237]

[0238] nd R1Gis H, or R6Gis O-C1-C6alkyl or S-C1-C6alkyl and R1Gis absent; Y7Gis N and R7Gis absent or is C1-C6alkyl; or Y7Gis C and R7Gis H, C1-C6alkyl, or N(Ra)(Rb); Y8Gis N and R8Gis absent, or Y8Gis C and R8Gis H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, or formyl, or

[0239] 20 BIOL0482WO

[0240] together form a 5-7-membered heterocycle; excluding where Y7Gis N and R7Gis absent; Y8Gis C, R8Gis H, R2Gis NH2, and R6Gis =O (unmodified guanine).

[0241] Unless otherwise indicated, modified thymine or modified uracil has structure (III):

[0242] III

[0243] 5 wherein: endently O or S and R5Uis H, OH, halogen, O-C1-C20alkyl, O-C1-C12substituted alkyl, C1-C12alky

[0244]

[0245] l, substituted C1-C12alkyl, C1-C12alkenyl, substituted C1-C12alkenyl, C1-C12alkynyl, or substituted C1-C12alkynyl; wherein if each X is O, R5Uis not H or CH3(unmodified uracil and unmodified thymine, respectively).

[0246] Unless otherwise indicated, modified cytosine has structure (IV):

[0247] V

[0248] 10 wherein: N(Ra)(Rb); R5Cis H, OH, halogen, O-C1-C12alkyl, O-C1-C12substituted alkyl,

[0249]

[0250] C1-C12alkyl , substituted C1-C12alkyl, C1-C12alkenyl, or substituted C1-C12alkenyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, C1-C12alkynyl, substituted C1-C12alkynyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where X is O, R4Cis NH2and R5Cis H (unmodified cytosine). As used herein, a “5-methylcytosine nucleobase” is a modified cytosine where X is O, 15 R4Cis NH2, and R5Cis methyl.

[0251] Hypoxanthine has structure (V):

[0252] V

[0253] Hypoxa

[0254]

[0255] a modified adenine, where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais H, R2Ais H, and R6Ais oxo.

[0256] 20 In certain embodiments, modified nucleobases of a modified oligonucleotide are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, hypoxanthine, 1-methylpseudouridine, 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl 25 (-CºC-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo (particularly

[0257] 21 BIOL0482WO

[0258] 5-bromo), 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2- aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N- isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N- benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases.

[0259] 5 Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3- diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7- deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleobases include those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense 10 Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.

[0260] Publications that teach the preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases include, without limitation, Rogers et al., U.S. 5,134,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S.5,502,177; Froehler et al., U.S.5,594,121; and Cook et al., U.S.5,681,941.

[0261] 15 In certain embodiments, at least one nucleobase of a modified oligonucleotide is a modified nucleobase selected from modified adenine (A) having a structure represented by structure I, modified guanine (G) having a structure represented by structure II, modified thymine (T) or modified uracil (U) having a structure represented by structure III, and modified cytosine (C) having a structure represented by structure IV. In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, 20 unmodified T, unmodified U, andmC.

[0262] In certain embodiments, there are no modified nucleobases in a modified oligonucleotide and each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U.

[0263] 3. Modified Internucleoside Linkages

[0264] 25 In certain embodiments, oligomeric agents provided herein comprise or consist of a modified oligonucleotide comprising at least one modified internucleoside linkage. The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Herein, all internucleoside linkages between furanosyl sugar moieties are 3’ to 5’ internucleoside linkages unless otherwise indicated. In certain embodiments, nucleosides of modified oligonucleotides are linked together using one or more modified internucleoside linkages. The two main classes of 30 internucleoside linkages are defined by the presence or absence of a phosphorus atom. Representative phosphorus- containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing internucleoside linkages include but are not limited to methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, 35 thionocarbamate (-O-C(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-).

[0265] Modified internucleoside linkages, compared to naturally occurring phosphodiester linkages, may be used to alter, e.g., typically increase, the nuclease resistance of the oligonucleotide.

[0266] 22 BIOL0482WO

[0267] In certain embodiments, a modified internucleoside linkage is any of those described in WO 2021 / 030778, incorporated by reference herein. In certain embodiments, a modified internucleoside linkage has the formula:

[0268] wherein y for each internucleoside linkage of the modified oligonucleotide:

[0269] 5 X is O o

[0270]

[0271] R1is H, C1-C6alkyl, or substituted C1-C6alkyl; and

[0272] T is SO2R2, C(=O)R3, or P(=O)R4R5, wherein:

[0273] R2is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6alkoxy, C1-C6alkyl, C1-C610 alkenyl, C1-C6alkynyl, substituted C1-C6alkyl, substituted C1-C6alkenyl, substituted C1-C6alkynyl, and a conjugate group;

[0274] R3is selected from an aryl, a substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group;

[0275] R4is selected from OCH3, OH, C1-C6alkyl, substituted C1-C6alkyl, and a conjugate group; and R5is selected from OCH3, OH, C1-C6alkyl, and substituted C1-C6alkyl.

[0276] 15 In certain embodiments, a modified oligonucleotide comprises a mesyl phosphoramidate linkage having the formula:

[0277] Certain

[0278]

[0279] linkages having reduced charge (referred to as “neutral internucleoside linkages”) have been described. Such neutral internucleoside linkages include, without limitation, phosphotriesters, 20 methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)- 5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP) (see US 9,926,556), and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral 25 internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2component parts.

[0280] In certain embodiments, a modified oligonucleotide comprises an internucleoside linkage comprising a triazole, alkyne, or cyclic guanidine moiety. In certain embodiments, a modified oligonucleotide comprises an internucleoside linkage having a formula:

[0281] 23 BIOL0482WO

[0282] which m om, or may be enriched for the Rp or Sp configuration.

[0283]

[0284] odiments, internucleoside linkages are not 3’-to-5’ internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, where a sugar moiety is linked 5 3’ to 3’ and / or 5’ to 5’, as shown below:

[0285] ,

[0286] wherein

[0287]

[0288] y nucleobase. In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain embodiments, additional features (e.g., a conjugate group) are attached to the inverted 10 nucleoside. Such terminal inverted nucleosides may be attached to either or both ends of an oligonucleotide.

[0289] In certain embodiments, inverted nucleosides lack a nucleobase (are abasic nucleosides). In certain such embodiments, additional features (e.g., a conjugate group) are attached to the inverted abasic nucleoside. A terminal inverted nucleoside may be attached to either or both ends of an oligonucleotide.

[0290] In certain embodiments, nucleosides are linked 2’ to 5’ rather than the 3’ to 5’ linkage. Such a linkage 15 between two nucleosides is illustrated below.

[0291] ,

[0292] wherein

[0293]

[0294] p y nucleobase.

[0295] 24 BIOL0482WO

[0296] In certain embodiments, a bicyclic sugar moiety may be linked via an atom on the non-furanosyl ring. In certain such embodiments, a bicyclic sugar moiety is linked 7’ to 5’, as shown below in the context of 3 linked nucleosides:

[0297] 5 In certai ternucleoside linkages have at least one chiral center. In such embodiments, a chiral atom can be

[0298]

[0299] prepared as a racemic mixture, or as separate enantiomers. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates, mesyl phosphoramidates, and phosphorothioates.

[0300] The mesyl phosphoramidate internucleoside linkage comprises a chiral center. In certain embodiments, 10 modified oligonucleotides comprising (Rp) and / or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

[0301] .

[0302]

[0303] omprises a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates comprise one or more of the following formulas, 15 respectively, wherein “B” indicates a nucleobase:

[0304] 25 BIOL0482WO

[0305] linkages having a chiral center may be prepared as populatio

[0306]

[0307] ns o moe ogonuceoes comprsng sereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising internucleoside linkages containing chiral centers in particular stereochemical 5 configurations. In certain embodiments, populations of modified oligonucleotides comprise one or more phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, populations of modified oligonucleotides comprise one or more mesyl phosphoramidate internucleoside linkages wherein all of the mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random 10 selection of the stereochemical configuration of each phosphorothioate internucleoside linkage and / or mesyl phosphoramidate linkage. Nonetheless, each individual phosphorothioate internucleoside linkage and / or mesyl phosphoramidate internucleoside linkage of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkage and / or mesyl 15 phosphoramidate internucleoside linkage in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage and / or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the 20 particular phosphorothioate internucleoside linkage and / or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage and / or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage and / or mesyl phosphoramidate linkage is present in at least 99% of the molecules in the 25 population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res.42, 13456 (2014), and WO 2017 / 015555.

[0308] As used herein, “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular 30 stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules

[0309] 26 BIOL0482WO

[0310] expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the chiral center is at the 5 phosphorous atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate internucleoside linkage. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate internucleoside linkage and / or mesyl phosphoramidate internucleoside linkage in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one 10 phosphorothioate internucleoside linkage and / or mesyl phosphoramidate internucleoside linkage in the (Rp) configuration. Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein may be stereorandom or in a particular stereochemical configuration. In certain embodiments, the chiral center is at positions 1’, 2’, 3’, and / or 4’ of a furanosyl sugar moiety. In certain embodiments, each chiral center of each furanosyl sugar moiety is enriched such that the sugar moieties have the β-D ribosyl stereochemical configuration.

[0311] 15 B. Motifs

[0312] In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In certain such embodiments, the modified, unmodified, and differently 20 modified sugar moieties, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, “nucleobase motif” describes the pattern of modifications to the nucleobases independent of the nucleobase sequence).

[0313] 25 1. Sugar Motifs

[0314] In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein. In certain embodiments, the sugar moiety of at least one nucleoside of an antisense oligonucleotide is a modified sugar moiety.

[0315] 30 In certain embodiments, the sugar moiety of at least one nucleoside of a sense oligonucleotide is a modified sugar moiety.

[0316] In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif (e.g., a fully modified region). In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire 35 modified oligonucleotide comprises a modified sugar moiety and the oligonucleotide is referred to as a fully modified oligonucleotide. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar

[0317] 27 BIOL0482WO

[0318] moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide is a 2’-substituted nucleoside comprising the same 2’-substituent. In certain embodiments, every other nucleoside of a fully modified oligonucleotide comprises the same 2’-substitutent, resulting in alternating 2’-substituents.

[0319] 5 In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, each nucleoside of the deoxy region is a deoxynucleoside. In certain embodiments, each nucleoside of the deoxy region is a 2’-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5-12 or 7-12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, at least one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly 10 one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides within the deoxy region comprise a modified sugar moiety. In certain embodiments, at least one nucleoside of the deoxy region comprises a 2’-OMe sugar moiety. In certain embodiments, exactly one nucleoside of the deoxy region comprises a 2’-OMe sugar moiety.

[0320] In certain embodiments, the deoxy region is flanked on the 5’-side by a 5’ external region consisting of linked 15 5’-region nucleosides and on the 3’-side by a 3’ external region consisting of linked 3’ external region nucleosides, wherein the 3’-most nucleoside of the 5’ external region comprises a modified sugar moiety and the 5’-most nucleoside of the 3’ external region comprises a modified sugar moiety. The three regions (the 5’ external region, the deoxy region, and the 3’ external region) form a contiguous sequence of nucleosides. In certain embodiments, the sugar moiety of the 3’-most nucleoside of the 5’ external region and the sugar moiety of the 5’-most nucleoside of the 3’ 20 external region each differ from the sugar moiety of the respective adjacent nucleoside of the deoxy region, thus defining the boundary between the 5’ external region, the deoxy region, and the 3’ external region. In certain embodiments, each nucleoside of the 5’ external region and each nucleoside of the 3’ external region comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of the 5’ external region and at least two nucleosides of the 3’ external region comprises a modified sugar moiety. In certain embodiments, at least three 25 nucleosides of the 5’ external region and at least three nucleosides of the 3’ external region comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each nucleoside of the 5’ external region and each nucleoside of the 3’ external region comprises a modified sugar moiety. In certain embodiments, each of the nucleosides within the 5’ external region comprise the same modified sugar moiety. In certain embodiments, each of the nucleosides within the 3’ external region comprise the same modified sugar moiety. In certain embodiments, each 30 of the nucleosides of the 5’ external region and each of the nucleosides of the 3’ external region comprise the same modified sugar moiety.

[0321] In certain embodiments, the 5’ external region and the 3’ external region of a modified oligonucleotide each independently comprises 1, 2, 3, 4, 5, 6, 7, 8 or 1-8 nucleosides. In certain embodiments, the 5’ external region and the 3’ external region of a modified oligonucleotide each consist of 1-8 nucleosides. In certain embodiments, the 5’ 35 external region consists of 1-7 nucleosides. In certain embodiments, the 5’ external region consists of 1-6 nucleosides.

[0322] In certain embodiments, the 5’ external region consists of 1-5 nucleosides. In certain embodiments, the 5’ external region consists of 1-6, 2-6, 3-6, or 3-5 nucleosides. In certain embodiments, the 5’ external region consists of 1, 2, 3,

[0323] 28 BIOL0482WO

[0324] 4, 5, 6, 7, 8, or 1-8 nucleosides. In certain embodiments, the 5’ external region consists of 4, 5, or 6 nucleosides. In certain embodiments, the 3’ external region consists of 1-7 nucleosides. In certain embodiments, the 3’ external region consists of 1-6 nucleosides. In certain embodiments, the 3’ external region consists of 1-5 nucleosides. In certain embodiments, the 3’ external region comprises 4, 5, or 6 nucleosides. In certain embodiments, the 3’external region 5 consists of 1-6, 2-6, 3-6, or 3-5 nucleosides. In certain embodiments, the 3’ external region consists of 1, 2, 3, 4, 5, 6, 7, 8, or 1-8 nucleosides. In certain embodiments, the 3’ external region consists of 4, 5, or 6 nucleosides.

[0325] In certain embodiments, the deoxy region consists of 8, 9, 10, 11, 12, or 8-12 nucleosides, with each nucleoside comprising a 2’-β-D-deoxyribosyl sugar moiety. In certain embodiments, such modified oligonucleotides are referred to as “gapmers”. Herein, the lengths (number of nucleosides) of the 5’-region, the deoxy region, and the 10 3’-region of an oligonucleotide may be provided using the notation [# of nucleosides in the 5’-region] – [# of nucleosides in the deoxy region] – [# of nucleosides in the 3’-region]. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-region (or “wing”), 10 linked 2’- β-D-deoxynucleosides in the deoxy region (or “gap”), and 5 linked 2’-MOE nucleosides in the 3’-region (or “wing”).

[0326] In certain embodiments, modified oligonucleotides disclosed herein are modified by a specific sugar motif.

[0327] 15 In certain embodiments, modified oligonucleotides have a sugar motif (from 5’ to 3’) of: eeeeeddddddddddeeeee;

[0328] wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety.

[0329] 2. Nucleobase Motifs

[0330] In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, at least one nucleobase is 20 modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, at least one purine and / or at least pyrimidine is modified. In certain embodiments, at least one adenine is modified. In certain embodiments, at least one guanine is modified. In certain embodiments, at least one thymine is modified. In certain embodiments, at least one uracil is modified. In certain embodiments, at least one cytosine is modified. In certain embodiments, at least one of the cytosine nucleobases in a modified oligonucleotide is 5-methylcytosine. In certain 25 embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, one or two of the cytosine nucleobases are 5- methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and unmodified hypoxanthine. In certain embodiments, 30 each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is selected from unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is selected from unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine.

[0331] 3. Internucleoside Linkage Motifs

[0332] 35 In certain embodiments, oligonucleotides comprise modified and unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage is a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside

[0333] 29 BIOL0482WO

[0334] linkage of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and 5 a (Rp) phosphorothioate.

[0335] In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif (from 5’ to 3’) of: sooosssssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage.

[0336] C. Lengths

[0337] 10 It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no 15 mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

[0338] In certain embodiments, oligonucleotides (including modified oligonucleotides) have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of linked nucleosides in the range and Y represents the largest number of linked nucleosides in the 20 range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 25 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 30 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 35 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0339] 30 BIOL0482WO

[0340] In certain embodiments, modified oligonucleotides consist of 12-50 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 12-30 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16-25 linked nucleosides. In certain embodiments, modified oligonucleotides consist modified oligonucleotides consist of 18-22 linked nucleosides. In certain embodiments, the modified oligonucleotide 5 consists of 19-20 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 18 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 19 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 20 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 21 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 22 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 23 linked nucleosides. In certain 10 embodiments, the modified oligonucleotides have no more than 1 to 3 mismatches to a target nucleic acid.

[0341] D. Oligomeric Agent Modifications

[0342] Provided oligomeric agents comprise one or more modifications (e.g., a modified sugar moiety, a modified nucleobase, a modified internucleoside linkage, and / or combinations thereof) incorporated into a modified oligonucleotide. In certain embodiments, a modified oligonucleotide is characterized by modification motif(s) and 15 overall length. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of a modified oligonucleotide having one or more modified sugar moiety and / or sugar motif, independently, is modified or unmodified and may or may not follow the modification pattern of the sugar modifications or sugar motif. For example, internucleoside linkages within a region of a modified oligonucleotide comprising certain sugar modifications may be the same or different from one another and may be the 20 same or different from the internucleoside linkages of the region of the modified oligonucleotide comprising different sugar modifications. Likewise, such modified oligonucleotides may comprise one or more modified nucleobase independent of the pattern of the sugar modifications or sugar motif and independent of the internucleoside linkages or internucleoside linkage motif. Unless specifically indicated, all modifications are independent of nucleobase sequence. Furthermore, each modification, whether internucleoside linkage, modified sugar moiety, or modified 25 nucleobase, of an antisense oligonucleotide is independent of each modification of a paired sense oligonucleotide unless specifically indicated otherwise.

[0343] E. Nucleobase Sequence

[0344] In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments, oligonucleotides have a nucleobase sequence that is 30 complementary to a nucleobase sequence of a second strand of linked nucleosides (e.g., another oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid) or a region thereof. In certain embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a nucleobase sequence of a second strand of linked nucleosides or a region thereof. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary 35 to the nucleobase sequence of a second strand of linked nucleosides or region thereof.

[0345] F. Oligomeric Duplexes

[0346] 31 BIOL0482WO

[0347] In certain embodiments, an oligomeric agent provided herein comprises a modified oligonucleotide having a targeting region having a nucleobase sequence complementary to a sequence in a PACS1 target nucleic acid paired with a second oligonucleotide to form an oligomeric duplex. In some embodiments, an oligomeric duplex comprises a first modified oligonucleotide having a targeting region complementary to a target region of a PACS1 target nucleic 5 acid and a second oligonucleotide having a duplexing region complementary to the first modified oligonucleotide or a region thereof. In certain embodiments, the second oligonucleotide is a modified oligonucleotide.

[0348] In certain embodiments, an oligomeric duplex comprises a first modified oligonucleotide having a targeting region complementary to a target region of a PACS1 target nucleic acid and a second modified oligonucleotide having a duplexing region complementary to the first modified oligonucleotide or a region thereof. In certain embodiments, 10 the oligomeric duplex is part of an oligomeric agent, wherein the oligomeric agent comprises or consists of: (1) a first modified oligonucleotide, (2) a second oligonucleotide, and (3) optionally a terminal group and / or a conjugate group. Either or both modified oligonucleotides of an oligomeric duplex may be linked to a conjugate group. Either or both modified oligonucleotides of an oligomeric duplex may comprise a terminal group. Each modified oligonucleotide of an oligomeric duplex may include non-complementary or unpaired overhanging nucleosides. In certain embodiments, 15 the nucleobase of the non-complementary or unpaired overhanging nucleosides is adenine or thymine. In certain embodiments, the two modified oligonucleotides have at least one mismatch relative to one another.

[0349] In certain embodiments, an oligomeric duplex comprises: a first modified oligonucleotide comprising a targeting region comprising at least 12 contiguous nucleosides, wherein the nucleobase sequence of the targeting region is at least 80% complementary to the nucleobase sequence of an equal-length region of a PACS1 nucleic acid; 20 and a second modified oligonucleotide containing a duplexing region comprising at least 12 contiguous nucleosides, wherein the nucleobase sequence of the duplexing region of the second modified oligonucleotide is at least 80% complementary to the nucleobase sequence of an equal length region (e.g., a region of the targeting region) of the first modified oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the nucleobase sequence of the duplexing region of the second modified oligonucleotide is 25 at least 90%, at least 95%, at least 98% or 100% complementary to the nucleobase sequence of an equal length region (e.g., a region of the targeting region) of the first modified oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.

[0350] 30 In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, modified furanosyl sugar moieties such as, for example, a non- bicyclic modified sugar moiety, such as a 2′-MOE sugar moiety, a 2′-F sugar moiety, or a 2′-OMe sugar moiety; or a bicyclic sugar moiety, such as a furanosyl sugar moiety comprising a 4′-2′ bridge selected from -CH2-O- and -35 CH(CH3)-O-. In certain embodiments, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide comprises an unmodified DNA sugar moiety. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified

[0351] 32 BIOL0482WO

[0352] oligonucleotide and / or the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the second modified oligonucleotide is independently selected from a 2’-F sugar moiety, a 2’-MOE sugar moiety, and a 2’-OMe sugar moiety. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides 5 of the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, and an unmodified DNA sugar moiety. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, and an unmodified DNA sugar moiety.

[0353] 10 In certain embodiments, in an oligomeric duplex provided herein, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, cyclic sugar surrogates, e.g., morpholino, hexitol nucleic acid (HNA), fluoro-hexitol nucleic acid (FHNA), and acyclic sugar surrogates, e.g., glycol nucleic acid (GNA) and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide 15 comprises a cyclic sugar surrogate, which is FHNA. In certain embodiments, the sugar moiety of at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide is independently selected from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, an unmodified DNA sugar moiety, and FHNA. In certain embodiments, the sugar moiety is at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and the second modified oligonucleotide is independently selected 20 from a 2′-F sugar moiety, a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, an unmodified DNA sugar moiety, and FHNA.

[0354] G. Conjugates

[0355] In certain embodiments, provided herein are oligomeric agents comprising one or more modified oligonucleotides and one or more conjugate groups. In certain embodiments, an oligomeric agent optionally further 25 comprises one or more terminal groups. Conjugate groups comprise or consist of a conjugate moiety and a conjugate linker. A conjugate group may be attached at the 3’ end and / or the 5’ end of an oligonucleotide and / or at any internal position. In certain embodiments, conjugate groups are attached through a modified sugar moiety or a modified internucleoside linkage. In certain embodiments, oligomeric agents comprise a modified oligonucleotide, a cell- targeting moiety, and a conjugate linker.

[0356] 30 1. Conjugate Groups

[0357] A conjugate group comprises a conjugate moiety and a conjugate linker. A conjugate moiety modifies one or more properties of an attached oligonucleotide compared to the same oligonucleotide lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, a conjugate moiety imparts a 35 new property on the attached oligonucleotide.

[0358] In some embodiments, the conjugate group comprises a small molecule drug substance (e.g., an active pharmaceutical ingredient), an aliphatic chain, a lipid, a peptide, a protein, a hydrocarbon, a polyamine, a polyamide,

[0359] 33 BIOL0482WO

[0360] a polyether, a thioether, an aptamer, an antibody, an antibody fragment, a VHH camelid antibody fragment, a VNAR shark antibody fragment, a vitamin, a fatty acid, a carbohydrate, an intercalator, a reporter molecule, a small molecule, or an alkyl moiety, e.g., a C22 alkyl, C20 alkyl, C17 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the 5 alkyl chain optionally has one or more unsaturated bonds. In some embodiments, the conjugate group comprises a 6- palmitamidohexyl moiety or a 2-(hydroxymethyl)-6-palmitamidohexyl moiety. In certain embodiments, the conjugate group comprises a cell-targeting moiety.

[0361] In certain embodiments, conjugation of one or more carbohydrate moieties to a modified oligonucleotide can alter one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is 10 attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g. a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety. A cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may 15 be a heteroatom, e.g., nitrogen, oxygen, sulphur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

[0362] In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate 20 moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et 25 al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl- rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-30 oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014 / 179620).

[0363] In certain embodiments, the conjugate group comprises a lipophilic moiety. In certain embodiments, the lipophilic moiety is selected from the group consisting of alkyl moiety, cholesterol, retinoic acid, cholic acid, 35 adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic

[0364] 34 BIOL0482WO

[0365] acid, O3-(oleoyl) lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine. In certain embodiments, the alkyl moiety is a saturated straight chain C16 hydrocarbon.

[0366] Methods of preparing conjugated oligonucleotides are known in the art and / or described herein. For example, in one non-limiting solid phase method for large-scale synthesis of conjugated oligonucleotides, monomethyoxytrityl 5 (MMT)-protected 5’ or (3’)-amino-modified oligonucleotide intermediates are generated using the phosphoramidate monomer coupling method and detritylated as described in U.S. Patent No.10,450,342. The 5’ (or 3’) MMT-protected amino group may be linked to the oligonucleotide through a linker group such as an alkyl phosphate group, and the MMT group may be removed from the oligonucleotide via solution-phase detritylation conducted at certain temperatures and pH. In certain embodiments, the detritylated oligonucleotide is then reacted with a conjugate group 10 (e.g., a GalNAc3) to generate a conjugated oligonucleotide.

[0367] Certain Cell-targeting Moieties

[0368] In certain embodiments, a conjugate moiety comprises or consists of a cell-targeting moiety. In certain embodiments, a cell-targeting moiety has affinity for a cell surface receptor on a cell. In certain embodiments, a cell- targeting moiety has affinity for a cell surface moiety on a cell. In certain embodiments, a cell-targeting moiety is 15 capable of binding a cell surface receptor on a cell. In certain embodiments, a cell-targeting moiety is capable of binding a cell surface moiety on a cell. In certain embodiments, an oligomeric agent comprising a cell-targeting moiety is capable of being internalized by the cell when the cell-targeting moiety interacts with and / or binds a cell surface receptor and / or cell surface moiety. In certain embodiments, a cell surface receptor is not expressed ubiquitously (e.g., the cell surface receptor is undetectable in at least one tissue of a human subject), and a cell-targeting moiety 20 selectively delivers an oligomeric agent, a modified oligonucleotide, or an oligomeric duplex to a tissue of interest or a cell of interest. By way of non-limiting example, the tissue of interest may be any one or more of brain, spinal cord, retina, heart, kidney, liver, lung, skeletal muscle, cardiac muscle, smooth muscle, adipose, white adipose, brown adipose, spleen, bone, intestine, colon, testes, breast, ovary, placenta, uterus, bladder, pancreas, pituitary, prostate, skin, adrenal gland, and thyroid. By way of non-limiting example, the cell of interest may be any one or more of a 25 myocyte, adipocyte, hepatocyte, cardiomyocyte, vascular smooth muscle cell, endothelial cell, neuron, blood cell, macrophage, lymphocyte, cancer cell, and immune cell. In certain embodiments, the cell of interest may be any one or more of neurons, astrocytes, oligodendrocytes, and microglia.

[0369] In certain embodiments, a cell-targeting moiety has affinity for a GLP-1 receptor. In certain embodiments, the cell-targeting moiety is any one of those described in US 2019 / 0134214.

[0370] 30 In certain embodiments, a cell-targeting moiety has affinity for neurons.

[0371] In certain embodiments, the cell-targeting moiety has affinity for a neurotransmitter receptor. In certain embodiments, a cell-targeting moiety has affinity for a Sortilin receptor. In certain embodiments, the cell-targeting moiety is any one of those described in WO 2021 / 236599. In certain embodiments, the cell-targeting moiety has affinity for a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA 35 transporter. See e.g., WO 2011 / 131693, WO 2014 / 064257.

[0372] In certain embodiments, a cell-targeting moiety has affinity for an integrin. In certain embodiments, the cell- targeting moiety has affinity for integrin αvβ3 and / or αvβ5. In certain embodiments, the cell-targeting moiety is any

[0373] 35 BIOL0482WO

[0374] one of those described in any of WO 2019 / 210200, WO 2019 / 210308. In certain embodiments, the cell-targeting moiety has affinity for integrin αvβ6. In certain embodiments, the cell-targeting moiety is any one of those described in any of WO 2018 / 085415, WO 2019 / 089765, WO 2022 / 056269, WO 2022 / 056277, or WO 2022 / 056286.

[0375] In certain embodiments, a cell-targeting moiety has an affinity for the type 1 transferrin receptor (TfR1, also 5 known as CD71). In certain embodiments, a cell-targeting moiety comprises an anti-TfR1 antibody or antigen-binding fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the anti-TfR1 antibody or antigen-binding fragment thereof may be any known in the art including but not limited to those described in WO 1991 / 004753; WO 2013 / 103800; WO 2014 / 144060; WO 2016 / 081643; WO 10 2016 / 179257; WO 2016 / 207240; WO 2017 / 221883; WO 2018 / 129384; WO 2018 / 124121; WO 2019 / 151539; WO 2020 / 132584; WO 2020 / 028864; US 7,208,174; US 9,034,329; US 10,550,188; and US 11,512,136. In certain embodiments, a fragment of an anti-TfR1 antibody is a F(ab')2, Fab, Fab', Fv, scFv, VHH, or VNAR. In certain embodiments, an antibody binds to TfR1 through an engineered Fc domain rather than through the antigen-binding portion, as described in, e.g., US 2020 / 0223935.

[0376] 15 In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1 that does not include the antigen-binding fragment of an antibody. In certain embodiments, the protein or peptide capable of binding TfR1 may be any known in the art including but not limited to those described in WO 2019 / 140050; WO 2020 / 037150; WO 2020 / 124032; WO 2022 / 026555; WO 2023 / 027125; WO 2023 / 022234; and US 10,138,483. In certain embodiments, the peptide is a cyclic peptide, as described in WO 2021 / 167107. In certain embodiments, the 20 peptide is a bicyclic peptide known as a ‘bicycle ligand’ selected from those described in WO 2022 / 101633 and WO 2023 / 056388, each of which is incorporated by reference herein. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the aptamer capable of binding TfR1 may be any known in the art including but not limited to those described in WO 2013 / 163303; WO 2019 / 033051; and WO 2020 / 245198.

[0377] 25 2. Conjugate Linkers

[0378] In certain embodiments, oligomeric agents comprise a modified oligonucleotide and a conjugate group, wherein the conjugate group consists of a conjugate moiety and a conjugate linker. The conjugate linker links the conjugate moiety to the oligonucleotide. In certain embodiments, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the 30 conjugate linker comprises one or more atoms. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units. In certain embodiments, the oligonucleotide is a modified oligonucleotide.

[0379] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate 35 linker comprises one or more groups selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and ether groups. In certain

[0380] 36 BIOL0482WO

[0381] embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0382] In certain embodiments, conjugate linkers, including the conjugate linkers described herein, are bifunctional 5 linking moieties, e.g., those known in the art to be useful for attaching conjugate moieties to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to react with a particular site on a parent compound and the other is selected to react with a conjugate moiety. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with 10 electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0383] In certain embodiments, conjugate linkers comprise chemical groups that are formed upon a reaction between a first functional group and a second functional group. In certain embodiments, an oligonucleotide (e.g., a modified oligonucleotide) is attached to the first functional group during synthesis, and a conjugate moiety is attached to a 15 second functional group during synthesis. Then, the two compounds are mixed under specific conditions to yield the oligonucleotide covalently linked to the conjugate moiety. Such reactions that are compatible with both oligonucleotide and peptide chemistry have been previously described and are often called “bioconjugation” reactions. These reactions include strain promoted azido-alkyne cycloaddition (SPAAC), copper-catalyzed click reaction (CuAAC), active ester conjugation to an amino modified oligonucleotide, maleimide-thiol Michael addition, 20 ketol / hydroxylamine ligation, the Staudinger ligation, reductive amination, thio ether formation, disulfide formation, reductive alkylation, catalyst-free N-arylation, sulfur fluoride exchange click reaction (SuFEx), and inverse demand Diels Alder reaction. Certain such reactions are described in, e.g., Jbara, et al., “Oligonucleotide Bioconjugation with Bifunctional Palladium Reagents”, Angew. Chem. Int. Ed. 2021, 60(21)12109-12115; Dong, et al., “Sulfur(VI) Fluoride Exchange (SuFEx): Another Good Reaction for Click Chemistry,” Angew. Chem. Int. Ed.2014, 53(36):9430-25 9448.4; Zhang, et al., “Arylation Chemistry for Bioconjugation,” Angew. Chem. Int. Ed. Engl.2019; 58(15): 4810– 4839; Walsh, et al., “Site-selective modification strategies in antibody-drug conjugates” Chem. Soc. Rev., 2021, 50: 1305-1353; Tiefenbrunn, et al., “Chemoselective ligation techniques: modern applications of time-honored chemistry”, Biopolymers, 2010, 94(1):95-106; Drake, et al., Bioconjug. Chem.2014, 25(7):1331-1341; Bode, Acc. Chem. Res., 2017, 50, 9, 2104–2115; J. Magano, B. Bock, et al, Org. Proc. Res. Dev.2014, 18:142-151; Craig S.

[0384] 30 McKay and M.G. Finn, “Click Chemistry in Complex Mixtures: Bioorthogonal Bioconjugation”, Chemistry & Biology 2014; Mitchell P. Christy et al., Org. Lett.2020, 22: 2365; Ren et al., Angew. Chem. Int. Ed. Engl.2009, 48, 9658–9662; Rohrbacher, F. et al., Helv. Chim. Acta.2018, 101; Baalmaan, et al, “A Bioorthogonal Click Chemistry Toolbox for Targeted Synthesis of Branched and Well-Defined Protein–Protein Conjugates”, Angew. Chem. Int. Ed.2020 (59): 12885-12893; Lang, et al, “Biorthogonal Reactions for Labeling Proteins”, J. Am. Chem. Soc, 2014, 35 9(1):16-20; Nair, et al., “The Thiol-Michael Addition Click Reaction: A Powerful and Widely Used Tool in Materials Chemistry”, Chem. Mater.201326(1):724-744; Kalia and Raines, “Hydrolytic Stability of Hydrazones and Oximes”, Angew. Chem. Int. Ed., 2008, 47:7523-7526.

[0385] 37 BIOL0482WO

[0386] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C2-C10alkenyl or substituted or unsubstituted C2-C10alkynyl, wherein a nonlimiting list of substituent 5 groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0387] In certain embodiments, it is desirable for a conjugate moiety to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric agents comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric agent has been taken up, it is desirable that the conjugate moiety be 10 cleaved to release the unconjugated oligonucleotide or oligomeric duplex. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a 15 lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

[0388] In certain embodiments, a cleavable bond is selected from: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or 20 phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester linkage between an oligonucleotide and a conjugate moiety.

[0389] In certain embodiments, a cleavable moiety may be part of the oligonucleotide and comprises or consists of one or more linked nucleosides. In certain such embodiments, the one or more linked nucleosides are linked to one another and / or to the remainder of the oligonucleotide through cleavable bonds. In certain embodiments, such 25 cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'- deoxynucleoside that is either the 3' or 5'-terminal nucleoside of an oligonucleotide linked by a phosphodiester internucleoside linkage to an adjacent nucleoside of the oligonucleotide and covalently attached to the conjugate linker or conjugate moiety by a phosphodiester or phosphorothioate linkage. In certain such embodiments, the cleavable moiety comprises 2'-deoxyadenosine.

[0390] 30 In certain embodiments, oligomeric agents described herein comprise an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the oligonucleotide is attached to the conjugate moiety using Click chemistry known in the art. Compounds have been prepared using Click chemistry wherein alkynyl phosphonate internucleoside linkages on an oligonucleotide attached to a solid support are converted into the 1,2,3- triazolylphosphonate internucleoside linkages and then cleaved from the solid support (Krishna et al., J. Am. Chem.

[0391] 35 Soc.2012, 134(28), 11618-11631, which is incorporated by reference herein in its entirety). Additional conjugate linkers suitable for oligonucleotide conjugates are prepared by Click chemistry described in “Click Chemistry for

[0392] 38 BIOL0482WO

[0393] Biotechnology and Materials Science” Ed. Joerg Laham, Wiley 2009, which is incorporated by reference herein in its entirety.

[0394] H. Terminal Groups

[0395] In certain embodiments, provided herein are oligomeric agents comprising one or more modified 5 oligonucleotides and one or more terminal groups. As used herein, “terminal group” means a group of atoms that is covalently linked to a terminus of an oligonucleotide. Examples of a terminal group include, but are not limited to, a capping group, a phosphate moiety, a stabilized phosphate group, and a protecting group, wherein one or more groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached 10 at the 3’ and / or 5’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 5’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3’-end of the oligonucleotide and one or more terminal groups is attached at the 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3’ and / or 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached 15 at the 3’-end of the oligonucleotide. In certain embodiments, a terminal group is attached near the 3’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached near the 5’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3’-end of the oligonucleotide and a terminal group is attached at the 5’-end of the oligonucleotide.

[0396] 20 In certain embodiments, an oligonucleotide is linked to a terminal group comprising a stabilized 5’- phosphate. In certain embodiments, in an oligomeric duplex provided herein, the first modified oligonucleotide is linked to a terminal group comprising a stabilized phosphate moiety attached to the 5’ end of the oligonucleotide. The stabilized phosphate moiety results in stabilization of a 5’-phosphate moiety of the 5’-terminal nucleoside of an oligonucleotide, relative to the stability of an unmodified 5’-phosphate of an unmodified nucleoside under biologic 25 conditions. Such stabilization of a 5’-phosphate group includes but is not limited to resistance to removal by phosphatases. Stabilized phosphate moieties, but are not limited to 5’-phosphonates, including, but not limited to 5’- vinylphosphonate, 5’-methylphosphonate, and 5’ cyclopropyl phosphonate. In certain embodiments, the stabilized phosphate moiety is a cyclopropyl phosphonate or an (E)-vinyl phosphonate.

[0397] 30 II. Target Nucleic Acids

[0398] A. PACS1

[0399] In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide comprising a targeting region that is complementary to an equal-length target region of a target nucleic acid, wherein the target nucleic acid is a PACS1 nucleic acid. In certain embodiments, PACS1 nucleic acid has the nucleobase sequence set 35 forth in SEQ ID NO: 1 (GENBANK Accession No. NC_000011.10 truncated from nucleoside 66067001 to nucleoside 66248000). In certain embodiments, contacting a cell with an oligomeric agent comprising a modified oligonucleotide comprising a targeting region that is complementary to an equal-length target region of SEQ ID NO: 1 reduces PACS1

[0400] 39 BIOL0482WO

[0401] RNA in the cell, and in certain embodiments reduces PACS1 protein produced in the cell. In certain embodiments, the oligomeric agent consists of a modified oligonucleotide. In certain embodiments, the oligomeric agent consists of a modified oligonucleotide and a conjugate group. In certain embodiments, the oligomeric agent consists of a modified oligonucleotide and one or more terminal group(s). In certain embodiments, the oligomeric agent consists of a 5 modified oligonucleotide, a conjugate group, and one or more terminal group(s). In certain embodiments, the modified oligonucleotide comprises the same number of nucleosides as the number of nucleosides in the target region of the PACS1 nucleic acid. In embodiments described herein, the modified oligonucleotide is an antisense oligonucleotide.

[0402] In certain embodiments, oligomeric agents comprise an antisense oligonucleotide comprising a targeting 10 region that is complementary to a target region of an PACS1 nucleic acid. In certain embodiments, oligomeric agents comprise an antisense oligonucleotide comprising a targeting region that is complementary to a target region of an PACS1 nucleic acid, and a sense oligonucleotide comprising a duplexing region that is complementary to the antisense oligonucleotide, or a region thereof.

[0403] In certain embodiments, the target nucleic acid is an endogenous PACS1 RNA molecule. In certain 15 embodiments, the PACS1 nucleic acid encodes phosphofurin acidic cluster sorting protein 1 (PACS1). In certain embodiments, the PACS1 nucleic acid is a precursor to a nucleic acid that encodes PACS1. In certain such embodiments, the PACS1 nucleic acid is a mature mRNA or a pre-mRNA including intronic, exonic, and untranslated regions. In certain embodiments, the PACS1 RNA is a mature mRNA. In certain embodiments, the PACS1 nucleic acid is a pre-mRNA. In certain embodiments, the oligomeric agent is an RNAseH agent.

[0404] 20 In certain embodiments, antisense oligonucleotides provided herein are complementary to a target region of a PACS1 nucleic acid over the entire length of the modified oligonucleotide. In certain embodiments, antisense oligonucleotides are at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to an equal length portion of the PACS1 nucleic acid. In certain embodiments, antisense oligonucleotides are at least 80% complementary to a target region of the PACS1 nucleic acid over the entire length of the antisense oligonucleotide 25 and comprise a targeting region that is 100% or fully complementary to the target region of the PACS1 nucleic acid.

[0405] In certain embodiments, a targeting region is from 6 to 20, 10 to 18, 14 to 18, 16 to 20, 18 to 20, or 19-20 nucleobases in length. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases. In certain embodiments, the target region comprises 30 or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases. In certain embodiments, the targeting region constitutes at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleosides of the antisense oligonucleotide. In certain embodiments, the targeting region constitutes 100% of the nucleosides of the antisense oligonucleotide. In certain embodiments, the targeting region of the antisense 35 oligonucleotide is at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to a target region of the PACS1 nucleic acid. In certain embodiments, the targeting region of the antisense oligonucleotide is 100% complementary to a target region of the PACS1 nucleic acid.

[0406] 40 BIOL0482WO

[0407] In certain embodiments, antisense oligonucleotides comprise one or more mismatches relative to the target region of the PACS1 nucleic acid. In certain embodiments, antisense activity against the target is reduced by such a mismatch, and activity against a non-target is reduced. In certain embodiments, activity against the non-target is reduced by a greater amount than activity against the target. Thus, in certain embodiments selectivity of the antisense 5 oligonucleotides is improved. In certain embodiments, antisense oligonucleotides are at least 80% complementary to the target region of the PACS1 nucleic acid over the entire length of the antisense oligonucleotide and comprise no more than one to three mismatches with the PACS1 nucleic acid. In certain embodiments, antisense oligonucleotides comprise a targeting region that is at least 80% complementary to a target region of the PACS1 nucleic acid over the entire length of the targeting region, and the targeting region comprises no more than one to three mismatches with 10 the target region. In certain embodiments, antisense oligonucleotides comprise a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a target region of the PACS1 nucleic acid over the entire length of the targeting region. In certain embodiments, additional mismatches may be present at the termini of the antisense oligonucleotide, outside of the targeting region. In certain embodiments, a mismatch is specifically positioned within an antisense oligonucleotide. In certain embodiments, a mismatch is at position 3, 4, 5, 6, 7, 8, 9, 15 10, 11, or 12 from the 5’-end of the antisense oligonucleotide. In certain embodiments, a mismatch is at position 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 from the 3’-end of the antisense oligonucleotide. In certain embodiments, a mismatch is at position 1, 2, 3, or 4 from the 5’-end of the antisense oligonucleotide. In certain embodiments, a mismatch is at position 4, 3, 2, or 1 from the 3’-end of the antisense oligonucleotide.

[0408] B. Target Nucleic Acids in Certain Tissues

[0409] 20 In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide comprising a targeting region that is complementary to a target region in a PACS1 nucleic acid, wherein the PACS1 nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is the brain. In certain embodiments, the PACS1 nucleic acid is expressed in the cortex, hippocampus, amygdala, corpus callosum, basal ganglia, cerebellum, thalamus, hypothalamus, midbrain, pons, medulla oblongata, spinal cord, white 25 matter, grey matter, and choroid plexus. In certain embodiments, the cells are brain cells. In certain embodiments, the cells include neurons, astrocytes, oligodendrocytes, glial cells, and microglia.

[0410] B. Oligonucleotide sequences

[0411] Provided herein are oligomeric agents comprising modified oligonucleotides complementary to a target region in a PACS1 nucleic acid, such as, for example, a human PACS1 nucleic acid, such as SEQ ID NO: 1 30 (GENBANK Accession No. NC_000011.10 truncated from nucleoside 66067001 to nucleoside 66248000), and compositions comprising such oligomeric agents. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a region of SEQ ID NO: 1. In certain embodiments, a modified oligonucleotide has a complementary region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 35 99% complementary to a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a target region of SEQ ID NO: 1. In certain embodiments, a modified oligonucleotide has a targeting region that is 100% complementary to a target region of SEQ ID NO: 1. In certain embodiments, a modified

[0412] 41 BIOL0482WO

[0413] oligonucleotide has a nucleobase sequence comprising or consisting of a complementary region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a targeting region that is 100% complementary to a target region of SEQ ID NO: 1. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of SEQ ID NO: 11. In certain embodiments, a modified oligonucleotide 5 has a nucleobase sequence comprising or consisting of SEQ ID NO: 12 or SEQ ID NO: 13. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of SEQ ID NO: 12. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of SEQ ID NO: 13.

[0414] III. Methods and Uses

[0415] 10 A. Antisense Activity

[0416] In certain embodiments, oligomeric agents provided herein comprise an antisense oligonucleotide that is capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric agents are antisense agents.

[0417] In certain antisense activities, hybridization of an antisense oligonucleotide to a target nucleic acid results in 15 recruitment of a protein, e.g., RNase H or Argonaute, that cleaves the target nucleic acid. Certain antisense agents result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, oligomeric agents are antisense agents that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the antisense agent are tolerated and RNase H activity 20 is retained. In certain embodiments, such antisense agents reduce or inhibit expression of or reduce the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay.

[0418] In certain antisense activities, an antisense oligonucleotide is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense oligonucleotides result in cleavage of the target nucleic acid by Argonaute. Antisense agents that comprise an antisense oligonucleotide 25 that is loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA or dsRNAi) or single- stranded (ssRNA). In certain embodiments, RNAi agents are capable of RISC-mediated modulation of a target nucleic acid in a cell. In certain embodiments, such RNAi agents reduce or inhibit the expression of or reduce the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. In certain embodiments, RNAi agents selectively affect one or more target nucleic acid. Such RNAi agents comprise a modified oligonucleotide having a 30 nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity. In certain embodiments, an RNAi agent comprises a modified oligonucleotide that does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.

[0419] In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition 35 of a binding interaction between the target nucleic acid and a protein or other nucleic acid (e.g., miRNA, lncRNA, sncRNA). In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in modulation of translation of the target nucleic acid. In certain embodiments, hybridization of an oligomeric compound

[0420] 42 BIOL0482WO

[0421] to a target nucleic acid results in an increase in the amount or activity of a target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in increased translation of the target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in reduced translation of the target nucleic acid.

[0422] 5 Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and / or a phenotypic change in a cell or a subject.

[0423] B. Treatment, Prophylaxis

[0424] 10 In certain embodiments, provided herein are methods of reducing PACS1 expression, PACS1 RNA levels, and / or PACS1 protein levels and / or activity, in a subject having, or at risk of having, a disease, disorder, condition or injury associated with PACS1 nucleic acid and / or PACS1 protein, such as a disease, disorder, condition or injury associated with PACS1-NDD, wherein the method includes administering to the subject an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region 15 of a PACS1 nucleic acid thereby reducing expression of PACS1 nucleic acid in the subject. In certain embodiments, expression of PACS1 nucleic acid is reduced. In certain embodiments, expression of PACS1 is reduced. In certain embodiments, administering such an oligomeric agent reduces PACS1 expression, PACS1 RNA levels, and / or PACS1 protein levels and / or activity in the plasma, serum, blood, cerebrospinal fluid (CSF), or brain of the subject. In certain embodiments, administering such oligomeric agent reduces PACS1 expression, PACS1 RNA levels, and / or PACS1 20 protein levels, and / or activity in the brain of the subject. In some instances, such an oligomeric agent is administered parenterally. In some instances, an oligomeric agent is administered intravenously, subcutaneously, intramuscularly, or intrathecally. In certain embodiments, the detectable amount of PACS1 RNA may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting 25 region complementary to a target region of SEQ ID NO: 1 is capable of decreasing or reducing a detectable amount of a PACS1 protein in a cell, organ (e.g., brain), tissue, plasma, serum, blood, CSF or other fluid of the subject, when the compound is administered to the cell, tissue, and / or subject. In certain embodiments, the detectable amount of PACS1 protein may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, provided herein are methods for preventing, treating, 30 or delaying the development or progression of a disease associated with PACS1 (e.g., PACS1 nucleic acid and / or protein), such as a neurological disease associated with PACS1, wherein the method comprises administering to a subject an oligomeric agent described herein (e.g., a modified oligonucleotide or an oligomeric duplex and optionally one or more conjugate and / or terminal groups) comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of a PACS1 nucleic acid. Also provided are methods of ameliorating, 35 preventing, or delaying the onset of, one or more symptoms associated with a disease associated with PACS1, such as a neurological disease associated with PACS1, wherein the method comprises administering to a subject an oligomeric agent comprising or consisting of a modified oligonucleotide having a nucleobase sequence complementary to a

[0425] 43 BIOL0482WO

[0426] nucleobase sequence in a PACS1 nucleic acid. Examples of diseases associated with PACS1 treatable with the oligomeric agents, compositions, and methods provided herein include a neurological disease associated with PACS1. In certain embodiments, the neurological disease associated with PACS1 is PACS1-neurodevelopmental disorder (PACS1-NDD), also known as Schuurs-Hoeijmakers Syndrome (SHMS) or PACS1 disorder.

[0427] 5 In certain embodiments, a method of modulating expression of PACS1 nucleic acid or modulating PACS1 protein levels and / or activity in a cell comprises contacting the cell with an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of a PACS1 nucleic acid. In certain embodiments, a method of reducing expression of PACS1 or reducing PACS1 protein levels and / or activity in a cell comprises contacting the cell with an oligomeric agent comprising or consisting of a modified 10 oligonucleotide comprising a targeting region having a nucleobase sequence complementary to a target region of a PACS1 nucleic acid. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a neuron, an astrocyte, an oligodendrocyte, or a glial cell.

[0428] A disease associated with PACS1 is associated with neurological diseases, for example, PACS1- neurodevelopmental disorder (PACS1-NDD), also known as Schuurs-Hoeijmakers Syndrome (SHMS) or PACS1 15 disorder. Symptoms of PACS1-NDD include developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly. Examples of congenital heart anomalies include, for example, atrial septal defect, ventral septal defect, patent ductus arteriosus, bicuspid aortic valve, dysplastic aortic and 20 pulmonary valves, and patent foramen ovale. Examples of ocular abnormalities include, for example, coloboma of the iris, the retina, and / or the optic nerve, as well as myopia, strabismus, or nystagmus. Examples of brain abnormalities include, for example, hypoplasia or partial agenesis cerebellar vermis, mild colpocephaly, ventriculomegaly / hydrocephalus ex vacuo, thin corpus callosum, frontal cortical dysplasia, paucity of cerebral white matter, mild delay in myelination, and hyperintensity of periventricular white matter. In some embodiments, materials 25 and methods provided herein improve one or more of developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly in the subject. In certain embodiments, the oligomeric agents, methods, and pharmaceutical compositions disclosed herein are useful in reducing progression of PACS1-NDD. 30 Thus, in certain embodiments, a method comprises administering to a subject an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of a PACS1 nucleic acid. In certain embodiments, the subject has or is at risk for developing a disease associated with PACS1. In certain embodiments, the subject has or is at risk for developing PACS1-NDD. In certain embodiments, the subject has or is at risk for developing a mutation in a PACS1 nucleic acid resulting in an arginine to tryptophan (R203W) 35 substitution in the PACS1 protein. In certain embodiments, at least one symptom of the PACS1-NDD associated is ameliorated. In certain embodiments, the at least one symptom is selected from developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods,

[0429] 44 BIOL0482WO

[0430] seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly. In certain embodiments, administration of an oligomeric agent provided herein (e.g., a modified antisense oligonucleotide or oligomeric duplex and optionally one or more conjugate and / or terminal groups) to the subject reduces or delays the onset or progression of at least one 5 of developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly.

[0431] In certain embodiments, a method of treating PACS1-PDD in a subject comprises administering to the subject an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary 10 to a target region of a PACS1 nucleic acid, thereby treating the subject. In certain embodiments, the subject has or is at risk for developing a disease associated with PACS1. In certain embodiments, the subject has or is at risk for developing PACS1-NDD. In certain embodiments, the subject has or is at risk for developing a mutation in a PACS1 nucleic acid resulting in an arginine to tryptophan (R203W) substitution in the PACS1 protein. In certain embodiments, administering a therapeutically effective amount of the oligomeric agent improves at least one of developmental delay, 15 intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly in the subject. In certain embodiments, at least one symptom of thePACS1-NDD is ameliorated. In certain embodiments, the at least one symptom is selected from developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal 20 reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly. In certain embodiments, administration of a pharmaceutical composition comprising an oligomeric agent (e.g., a modified oligonucleotide, or oligomeric duplex and optionally one or more conjugate and / or terminal groups) to the subject reduces or delays the onset or progression of at least one of developmental delay, 25 intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly.

[0432] In certain embodiments, a method of modulating expression of PACS1 nucleic acid, such as RNA, in a subject having or at risk of a disease associated with PACS1 comprises administering to the subject an oligomeric agent 30 comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a PACS1 nucleic acid, thereby modulating expression of PACS1 nucleic acid in the subject. In certain embodiments, administering the oligomeric agent modulates expression of PACS1 in the brain. In certain embodiments, expression of PACS1 nucleic acid is reduced. In certain embodiments, the subject has, or is at risk of having PACS1-NDD. In certain embodiments, PACS1-NDD is genetic, including PACS1 mutations. In certain embodiments, administering 35 the oligomeric agent improves at least one of developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular

[0433] 45 BIOL0482WO

[0434] abnormalities, brain abnormalities, and microcephaly. In certain embodiments, at least one symptom of the PACS1- NDD is ameliorated. In certain embodiments, the at least one symptom is selected from developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, 5 congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly. In certain embodiments, administration of a pharmaceutical composition comprising an oligomeric agent (e.g., an antisense oligonucleotide or oligomeric duplex and optionally one or more conjugate and / or terminal groups) to the subject reduces or delays the onset or progression of at least one of developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, 10 temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly.

[0435] Certain embodiments are drawn to an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a PACS1 nucleic acid, for use in treating a disease associated with PACS1. In certain embodiments, the disease is associated with PACS1, for example, a 15 neurological (e.g., brain) disease associated with PACS1. Certain embodiments provided herein are drawn to an oligomeric agent comprising or consisting of a modified oligonucleotide having a nucleobase sequence complementary to a nucleobase sequence in a PACS1 nucleic acid, for use in treating a disease associated with PACS1, for example, a neurological disease (e.g., brain) associated with PACS1 (e.g., PACS1-NDD). In certain embodiments, the disease is PACS1-NDD. In certain embodiments, PACS1-NDD is genetic, including PACS1 mutations. In certain 20 embodiments, an oligomeric agent is for use in improving at least one of developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly.

[0436] Certain embodiments are drawn to an oligomeric agent comprising or consisting of a modified 25 oligonucleotide having a targeting region complementary to a target region of a PACS1 nucleic acid, for the manufacture or preparation of a medicament for ameliorating, or delaying or preventing development or progression of a disease and / or for ameliorating, preventing or delaying the onset of one or more symptoms of a disease, wherein the disease is associated with PACS1, for example, a neurological (e.g., brain) disease associated with PACS1 (e.g., PACS1-NDD). In certain embodiments, the disease is PACS1-NDD. In certain embodiments, an oligomeric agent is 30 for the manufacture or preparation of a medicament for improving at least one of developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly. In certain embodiments, PACS1-NDD is genetic, including PACS1 mutations.

[0437] 35 Certain embodiments are drawn to an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a PACS1 nucleic acid, for the manufacture or preparation of a medicament for treating a disease associated with PACS1, for example, a neurological

[0438] 46 BIOL0482WO

[0439] (e.g., brain) disease. In certain embodiments, the disease is PACS1-NDD. In certain embodiments, PACS1-NDD is genetic, including PACS1 mutations.

[0440] In certain embodiments, prophylactic administration of an oligomeric agent or composition provided herein to a subject at risk for PACS1-NDD, is able to prevent, ameliorate, postpone or delay a symptom and / or development 5 or progression of PACS1-NDD progression. In certain embodiments, an oligomeric agent is for the manufacture or preparation of a medicament for improving at least one of developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, poor balance and / or coordination, congenital heart anomalies, ocular abnormalities, brain abnormalities, and microcephaly.

[0441] 10 In any of the methods or uses described herein, the oligomeric agent be any oligomeric agent (e.g., an oligomeric agent comprising or consisting of a modified oligonucleotide, an antisense oligonucleotide, or oligomeric duplex, and optionally one or more conjugate and / or terminal groups) described herein.

[0442] In certain embodiments, an oligomeric agent has greater PACS1 RNA and / or PACS1 protein reduction activity (i.e., greater specificity of action) in a target (e.g., neurological) cell / organ / tissue / system than PACS1 RNA 15 and / or PACS1 protein reduction activity in a non-target (e.g., cardiovascular, lung, liver) cell / tissue / system. For example, in some embodiments, administration of an oligomeric agent provided herein reduces the amount or activity of a neurological target cell / organ / tissue / system PACS1 RNA and / or PACS1 protein at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to a control and has no, or a non-20 significant, effect on (e.g., reduction in) the amount or activity of PACS1 RNA and / or PACS1 protein in cardiovascular cells / tissue. In some embodiments administration of an oligomeric agent reduces the amount or activity of target cell / organ / tissue / system (e.g., neurological cells / tissue / system) PACS1 RNA and / or PACS1 protein at least 15% - 90%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% more than it reduces the amount or activity of PACS1 RNA and / or PACS1 protein in cardiovascular, lung, 25 or liver cell / tissue / system.

[0443] IV. Pharmaceutical Compositions

[0444] In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric agent described herein, wherein each oligomeric agent comprises or consists of a modified oligonucleotide.

[0445] 30 In certain embodiments, the one or more oligomeric agents comprise or consists of a modified oligonucleotide. In certain embodiments, the one or more oligomeric agent consists of or comprises an antisense oligonucleotide. In certain embodiments, a pharmaceutical composition comprises a pharmaceutically acceptable diluent. Examples of pharmaceutically acceptable diluents include water, saline, phosphate-buffered saline, and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent 35 (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and a sterile saline solution. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided

[0446] 47 BIOL0482WO

[0447] herein and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and sterile phosphate-buffered saline (PBS). In certain embodiments, sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition 5 comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and sterile artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In certain embodiments, the sterile artificial cerebrospinal fluid is pharmaceutical grade sterile artificial cerebrospinal fluid.

[0448] In certain embodiments, a pharmaceutical composition comprises an oligomeric agent and sterile water. In certain embodiments, a pharmaceutical composition consists of an oligomeric agent and sterile water. In certain 10 embodiments, a pharmaceutical composition consists essentially of an oligomeric agent and sterile water. In certain embodiments, the water is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and sterile water. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and sterile water. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and sterile water. In certain embodiments, the sterile water is pharmaceutical grade.

[0449] 15 In certain embodiments, a pharmaceutical composition comprises an oligomeric agent comprising or consisting of a modified oligonucleotide and sterile saline. In certain such embodiments, a pharmaceutical composition consists of such oligomeric agent and sterile saline. In certain embodiments, a pharmaceutical composition consists essentially of such oligomeric agent and sterile saline. In certain embodiments, the sterile saline is sterile PBS. In certain embodiments, the sterile saline is pharmaceutical grade.

[0450] 20 In certain embodiments, a pharmaceutical composition comprises an oligomeric agent and sterile artificial cerebrospinal fluid (aCSF). In certain embodiments, a pharmaceutical composition consists of an oligomeric agent and sterile aCSF. In certain embodiments, a pharmaceutical composition consists essentially of an oligomeric agent and sterile aCSF. In certain embodiments, the sterile artificial cerebrospinal fluid is pharmaceutical grade. In certain embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium 25 phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2.

[0451] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric agent and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene 30 glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0452] In certain embodiments, an oligomeric agent may be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of 35 administration, extent of disease, or dose to be administered.

[0453] In certain embodiments, pharmaceutical compositions comprising an oligomeric agent encompass any pharmaceutically acceptable salt of the oligomeric agent, esters of the oligomeric agent, or salts of such esters.

[0454] 48 BIOL0482WO

[0455] Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent comprising or consisting of one or more modified oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue 5 thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric agents provided herein, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an 10 oligonucleotide, wherein the conjugate group is cleaved, for example by endogenous nucleases, within the body.

[0456] In certain embodiments, oligomeric agents are lyophilized and isolated, e.g., as sodium salts. In certain embodiments, a sodium salt of an oligomeric agent is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is sterile water, sterile saline, sterile phosphate-buffered saline or sterile artificial cerebrospinal fluid. In certain embodiments, a sodium salt of an oligomeric agent is mixed with 15 PBS. In certain embodiments, the sodium salt of the oligomeric agent is a sodium salt of a modified oligonucleotide.

[0457] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain methods, a nucleic acid, such as an oligomeric agent comprising a modified oligonucleotide, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, nucleic acid complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety 20 is selected to increase distribution of an oligomeric agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to muscle tissue.

[0458] In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing 25 certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

[0459] In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more oligomeric agents to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

[0460] 30 In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co- solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non- limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™ and 65% w / v polyethylene 35 glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied;

[0461] 49 BIOL0482WO

[0462] other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

[0463] In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a 5 pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV)). In certain of such embodiments, a pharmaceutical composition comprises a diluent and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, 10 injectable suspensions are prepared using appropriate liquid diluents, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic 15 solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0464] Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an 20 oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” herein is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise 25 intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation or a combination of cations. In certain embodiments, one or more specific cation is identified. The cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, a structure depicting the free acid of a compound followed by the term “or a 30 pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0465] In certain embodiments, oligomeric agents provided herein are in aqueous solution with sodium. In certain embodiments, oligomeric agents are in aqueous solution with potassium. In certain embodiments, oligomeric agents 35 are in PBS. In certain embodiments, oligomeric agents are in water. In certain such embodiments, the pH of a solution is adjusted with NaOH and / or HCl to achieve a desired pH.

[0466] 50 BIOL0482WO

[0467] Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of an oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex, antisense agent) in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric duplex. As described herein, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of 5 calculating dose, it is assumed that the oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex) exists as a solvent-free, sodium-acetate free, anhydrous, free acid. In certain embodiments, where an oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex) is in solution comprising sodium (e.g., saline), the oligomeric agent may be partially or fully de-protonated and in association with sodium ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium ions is not counted toward the weight 10 of the dose. When an oligomeric agent comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric agent. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.

[0468] V. Agents

[0469] 15 Compound No.1277887

[0470] Compound No.1277887 is characterized as a 5-10-5 MOE gapmer consisting of 20 linked nucleosides and having a nucleobase sequence of (from 5’ to 3’) AGCCACATAACCCGTAGGAC (SEQ ID NO: 11), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2’-β-D- deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 20 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7, to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine.

[0471] Compound No. 1277887 is represented by the following chemical notation (from 5’ to 3’): AesGeomCeomCeoAesmCdsAdsTdsAdsAdsmCdsmCdsmCdsGdsTdsAeoGeoGesAesmCe(SEQ ID NO: 12), wherein,

[0472] 25 A = an adenine nucleobase,

[0473] mC = a 5-methylcytosine nucleobase,

[0474] G = a guanine nucleobase,

[0475] T = a thymine nucleobase,

[0476] e = a 2’ MOE sugar moiety,

[0477] 30 d = an unmodified DNA sugar moiety,

[0478] s = a phosphorothioate internucleoside linkage, and

[0479] o = a phosphodiester internucleoside linkage.

[0480] 51 BIOL0482WO

[0481] Compound No.1277887 is represented by the following chemical structure:

[0482]

[0483] In certain embodiments, Compound 1277887 is a pharmaceutically acceptable salt comprising one or more 5 cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, Compound 1744767 is a sodium salt or a potassium salt.

[0484] The sodium salt of Compound No.1277887 is represented by the following chemical structure:

[0485] 52 BIOL0482WO

[0486]

[0487] Nonlimiting disclosure and incorporation by reference

[0488] 5 Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

[0489] While certain compounds, compositions, and methods have been described herein with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, and the like recited in the present application is incorporated herein by reference in its entirety.

[0490] 10 The sequence listing accompanying this filing identifies each nucleic acid sequence as either “RNA” or “DNA” as required; however, one of skill in the art will readily appreciate that designation of “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a

[0491] 53 BIOL0482WO

[0492] nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (i.e., 2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (i.e., thymine (5-methyl uracil) in place of an uracil of RNA); and certain nucleic acid compounds described herein comprise one or more nucleosides comprising modified sugar moieties having 2’-substituent(s) that are neither OH nor H. One of skill in the art will 5 readily appreciate that labeling such nucleic acid compounds “RNA” or “DNA” does not alter or limit the description of such nucleic acid compounds.

[0493] Herein, the description of compounds as having “the nucleobase sequence of” a SEQ ID NO describes only the nucleobase sequence. Accordingly, absent additional description, such description of compounds by reference to a nucleobase sequence of a SEQ ID NO does not limit sugar or internucleoside linkage modifications or presence or 10 absence of additional substituents such as a conjugate group. Further, absent additional description, the nucleobases of a compound “having the nucleobase sequence of” a SEQ ID NO include such compounds having modified forms of the identified nucleobases as described herein.

[0494] Herein, the description of compounds by chemical notation (subscripts and / or superscripts to indicate chemical modifications) without reference to a specific Compound No. include only each noted modification, but may 15 include additional substituents, such as a conjugate group, unless otherwise indicated. For example, the chemical notation of “AesTkomCezGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-MOE sugar moiety (indicated by the “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a 20 phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesyl phosphoramidate linkage (indicated by the “z” subscript); the fourth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety (indicated by the “d” subscript) and an unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety and an 25 unmodified cytosine nucleobase; and the compound may include additional substituents, such as a conjugate group.

[0495] Herein, where a specific compound (e.g., with reference to a Compound No.) is described (as in the examples) by chemical notation, each nucleobase, sugar, and internucleoside linkage of such specific compound is modified only as indicated. Accordingly, in the context of a description of a specific compound having a particular Compound No., “AesTkomCezGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-MOE sugar moiety (indicated 30 by the “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesyl phosphoramidate linkage 35 (indicated by the “z” subscript); the fourth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety (indicated by the “d” subscript) and an unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate

[0496] 54 BIOL0482WO

[0497] linkage; and the fifth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound does not include additional substituents.

[0498] Herein, sugar, internucleoside linkage, and nucleobase modifications may be indicated within a nucleotide or nucleobase sequence (e.g., by superscript or subscript, as shown above) or may be indicated in text accompanying 5 a sequence (e.g., in separate text that appears within or above or below a table of compounds).

[0499] Where a specific compound is described herein by way of a drawn chemical structure, each nucleobase, sugar, and internucleoside linkage of such a specific compound includes only the modifications indicated in the drawn chemical structure. One of skill will appreciate, however, that drawn compounds may exist in equilibrium between tautomeric forms and / or as salts in equilibrium with protonated or ionic forms. Drawn structures are intended to 10 capture all such forms of such compounds.

[0500] While effort has been made to accurately describe compounds in the accompanying sequence listing, should there be any discrepancies between a description in this specification and in the accompanying sequence listing, the description in the specification and not in the sequence listing is the accurate description.

[0501] The compounds described herein include variations in which one or more atoms are replaced with a non-15 radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to:2H or3H in place of1H,13C or14C in place of12C,15N in place of14N,17O or18O in place of16O, and33S,34S,35S, or36S. In certain embodiments, non- radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use 20 as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

[0502] EXAMPLES

[0503] The following examples illustrate certain embodiments of the present disclosure and are not limiting.

[0504] 25 Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high- affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

[0505] 30

[0506] Example 1: Design and effect of a modified oligonucleotide on human PACS1 RNA in vitro, single dose A modified oligonucleotide complementary to a human PACS1 RNA was designed and tested for single dose effects on PACS1 RNA in vitro.

[0507] The modified oligonucleotide in the table below is a 5-10-5 MOE gapmer with mixed PS / PO internucleoside 35 linkages. The modified oligonucleotide is 20 nucleosides in length. The sugar motif for the modified oligonucleotide is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’-β-D-deoxyribosyl sugar moiety and each “e” represents a ribo-2’-MOE sugar moiety modified sugar moiety. The internucleoside linkage motif of the modified

[0508] 55 BIOL0482WO

[0509] oligonucleotide is (from 5’ to 3’): sooosssssssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0510] “Start site” indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3’-most nucleoside to which the modified oligonucleotide is 5 complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NC_000011.10 truncated from nucleoside 66067001 to nucleoside 66248000).

[0511] Cultured A431 cells were treated with modified oligonucleotide at a concentration of 4000 nM by free uptake at a density of 10,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from 10 the cells and PACS1 RNA levels were measured by quantitative real-time PCR (RTPCR). PACS1 RNA levels were measured by mouse primer-probe set RTS44556 (forward primer sequence CGTTACAAGAATCGGACCATCT, designated herein as SEQ ID NO: 2; reverse primer sequence AGACATCCTTCACGTTGCTG, designated herein as SEQ ID NO: 3; probe sequence TGCTGCATCACCTCTGCCATGT, designated herein as SEQ ID NO: 4). PACS1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of PACS1 RNA is 15 presented in the table below as percent PACS1 RNA relative to the amount of PACS1 RNA in untreated control cells (% UTC).

[0512] Table 1

[0513] Reduction of PACS1 RNA in A431 cells

[0514] Compound No.SEQ ID NO: 1SEQ ID NO: 1 PACS1 (%

[0515] Start Site Sto SiteSequence (5' to 3')UTC)SEQ ID NO

[0516]

[0517] Modified oligonucleotide selected from the example above was tested at various doses in A431 cells.

[0518] A431 cells were plated at a density of 10,000 cells per well and were treated by free uptake with various concentrations of modified oligonucleotide as specified in the table below. After a treatment period of approximately 72 hours, total RNA was isolated from the cells, and PACS1 RNA levels were measured by quantitative real-time PCR 25 (RTPCR). PACS1 RNA levels were measured by human PACS1 primer-probe set RTS44556 (described herein above).

[0519] PACS1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of PACS1 RNA is presented in the table below as percent PACS1 RNA, relative to the amount of PACS1 RNA in untreated control cells (% UTC).

[0520] The half maximal inhibitory concentration (IC50) of the modified oligonucleotide was calculated using 30 GraphPad Prism 10 software (GraphPad Software, San Diego, CA) and is presented in the table below.

[0521] 56 BIOL0482WO

[0522] Table 2

[0523] Dose-dependent effects on human PACS1 RNA in A431cells

[0524] PACS1 RNA (% UTC)

[0525] Compound No. IC (µM)

[0526] 200 nM 1000 nM 10000 nM50

[0527] Example 3: Dose-depe

[0528]

[0529] a modified oligonucleotide 5 Modified oligonucleotide from the examples above, was tested at various doses in iCell® GABAneurons (FujiFilm Cellular Dynamics, Inc.; Catalog No: R1013).

[0530] Cultured iCell® GABAneurons at a density of 50,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and PACS1 RNA levels were measured by quantitative real-time PCR 10 (RTPCR). PACS1 RNA levels were measured by human PACS1 primer-probe set RTS44562 (forward primer sequence TGCTCACCCGGATCCAG, designated herein as SEQ ID NO: 5; reverse primer sequence GACAAAGAACCTGAGGATGGA, designated herein as SEQ ID NO: 6; probe sequence TGGGAGGCCAGAGCTACCTGA, designated herein as SEQ ID NO: 7). PACS1 RNA levels were normalized to mouse PPIA. Mouse PPIA was amplified using primer probe set m_cyclo24 (forward primer sequence 15 TCGCCGCTTGCTGCA, designated herein as SEQ ID NO: 8; reverse primer sequence ATCGGCCGTGATGTCGA, designated herein as SEQ ID NO: 9; probe sequence CCATGGTCAACCCCACCGTGTTC, designated herein as SEQ ID NO: 10). Reduction of PACS1 RNA is presented in the table below as percent PACS1 RNA, relative to the amount of PACS1 RNA in untreated control cells (% UTC).

[0531] The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using 20 GraphPad Prism 10 software (GraphPad Software, San Diego, CA) and is also presented in the tables below.

[0532] Table 3

[0533] Dose-dependent reduction of human PACS1 RNA in iCell® GABAneurons by modified oligonucleotides Compound No.PACS1 RNA (% UTC)IC50

[0534] (M)Exa

[0535]

[0536] mpe 4: Dose-dependent nbton o uman PACS1 n SH-SY5Y ces by a moded ogonuceotde 25 The modified oligonucleotide Compound 1277887 described in the examples above was tested at various doses in differentiated SH-SY5Y cells. SH-SY5Y cells plated at a density of 10,000 cells per well were differentiated in Neurobasal media (Gibco) supplemented with B27 supplement, 1X Glutamax and 10 µM all-trans retinoic acid for 10 days before they were treated with various concentrations of modified oligonucleotide, as specified in the table below, by free uptake. After a treatment period of approximately 5 days, total RNA was isolated from the cells and 30 PACS1 RNA levels were measured by quantitative real-time RT-PCR.

[0537] PACS1 RNA levels were measured by human primer-probe set RTS44556 (described herein above). PACS1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of PACS1 RNA is

[0538] 57 BIOL0482WO

[0539] presented in the table below as percent PACS1 RNA relative to the amount of PACS1 RNA in untreated control cells (% UTC).

[0540] The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using GraphPad Prism 10 software (GraphPad Software, San Diego, CA) and is also presented in the tables below.

[0541] 5 Table 4

[0542] Dose-dependent effects of human PACS1 RNA in SH-SY5Y cells by Compound 1277887 CompoundPACS1 RNA (% UTC) IC50No.(µM)M 1 M M 2 M 2 M 12 M 12 M 2 M M 2 M 9

[0543]

[0544] 58

Claims

1. BIOL0482WO2.CLAIMS:

1. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation: AesGeomCeomCeoAesmCdsAdsTdsAdsAdsmCdsmCdsmCdsGdsTdsAeoGeoGesAesmCe(SEQ ID NO: 12), wherein:4.A = an adenine nucleobase,5.mC = a 5-methylcytosine nucleobase;6.G = a guanine nucleobase;7.T = a thymine nucleobase;8.e = a 2’-MOE sugar moiety;9.d = a 2’-β-D-deoxyribosyl sugar moiety;10.s = a phosphorothioate internucleoside linkage; and11.o = a phosphodiester internucleoside linkage; and12.wherein the oligomeric compound optionally comprises a conjugate group and / or a terminal group.

2. An oligomeric agent comprising a modified oligonucleotide according to the following chemical notation: N1esGeomCeomCeoAesmCdsAdsTdsAdsAdsmCdsmCdsmCdsGdsTdsAeoGeoGesAesmCe(SEQ ID NO: 13), wherein:14.A = an adenine nucleobase,15.mC = a 5-methylcytosine nucleobase;16.G = a guanine nucleobase;17.T = a thymine nucleobase;18.e = a 2’-MOE sugar moiety;19.d = a 2’-β-D-deoxyribosyl sugar moiety;20.s = a phosphorothioate internucleoside linkage;21.o = a phosphodiester internucleoside linkage; and22.N1= an adenine nucleobase, a modified adenine nucleobase, a hypoxanthine nucleobase, an abasic sugar moiety, a terminal group, or is absent, wherein when N1is absent its sugar and internucleoside linkage are also absent; and23.wherein the oligomeric compound optionally comprises a conjugate group and / or a terminal group.

3. The oligomeric agent of claim 2, wherein N1is an adenine nucleobase.

4. The oligomeric agent of claim 2, wherein N1is a modified adenine nucleobase.

5. The oligomeric agent of claim 2, wherein N1is a hypoxanthine nucleobase.

6. The oligomeric agent of claim 2, wherein N1is an abasic sugar moiety.

7. The oligomeric agent of claim 2, wherein N1is a terminal group.

8. The oligomeric agent of claim 2, wherein N1is absent.

9. The oligomeric agent of any one of claims 1-8, consisting of the modified oligonucleotide.

10. The oligomeric agent of any one of claims 1-9, wherein the oligomeric agent comprises a conjugate group.31.59 BIOL0482WO11. The oligomeric agent of claim 10, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

12. The oligomeric agent of claim 11, wherein the conjugate linker is cleavable.

13. The oligomeric agent any one of claims 11-12, wherein the conjugate linker consists of a single bond.

14. The oligomeric agent of any one of claims 11-13, wherein the conjugate linker comprises 1-3 linker-nucleosides.

15. The oligomeric agent of any one of claims 11-13, wherein the conjugate linker does not comprise any linker nucleosides.

16. The oligomeric agent of any one of claims 10-15, wherein the conjugate group is attached to the modified oligonucleotide at the 5’-end of the modified oligonucleotide.

17. The oligomeric agent one of any one of claims 10-15, wherein the conjugate group is attached to the modified oligonucleotide at the 3’-end of the modified oligonucleotide.

18. The oligomeric agent one of any one of claims 1 to 17, wherein the oligomeric agent comprises a terminal group.

19. The oligomeric agent of claim 1718 wherein the terminal group is an abasic sugar moiety.

20. The oligomeric compound of any one of claims 1-19, wherein the oligomeric compound is a pharmaceutically acceptable salt.

21. The oligomeric compound of claim 20, wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

22. The oligomeric agent of any one of claims 1-21, wherein the oligomeric agent is a singled-stranded oligomeric agent.44.60 BIOL0482WO23. A modified oligonucleotide according to the following chemical structure:

47.

24. The modified oligonucleotide of claim 23, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

25. The modified oligonucleotide of claim 24, which is the sodium salt or the potassium salt.51.61 BIOL0482WO26. A modified oligonucleotide according to the following chemical structure53.NH2O O54.N N NH NHHON O NO22N2N O O58.

27. A population of oligomeric agents of any one of claims 1-22 or a population of modified oligonucleotides of any one of claims 23-26, wherein each of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

28. A pharmaceutical composition comprising an oligomeric agent of any one of claims 1-22, a modified oligonucleotide of any one of claims 23-26, or a population of claim 27, and a pharmaceutically acceptable diluent.

29. The pharmaceutical composition of claim 28, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, water, or phosphate-buffered saline.63.62 BIOL0482WO30. The pharmaceutical composition of claim 28 or claim 29, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and artificial cerebrospinal fluid.

31. The pharmaceutical composition of any one of claims 28-30, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and phosphate-buffered saline.

32. A method comprising administering to a subject an oligomeric agent of any one of claims 1-22, a modified oligonucleotide of any one of claims 23-26, a population of claim 27, or a pharmaceutical composition of any one of claims 28-31.

33. The method of claim 32, wherein the subject has or is at risk for developing a disease associated with PACS1.

34. The method of claim 32 or claim 33, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition ameliorates at least one symptom of a disease associated with PACS1.

35. The method of claim 34, wherein the at least one symptom of the disease associated with PACS1 comprises developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, motor disturbances, congenital heart anomalies, ocular abnormalities, brain abnormalities, or microcephaly.

36. The method of any one of claims 32-35, wherein PACS1 protein levels in the subject are reduced.

37. The method of any one of claims 33-36, wherein the disease associated with PACS1 is a neurodegenerative disease.

38. The method of claim 37, wherein the disease associated with PACS1 is a PACS1-neurodevelopmental disorder (PACS1-NDD).

39. A method of treating a disease associated with PACS1 comprising administering to a subject having or at risk for developing the disease associated with PACS1 a therapeutically effective amount of an oligomeric agent of any one of claims 1-22, a modified oligonucleotide of any one of claims 23-26, a population of claim 27, or a pharmaceutical composition of any one of claims 28-31, thereby treating the disease or disorder associated with PACS1.

40. The method of claim 39, wherein administering the oligomeric agent, the modified oligonucleotide, the population, or the pharmaceutical composition ameliorates at least one symptom of the disease associated with PACS1.

41. The method of claim 39 or claim 40, wherein the at least one symptom of the disease associated with PACS1 comprises developmental delay, intellectual disability, speech disability, hypotonia, gastroesophageal reflux, constipation, oral aversion, preference for soft foods, seizures, autism spectrum disorder, temper tantrums, aggression, anxiety, motor disturbances, congenital heart anomalies, ocular abnormalities, brain abnormalities, or microcephaly.76.63 BIOL0482WO42. The method of any one of claims 39-41, wherein PACS1 protein levels in the subject are reduced.

43. The method of any one of claims 39-42, wherein the disease associated with PACS1 is a neurodegenerative disease.

44. The method of claim 43, wherein the disease associated with PACS1 is a PACS1-neurodevelopmental disorder (PACS1-NDD).

45. The method of any one of claims 39-44, wherein the subject is human.

46. A method of reducing expression of PACS1 in a cell comprising contacting the cell with an oligomeric agent of any one of claims 1-22, a modified oligonucleotide of any one of claims 23-26, a population of claim 27, or a pharmaceutical composition of any one of claims 28-31.

47. The method of claim 46, wherein the cell is a neuron or an oligodendrocyte.

48. The method of claim 46 or claim 27, wherein the cell is a human cell.

49. Use of an oligomeric agent of any one of claims 1-22, a modified oligonucleotide of any one of claims 23-26, a population of claim 27, or a pharmaceutical composition of any one of claims 28-31 for treating a disease associated with PACS1.

50. Use of an oligomeric agent of any one of claims 1-22, a modified oligonucleotide of any one of claims 23-26, a population of claim 27, or a pharmaceutical composition of any one of claims 28-31 in the manufacture of a medicament for treating a disease associated with PACS1.

51. The use of claim 49 or claim 50, wherein the disease associated with PACS1 is associated with an elevated level of PACS1.

52. The use of any one of claims 49-51, wherein the disease or disorder associated with PACS1 is a neurodegenerative disease.

53. The use of claim 51, wherein the disease associated with PACS1 is a PACS1-neurodevelopmental disorder (PACS1-NDD).89.64