Method of generating liver organoid model and model recapitulating nafld hallmarks

Abstract

The present disclosure provides a liver organoid model that recapitulates the hallmarks of non-alcoholic fatty liver disease (NAFLD), comprising both parenchymal and non-parenchymal liver cell types. The organoid is formed from primary hepatocytes isolated from healthy individuals, NAFLD patients, or a combination thereof, and expresses molecular markers of hepatocytes, cholangiocytes, stem cells, stellate cells, and Kupffer-like cells, displaying steatosis, inflammation, and fibrosis. The method for generating this model includes isolating primary hepatocytes, culturing them in defined initiation, expansion, and differentiation media, and performing functional characterization and passaging. The resulting organoid serves as a platform for developing in vitro models of steatohepatitis, high-throughput screening of candidate compounds, and gene expression and imaging analyses, with further validation in animal models. This approach enables physiologically relevant disease modeling and evaluation of therapeutic candidates for NAFLD and steatohepatitis.

Description

METHOD OF GENERATING LIVER ORGANOID MODELAND MODEL RECAPITULATING NAFLD HALLMARKSFIELD OF THE PRESENT DISCLOSURE

[0001] The present disclosure generally relates to a liver organoid model and a method of generating a liver organoid model that recapitulates key hallmarks of non-alcoholic fatty liver disease (NAFLD), including steatosis, inflammation, and fibrosis. More specifically, the present disclosure pertains to a method for generating a liver organoid model from primary hepatocytes isolated from healthy individuals and NAFLD patients, wherein the resulting model recapitulates the hallmarks of steatohepatitis.BACKGROUND

[0002] Non-alcoholic fatty liver disease (NAFLD), also known as metabolic dysfunction-associated steatotic liver disease (MASLD) is a global epidemic impacting more than 30% of the world's populationl. A more severe form of the disease is called NASH or metabolic dysfunction-associated steatohepatitis (MASH). It begins with the accumulation of intra-hepatic lipids, known as steatosis, which may subsequently progress to steatohepatitis (NASH / MASH), fibrosis, cirrhosis and potentially hepatocellular cancer.

[0003] In March 2024, the FDA gave fast-track approval to Madrigal's Resmetirom (Rezdiffra), making it the first-ever licensed drug for the management of NAFLD. However, even with an approved drug available for prescription, the path ahead for these patients remains challenging because, in phase III testing, Resmetirom improved key readouts of liver pathology in just 25-30% of patients.4 Therefore, there is an ongoing need for increasingly effective medications.

[0004] While multiple other investigational drug molecules have also demonstrated promising outcomes in the pre-clinical studies, any further development of these candidates has been largely hindered due to the poor translation of in vitro and in vivo findings during their clinical evaluation. A major hurdle in developing medication for NAFLD is the absence of translationalpre-clinical human-relevant models.

[0005] In vitro assays, used for the screening of compounds at the pre-clinical level utilize immortalized cell lines specific to certain cell types, which are unable to replicate the complex role played by the liver in maintaining homeostasis or in pathological states. Although primary human hepatocytes (PHH) constitute approximately 90% of liver tissue and are considered the gold standard for studying liver diseases, acquiring fresh liver tissue is challenging.

[0006] Additionally, primary hepatocytes rapidly lose their function in culture, restricting their use to a few days in flasks. Thus, the development of clinically relevant in vitro disease models becomes imperative to surmount these challenges. In addition, several diet-induced animal models of NAFLD have been developed to date to understand the mechanisms of NASH pathogenesis and progression, however, they also lack reproduction of the disease architecture similar to human NASH. Further investigations are therefore demanded to develop more precise models that accurately reproduce the disease pathophysiology.

[0007] In the last decade, a significant amount of literature has emerged in the development of liver organoid models suggesting their potential in understanding the fundamental mechanisms of disease pathophysiology, drug testing and regenerative studies. Organoids are three-dimensional multicellular clusters that recapitulate the original characteristics of their primary tissues, including self-renewal, organization, and differentiation. Liver organoids can be developed from several cellular sources such as; pluripotent stem cells (PSCs), inducible PSCs (iPSCs), stem cells (ESCs), or primary epithelial cells, such as primary hepatocytes or cholangiocytes isolated from fetal or adult human liver tissues. These organoid models represent a liver tissue-like cytoarchitecture and have been re-viewed in detail in a few recent publications.

[0008] Recently, a human iPSC derived liver organoids-on-a-chip platform to study NAFLD and develop effective therapies. Upon induction with free fatty acids (FFA), these liver organoids exhibited lipid droplet formation and triglyceride ac-cumulation along with upregulated expressions of lipid metabolism-associated genes suggesting the abnormal lipid metabolic process in NAFLD. This model however did not describe the development of other hallmarks of steatohepatitis such as inflammation or fibrosis.

[0009] In addition to this, there have also been some concerns about the acceptability of organoid models prepared from PSCs, ESCs or induced PSCs (iPSCs) due to the requirementof several steps of genetic reprogramming. Organoids derived from cells isolated from specific tissues however do not require any genetic manipulations. These organoids are gaining a wider acceptance also because they are developed using cells isolated from the desired, bonafide and authentic tissue source.

[0010] To understand the stage-specific modulation of NASH and gain a mechanistic understanding of disease progression, in the existing art, have recently reported the development of liver organoid culture using liver tissues derived from mice with different stages of nonalcoholic steatohepatitis (NASH).

[0011] However, since animal models do not fully recapitulate human NASH, McCarron et al., developed liver organoid cultures using the stem cells isolated directly from the end stage liver of patients with NASH to overcome these concerns and address the current knowledge gaps in human NASH pathology.

[0012] One of a recent report have also reported the establishment of an in vitro model using tissue-derived organoids to mimic the first stage of NAFLD, steatosis and demonstrated the antisteatotic property of test compounds using this model. However, this model does not show the other hallmarks of steatohepatitis such as inflammation or fibrosis.

[0013] Another recent report has also shown the generation of three-dimensional multi-cell-type liver organoids fusing three different cell lines such as Hepa-RG cells, primary human macrophages, and hepatic-stellate-cell-derived LX-2 cells. Although the exposed organoids showed typical features of steatosis and expressed fibrosis markers, this model does not pacify the concerns associated with the use of cell-line-based models for screening purposes. According to a comprehensive analysis of the literature, which includes a recent review article by Park et al., there are no reports of organoids that mimic all three key characteristics of steatohepatitis fibrosis, inflammation, and steatosis-derived from liver cells taken from healthy or non-alcoholic fatty liver disease patients.

[0014] According to a comprehensive analysis of the literature, there are no reports of organoids that mimic all three key characteristics of steatohepatitis: steatosis, inflammation and fibrosis derived from liver cells taken from healthy or non-alcoholic fatty liver disease patients.

[0015] Despite significant advances in the understanding of non-alcoholic fatty liverdisease (NAFLD) and its progression to steatohepatitis, current preclinical models remain inadequate for faithfully recapitulating the human disease. In vitro assays commonly rely on immortalized cell lines, which lack the complex multicellular architecture and functional diversity of the human liver. These cell lines are unable to reproduce the dynamic interactions between parenchymal and non-parenchymal cells that are critical for maintaining liver homeostasis and for modeling pathological states such as steatosis, inflammation, and fibrosis. Furthermore, while primary human hepatocytes are considered the gold standard for liver disease studies, their rapid loss of function in culture and limited availability restrict their utility for long-term disease modeling and drug screening.

[0016] Animal models, including diet-induced and genetically engineered mice, have been widely used to study NAFLD and NASH pathogenesis. However, these models often fail to reproduce the full spectrum of human disease, particularly the cellular and molecular hallmarks of steatohepatitis. Differences in liver physiology, immune response, and disease progression between animals and humans limit the translational relevance of findings from these systems. Similarly, organoid models derived from pluripotent stem cells or reprogrammed cell lines require multiple steps of genetic manipulation and do not consistently express all three key features of steatohepatitis steatosis, inflammation, and fibrosis within a single system. Some recent approaches have attempted to combine multiple cell types or use tissue-derived organoids, but these models either lack the necessary cellular heterogeneity or fail to maintain disease-specific characteristics over time.

[0017] Given these limitations, there is a clear and pressing need for a robust, physiologically relevant in vitro model that can accurately recapitulate the hallmarks of NAFLD and steatohepatitis. A model developed from primary hepatocytes isolated from both healthy individuals and NAFLD patients would overcome the shortcomings of existing systems by providing authentic cellular architecture, spontaneous multilineage differentiation, and long-term functional stability. Such a model would enable the simultaneous study of steatosis, inflammation, and fibrosis, facilitate mechanistic investigations, and support high-throughput screening of candidate compounds for therapeutic intervention. Addressing this unmet need would represent a significant advancement in the field, paving the way for more effective drug discovery and personalized approaches to managing NAFLD and its complications.SUMMARY

[0018] To achieve the foregoing and other objectives, the present disclosure provides a liver organoid model and a method for generating a liver organoid model that recapitulates the hallmarks of non-alcoholic fatty liver disease (NAFLD). The present disclosure enables the systematic isolation of primary hepatocytes from healthy individuals and NAFLD patients, followed by their culture in a defined sequence of initiation, expansion, and differentiation media to form three-dimensional organoids. Through this optimized methodology, the resulting organoid expresses molecular markers of both parenchymal and non-parenchymal liver cells and displays the key features of steatosis, inflammation, and fibrosis. This approach establishes a physiologically relevant model for studying NAFLD pathogenesis and supports the advancement of targeted strategies for disease modeling and therapeutic discovery.

[0019] In one embodiment, the present disclosure provides a liver organoid model that recapitulates hallmarks of non-alcoholic fatty liver disease (NAFLD) comprising both parenchymal and non-parenchymal liver cell types, wherein the organoid is formed from primary hepatocytes isolated from a group consisting of a healthy individual, a NAFLD patient, and a combination thereof, and wherein the organoid expresses molecular markers of hepatocytes, cholangiocytes, stem cells, stellate cells, and kupffer-like cells, and displays the hallmarks of steatosis, inflammation, and fibrosis.

[0020] In another embodiment, the present disclosure provides a method for generating and characterizing a liver organoid model that recapitulates hallmarks of non-alcoholic fatty liver disease (NAFLD). The method comprises performing needle biopsy of liver tissue from NAFLD patients and conducting histopathological analysis of the biopsy specimens, isolating primary hepatocytes from liver tissue obtained from a group consisting of healthy individuals, NAFLD patients, and a combination thereof, suspending the primary hepatocytes in a basement membrane extract and culturing the cells in an initiation medium to form three-dimensional organoids, expanding the organoids in an expansion medium and subsequently differentiating the organoids in a differentiation medium, passaging and functionally characterizing the resulting organoids for molecular markers of both parenchymal and non-parenchymal liver cell types, and culturing the resulting organoids until a resulting liver organoid model is formed that expresses molecular markers of hepatocytes, cholangiocytes, stem cells, stellate cells, and Kupffer-like cells,and displays the hallmarks of steatosis, inflammation, and fibrosis.

[0021] In one or more embodiments, the method further comprises developing an in vitro model of steatohepatitis using the resulting organoids and, optionally, a co-culture with primary human stellate cells, establishing a high-throughput screening platform to test the antisteatotic activity of candidate compounds using the organoids, performing gene expression analysis and confocal microscopy for steatosis and immunofluorescence studies on the organoid samples, and conducting in vivo efficacy studies in C57BL / 6 mice fed with a high fat-high fructose diet, including biochemical analysis, intraperitoneal glucose tolerance test, histopathological analysis, gene expression studies of mouse liver tissue samples, and statistical analysis.

[0022] In one or more embodiments, the basement membrane extract comprises CultrexUltimatrix RGF basement membrane extract.

[0023] In one or more embodiments, the initiation medium comprises a combination of growth factors and supplements selected from the group consisting of DMEM / F12, penicillin / streptomycin, nicotinamide, HEPES, N2-MAX, glutamine, B-27, gastrin, FGF-10, N-acetylcysteine, A 83-01, BMP-7, Noggin, R-Spondin-1, Wnt-3a, HGF, Y-27632, EGF, forskolin and a combination thereof.

[0024] In one or more embodiments, the expansion medium is identical to the initiation medium except for the absence of Noggin, Wnt-3a, and Y-27632.

[0025] In one or more embodiments, the differentiation medium comprises a combination of growth factors and supplements selected from the group consisting of DMEM / F12, penicillin / streptomycin, dexamethasone, HEPES, A 83-01, N2-MAX, EGF, gastrin, FGF-19, HGF, BMP-7, B-27, DAPT, glutamine, retinoic acid, activin A, oncostatin M, VEGF, dorsomorphin dihydrochloride and a combination thereof.

[0026] In one or more embodiments, the resulting organoid expresses functional markers of hepatocytes, cholangiocytes, stem cells, stellate cells, and kupffer-like cells.

[0027] In yet another embodiments, the present disclosure provides an in vitro method for screening candidate compounds for efficacy against steatohepatitis. The method comprises exposing a three-dimensional liver organoid comprising both parenchymal and non-parenchymal liver cell types to a candidate compound and optionally to fatty acids, and assaying the liverorganoid for changes in gene expression and cellular markers associated with a group consisting of steatosis, inflammation, and fibrosis. Herein, the response of the liver organoid is indicative of the potential of the candidate compound to modulate the hallmarks of steatohepatitis.BRIEF DESCRIPTION OF THE FIGURES

[0028] The advantages and features of the present disclosure will become better understood with reference to the following detailed description and claims taken in conjunction with the accompanying drawing, in which:

[0029] FIG. 1 illustrates a method flow generating a liver organoid model that recapitulates hallmarks of non-alcoholic fatty liver disease (NAFLD), in accordance with an exemplary embodiment of the present disclosure.

[0030] FIG. 2 illustrates schematic representation of development of mouse model of non-alcoholic fatty liver diseases in a 22-week study using C57BL / 6 mice fed with and high fat-high fructose (HF -HF) diet, in accordance with an exemplary embodiment of the present disclosure.

[0031] FIG. 3 illustrates the establishment of hepatic liver organoids using primary hepatocytes derived from healthy human liver tissue, in accordance with an exemplary embodiment of the present disclosure.

[0032] FIG. 4A illustrates the characterization of functional markers of epithelial cells and stem cell functions in human liver organoids (HLOs) by RTPCR, in accordance with an exemplary embodiment of the present disclosure.

[0033] FIG. 4B illustrates the characterization of functional markers of epithelial cells and stem cell functions in HLOs by immunofluorescence studies, in accordance with an exemplary embodiment of the present disclosure.

[0034] FIG. 5A illustrates the development of in vitro model of fatty acids induced steatosis in HLOs, as demonstrated by establishment of a high-throughput screening model to test the antisteatotic potential of test compounds, in accordance with an exemplary embodiment of the present disclosure.

[0035] FIG. 5B illustrates the development of in vitro model of fatty acids induced steatosis in HLOs, as demonstrated by immunofluorescence study by high content imaging analysis, in accordance with an exemplary embodiment of the present disclosure.

[0036] FIG. 5C illustrates immunofluorescence study by confocal imaging, in accordance with an exemplary embodiment of the present disclosure.

[0037] FIG. 6A illustrates the establishment of an in vitro co-culture model of steatohepatitis using HLO-HLSCs that is HLOs and primary human stellate cells through a schematic flow, in accordance with an exemplary embodiment of the present disclosure.

[0038] FIG. 6B illustrates the establishment of an in vitro co-culture model of steatohepatitis using HLO-HLSCs that is HLOs and primary human stellate cells to test the antisteatotic properties of compounds by RT-PCR, in accordance with an exemplary embodiment of the present disclosure.

[0039] FIG. 6C illustrates the establishment of an in vitro co-culture model of steatohepatitis using HLO-HLSCs that is HLOs and primary human stellate cells to test the antiinflammatory properties of compounds by RT-PCR, in accordance with an exemplary embodiment of the present disclosure.

[0040] FIG. 6D illustrates the establishment of an in vitro co-culture model of steatohepatitis using HLO-HLSCs that is HLOs and primary human stellate cells to test the anti-fibrotic properties of compounds by RT-PCR, in accordance with an exemplary embodiment of the present disclosure.

[0041] FIG. 7A illustrates the establishment of an in vitro model of steatohepatitis using HLOs through a schematic flow, in accordance with an exemplary embodiment of the present disclosure.

[0042] FIG. 7B illustrates the characterization of HLO model to show the existence of non-parenchymal lineages by RTPCR, in accordance with an exemplary embodiment of the present disclosure.

[0043] FIG. 7C illustrates immunofluorescence studies showing the presence of hepatocyte and fibrotic markers in HLO-HLSCs, HLOs, and Hep-G2 cells, in accordance with an exemplary embodiment of the present disclosure.

[0044] FIG. 7D illustrates antisteatotic properties of test compound by RTPCR in PA-induced steatohepatitis model using HLOs, in accordance with an exemplary embodiment of the present disclosure.

[0045] FIG. 7E illustrates anti-inflammatory properties of test compound by RTPCR in PA-induced steatohepatitis model using HLOs, in accordance with an exemplary embodiment of the present disclosure.

[0046] FIG. 7F illustrates anti-fibrotic properties of test compound by RTPCR in PA-induced steatohepatitis model using HLOs, according to the present disclosure.

[0047] FIG. 8A illustrates the establishment of in vitro screening model using NAFD patients-derived organoids that is HLONAFLD through histopathological data of biopsy tissues from 6 NAFLD patients, in accordance with an exemplary embodiment of the present disclosure.

[0048] FIG. 8B illustrates the establishment of in vitro screening model using NAFD patients-derived organoids that is HLONAFLD through schematic flow of steatohepatitis model using HLONAFLD, in accordance with an exemplary embodiment of the present disclosure.

[0049] FIG. 8C illustrates the establishment of in vitro screening model using organoids derived from primary hepatocytes from NAFD patients that is HLONAFLD through expression levels of key functional markers of hepatocytes that is HNF4, Albumin, cholangiocytes that is Epcam, stem cells that is Lgr5+, Kupffer-like cells that is CD 166, EMR1 and stellate cells that is CD 166 markers in HLONAFLD, in accordance with an exemplary embodiment of the present disclosure.

[0050] FIG. 8D illustrates the establishment of in vitro screening model using NAFD patients-derived organoids that is HLONAFLD and testing antisteatotic properties of test compound that is metformin, in accordance with an exemplary embodiment of the present disclosure.

[0051] FIG. 8E illustrates the establishment of in vitro screening model using NAFD patients-derived organoids that is HLONAFLD and testing anti-inflammatory properties of test compound that is metformin, in accordance with an exemplary embodiment of the present disclosure.

[0052] FIG. 8F illustrates the establishment of in vitro screening model using NAFD patients-derived organoids that is HLONAFLD and testing anti-fibrotic properties of test compoundthat is metformin, in accordance with an exemplary embodiment of the present disclosure.

[0053] FIGs. 9A1 and 9A2 illustrate validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vitro data of Saroglitazar using PA-induced HLOs for antisteatotic properties of Saroglitazar by RTPCR in PA-induced steatohepatitis model using HLOs, according to the present disclosure.

[0054] FIGs. 9A3 and 9A4 illustrate validation of PA-induced human liver organoid (HLO) model of steatohepatitis by testing Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vitro data of Saroglitazar using PA-induced HLOs for antiinflammatory properties of Saroglitazar by RTPCR in PA-induced steatohepatitis model using HLOs, according to the present disclosure.

[0055] FIGs. 9A5 to 9A8 illustrate validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vitro data of Saroglitazar using PA-induced HLOs for anti-fibrotic properties of Saroglitazar by RTPCR in PA-induced steatohepatitis model using HLOs, according to the present disclosure.

[0056] FIG. 9B1 illustrates validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar for change in body-mass index (BMI), after 16 weeks of treatment, according to the present disclosure.

[0057] FIG. 9B2 illustrates validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar for IPGTT: AUC curve representing the area under each treatment group for blood glucose level, according to the present disclosure.

[0058] FIGs. 9B3 to FIG. 9B6 illustrate validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet- induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar for Plasma HDL, Plasma LDL, TG and Cholesterol respectively at the end of the treatment period, according to the present disclosure.

[0059] FIGs. 9B7 illustrate validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar for representative sections of histopathological analysis of liver tissues with 200 times magnification and H&E stain in the second lane and MT stain in the third lane, according to the present disclosure.

[0060] FIGs. 9B8 to FIG. 9B11 illustrate validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet- induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar, with scores from liver histopathology sections for Steatosis; Ballooning; Lobular inflammation and NAS score respectively, according to the present disclosure.

[0061] FIGs. 9B12 to FIG. 9B14 illustrate validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet- induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar, through mRNA expression analysis of inflammatory genes TNF-a; IL-6; CXCL1, according to the present disclosure.

[0062] FIGs. 9B15 to FIG. 9B17 illustrate validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet- induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar, through fibrogenic genes TGF-0; a-SMA; and Coll Al respectively using liver tissues from mice by real-time PCR analysis, according to the present disclosure.DETAILED DESCRIPTION

[0063] The exemplary embodiments described herein for illustrative purposes are subject to many variations in structure and design. It should be emphasized, however, that the present disclosure is not limited to the specific methods and integrated platforms for quantitative proteomic analysis of hair damage response as shown and described. The present disclosure offers significant advantages, including high-resolution and reproducible profiling of protein changes in hair, the ability to distinguish hair-type-specific damage responses, and the facilitation of targeted and effective hair repair strategies. Various omissions, modifications, and substitutions of equivalents are contemplated as circumstances may suggest or render expedient, and these are intended to cover the application or implementation without departing from the spirit or scope of the claims of the present disclosure. Furthermore, the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting.

[0064] The exemplary embodiments described herein for illustrative purposes are subject to numerous variations in structure and design. It should be emphasized, however, that the present disclosure is not limited to the specific liver organoid model and method for generating liver organoid model recapitulating the hallmarks of non-alcoholic fatty liver disease (NAFLD) as shown and described. The present disclosure offers significant advantages, including the reproducible generation of organoids expressing both parenchymal and non-parenchymal liver cell markers, the ability to model steatosis, inflammation, and fibrosis, and the facilitation of physiologically relevant disease modeling and drug screening. Various omissions, modifications, and substitutions of equivalents are contemplated as circumstances may suggest or render expedient, and these are intended to cover the application or implementation without departing from the spirit or scope of the claims of the present disclosure. Furthermore, the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting.

[0065] The use of terms “including,” “comprising,” or “having” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items.

[0066] Further, the terms, “a” and “an” herein do not denote a limitation of quantity but rather denote the presence of at least one of the referenced items.

[0067] As used herein, the term “about” will be understood by persons of ordinaryskill in the art and will vary to some extent depending upon the context in which it is used. If there are uses of the term which are not clear to persons of ordinary skill in the art, given the context in which it is used, “about” will mean up to plus or minus 10 % of the particular term.

[0068] In an embodiment, the present disclosure provides a liver organoid model that recapitulates hallmarks of non-alcoholic fatty liver disease (NAFLD) comprising both parenchymal and non-parenchymal liver cell types, wherein the organoid is formed from primary hepatocytes isolated from a group consisting of a healthy individual, a NAFLD patient, and a combination thereof, and wherein the organoid expresses molecular markers of hepatocytes, cholangiocytes, stem cells, stellate cells, and kupffer-like cells, and displays the hallmarks of steatosis, inflammation, and fibrosis.

[0069] The present disclosure generally relates to a liver organoid model alternatively termed as steatohepatitis model. The model expresses the key molecular signatures of the three major hallmarks of NAFLD: steatosis, inflammation, and fibrosis and it is used to find possible therapeutic candidates to treat this challenging pandemic across the globe. The model is further used to report to use patient-derived liver organoids (HLONAFLD) for the screening of compounds.

[0070] In another embodiment, the present disclosure provides a method for generating and characterizing a liver organoid model that recapitulates hallmarks of non-alcoholic fatty liver disease (NAFLD). The method comprises performing needle biopsy of liver tissue from NAFLD patients and conducting histopathological analysis of the biopsy specimens, isolating primary hepatocytes from liver tissue obtained from a group consisting of healthy individuals, NAFLD patients, and a combination thereof, suspending the primary hepatocytes in a basement membrane extract and culturing the cells in an initiation medium to form three-dimensional organoids, expanding the organoids in an expansion medium and subsequently differentiating the organoids in a differentiation medium, passaging and functionally characterizing the resulting organoids for molecular markers of both parenchymal and non-parenchymal liver cell types, culturing the organoids until a resulting liver organoid model is formed that expresses molecular markers of hepatocytes, cholangiocytes, stem cells, stellate cells, and Kupffer-like cells, and displays the hallmarks of steatosis, inflammation, and fibrosis.

[0071] Referring to FIG. 1, the method 100 relates to a method for generating and characterizing a liver organoid model that recapitulates hallmarks of non-alcoholic fatty liverdisease (NAFLD). At step 102, the method 100 comprises performing needle biopsy of liver tissue from NAFLD patients and conducting histopathological analysis of the biopsy specimens. At step 104, the method 100 comprises isolating primary hepatocytes from liver tissue obtained from a group consisting of healthy individuals, NAFLD patients, and a combination thereof. At step 106, the method 100 comprises suspending the primary hepatocytes in a basement membrane extract and culturing the cells in an initiation medium to form three-dimensional organoids.

[0072] Again, referring to FIG. 1, at step 108, the method 100 comprises expanding the organoids in an expansion medium and subsequently differentiating the organoids in a differentiation medium. At step 110, the method 100 comprises passaging and functionally characterizing the resulting organoids for molecular markers of both parenchymal and non-parenchymal liver cell types. At step 112, the method 100 comprises culturing the resulting organoids until a resulting liver organoid model is formed that expresses molecular markers of hepatocytes, cholangiocytes, stem cells, stellate cells, and Kupffer-like cells, and displays the hallmarks of steatosis, inflammation, and fibrosis.

[0073] Specifically, the method begins with the procurement of liver tissue from NAFLD patients through ultrasound-guided percutaneous needle biopsy, followed by histopathological analysis to confirm disease status and tissue quality. The biopsy specimens are fixed in buffered neutral formalin, processed, and paraffin embedded, with thin sections stained using hematoxylin and eosin (H&E) and Masson’s trichrome (MT) for expert pathological evaluation. Adequate samples are defined by the identification of at least 11 portal areas.

[0074] Primary human hepatocytes are then isolated from these biopsy specimens, as well as from healthy individuals, to serve as the cellular source for organoid generation. The isolated hepatocytes are suspended in a basement membrane extract and cultured in an initiation medium to form three-dimensional liver organoids. These organoids are expanded and differentiated in defined media, and passaged as needed to maintain growth and viability. Functional characterization of the organoids is performed to confirm the expression of molecular markers representative of both parenchymal and non-parenchymal liver cell types.

[0075] Once established, the liver organoid model is used to develop an in vitro model of steatohepatitis by subjecting the organoids to specific conditions, such as exposure to fatty acids or candidate compounds. High-throughput screening platforms are established to test theantisteatotic activity of test compounds using these organoids. Additional experimental setups may include co-culture of organoids with primary human stellate cells to further model the cellular complexity of steatohepatitis. Gene expression analysis, confocal microscopy for steatosis and immunofluorescence studies, and other molecular assays are performed to assess disease hallmarks and compound effects. Where applicable, in vivo efficacy studies are conducted using C57BL / 6 mice fed with a high fat-high fructose diet, including biochemical analysis, intraperitoneal glucose tolerance testing, histopathological analysis, gene expression studies of mouse liver tissue samples, and comprehensive statistical analysis to validate findings and ensure translational relevance.

[0076] The NASH Clinical Research Network (CRN) scoring system is used to grade macro-vesicular steatosis, ballooning degeneration and lobular inflammation, calculate the activity score and assess the stage of fibrosis. NASH activity score ranged from 0-8. NASH activity score lesser that 4 points is used to define NASH.28 Fibrosis seen in NAFLD patients are graded from F0 to F4. F0 represents the absence of fibrosis, Fl includes periportal or perisinusoidal fibrosis, F2 perisinusoidal and portal / periportal, F3 bridging fibrosis, and F4 cirrhosis.

[0077] Herein the generation of liver organoids from primary human hepatocytes derived from healthy individuals and NAFLD patients involves preparation of liver organoids by using primary hepatocytes isolated from healthy human liver tissues from Lonza or liver biopsy tissues obtained from NAFLD patients as shown in FIG. 3.

[0078] Referring to FIG. 3, the establishment of hepatic liver organoids using primary hepatocytes derived from healthy human liver tissue. Again, referring to FIG. 3, primary hepatocytes are isolated from biopsy-derived human liver tissues.

[0079] For the preparation of organoids, PHHs are suspended in CultrexUltiMatrix RGF Basement Mem-brane Extract (CBM) and plated at a density of 10x103 cells / 50 pl in the centre of each well of a 24-well plate, to generate domes following an established protocol.

[0080] Specifically, the plate-carrying domes are incubated at 37°C in a CO2 incubator for 15 minutes to polymerize the CBM before adding 500 pl / well of liver organoid initiation media and incubated further in a CO2 incubator at 37°C. After 3 days, the culture medium from each well is aspirated and replaced with a new liver organoid expansion medium (EM), maintaining the same composition as the initiation medium except for Noggin, Wnt-3a, and Y-27632. The expansion medium is changed every 3 days (500 pl / well).

[0081] In TABLE 1 , the description of initiated media is depicted. Herein Expansion Medium (EM): IM minus Noggin, Wnt-3a, and Y-27632.TABLE 1S.N. Reagent Name Final Concentration1 Ad DMEM / F12 (Gibco) IX2 Penicillin / Streptomycin (Gibco) IX3 Nicotinamide (Tocris Biosciences) 10 mM4 HEPES (Gibco) 10 mM5 N2-MAX (R&D Systems) IX6 Glutamine (Gibco) 2 mM7 B-27 (Gibco) IX8 Gastrin (Tocris Biosciences) lO nM9 FGF-10 (R&D Systems) 100 ng / ml 10 N-Acetylcystein (Sigma-Aldrich) 1.25 mM11 A 83-01 (Tocris Biosciences) 5 pM12 BMP-7 (R&D Systems) 25 ng / ml13 Noggin (R&D Systems) 25 ng / ml14 R-Spondin-1 (R&D Systems) 0.5mg / ml15 Wnt-3a (R&D Systems) 100 ng / ml 16 HGF (R&D Systems) 25 ng / ml17 Y-27632 (Tocric Biosciences) 10 pM18 EGF (R&D Systems) 50 ng / ml19 Forskolin (Tocric Biosciences) 10 pM

[0082] Herein, the expansion medium is changed every 3 days (500 pl / well). The liver organoids are passaged after 7-10 days. Following a minimum of 7-10 days in the expansion stage, the expansion medium is aspirated, washed with phosphate buffer saline (PBS) once, and supplemented with liver organoid differentiation medium (DM) (500 pl / well).

[0083] In TABLE 2, the description of differentiation media is depicted.TABLE 2S.N. Reagent Name Final Concentration1 Ad DMEM / F12 (Gibco) IX2 Penicillin / Streptomycin IX3 Dexamethasone (Sigma-Aldrich) 25 pM4 HEPES (Gibco) 10 mM5 A 83-01 (Tocris Biosciences) 0.5 pM6 N2-MAX (R&D Systems) IX7 EGF (R&D Systems) 50 ng / ml8 Gastrin (Tocris Biosciences) lO nM9 FGF-19 (R&D Systems) 100 ng / ml10 HGF (R&D Systems) 25 ng / ml11 BMP-7 (R&D Systems) 25 ng / ml12 B-27 (Gibco) IX13 DAPT (Tocris Biosciences) 10 pM14 Glutamine (Gibco) 2 mM15 Retinoic Acid (Sigma) 2.5 pM16 Activin A (Sigma) 100 ng / ml17 Oncostatin M (Sigma) 10 ng / ml18 VEGF (Peprotech) 10 ng / ml19 Dorsomorphin dihydrochloride 500pM(Tocris)

[0084] Thereafter, the culture media is gently changed with fresh liver organoid differentiation medium after every three days. Organoids are harvested after 10-12 days in the DM for the subsequent studies or maintained in the culture for another 8-12 weeks without losing any activity.

[0085] Liver organoids from the patient-derived hepatocytes are prepared following a methodology similar to healthy human liver tissue-derived hepatocytes. HLONAFLD from patients with NAS score=5 are used for the steatohepatitis model establishment.

[0086] Herein, the step of “passaging of HLOs” involves observation of organoids under the microscope and divided into 1:2 to 1:4 ratios based on their growth conditions. Subsequently, organoids are rinsed thrice with 250 pl cold (2-8°C) PBS, followed by the addition of 250 pl cold cultrex organoid harvesting solution from lonza.

[0087] The plate is then incubated for 30-90 minutes with gentle shaking at 2-8°C. After matrix depolymerisation, the contents of each well are transferred to a tube and centrifuged at 500 x g for 10 minutes at 2-8°C in a swinging bucket rotor to pellet the organoids.

[0088] The pellet is washed thrice with 500 pl of cold (2-8°C) PBS and suspended in a fresh ice-cold Liver Organoid Expansion Medium. After centrifugation, the culture medium is replaced with CultrexUltiMatrix RGF Basement Membrane Extract and 50 pl of the mixture is dispensed in the centre of each well of a 24- well plate to form domes and incubated at 37°C in a CO2 incubator for 15 minutes to polymerize CultrexUltimatrix RGF basement membrane extract. Following this, 500 pl of liver organoid initiation medium per well is added, and the plate is incubated again in a CO2 incubator to promote organoid growth.

[0089] Further, herein, the step of “Functional characterization of primary hepatocyte-derived organoids” involves harvesting of the organoids after a minimum of 7-10 daysin the EM and DM using an organoid harvesting medium from Lonza. The harvested organoids underwent two washes with PBS and are lysed with 50 pl lysis buffer. Subsequently, cDNA is prepared for further analysis. The expression levels of functional markers are assessed by RT-PCR in the PHH, organoids in the expansion medium (EM) and organoids in the differentiation medium (DM).

[0090] The markers include those indicative of hepatocytes such as albumin, AFP, SOX9, HNF4, cytokeratin-19, Ki-67, ductal cells that is Epcam and stem cell function that is Lgr5+. Additionally, the expression levels of functional markers specific to stellate cells that is CD 166 and Kupffer-like cells that is D68, EMR1 are analysed in the Organoids (DM) and PHH by RT-PCR. HLONAFLD are also characterized for the expression of functional markers of parenchymal and non-parenchymal cells wherein n=6 patients.

[0091] In one or more embodiments, the method further comprises developing an in vitro model of steatohepatitis using the resulting organoids and, optionally, a co-culture with primary human stellate cells, establishing a high-throughput screening platform to test the antisteatotic activity of candidate compounds using the organoids, performing gene expression analysis and confocal microscopy for steatosis and immunofluorescence studies on the organoid samples, conducting in vivo efficacy studies in C57BL / 6 mice fed with a high fat-high fructose diet, including biochemical analysis, intraperitoneal glucose tolerance test, histopathological analysis, gene expression studies of mouse liver tissue samples, and statistical analysis.

[0092] Herein, the step of “development of an in vitro model of steatohepatitis using HLOs” involves culturing of HLOs in a 48-well plate and treated with 10 pM metformin 10 pM for 30 minutes, followed by treatment with 750 pM palmitic acid and incubated further in a CO2 incubator at 37°C for 72 hours. Herein HLOs are harvested, and gene expression analysis is carried out.

[0093] Further the step of “establishment of a high-throughput screening platform to test the antisteatotic activity of test compounds using HLOs” involves maintaining HLOs for a minimum of 7-10 days in the differentiation medium followed by seeding at a density of lx 103 / well in a 96-well plate and exposed to varying concentrations of oleic acid (OA) and palmitic acid (PA). The assay is optimized to provide an acceptable assay window between induced / uninduced conditions and inhibition of fatty acid absorption using a standard toolcompound that is metformin and appropriate quality check parameters.

[0094] Herein, a concentration of 500 pM and a 2: 1 combination of OA and PA are found to be optimal for inducing steatosis in organoids without toxicity. Following 24 hours of OA: PA treatment, organoids are fixed with 2% formaldehyde and 0.1% glutaraldehyde in PBS for 30 minutes at room temperature. Subsequently, organoids are rinsed three times with 500 pl PBS.

[0095] To quench the free aldehyde groups, the organoids are treated with 10 mM NaBH4 solution for 5 minutes at room temperature and washed again three times with PBS. The organoids are then permeabilized for 2 hours at room temperature or overnight at 4°C with 0.5% Triton XI 00, followed by another three washes with PBS. The cells are then stained with 5 pM Nile Red; and 5 pg / ml DAPI for 15 minutes, followed by washing thrice with PBS and suspending in PBS for imaging.

[0096] Thereafter, the images of the organoids are acquired using the 10X objective of High-Content Imaging equipment. The step size is set at 20 pM, with 7 steps covering the complete length / range of 140 pm in a well. Beyond this range, pictures are observed to become fuzzy both above and below the well. Z-sectioning settings are employed to capture images of DAPI and Nile Red stained organoids at wavelengths of 358 / 461 nm and 530 / 570 nm, respectively. Each well received a total of 126 images wherein 63 for the DAPI channel and 63 for the Nile Red channel.

[0097] Herein, a custom-built pipeline is used to evaluate the obtained images. The intensity above the background criterion is utilized as a threshold line in this multi-wavelength cell scoring procedure, over which the signal is regarded as positive. The pipeline settings are the same for all the wells.

[0098] Further, herein, the step of “development of an in vitro model of steatohepatitis using a co-culture of HLOs with primary human stellate cells (HLSC)” involves a co-culture model of organoids and primary human liver stellate cells (HLSCs) is established. Differentiated HLOs are split, as described previously and mixed with HLSCs in a ratio of 5:1, respectively and centrifuged. The cell pellet is then suspended in CultrexUltiMatrix RGF Basement Membrane Extract and mounted in a 48-well plate with proportion of 25 pl / well to create domes in the centre of each well.

[0099] Thereafter, the plate is incubated in a CO2 incubator at 37°C for 10-15 minutes to polymerize the matrig el, followed by the addition of organoid differentiation medium (250 pl / well), which is replenished every 2-3 days with new media. HLO-HLSCs co-culture is pretreated with 10 pM metformin for 30 min, followed by treatment with 750 pM palmitic acid. The cells are then incubated at 37°C in a CO2 incubator for 72 hours. Subsequently, organoids are harvested using Cultrex Organoid Harvesting Solution, lysed with the lysis buffer Bio-rad) and reverse transcribed to prepare cDNA. The iScript cDNA Synthesis Kit is used to generate cDNA in a 20 pl reaction volume as per the manufacturer’s instructions.

[0100] Further, herein, the step of “gene expression analysis of organoid samples” involves gene expression analysis is carried out using TB Green® Premix Ex TaqTM (TIiR-NaseH Plus, TaKaRa Cat#RR420A). The RT-PCR assay is set up in a 384 well plate using a final volume of 10 pl containing; 5 pl TB green master mix, 0.2 pl Rox Reference Dye II, 0.2 pl forward primer, 0.2 pl reverse primer, 3.4 pl nuclease-free water (NFW), and 1 pl cDNA. The real-time PCR reaction is carried out using QuantStudio 6 to assess the antisteatotic, anti-inflammatory, and anti-fibrotic properties of the test compound using gene specific primers.

[0101] In TABLE 3A, the gene specific primers (Human) / Human primers are depicted.TABLE 3AGene Forward Primer Reverse PrimerIL-ip CCACAGACCTTCCAGGAGAATG GTGCAGTTCAGTGATCGTACAGG IL-18 GATAGCCAGCCTAGAGGTATGG CCTTGATGTTATCAGGAGGATTCA CollAl GATTCCCTGGACCTAAAGGTGC AGCCTCTCCATCTTTGCCAGCA a-SMA CTATGCCTCTGGACGCACAACT CAGATCCAGACGCATGATGGCA TGF-P TACCTGAACCCGTGTTGCTCTC GTTGCTGAGGTATCGCCAGGAA Albumin GATGAGATGCCTGCTGACTTGC CACGACAGAGTAATCAGGATGCC HNF4 GGTGTCCATACGCATCCTTGAC AGCCGCTTGATCTTCCCTGGAT EPCAM GCCAGTGTACTTCAGTTGGTGC CCCTTCAGG I 1 1 I GCTCTTCTCC LGR5 CCTGCTTGACITTGAGGAAGACC CCAGCCATCAAGCAGGTGTTCA CD36 CAGGTCAACCTATTGGTCAAGCC GCCTTCTCATCACCAATGGTCC SCD-1 CCTGGTTTCACTTGGAGCTGTG TGTGGTGAAGTTGATGTGCCAGCLIPA GTGGGTCATTCTCAAGGCACCA CCATAGGGCTAGTACAGAAGGC CD166 TCCAGAACACGATGAGGCAGAC GTAGACGACACCAGCAACAAGG CD68 CGAGCATCA 1 1 C 1 1 1 CACCAGCT ATGAGAGGCAGCAAGATGGACC EMR1 TGTGACGTTGGACTTGGTAGCC GGAGACAAAAGCCACACCAGTG (ADGRE1)Keratin 19 AGCTAGAGGTGAAGATCCGCGA GCAGGACAATCCTGGAGTTCTC Ki 67 GAAAGAGTGGCAACCTGCCTTC GCACCAAG 1 1 1 1 ACrACATCTGCC S0X9 AGGAAGCTCGCGGACCAGTAC GGTGGTCCTTCTTGTGCTGCAC AFP GCAGAGGAGATGTGCTGGATTG CGTGGTCAGTTTGCAGCATTCTG APOB AGAGGACAGAGCCTTGGTGGAT CTGGACAAGGTCATACTCTGCC TNF-a CTCTTCTGCCTGCTGCACTTTG ATGGGCTACAGGCTTGTCACTC IL-6 AGACAGCCACTCACCTCTTCAG TTCTGCCAGTG CCTCTTTG CTG IL-8 GAGAGTGATTGAGAGTGGACCAC CACAACCCTCTGCACCCAGTTT TIMP1 GG AG AGTGTCTG CG G ATACTTC GCAGGTAGTGATGTGCAAGAGTC

[0102] In TABLE 3B, the list of gene-specific markers (Mouse) / mouse primers is depicted.TABLE 3BGene Forward Primer Reverse Primer tnf-a G GTG CCTATGTCTCAG CCTCTT GCCATAGAACTGATGAGAGGGAG il-6 TACCACTTCACAAGTCG G AGG C CTGCAAGTGCATCATCGTTGTTC cxcll TCCAGAGCTTGAAGGTGTTGCC AACCAAGGGAGCTTCAGGGTCA collAl CCTCAGGGTATTGCTGGACAAC CAGAAGGACCTTGTTTGCCAGG a-sma TGCTGACAGAGGCACCACTGAA CAGTTGTACGTCCAGAGGCATAG tgf-p TGATACGCCTGAGTGGCTGTCT CACAAGAGCAGTGAGCGCTGAA

[0103] Thermal cycling consisted of 50°C for 2 minutes, 95°C for 2 minutes at a hold stage, 95°C for 3 seconds, and 60°C for 30 seconds at a PCR stage for 40 cycles. qPCR data is normalized against the housekeeping gene, GAPDH.

[0104] Herein, the step of “development of steatohepatitis model using NAFLD patients-derived organoids” involves treatment of HLONAFLD with 10 pM metformin for 72 hours without any treatment with PA and analysed for the expression of markers of steatohepatitis compared to untreated control wells as in the case of healthy organoids.

[0105] Further, herein, the confocal microscopy for steatosis assay involves culturing of HLOs in eight-well p-slides and steatosis is induced as described above for high-content imaging. Subsequently, organoids are fixed with 4% paraformaldehyde for 30 minutes, followed by blocking with 1% bovine serum albumin for an additional 30 minutes and incubated for 20 minutes at room temperature with a mixture of pg / ml Nile Red 5 and 2 pg / ml DAPI. Images are acquired using an FV3000 laser scanning confocal microscope after the addition of fluorescent mounting solution to each well. Olympus software is used to analyse the increase in fatty acid uptake compared to untreated organoids.

[0106] Further, herein, the step of “confocal microscopy for immunofluorescence study” involves seeding of HLOs in the eight-well p-slides and treated with different conditions, as mentioned in the results section. HLOs are then fixed with 4% paraformaldehyde and incubated at room temperature for 30 minutes followed by blocking with PBS containing 5% horse serum and 0.5% Triton X 100 and incubated further overnight at 4°C. HLOs are then treated with primary antibodies in 1 : 3000 dilution and incubated overnight at 4°C followed by washing thrice with PBS and treatment with 4 pg / ml secondary antibody overnight at 4°C. Organoids are then rinsed thrice with PBS and stained with 5 pg / ml DAPI for 15 minutes at room temperature followed by a final rinsing with PBS and proceeded for confocal imaging.

[0107] Further, herein, the step of “procuring animals in accordance with the standard protocols” involves procuring 8-12-week-old male C57BL / 6 mice (20-25 g) from the small animal facility of the translational health science and technology, Faridabad, and housed in individually ventilated cages with controlled air flow as per the institute’s experimental animal guidelines. The animal room has a controlled 12 hours light and 12 hours dark cycle with a temperature of 25 ± 2 °C and a relative humidity of 60 ± 10%. The animals are acclimatized for one week in the above conditions before initiating the experiments.

[0108] All the protocols for animal experiments are approved by the Institutional Animal Ethics Committee (IAEC) of THSTI, Faridabad, India.

[0109] Further, herein, the step of “in vivo efficacy studies in C57BL / 6 mice fed with an HF-HF diet” involves dividing C57BL / 6 mice into five different groups concerning their initial body weight. The first group as a control is kept on a chow diet, and the remaining four groups are fed a high-fat, high-fructose (HF-HF) diet.

[0110] In TABLE 4, the detailed composition of the animal diet is depicted.TABLE 4Description Ingredients Grams Protein Casein, Lactic, 30 Mesh 200.00 g Protein Cystine, L 3.00 g Carbohydrate Fructose 193.80 g Carbohydrate Sucrose 4.00 g Fiber Solka Floc, FCC200 50.00 g Fat Lard 245.00 g Fat Soybean Oil, USP 25.00 g Mineral S10026B 50.00 g Vitamin Choline Bitartrate 2.00 g Vitamin V10001C 1.00 g Dye Dye, Yellow FD&C #5, Alum. Lake 35-42% 0.03 g Dye Dye, Blue FD&C #1, Alum. Lake 35-42% 0.03 g

[0111] In TABLE 4A, the mineral S10026B composition is depicted.TABLE 4ADescription Ingredients Grams Carbohydrate Sucrose, Fine Granulated 179.82 gMineral Potassium Citrate, Monohydrate 330.00 g Mineral Calcium Phosphate, Dibasic 260.00 g Mineral Calcium Carbonate, Light, USP 110.00 g Mineral Sodium Chloride 51.80 g Mineral Magnesium Sulfate, Heptahydrate 51.52 g Mineral Magnesium Oxide, Heavy, DC USP 8.38 g Mineral Ferric Citrate 4.20 g Mineral Manganese Carbonate Hydrate 2.45 g Mineral Zinc Carbonate 1.12 g Mineral Chromium Potassium Sulfate 0.39 g Mineral Copper Carbonate 0.21 g Mineral Ammonium Molybdate Tetrahydrate 0.06 g Mineral Sodium Fluoride 0.04 g Mineral Sodium Selenite 0.01 g Mineral Potassium Iodate 0.01 g Total: 1000.00 g

[0112] In TABLE 4B, the vitamin V 10001 C composition is depicted.TABLE 4BDescription Ingredients Grams Carbohydrate Sucrose, Fine GranulatedVitamin Vitamin E Acetate, 50% 10.00 gVitamin Niacin (a.k.a. B3, Nicotinic Acid) 3.00 gVitamin Biotin, 1% 2.00 g Vitamin Pantothenic Acid, d, Calcium (a.k.a. B5) 1.60 g Vitamin Vitamin D3, 100,000 lU / gm 1.00 g Vitamin Vitamin Bl 2, Cyanocobalamin, 0.1% 1.00 g Vitamin Vitamin A Acetate, 500,000 lU / gm 0.80 g Vitamin Pyridoxine HC1 (a.k.a. B6) 0.70 g Vitamin Riboflavin (A.K.A. B2) 0.60 gVitamin Thiamine HC1 (a.k.a. Bl) 0.60 g Vitamin Folic Acid 0.20 g Vitamin Menadione Sodium Bisulfite 0.08 g Total: 100.0 G

[0113] The number of mice in each group is 6 that is n=6, and 4 weeks after HF-HF feeding, animals are regrouped based on weight, fasting blood glucose (FBG), and triglyceraldehyde (TG) to initiate treatment with HF-HF+Saroglitazar, herein HF-HF+SGR is 3 mg / kg b.w, and HF-HF alone in the control group daily for the next 18 weeks by oral route using 0.5% carboxymethylcellulose (CMC) as a vehicle as shown in FIG. 2.

[0114] Referring to FIG. 2, the schematic representation of development of mouse model of non-alcoholic fatty liver diseases in a 22-week study using C57BL / 6 mice fed with and high fat- high fructose (HF-HF) diet. The dose of Saroglitazar in the in vivo studies is selected based on the literature evidence. After 18 weeks of treatment, an intraperitoneal glucose tolerance test (IPGTT) is also performed along with their body weight, tail / body length, fasting blood glucose, and lipids.

[0115] The dose of Saroglitazar in the in vivo studies is selected based on the literatureevidence. After 18 weeks of treatment, an intraperitoneal glucose tolerance test (IPGTT) is also performed along with their body weight, tail or body length, fasting blood glucose, and lipids. Mice are euthanized and blood and liver tissues are collected and weighed after washing with chilled phosphate buffer saline (PBS). The plasma and tissue samples are stored at around 80 °C freezer for further analysis.

[0116] Herein, the step of “biochemical analysis” involves measuring plasma triglycerides, cholesterol, low-density lipoprotein, and high-density lipoprotein in plasma samples using the manufacturer’s protocols.

[0117] Further, herein, the step of “intraperitoneal glucose tolerance test (IPGTT)” involves putting animals on fast for six hours for the IPGTT assessment before and after the treatment period. 2 g / kg glucose is administered to the fasted mice, and blood glucose concentrations are measured at 0, 15, 30, 60, 90, and 120 minutes after glucose administration, using a glucometer.

[0118] Further, herein, the step of “histopathological analysis” involves washing of small pieces of liver tissue with PBS followed by fixing in 10% formalin, thereafter, sectioned and stained with hematoxylin and eosin (H&E), and Masson’s trichrome (MT) stains. Histological evaluation and NASH-CRN grading and staging are performed at 200 times magnification.

[0119] Further, herein, the step of “gene expression studies of mouse liver tissue sample” involves isolation of RNA from the mouse liver tissues using the TRI reagent following the manufacturer’s protocol. The quality and concentration of the isolated RNA are determined using a NanoDrop spectrophotometer and 1 pg of RNA is used to synthesize cDNA as per the manufacturer’s protocol. Real-time Polymerase Chain Reaction (RT-PCR) is carried out on Realtime PCR QS6 using SYBR Green master mix and the gene-specific primers. Thereafter, the gene expression data is normalized against the housekeeping gene, GAPDH. Referring to TABLE 3B for gene-specific markers / mouse primers.

[0120] Further, herein, the step of “statistical analysis” involves using mean SEM (standard error of the mean) to express data. Multiple comparisons are done using Graph Pad Prism (Version 8.3) and a one-way ANOVA or two-way ANOVA (if needed), followed by Bonferroni's multiple comparison test. P value <0.05 is regarded as statistically significant (*P < 0.05, ** = P < 0.01, *** =P<0.001, **** =P < 0.0001).

[0121] In yet another embodiment, the present disclosure provides an in vitro method for screening candidate compounds for efficacy against steatohepatitis. The method comprises exposing a three-dimensional liver organoid comprising both parenchymal and non-parenchymal liver cell types to a candidate compound and optionally to fatty acids and assaying the liver organoid for changes in gene expression and cellular markers associated with a group consisting of steatosis, inflammation, and fibrosis. Herein the response of the liver organoid is indicative of the potential of the candidate compound to modulate the hallmarks of steatohepatitis.Results

[0122] This section summarizes the development and characterization of human liver organoids (HLOs) derived from primary human hepatocytes, demonstrating their bipotent and stem cell properties. The organoids express functional markers of hepatocytes, cholangiocytes, and stem cells, and are validated through gene expression and immunofluorescence analyses. The HLOs serve as the foundation for high-throughput in vitro models of steatosis and steatohepatitis, enabling the assessment of fatty acid uptake, lipid accumulation, and the effects of candidate compounds using advanced imaging and molecular techniques.

[0123] Further, the disclosure details the creation of co-culture models with stellate cells to better mimic the multicellular liver environment and the establishment of patient-derived organoids for personalized disease modeling. These models are used for drug screening, mechanistic studies, and validation with in vivo mouse models, collectively providing a robust platform for understanding NAFLD pathogenesis and evaluating therapeutic interventions.HLOs derived from PHH are bipotent and possess stem cell properties

[0124] Human liver organoids are generated using primary human hepatocytes and characterized by gene expression as well as immunofluorescence analysis to show the functional markers of hepatocytes, cholangiocytes and stem cell function.

[0125] Referring to FIG. 4A, the characterization of functional markers of epithelial cells and stem cell functions in HLOs by RTPCR is represented.

[0126] Referring to FIG. 4B, the characterization of functional markers of epithelial cells and stem cell functions in HLOs by immunofluorescence studies is represented.

[0127] During the initiation phase, PHHs are treated with a cocktail of TGF-0inhibitor; A83-01, ROCK inhibitor; Y-27632, and GSK-3P inhibitor; CHIR9902 to check their differentiation and prevent epithelial-to-mesenchymal transition (EMT), which allowed hepatocytes to acquire the characteristics of progenitor stem cells.

[0128] During the expansion stage, however, ROCK inhibitor; Y-27632 is removed, and organoids are allowed to expand and are passaged every two weeks. Immunofluorescence studies reveal the expression of epithelial cell markers such as HNF4, albumin, AFP and cytokeratin-19 as well as the stem cell marker Lgr5+ as reported previously.

[0129] Hep-G2 cells, on the other hand, showed expression of hepatocyte markers-albumin and HNF4, but not the stem cell marker- Lgr5+. Gene expression studies demonstrated that organoids in the expansion stage lost mature hepatocyte markers such as albumin, HNF4 and AFP, cytokeratin-19 and Ki-67, which are restored further during the organoid differentiation stage.

[0130] Unlike PHH, organoids in the expansion phase (EM) acquired the expression levels of Lgr5+, the receptor for the Wnt agonists R-Spondin as a marker of stem cell function as well as expression of ductal marker Epcam which are maintained in the differentiation phase (DM) of organoids also. During the differentiation stage, organoids demonstrated bipotent properties by expressing the functional markers of both hepatocytes such as well as cholangiocytes along with the expression of stem cell marker (Lgr5+) as analysed by RT- PCR as represented in FIG. 4A and immunofluorescence studies also showed the expression of HNF4, Albumin, cytokeratin-19 and Lgr5+ in DM as represented in FIG. 4B.Development of a high-throughput screening model using HLOs

[0131] Treatment of HLOs with a combination of oleic acid (OA) and palmitic acid (PA) in the ratio of 2: 1 and 500 pM showed an increase in the fatty acid uptake as revealed by high content image analysis of FIG. 5 A and FIG. 5B.

[0132] Referring to FIG. 5A, the development of in vitro model of fatty acids induced steatosis in HLOs, as demonstrated by establishment of a high-throughput screening model to test the antisteatotic potential of test compounds is represented.

[0133] Again, referring to FIG. 5A, the establishment of an in vitro model for fatty acid-induced steatosis in human liver organoids (HLOs) is shown. This figure depicts key steps ina high-throughput screening assay, where HLOs are plated in a 96-well format, exposed to test substances, and then induced with a mixture of fatty acids such as palmitic acid or oleic acid for 72 hours to simulate steatosis. The organoids are subsequently stained with Nile Red and DAPI for lipid quantification and cell nuclei labeling, respectively, followed by high-content imaging that enables automated, multi-well quantification of lipid accumulation and evaluation of antisteatotic effects of candidate compounds.

[0134] Referring to FIG. 5B, the development of in vitro model of fatty acids induced steatosis in HLOs, as demonstrated by immunofluorescence study by confocal imaging is represented.

[0135] Again, referring to FIG. 5B represents the same fatty acid-induced steatosis model but focuses on the visualization aspect through immunofluorescence and confocal imaging. After the organoids are treated and stained as in FIG. 5A, confocal microscopy is employed to capture high-resolution images that highlight intracellular lipid droplets (Nile Red fluorescence) and nuclei (DAPI). This approach allows detailed morphological and spatial analysis of steatosis at a cellular level, validating the lipid accumulation phenotype in the HLOs

[0136] Referring to FIG. 5C, immunofluorescence study by confocal imaging is represented.

[0137] Again, referring to FIG. 5C, immunofluorescence studies through confocal imaging, providing an overlay or merge of fluorescent signals that reveal lipid distribution relative to cellular structures in the organoids are shown. This figure underlines the application of advanced microscopy to confirm and quantify fatty acid uptake and storage within the organoid model, facilitating assessment of steatosis and the therapeutic action of test compounds in a visually robust manner.

[0138] Treatment of differentiated hepatic organoids with a mixture of OA and PA led to an increase in the fatty acid uptake by organoids as analysed by an increase in the Nile Red staining of organoids which is normalized against nuclear staining of organoids using DAPI. In this multi-wavelength cell scoring program, intensity above the background criteria is used as a threshold line above which the signal is considered positive as represented in FIG. 4B.Development of in vitro steatohepatitis model using HLO-HLSC co-culture

[0139] Although hepatic organoids generated from both types of epithelial cells such as hepatocytes and cholangiocytes are bipotent and also exhibit stem cell properties, they have been reported to represent only parenchymal cells and lack the non-parenchymal architecture present in the normal liver tissue. We therefore created a co-culture model using HLOs and primary human liver stellate cells (HLSCs) in the ration of 5: 1 ratio as represented in FIG. 6A.

[0140] Referring to FIG. 6A, the establishment of an in vitro model co-culture model of steatohepatitis using HLO-HLSCs that is HLOs and primary human stellate cells through a schematic flow is represented.

[0141] Again, referring to FIG. 6A, an overview of gene expression resulting from the co-culture of human liver organoids (HLOs) with stellate cells under exposure to a high concentration (750 pM) of palmitic acid is shown. The co-culture system is designed to model key aspects of steatohepatitis in vitro, enabling simultaneous assessment of gene markers associated with fatty acid metabolism, inflammation, and fibrosis. The figure indicates that, in this model, the levels of SCD1, TNF-a, IL-8, and CollAl are not increased in palmitic acid (PA)-treated wells compared to controls, highlighting the specificity of the pathway responses in this system.

[0142] Exposure to co-culture of HLOs with stellate cells with high concentrations of 750 pM palmitic acid demonstrated an increase in the mRNA expression of genes related to fatty acid metabolism, inflammation and fibrosis as shown in FIGS. 6B to 6D.

[0143] Referring to FIG. 6B, the establishment of an in vitro model co-culture model of steatohepatitis using HLO-HLSCs that is HLOs and primary human stellate cells to test the antisteatotic properties of compounds by RT-PCR is represented.

[0144] Again, referring to FIG. 6B, the co-culture of HLOs and primary human stellate cells (HLSCs) for assessing antisteatotic effects of candidate compounds using RT-PCR analysis is. The data show expression changes in fatty acid metabolism genes (such as CD36, APOB, SCD-1, FASN, LIPA) after PA exposure, and the effect of metformin pre-treatment in inhibiting the PA-induced expression of these markers, thus validating the model for drug screening.

[0145] Referring to FIG. 6C, the establishment of an in vitro model co-culture model of steatohepatitis using HLO-HLSCs that is HLOs and primary human stellate cells to test the anti-inflammatory properties of compounds by RT-PCR is represented.

[0146] Again, referring to FIG. 6C, the evaluation of anti-inflammatory properties of compounds in the co-culture model by RT-PCR is focussed. It demonstrates the modulation of inflammation-related gene expression, including TNF-a, IL-6, IL-10, and IL-8, in response to PA and the suppressive effects of metformin pre-treatment. The lack of significant change in IL- 18 and TGF-0 levels indicates selective pathway responses in this experimental setup.

[0147] Referring to FIG. 6D, the establishment of an in vitro model co-culture model of steatohepatitis using HLO-HLSCs that is HLOs and primary human stellate cells to test the anti-fibrotic properties of compounds by RT-PCR is represented.

[0148] Again, referring to FIG. 6D, the details of use of the in vitro co-culture model for testing anti-fibrotic properties of compounds by analysing the expression of fibrogenic activation markers a-SMA and TIMP1 through RT-PCR is provided. The results indicate that metformin pre-treatment inhibits the PA-induced upregulation of these fibrotic markers, though it does not show improvement in IL-18 and TGF-0, marking the selective therapeutic action detected within the experimental context.

[0149] As shown in FIGS. 6A to 6D, no increase in the levels of SCD1, TNF-a, IL-8 and Coll Al however is observed in PA-treated wells compared to control wells in the co-culture model. Pre-treatment of organoid co-culture with 10 pM metformin on the other hand showed inhibition of PA-induced increase in the expression levels of markers of fat metabolism such as CD-36, APOB, SCD-1, FASN and LIPA and inflammation such as TNF-a, IL-6, IL-10, and IL-8 as represented in FIGS. 6B and 6C. As represented in FIG. 6D, Metformin also showed inhibition of fibrogenic activation markers such as a-SMA and TEMPI. Treatment with metformin however did not show any improvement in the levels of IL- 18 and TGF-0, in the co-culture model.Expression of non-parenchymal cell functions by HLOs

[0150] The presence of both parenchymal and non-parenchymal cell types is important in an ideal in vitro model to study liver function. It is found that the expression of markers of non-parenchymal cells such as stellate cell marker CD 166 and Kupffer-like cell markers CD68 and EMR1 also in the HLOs. A significant expression of fibrotic markers Coll Al and a-SMA is observed in the HLOs compared to primary human hepatocytes as represented inFIGS. 7 A and 7B.

[0151] Referring to FIG. 7A, the establishment of an in vitro model of steatohepatitis using HLOs through a schematic flow is represented.

[0152] Again, referring to FIG. 7A, the presence of both parenchymal and non-parenchymal liver cell types in the human liver organoids (HLOs) is demonstrated. It highlights significant expression of stellate cell marker CD 166 and Kupffer-like cell markers CD68 and EMR1, indicating the multi-lineage composition essential for replicating liver function in vitro.

[0153] Referring to FIG. 7B, the characterization of HLO model to show the existence of non-parenchymal lineages by RTPCR is represented.

[0154] Again, FIG. 7B compares the expression of fibrotic markers CollAl and a-SMA between HLOs and primary human hepatocytes. The observed enrichment in HLOs confirms their capacity to model fibrotic processes relevant to liver diseases.

[0155] Referring to FIG. 7C illustrates the establishment of an in vitro co-culture model of steatohepatitis using HLO-HLSCs that is HLOs and primary human stellate cells to test the anti-inflammatory properties of compounds by RT-PCR, in accordance with an exemplary embodiment of the present disclosure.

[0156] Again, referring to FIG. 7C, the immunofluorescence analysis also shows the expression of a-SMA and CollAl in HLOs, in addition to HNF4, Albumin, and cytokeratin-19. Hep-G2 cells, although displays immunostaining for HNF4 and Albumin but does not show expression of any fibrotic marker(s). This data shows the multi-lineage properties of HLOs and therefore is used further to model the key hallmarks of steatohepatitis.Development of in vitro steatohepatitis model using HLOs alone

[0157] Referring to FIG. 7D, the antisteatotic properties of test compound by RTPCR in PA-induced steatohepatitis model using HLOs is represented.

[0158] Again, referring to FIG. 7D gene expression data showing that treatment of HLOs with high concentrations of palmitic acid (PA) induces upregulation of genes associated with fatty acid metabolism, inflammation, and fibrosis, including markers such as SCD1 and CollAl is shown.

[0159] Referring to FIG. 7E, the anti-inflammatory properties of test compound by RTPCR in PA-induced steatohepatitis model using HLOs is represented.

[0160] Again, referring to FIG. 7E, the anti-inflammatory effects of metformin in the PA-induced steatohepatitis HLO model is shown, where metformin pre-treatment reduces the expression of pro-inflammatory cytokines such as TNF-a, IL-6, IL-ip, and IL-8.

[0161] Referring to FIG. 7F, the anti-fibrotic properties of test compound by RTPCR in PA-induced steatohepatitis model using HLOs is represented.

[0162] Again, referring to FIG. 7F, the anti-fibrotic effects of metformin, as reflected by the decreased expression of profibrotic genes including CollAl, a-SMA, TGF-0, and TIMP1 following treatment in the HLO model is shown. However, IL- 18 expression remains elevated despite metformin treatment.

[0163] Since HLOs are found to express markers of both parenchymal and non-parenchymal cells, they are challenged with a high concentration of PA to check whether it leads to the development of steatohepatitis. Similar to the HLO-HLSC co-culture model, treatment of HLOs alone with the lipotoxic shock using 750 pM PA for 72 hours led to an increase in the mRNA expression of all the representative genes undertaken in our study related to fatty acid metabolism, inflammation, and fibrosis including SCD1 and CollAl which are not elevated above control in the co-culture model as represented in FIGS. 7D to 7F.

[0164] As further represented through FIGS. 7D to 7F, pre-treatment of HLOs with metformin also shows a reduction in the expression levels of genes related to hepatic metabolism such as CD-36, SCD-1, APOB, and LIPA, profibrotic genes such as CollAl, a-SMA, TGF-0, and TIMP1 as well as pro-inflammatory genes such as TNF-a, IL-6, IL-ip and IL-8 in this model. Expression levels of IL- 18 are however found to be higher in HLOs treated with metformin. Histopathological analysis of liver biopsy tissues derived from NAFLD patients

[0165] The liver biopsies from 6 patients are evaluated for NASH activity score (NAS) and fibrosis stage. Mean steatosis, ballooning degeneration and lobular inflammation scores are 1.6, 1 and 1 respectively. The mean NASH activity score is 3.67. Fibrosis score is 0 in 2 patients, 1 in 3 patients and 2 in another patient. The scoring of various histopathological features and fibrosis has been represented in FIG. 8A.

[0166] Referring to FIG. 8A, the establishment of in vitro screening model using NAFD patients-derived organoids that is HLONAFLD through histopathological data of biopsy tissues from 6 NAFLD patients is represented.

[0167] The results present histopathological data from these patient biopsy samples, supporting the development and validation of patient-specific organoid models to study NAFLD pathophysiology and screen potential therapeutic compounds.Development of in vitro steatohepatitis model using NAFLD patients derived HLOs (HLONAFLD)

[0168] Referring to FIG. 8B, the establishment of in vitro screening model using NAFD patients-derived organoids that is HLONAFLD through schematic flow of steatohepatitis model using HLONAFLD is represented. Herein, this model provides a structured experimental workflow for studying disease mechanisms and testing therapeutic compounds in a patient-specific context.

[0169] Referring to FIG. 8C, the establishment of in vitro screening model using NAFD patients-derived organoids that is HLONAFLD through expression levels of key functional markers of hepatocytes that is HNF4, Albumin, cholangiocytes that is Epcam, stem cells that is Lgr5+, Kupffer-like cells that is CD 166, EMR1 and stellate cells that is CD 166 markers in HLONAFLD is represented.

[0170] Similar to HLOs, organoids prepared from the hepatocytes isolated from NAFLD patients (HLONAFLD) also showed the expression of functional markers of hepatocytes, cholangiocytes, stem cells and also the Kupffer-like cells and stellate cells as represented in FIGs.8A to 8C.

[0171] Referring to FIG. 8D, the establishment of in vitro screening model using NAFD patients-derived organoids that is HLONAFLD and testing antisteatotic properties of test compound that is metformin is represented.

[0172] Referring to FIG. 8E, the establishment of in vitro screening model using NAFD patients-derived organoids that is HLONAFLD and testing anti-inflammatory properties of test compound that is metformin is represented.

[0173] Referring to FIG. 8F, the establishment of in vitro screening model usingNAFD patients-derived organoids that is HLONAFLD and testing anti-inflammatory properties of test compound that is metformin is represented.

[0174] Treatment of HLONAFLD with 10 pM metformin for 72 hours led to inhibition of expression levels of markers of steatosis such as APOB, LIPA, SCD1 and FASN, the inflammatory markers such as TNF-a, IL-6, IL-8 and IL-10 and fibrotic markers such as a-SMA, Coll Al, TGF- 0 and TIMP-1 a shown in FIGs. 8D to 8F. Herein , treatment with metformin also showed an increase in the levels of CD36, specifically shown in FIG. 8D. Expression levels of IL-18 are also found to be higher in organoids treated with metformin similar to the in vitro model using HLOs treated with high concentrations of palmitic acid in comparison with untreated control wells as shown in FIGs. 7E and 8E.Validation of organoid steatohepatitis model using Saroglitazar

[0175] To validate the liver organoid model developed in the laboratory, and it is screened for Saroglitazar in the healthy liver tissue-derived model of steatohepatitis and compared the outcomes with the in vivo efficacy data using the high-fat, high carbohydrate diet-induced model of NAFLD using C57 / BL-6 mice.In vitro activity of Saroglitazar in the palmitic acid-induced liver organoid model of steatohepatitis

[0176] The effect of SGR is evaluated on the expression levels of a few representative markers of steatosis, inflammation and fibrosis in the palmitic acid-induced model of steatohepatitis using healthy liver tissue-derived organoids.

[0177] Referring to FIGS. 9A1 and 9A2 the validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet- induced NAFLD in C57 / BL-6 mice through in vitro data of Saroglitazar using PA-induced HLOs for antisteatotic properties of Saroglitazar by RTPCR in PA-induced steatohepatitis model using HLOs is represented.

[0178] Referring to FIGS. 9A3 and 9A4 the validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet- induced NAFLDin C57 / BL-6 mice through in vitro data of Saroglitazar using PA-induced HLOs for antiinflammatory properties of Saroglitazar by RTPCR in PA-induced steatohepatitis model using HLOs is represented.

[0179] Referring to FIGS. 9A5 to 9A8 the validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet- induced NAFLD in C57 / BL-6 mice through in vitro data of Saroglitazar using PA-induced HLOs for anti-fibrotic properties of Saroglitazar by RTPCR in PA-induced steatohepatitis model using HLOs is represented.

[0180] SGR shows a significant reduction of the PA-induced increase in mRNA levels of FASN, APOB, TNF- a, IL-18, a-SMA, CollAl, TIMP1 and TGF-0 in FIGs. 9A1-9A8.In vivo efficacy of Saroglitazar in high-fat high fructose diet-induced model of NAFLD using C57 / BL-6 mice

[0181] In vivo, efficacy of SGR is evaluated in the high-fat high fructose diet-induced model of NAFLD using C57 / BL-6 mice to find if there is a correlation between the outcomes from the PA-induced HLO model.Saroglitazar improves the key metabolic and biochemical parameters in the HF-HF diet-induced mouse model of NAFLD

[0182] Referring to FIG. 9B1 the validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar for change in body-mass index (BMI), after 16 weeks of treatment is represented.

[0183] A significant and consistent gain in the overall weight of the animals is seen after 8 weeks of HF-HF diet feeding. Treatment of mice with SGR, for 18 weeks showed a reduction in body weight. Similarly, a significant increase in the body mass index (BMI) is observed in the HF-HF-fed mice in comparison to the control chow-fed mice as shown in FIG. 9B1.

[0184] Referring to FIG. 9B2, the validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with invivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar for IPGTT: AUC curve representing the area under each treatment group for blood glucose level is represented.

[0185] To gain insight into the effect of SGR on HF-HF-induced changes in glucose and lipid metabolism, as analysed, the biochemical parameters in the blood plasma. The blood glucose level and the AUC is higher in the HF -HF group whereas mice in the SGR group showed a significant reduction in the blood glucose levels as shown in FIG. 9B2.

[0186] Referring to FIGs. 9B3 to 9B6, the validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet- induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar for Plasma HDL, Plasma LDL, TG and Cholesterol respectively at the end of the treatment period is represented.

[0187] Herein the LDL, plasma total triglycerides (TG) and Cholesterol are also significantly increased in mice fed with the HF -HF diet compared with mice in the control group, and administration with SGR exhibited a reduction in the total LDL, TG and Cholesterol, as compared with the mice in the HF-HF diet fed vehicle control group as shown in FIGs. 9B3 to 9B6.Saroglitazar shows improvement in the histological parameters and reduced mRNA levels of markers of steatosis, inflammation and fibrosis in the HF-HF diet- induced model of NAFLD Histopathological analysis:

[0188] Referring to FIG. 9B7, the validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar for representative sections of histopathological analysis of liver tissues with 200 times magnification and H&E stain in the second lane and MT stain in the third lane is represented.

[0189] The development of steatosis is observed in mice fed with a high-fat, high-fructose (HF-HF) diet for 18 weeks. The livers of mice in the HF-HF group appeared pale, indicating the deposition of lipids, while the livers of mice in the other groups appeared similar tothe control group with little discolouration as shown in FIG. 9B7.

[0190] Referring to FIGS. 9B8 to FIG. 9B11, the validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar, with scores from liver histopathology sections for Steatosis; Ballooning; Lobular inflammation and NAS score respectively is represented.

[0191] Histopathological examination confirmed the development of the NAFLD phenotype in mice in the HF -HF group compared to mice fed with the Chow diet. After 18 weeks of treatment, the livers of mice in the HF -HF group showed significant macro vesicular steatosis, ballooning degeneration, and lobular inflammation. Mice in the HF-HF+SRG group demonstrated a reduction in steatosis, ballooning and inflammation as compared to the HF -HF group as shown in FIGS. 9B8 toFIG. 9B10.

[0192] The mean NAFLD activity score (NAS) in the HF-HF group is 3.75, which is significantly higher compared to the control mice (0), while the HF-HF+SRG group had lower mean NAS scores than the disease group as shown in FIG. 9B11.

[0193] Again, referring to FIG. 9B11, early-stage fibrosis is observed in one animal in the HF-HF group (mean score-0.25) whereas no fibrosis is seen in the control, and HF-HF+SRG groups (score-0). Our data suggests that the HF-HF diet induces NAFLD in mice, and treatment with SAR reduces the severity of the disease, as evidenced by the improvement in the histopathological scores.Gene Expression Analysis:

[0194] Referring to FIGS. 9B12 to FIG. 9B14 the validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and its correlation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar, through mRNA expression analysis of inflammatory genes TNF-a; IL-6; CXCL1 is represented.

[0195] Referring to FIGS. 9B15 to FIG. 9B17, the validation of PA-induced human liver organoid (HLO) model of steatohepatitis by profiling Saroglitazar in this model and itscorrelation with in vivo findings using a 22-week mouse model of high-fat high fructose diet-induced NAFLD in C57 / BL-6 mice through in vivo data of Saroglitazar, through fibrogenic genes TGF-0; a-SMA; and Coll Al respectively using liver tissues from mice by real-time PCR analysis is represented.

[0196] As used herein, the data is normalized with mouse GAPDH as a housekeeping gene. Data are represented as Mean ± SEM, n = 6 per group, and statistical analysis consisted of one-way ANOVA followed by Bonferroni’s test (*p < 0.05; ****p < 0.0001 for Control vs. all other groups.

[0197] The relative gene expression profiling results of mouse hepatic tissues revealed increased mRNA expression levels of the inflammatory and fibro-genic markers, TNF-a and CXCL1, TGF-0, a-SMA and CollAl, in the liver tissues of mice in the HF-HF group. Mice in the SGR group however showed reduced mRNA levels of these genes in the liver tissue compared with HF-HF mice treated with vehicle as shown in FIGS. 9B12 to 9B17.

[0198] The liver is a heterogeneous tissue, and any screening system for modelling the liver should have both parenchymal and non-parenchymal cells. It is reported herewith the establishment of liver organoids from hepatocytes isolated from both healthy individuals and NAFLD patients. These organoids are found to be bipotent showing the functional markers of hepatocytes, cholangiocytes and stem cell function as reported previously.

[0199] In addition to these, it is found that both HLOS and HLONAFLD express the functional markers of non-parenchymal cells such as Kupffer-like cells and stellate cells. This suggests that this model represents a unique culture system wherein parenchymal and supportive lineages are co-maintained to model the complex physiological functions of the liver as well as the pathologic inflammatory states in NAFLD.

[0200] Although pluripotent stem cells have previously shown the potential to be differentiated into both parenchymal and non-parenchymal liver cells in individual set-ups by using specific growth factors and cell culture conditions similar to embryonic development, no in vitro hepatic model or artificial models have been reported to date showing the co-existence of both parenchymal and non-parenchymal cells required to replicate the heterogeneous liver microenvironment.

[0201] The lack of reliable sources of different cell types required to create a coculture model of organoids with other non-parenchymal cells has been a limitation in creating such a model.

[0202] As represented through the present disclosure, the data suggests that hepatocyte-derived HLOs display the required balance between parenchymal and non-parenchymal cells to study steatohepatitis. These liver organoids resemble the original liver tissue because of their multi-cellular architecture, with different cell types organized in a three-dimensional structure.

[0203] Through the present disclosure the pathological features of NAFLD in liver organoids by exposing the three-dimensional cultures to free fatty acids (FFAs) during prolonged treatment is characterized. In treatment with a combination of oleic acid and palmitic acid (500 pM, 2: 1), liver organoids exhibit lipid droplet accumulation, as demonstrated by confocal imaging and high-content imaging analysis as shown in FIGs. 5A and 5B. Moreover, treatment of hepatocytes-derived organoids derived from healthy individuals with high concentrations of palmitic acid also shows abnormal lipid metabolic processes in NAFLD.

[0204] The upregulation of the genes related to steatosis, inflammatory cytokines and fibrogenic markers is further observed. These alterations represent the key biochemical characteristics of NAFLD progression, which may provide insight into the potential mechanisms underlying steatosis. This model therefore can be a promising tool for developing effective therapies and under-standing disease mechanisms.

[0205] It is therefore recommended that the HLOs can be used as a preliminary high-throughput screening platform using a 96 or 384- well format wherein HLOs can be treated with test compounds 30 minutes before the treatment with a mixture of OA and PA followed by Nile Red staining and their evaluation on a high-content imaging platform. Compounds showing a decrease in the Nile Red compared to untreated control wells can be considered as hits with potent lipid-lowering potential. These hits can be characterized further for their potential to lower the expression levels of functional markers of steatosis, inflammation and fibrosis.

[0206] Through gene expression studies it is found that the treatment of HLOs with palmitic acid for 72 hours for the development of steatohepatitis. An increase in the expression levels of key markers of NAFLD is observed in this model, such as lipid accumulation (steatosis),inflammation, and fibrosis, Pre-treatment of HLOs with metformin on the other hand showed reduced expression of genes related to steatosis (CD-36, SCD-1, APOB, and LIPA), pro-inflammatory genes such (TNF-a, IL-6, IL-ip and IL-8) and profibrotic genes such as Coll Al, a-SMA, TGF-0, and TIMP1 genes in this model.

[0207] Baseline expression levels of fibrotic and inflammatory genes in the HLO-HLSC model are, however, found to be significantly high, rendering them unable to display any additional rise in the levels of these genes as a result of lipotoxic stress on treatment with PA in the case of certain genes such as SCD-1, TNF-a, IL-8 and Coll AL

[0208] This suggests the redundancy of using a co-culture model, and HLOs alone may be used as a model system to develop steatohepatitis for drug discovery research.

[0209] The findings of the present disclosure suggests that similar to the HLOs treated with free fatty acid challenge, NAFLD patient-derived organoids (HLONAFLD) also showed significant expression of markers of steatohepatitis without any exposure to lipotoxic shock. Increased levels of CD-36 and IL- 18 by metformin-treated HLONAFLD along with an increase in the levels of IL- 18 in the HLO model indicates that although metformin has so far been considered safe, however, its extended use in patients may lead to some side effects which can be investigated further in details.

[0210] Since Saroglitazar is the only drug approved by the Drugs Controller General of India (DCGI) for the treatment of patients with NAFLD in India at the time of our study, it is evaluated this in the in vitro organoid model as well as in the 22-week mouse model of NAFLD using C57 / BL-6 mice fed with high-fat high fructose diet.

[0211] It is found that the outcomes are to be complementary based on the correlation between both the organoid as well as in vivo models.

[0212] The data of the present disclosure suggests that treatment with SGR ameliorates the key bio-chemical and metabolic parameters of NAFLD in vivo and reduces the mRNA expression of inflammatory and fibrogenic markers in both the studies. These results validate the concept of using the in vitro model of steatohepatitis using primary human hepatocyte-derived organoids to screen small molecules as potential drug candidates to manage NAFLD. It is further aimed to validate these findings using the liver organoid model developed usinghepatocytes from patients with stage-specific non-alcoholic fatty liver disease.

[0213] The present disclosure is the first to show that the steatohepatitis model generated at our end expresses the molecular fingerprints of all the three key hallmarks of NAFLD, such as steatosis, inflammation, and fibrosis.

[0214] Primary hepatocytes-derived organoids as shown by the present disclosure contain not only differentiated hepatocytes but also stem cells that can differentiate into hepatocytes and hepatic stellate cells, and also possess Kupffer cell-like features. This model therefore represents the heterogeneity of both parenchymal and non-parenchymal cells present in the liver tissues and does not require the development of co-culture screening models used in the conventional drug discovery research.

[0215] The present disclosure is using organoids developed from very tiny biopsy-proven liver tissue samples as a natural model of steatohepatitis for in vitro screening of compounds.

[0216] These findings of the present disclosure will be able to overcome the current limitations of the application of organoid cultures for disease modelling studies and can potentially be leveraged further for drug discovery research on NAFLD. Since NAFLD patients also demonstrate significant heterogeneity in terms of disease progression, risk factors, and response to treatment, an in vitro model based on patient- derived organoids (HLONAFLD) can be a useful tool for developing tailoring interventions to specific patient profiles.

[0217] It is further anticipated that implementing the HLO-based screening models at the discovery stage will help in ranking exploratory medications and avoid costly and timeconsuming clinical trial failures.

[0218] The further aim is to identify stage-specific molecular signatures of NASH using patient-derived organoids. Screening of exploratory drugs in the stage-defined or-ganoid models from biopsy-proven patients is expected to guide about their suitability ranging from NAFLD to NASH and beyond. Developing organoids from cirrhotic or degenerated livers however can be a challenge due to the poor quality of hepatocytes. A lot of patient-to-patient variation is also expected therefore pooling the data from patients based on their NAS score and stage of NAFLD may be helpful. Increasing the number of patients for a particular drug is also expected toovercome some of these issues.

[0219] In the present disclosure, the Organoid are prepared using hepatocytes from healthy individuals from a commercial source (HLOs) and also from the NAFLD biopsy-proven liver tissues of non-alcoholic fatty liver disease patients (HLONAFLD). In vitro models are developed by treating HLOs with palmitic acid (PA) for 72 hours and HLONAFLD without PA treatment. Both HLOs and HLONAFLD are characterized by gene expression and confocal analysis.

[0220] As further described in the present disclosure, both HLOs and HLONAFLD showed significant expression of markers of hepatocyte function (HNF4, albumin, AFP), ductal cells (Epcam), and stem cells (Lgr5+). Be-sides that, they showed the presence of markers for non-parenchymal cells like stellate cells (CD 166) and Kupffer-like cells (CD68 and EMR1). In both the PA- induced HLO and HLONAFLD-based models, markers linked to steatosis, inflammation, and fibrogenic activation.

[0221] The findings of the present disclosure are the first to show that organoids derived from hepatocytes both HLO and HLONAFLD express functional markers for both parenchymal and non-parenchymal cells. This is also the first study to evaluate the three critical characteristics of NAFLD, namely steatosis, inflammation, and fibrosis, utilizing a hepatocyte-derived organoid model from both healthy individuals and patients. This model can be used in the preclinical settings to find possible treatments for NAFLD.

[0222] The present disclosure further aims to develop an in vitro humanized model of steatohepatitis that can display all three key hallmarks of NAFLD: steatosis, inflammation and fibrosis without any requirement of co-culture with other cell types. It also realised the need to develop a patient-centric model of steatohepatitis using hepatocytes from NAFLD patients to have a more realistic assessment of new compounds in development.

[0223] As fulfilling both objectives is challenging in the absence of any report showing the spontaneous multilineage properties of organoids developed from only one type of liver cells and the unavailability of liver tissues from NAFLD patients. It is therefore required to determine an optimized assay conditions to develop a multilineage model of human liver organoids (HLOs) using primary hepatocytes from healthy individuals from a commercial source.

[0224] Further, to develop NAFLD patients-derived organoids (HLONAFLD) weisolated primary hepatocytes from ultrasound-guided needle biopsies from the liver tissues of NAFLD patients. Organoids from both sources were used to develop the in vitro models of steatohepatitis displaying all three hallmarks of NAFLD. Metformin and Saroglitazar were used to validate these models. Extensive gene expression and confocal imaging studies were carried out to characterize these models at the mRNA and protein levels.

[0225] By expressing the key molecular signatures of both parenchymal and non-parenchymal cells, HLOs and HLONAFLD mimic the heterogeneous architecture found in the liver tissue without the necessity for co-culture with other non-parenchymal cells. This is reflected by the display of the key hallmarks of NAFLD: steatosis, inflammation, and fibrosis in the in vitro liver organoid models of steatohepatitis developed in our lab employing HLOs and HLONAFLD. We believe that implementing the HLO-based screening models at the discovery stage will help us rank exploratory medications and avoid costly and time-consuming clinical trial failures.

[0226] The development of a humanized patient-centric steatohepatitis model using primary hepatocytes isolated from ultrasound-guided biopsy tissues from NAFLD patient samples is also expected to provide a more realistic assessment of test substances to develop therapeutics for NAFLD in future. Screening of exploratory drugs in the stage-defined organoid models from biopsy-proven patients is likely to provide insights into their suitability for conditions ranging from NAFLD to NASH and beyond. Given the enormous heterogeneity in disease progression, risk factors, and response to treatment across NAFLD patients, an in vitro model based on patient-derived organoids (HLONAFLD) can be a useful tool for developing therapies tailored to specific patient profiles.

[0227] The generation of organoids from cirrhotic or degenerated livers is currently limited by the poor quality of hepatocytes. A lot of patient-to-patient variation is also expected therefore pooling the data from patients based on their NAS score and stage of NAFLD may be helpful. Increasing the number of patients for a specific drug is also expected to help address some of these concerns.

[0228] The foregoing descriptions of specific embodiments of the present disclosure have been presented for purposes of illustration and description. They are not intended to be exhaustive or to limit the present disclosure to the precise forms disclosed, and obviously many modifications and variations are possible in light of the above teaching. The embodiments werechosen and described in order to best explain the principles of the present disclosure and its practical application, to thereby enable others skilled in the art to best utilize the present disclosure and various embodiments with various modifications as are suited to the particular use contemplated. (It is understood that various omissions and substitutions of equivalents are contemplated as circumstance may suggest or render expedient, but such are intended to cover the application or implementation without departing from the spirit or scope of the claims of the present disclosure).

Claims

WE CLAIM:

1. A liver organoid model that recapitulates hallmarks of non-alcoholic fatty liver disease (NAFLD) comprising both parenchymal and non-parenchymal liver cell types, wherein the organoid is formed from primary hepatocytes isolated from a group consisting of a healthy individual, a NAFLD patient, and a combination thereof, and wherein the organoid expresses molecular markers of hepatocytes, cholangiocytes, stem cells, stellate cells, and kupffer-like cells, and displays the hallmarks of steatosis, inflammation, and fibrosis.

2. A method for generating and characterizing a liver organoid model that recapitulates hallmarks of non-alcoholic fatty liver disease (NAFLD), the method comprising:performing needle biopsy of liver tissue from NAFLD patients and conducting histopathological analysis of the biopsy specimens;isolating primary hepatocytes from liver tissue obtained from a group consisting of healthy individuals, NAFLD patients, and a combination thereof;suspending the primary hepatocytes in a basement membrane extract and culturing the cells in an initiation medium to form three-dimensional organoids;expanding the organoids in an expansion medium and subsequently differentiating the organoids in a differentiation medium;passaging and functionally characterizing the resulting organoids for molecular markers of both parenchymal and non-parenchymal liver cell types;culturing the resulting organoids until a resulting liver organoid model is formed that expresses molecular markers of hepatocytes, cholangiocytes, stem cells, stellate cells, and Kupffer-like cells, and displays the hallmarks of steatosis, inflammation, and fibrosis.

3. The method as claimed in claim 1, further comprising:developing an in vitro model of steatohepatitis using the resulting organoids and, optionally, a co-culture with primary human stellate cells;establishing a high-throughput screening platform to test the antisteatotic activity of candidate compounds using the organoids;performing gene expression analysis and confocal microscopy for steatosis and immunofluorescence studies on the organoid samples; andconducting in vivo efficacy studies in C57BL / 6 mice fed with a high fat-high fructose diet, including biochemical analysis, intraperitoneal glucose tolerance test, histopathological analysis, gene expression studies of mouse liver tissue samples, and statistical analysis.

4. The method as claimed in claim 1, wherein the basement membrane extract comprises CultrexUltimatrix RGF basement membrane extract.

5. The method as claimed in claim 1, wherein the initiation medium comprises a combination of growth factors and supplements selected from the group consisting of DMEM / F12, penicillin / streptomycin, nicotinamide, HEPES, N2-MAX, glutamine, B-27, gastrin, FGF- 10, N-acetylcysteine, A 83-01, BMP-7, Noggin, R-Spondin-1, Wnt-3a, HGF, Y-27632, EGF, forskolin and a combination thereof.

6. The method as claimed in claim 1, wherein the expansion medium is identical to the initiation medium except for the absence of Noggin, Wnt-3a, and Y-27632.

7. The method as claimed in claim 1, wherein the differentiation medium comprises a combination of growth factors and supplements selected from the group consisting of DMEM / F12, penicillin / streptomycin, dexamethasone, HEPES, A 83-01, N2-MAX, EGF, gastrin, FGF-19, HGF, BMP-7, B-27, DAPT, glutamine, retinoic acid, activin A, oncostatin M, VEGF, dorsomorphin dihydrochloride and a combination thereof.

8. The method as claimed in claim 1, wherein the resulting organoid expresses functional markers of hepatocytes, cholangiocytes, stem cells, stellate cells, and kupffer-like cells.

9. An in vitro method for screening candidate compounds for efficacy against steatohepatitis, the method comprising:exposing a three-dimensional liver organoid comprising both parenchymal and non-parenchymal liver cell types to a candidate compound and optionally to fatty acids; andassaying the liver organoid for changes in gene expression and cellular markers associated with a group consisting of steatosis, inflammation, and fibrosis,wherein the response of the liver organoid is indicative of the potential of the candidate compound to modulate the hallmarks of steatohepatitis.

Images