Frogligo TRNA chaining strategy

Abstract

Disclosed are nucleic acid analysis and sequencing technologies. The disclosure addresses the preparation of transfer RNA (tRNA) constructs suitable for direct RNA sequencing and structural applications by enzymatically ligating multiple tRNA molecules into a single, longer RNA strand using designed RNA oligonucleotides. Disclosed are methods of preparing a sequencing library for a plurality of tRNAs and kits.

Description

[0001] FROGLIGO TRNA CHAINING STRATEGY

[0002] RELATED APPLICATIONS

[0003] This application claims the benefit of priority to U.S. Provisional Patent Application serial number 63 / 710,331, filed October 22, 2024.

[0004] BACKGROUND

[0005] Short, highly structured, and densely modified tRNAs present significant challenges for contemporary sequencing platforms, including software limitations for short reads and reduced processivity in reverse-transcription-based methods. Direct RNA nanopore sequencing is uniquely positioned to interrogate native RNA modifications but is hindered by the brevity and structure of individual tRNAs. There is thus a need for methods and compositions to optimize tRNAs for sequencing and other functional uses.

[0006] SUMMARY OF THE INVENTION

[0007] The disclosure relates to the fields of nucleic acid engineering, RNA sequencing, and RNA nanotechnology. In particular, it addresses the preparation of transfer RNA (tRNA) constructs suitable for direct RNA sequencing and structural applications by enzymatically ligating multiple tRNA molecules into a single, longer RNA strand using designed RNA oligonucleotides.

[0008] Disclosed is a method of preparing a sequencing library. The method may comprise: providing at least two transfer RNAs (tRNAs), each independently having a 3' NCCA overhang or a functional variant; contacting the tRNAs with a plurality of RNA targeting oligonucleotides, wherein each targeting oligonucleotide independently comprises in 5' to 3' order: (i) a capture sequence complementary to at least a portion of the 3' NCCA overhang or the functional variant of a corresponding tRNA, and (ii) an annealing domain that hybridizes to a complementary annealing domain of an adjacent targeting oligonucleotide; annealing the tRNAs and targeting oligonucleotides to form an alternating complex of targeting oligonucleotides and tRNAs; and ligating the annealed components of the alternating complex with an RNA ligase to form a single concatenated RNA molecule comprising the at least two or more tRNAs covalently linked via the targeting oligonucleotides.

[0009] In some embodiments, the capture sequence comprises UGGU, CGGU, AGGU, or GGGU. In some embodiments, the at least two tRNAs are the same tRNA species. In some embodiments, each of the at least two tRNAs is a different tRNA species. In some embodiments, the at least two tRNAs are identical in sequence. In some embodiments, each of the at least two tRNAs differs in sequence from the others. In some embodiments, the concatenated RNA molecule comprises at least three tRNAs, at least four tRNAs, at least five tRNAs, at least six tRNAs, at least seven tRNAs, at least eight tRNAs, at least nine tRNAs, or at least ten tRNAs. In some embodiments, the concatenated RNA molecule comprises 2-4 tRNAs, 4-6 tRNAs, 6-8 tRNAs, 8-10 tRNAs, 10-12 tRNAs, 12-14 tRNAs, 14-16 tRNAs, 16-18 tRNAs, or 18-20 tRNAs. In some embodiments, the concatenated RNA molecule comprises n tRNAs and n+1 targeting oligonucleotides, wherein n is at least 2. In some embodiments, n is 2-100. In some embodiments, nis 2-4, 4-6, 6-8, 8-10, 10-12, 12-14, 14-16, 16-18, 18-20.

[0010] In some embodiments, the concatenated RNA molecule comprises a 5' bookend oligonucleotide and a 3' adapter-compatible oligonucleotide. In some embodiments, the concatenated RNA molecule comprises at least four tRNAs and five targeting oligonucleotides. In some embodiments, the annealing domains selectively hybridize to the complementary annealing domain of the adjacent targeting oligonucleotide compared to annealing domains of non-adjacent targeting oligonucleotides. In some embodiments, the tRNAs include at least one native tRNA and at least one in vitro transcribed (IVT) tRNA on the same concatenated RNA molecule. In some embodiments, the method further comprises sequencing the concatenated RNA molecule using a sequencing platform.

[0011] In some embodiments, the sequencing platform is a nanopore sequencing platform. In some embodiments, the sequencing platform uses a motor associated sequencing adapter for direct RNA sequencing. In some embodiments, the 3' adapter-compatible oligonucleotide comprises a terminal region for direct RNA sequencing library preparation. In some embodiments, the RNA targeting oligonucleotide is 10 to 200 nucleotides in length. In some embodiments, the RNA targeting oligonucleotide is 10 to 20 nucleotides in length, 20 to 30 nucleotides in length, 30 to 40 nucleotides in length, 40 to 50 nucleotides in length, 50 to 100 nucleotides in length, 100 to 150 nucleotides in length, or 150 to 200 nucleotides in length.

[0012] In some embodiments, ligating comprises using T4 RNA Ligase 2, T4 DNA ligase, or a combination thereof. In some embodiments, the concatenated RNA molecule has a total length of at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, or at least 500 nucleotides. In some embodiments, the concatenated RNA molecule has a total length of 100-200 nucleotides, 200-300 nucleotides, 300-400 nucleotides, 400-500 nucleotides, or 500-1000 nucleotides. In some embodiments, one or more of the targeting oligonucleotides comprises GC-rich annealing domains. In some embodiments, the method further comprises enriching for a subgroup of tRNAs by selecting capture sequences that selectively hybridize to the functional variant unique to the subgroup of tRNAs.

[0013] Disclosed herein is a kit comprising a plurality of RNA targeting oligonucleotides, wherein each targeting oligonucleotide independently comprises in 5' to 3' order: (i) a capture sequence complementary to at least a portion of a 3' NCCA overhang or a functional variant of a corresponding tRNA, and (ii) an annealing domain that hybridizes to a complementary annealing domain of an adjacent targeting oligonucleotide. In some embodiments, the kit further comprises an RNA ligase.

[0014] In some embodiments, the kit further comprises instructions for annealing and ligating the tRNAs and targeting oligonucleotides to produce a single concatenated RNA molecule. In some embodiments, the set of RNA targeting oligonucleotides comprises a 5' bookend oligonucleotide and a 3' adapter-compatible oligonucleotide. In some embodiments, at least one capture sequence comprises UGGU. In some embodiments, at least one pair of annealing domains is GC-rich. In some embodiments, the annealing domains selectively hybridizes to the complementary annealing domain of the adjacent targeting oligonucleotide compared to annealing domains of non-adjacent targeting oligonucleotides. In some embodiments, the 3' adapter-compatible oligonucleotide comprises a terminal region for direct RNA sequencing library preparation.

[0015] In some embodiments, the RNA targeting oligonucleotide is 10 to 200 nucleotides in length. In some embodiments, the RNA targeting oligonucleotide is 10 to 20 nucleotides in length, 20 to 30 nucleotides in length, 30 to 40 nucleotides in length, 40 to 50 nucleotides in length, 50 to 100 nucleotides in length, 100 to 150 nucleotides in length, or 150 to 200 nucleotides in length.

[0016] BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Fig- 1 shows a predicted secondary structure of the complete frogligo construct. tRNAs are labeled 1-4 in the 5' to 3' direction. In this example, all the tRNA’s are fMet, and the overhangs on oligos are UGGU.

[0018] Fig- 2 shows four component oligos with UGGU overhangs targeting ACC A tRNA 3' overhangs. The fifth oligo (3' side) labeled RMX is designed to fit into the Oxford Nanopore Technologies Direct RNA sequencing protocol. This shows 4 tRNA capture with 5 oligo system, 5 oligo system to capture 4 tRNAs, 4 unique NCCA overhang capture styles to account for complete variation in E. Coli tRNA Profile (UCCA, CCCA, GCCA, ACCA). RMX adapter is linked to ACCA overhang capture point, potentially increasing likelihood of producing sequence-able ligation products. Theis reduced GAGA sequence to 4 nucleotides, increased RNA fold performance for individual oligos as well as full oligo construct Fig. 3 shows oligo 1 (5' to 3' direction). Part A shows a sequence coded to match full oligo diagram. Part B shows a full oligo diagram with oligo 1 outlined in a box. Part C shows a predicted RNA fold secondary structure for oligo 1. Part D shows the self-annealing potential and Delta G from IDT Oligo Analyzer. Part E shows predicted Hairpin structure from IDT Oligo Analyzer. Part F shows the melting temperature from IDT Oligo Analyzer. Part G shows the annealing potential with the other 4 oligos (in numerical order descending from 2 to 5). The top box indicates intended annealing; the three bottom boxes indicate non intentional annealing.

[0019] Fig- 4 shows oligo 2 (5' to 3' direction). Part A shows a diagram of a sequence coded to match full oligo. Part B shows a full oligo diagram with oligo 2 outlined in a box. Part C shows predicted RNA Fold secondary structure for oligo 1. Part D shows self-annealing potential and Delta G from IDT Oligo Analyzer. Part E shows predicted Hairpin structure from IDT Oligo Analyzer. Part F shows melting temperature from IDT Oligo Analyzer. Part G shows annealing potential with the other 4 oligos (in numerical order descending from 1 to 5). First and second boxes indicate intended annealing, and the third and fourth boxes indicate non intentional annealing.

[0020] Fig- 5 shows oligo 3 (5' to 3' direction). Part A shows a diagram of a sequence coded to match full oligo. Part B shows a full oligo diagram with oligo 3 outlined in a box. Part C shows a predicted RNA Fold secondary structure for oligo 1. Part D shows self-annealing potential and Delta G from IDT Oligo Analyzer. Part E shows predicted Hairpin structure from IDT Oligo Analyzer. Part F shows melting temperature from IDT Oligo Analyzer. Part G shows annealing potential with the other 4 oligos (in numerical order descending from 1 to 5). Middle two boxes indicate intended annealing, and the top and bottom boxes indicate non intentional annealing.

[0021] Fig- 6 shows oligo 4 (5' to 3' direction). Part A shows a diagram of a sequence coded to match full oligo. Part B shows a full oligo diagram with oligo 4 outlined in a box. Part C shows predicted RNA Fold predicted structure for oligo 1. Part D shows self-annealing potential and Delta G from IDT Oligo Analyzer. Part E shows predicted Hairpin structure from IDT Oligo Analyzer. Part F shows melting temperature from IDT Oligo Analyzer. Part G shows annealing potential with the other 4 oligos (in numerical order descending from 1 to 5). Top two boxes indicate intended annealing, and the bottom two boxes indicate non intentional annealing.

[0022] Fig- 7 shows Oligo 5 (5' to 3' direction). Part A shows a diagram of a sequence coded to match full oligo. Part B shows a full oligo diagram with oligo 5 outlined in a red box. Part C shows predicted RNA Fold secondary structure for oligo 1. Part D shows self-annealing potential and Delta G from IDT Oligo Analyzer. Part E shows predicted Hairpin structure from IDT Oligo Analyzer. Part F shows melting temperature from IDT Oligo Analyzer. Part G shows annealing potential with the other 4 oligos (in numerical order descending from 1 to 4). Bottom box indicates intended annealing, and the top three boxes indicate non intentional annealing.

[0023] Figs. 8A-8C show results of an experimental run using oligos 3-5 and synthetic tRNA fMet. Fig. 8 A shows a gel showing oligos 3, 4, and 5 ligated with 2 fMets at the — 260 nt. band. Fig. 8B shows results showing successful sequencing of targets, giving full length reads. Fig. 8C shows distribution of reads length indicating sequences of at least the target length.

[0024] DETAILED DESCRIPTION

[0025] Short RNA, often considered hard to access small molecules, have a wide variety of impactful roles in cellular function. One type of high abundance short RNA molecule in the cell is tRNA. tRNA acts as the courier of amino acids used by the ribosome to construct proteins, one of the primary functional units of the cell. Chemical alterations of tRNA ribonucleotides have been shown to have a strong effect on the phenotype of a cell, and dysregulation or dysfunction of these alterations can lead to human diseases. While the basic functional role of tRNA has been known since the 1950s, recent research has shown additional functionality such as gene regulation, cell differentiation, apoptosis and cell differentiation.

[0026] Unlike the long stranded and sparsely modified mRNA, tRNA molecules have a variety of chemical modifications occurring in high density on strands of less than 100 ribonucleotides. These highly modified molecules are worthy of significant clinical and academic examination, but the modification landscape, intense secondary structure, and short length of tRNA make them particularly challenging to directly sequence using contemporary techniques and technology.

[0027] One avenue of interest with tRNA is sequence level information including but not limited to modifications. Nanopore sequencing is well suited for studying RNA modifications because it is the only technology that can directly sequence native RNA. However, the accompanying sequencing software is limited in its ability to process data of short and densely modified molecules. Our “Frogligo” strategy overcomes this hurdle by chaining multiple tRNAs together with RNA ligation, resulting in a longer sequencing product and more information rich data.

[0028] Additionally the field of nucleic acid “origami” has been a growing area of research showing significant promise in areas such as DNA computing and drug delivery. tRNAs have been shown to have excellent characteristics for the construction of polyhedrons. This means that technologies and strategies for the intentional manipulation and linking of tRNAs are a necessary step towards understanding the biological function, and harnessing the molecular power of tRNA and its properties.

[0029] Contemporary tRNA augmentation strategies focus on the preparation of tRNA for sequencing technologies. This includes purification of tRNA and adaptation of tRNA molecules with primers for sequencing (Shigematsu et al. 2017). Currently all major sequencing platforms have some tRNA sequencing capability (Yan et al. 2018; Thomas et al.

[0030] 2021; Shigematsu et al. 2017), albeit in some cases incomplete. Both PacBio and Illumina platforms are dependent on sequencing by synthesis, which has known issues with the processivity of reverse transcriptase in densely modified landscapes. Other nanopore strategies have been developed, but only sequence a single tRNA at a time. This strategy aims to expand on the current best practices in Nanopore direct tRNA sequencing. But none of these strategies focus beyond the construction of a sequencing libraries of single tRNA molecules. We have designed a technique for linking multiple tRNAs together in a manner that can be conducive to sequencing, RNA polyhedron construction, synthetic controls for modifications, or any application that requires tRNAs that are linked into a single molecule.

[0031] Beyond sequencing, tRNAs exhibit desirable and well-characterized secondary and tertiary structural features that make them attractive building blocks for nucleic acid origami and nanostructure assembly. However, robust, selective, and scalable strategies for linking multiple tRNAs in a controlled manner have been lacking. The present disclosure provides a modular, oligonucleotide-guided ligation strategy, referred to herein as Frogligo, that enables selective chaining of multiple tRNAs, yielding longer constructs for improved read length, information density, and structural programmability.

[0032] This strategy allows multiple tRNAs to be chained together through the use of oligos and ligases. This can increase the length of tRNAs either for sequencing purposes or for the structural properties of tRNA. This disclosure provides the following advantages:

[0033] 1. Single tRNAs are hard to sequence on their own due to the length of the molecule as well as the tertiary structure. This strategy allows for multiple tRNAs to be attached, creating a longer molecule and increasing the amount of information per sequenced strand.

[0034] 2. tRNAs have unique structural properties that are ideal for nucleic acid origami and potential drug delivery capsules since they are ubiquitous in biology. This strategy allows for selective inclusion of tRNAs into the growing chain of tRNAs. This gives great control to the designer of frogligo tRNA products.

[0035] 3. The inclusion of IVT tRNA in conjunction with native tRNA in a single strand would provide a negative control for the identification of modifications on the same strand of tRNA. This is critical for precise control and detection of minor fluctuations in signal deviation.

[0036] This disclosure provides tools for tRNA Research and Biomedical testing.

[0037] In some implementations, five synthetic RNA targeting oligos are used to concatenate four tRNAs into a single construct. Adjacent targeting oligos are designed as complementary pairs across extended, GC-rich annealing domains that ensure strong and selective hybridization. Each targeting oligo further includes a capture sequence complementary to the 3' NCCA overhang of its assigned tRNA. The 5'-most oligo functions as a bookend to buffer sequence loss and initiate sequencing, while the 3 '-most oligo is adapter-compatible for direct RNA sequencing library preparation, facilitating loading and processivity on a nanopore sequencer.

[0038] Disclosed is a method of preparing a sequencing library.

[0039] Definitions

[0040] For convenience, certain terms employed in the specification, examples, and appended claims are collected here.

[0041] As used herein, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0042] The term “about” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the values measured or determined, ie., the limitations of the measurement system. Where the terms “about” or “approximately” are used in the context of compositions containing amounts of ingredients or conditions such as temperature, these values include the stated value with a variation of 0-10% around the value (X ± 10%). The terms “including,” “includes,” “having,” “has,” “with,” or variants thereof are inclusive in a manner similar to the term “comprising.” The term “consisting” and the grammatical variations of consist encompass embodiments with only the listed elements and excluding any other elements. The phrases “consisting essentially of’ or “consists essentially of’ encompass embodiments containing the specified materials or steps and those including materials and steps that do not materially affect the basic and novel characteristic(s) of the embodiments.

[0043] Ranges are stated in shorthand to avoid having to set out at length and describe each and every value within the range. Therefore, when ranges are stated for a value, any appropriate value within the range can be selected, and these values include the upper value and the lower value of the range. For example, a range of two to thirty represents the terminal values of two and thirty, as well as the intermediate values between two to thirty, and all intermediate ranges encompassed within two to thirty, such as two to five, two to eight, two to ten, etc.

[0044] The term “preventing” is art-recognized, and when used in relation to a condition is well understood in the art, and includes administration of a composition which reduces the frequency of, or delays the onset of, symptoms of a medical condition in a subject relative to a subject which does not receive the composition. Thus, prevention of cancer includes, for example, reducing the incidence of cancer in a population of patients receiving a prophylactic treatment relative to an untreated control population, and / or delaying the onset of cancer in a treated population versus an untreated control population, e.g., by a statistically and / or clinically significant amount.

[0045] The term “ subject ' as used herein refers to a living mammal and may be interchangeably used with the term “patient”. Examples of mammals include, but are not limited to, any member of the mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. The term does not denote a particular age or gender.

[0046] The term “therapeutically effective amount” of a compound with respect to the subject method of treatment refers to an amount of the compound(s) in a preparation which, when administered as part of a desired dosage regimen (to a mammal, preferably a human) alleviates a symptom, ameliorates a condition, or slows the onset of disease conditions according to clinically acceptable standards for the disorder or condition to be treated or the cosmetic purpose, e.g., at a reasonable benefit / risk ratio applicable to any medical treatment. A therapeutically effective amount herein may vary according to factors such as the disease state, age, sex, and weight of the patient, and the ability of the antibody to elicit a desired response in the individual.

[0047] As used herein, the term "treating ' or “treatment' includes reducing, arresting, or reversing the symptoms, clinical signs, or underlying pathology of a condition to stabilize or improve a subject’s condition or to reduce the likelihood that the subject’s condition will worsen as much as if the subject did not receive the treatment.

[0048] The term "complementary" and "complementarity" are interchangeable and refer to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions. Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G). 100% (or total) complementary refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region. Less than perfect (or partial) complementarity refers to the situation in which some, but not all, nucleotide units of two strands or two regions can hydrogen bond with each other and can be expressed as a percentage.

[0049] The term “hybridization” is used to refer to the structure formed by 2 independent strands of RNA that form a double stranded structure via base pairings from one strand to the other. These base pairs are considered to be G-C, A-U, and G-U. (A - Adenine, C - Cytosine, G - Guanine, U - Uracil). As in the case of complementarity, hybridization can be total or partial.

[0050] The term “oligonucleotide” refers to RNA, DNA, or RNA: DNA oligonucleotides. The term “nucleotide” can refer to both, ribonucleotide or deoxyribonucleotide, unless otherwise explained.

[0051] A “hairpin” is a secondary structure making a stem-loop, formed when a single RNA or DNA strand folds back so that two complementary regions base-pair to make a double-stranded stem capped by an unpaired loop. A hairpin comprises a largely Watson-Crick base-paired stem and an apical loop of unpaired (or non-canonical) nucleotides. A “loop” refers to the unpaired segment of nucleotides at the apex of a stem-loop (hairpin) structure.

[0052] An “RNA ligation adapter” is a short, synthetic oligonucleotide that is covalently attached to an end of RNA molecules during next-generation sequencing (NGS) library preparation. By adding known sequences to otherwise unknown RNA ends, adapters provide the handles required for reverse transcription, PCR amplification, sample indexing, and attachment to the sequencing platform.

[0053] “tRNA” means a transfer RNA molecule, native or synthetic, typically comprising a conserved 3' terminal NCCA sequence and known to bear post-transcriptional nucleotide modifications.

[0054] “IVT tRNA” means an in vitro transcribed tRNA, which may have reduced or absent native nucleotide modifications relative to tRNAs isolated from biological sources.

[0055] “3' NCCA overhang” means the terminal sequence NCCA at the 3' end of a tRNA, where N denotes any naturally occurring ribonucleotide; this terminus is available for complementary base pairing to an engineered capture sequence.

[0056] “Capture sequence” means an RNA oligonucleotide segment designed to base pair with at least a portion of the 3' NCCA overhang of a tRNA, including sequences complementary to NCCA (e.g., UGGU) or to functional variants that achieve selective hybridization.

[0057] “Functional variant” means, in the context of tRNA capture and chaining, a terminal sequence motif or immediately adjacent sequence configuration of a tRNA that is characteristic of, and thus selectively identifies, a defined subgroup of tRNAs, including but not limited to specific anticodon families, isoacceptors, or organism-specific tRNA variants. A capture sequence can be designed to hybridize either (i) to the canonical 3' NCCA overhang or (ii) to such a functional variant, with sufficient affinity and specificity to direct assembly and permit ligation in the Frogligo system. By targeting a functional variant, the system can enrich the corresponding tRNA species or subgroup, thereby reducing purification burdens and enabling control over chain composition. Functional variants include, for example, sequence polymorphisms at or proximal to the 3' end (e.g., discriminator base identities, partial or species-specific CCA processing states, non-templated tailing), conserved short sequence features adjacent to the NCCA that are shared within targeted anticodon families or organisms, and other organism- or family-specific terminal signatures that support selective hybridization without abrogating ligation.

[0058] “Targeting oligo” means an RNA oligonucleotide engineered to specifically hybridize to a given tRNA through the capture sequence and to hybridize to an adjacent oligonucleotide through a designed complementary region, thereby positioning the tRNA for enzymatic ligation to another RNA component. “Bookend oligo” means a terminal targeting oligo at the 5' or 3' end of a chained tRNA construct that provides length, stability, functionality, or adapter compatibility for downstream processes such as direct RNA sequencing.

[0059] “Adapter-compatible oligo” means a bookend oligo bearing a terminal region designed to interface with, or be compatible with, a sequencing adapter or library preparation workflow.

[0060] “Concatenated tRNA construct” or “tRNA chain” means a single RNA molecule comprising two or more tRNAs covalently linked via ligation and positioned by targeting oligos.

[0061] “Annealing domain” means a segment of an oligonucleotide designed to hybridize with high specificity and thermodynamic stability to a complementary domain on another oligo, with minimal off-target pairing among the set.

[0062] “Ligase” or “RNA ligase” means an enzyme capable of catalyzing the formation of a phosphodiester linkage between RNA substrates under suitable conditions.

[0063] Methods

[0064] The disclosure, referred to as the “Frogligo tRNA chaining strategy,” is a biochemical method for linking multiple transfer RNA (tRNA) molecules into a single, longer RNA construct using designed short RNA segments (oligos) and RNA-joining enzymes (ligases). The purpose is to overcome the inherent difficulty of analyzing single, short, and heavily modified tRNAs, especially by direct RNA sequencing technologies, by converting several tRNAs into one longer strand that is easier to process and yields more information in a single read. Beyond sequencing, the chained tRNAs can serve as structural building blocks for RNA nanostructures (e.g., “nucleic acid origami”) and as customizable constructs for research and biomedical uses.

[0065] tRNA is a highly abundant, short RNA molecule (-70-90 nucleotides) that delivers amino acids to ribosomes during protein synthesis. tRNAs are densely decorated with chemical modifications (alterations to their nucleotides) that are biologically important but hard to read with existing methods. The disclosure addresses this challenge by chaining multiple tRNAs, thus producing longer molecules that are better suited for “long-read” platforms such as nanopore sequencers, which directly read native RNA and can detect modifications.

[0066] At its core, the method uses a set of synthetic RNA oligonucleotides (oligos) designed to “bridge” adjacent tRNAs and a ligase enzyme to seal the junctions. An “oligo” is a short, custom-designed RNA sequence engineered to base-pair (anneal) with specific regions of a target RNA; here, oligos are designed to hybridize strongly and selectively to their intended neighbors. “Annealing” refers to Watson-Crick base pairing that holds complementary strands together. A “ligase” is an enzyme that forms covalent bonds between adjacent nucleic acids, turning base-paired junctions into continuous RNA backbones.

[0067] A key recognition feature exploited by the design is the conserved “NCCA” (often ACCA) 3' overhang at the end of many tRNAs. This short tail is the site where amino acids are attached during protein synthesis and is highly conserved. By building complementary sequences to these overhangs into the oligos, each tRNA can be selectively captured and positioned in sequence. The disclosure illustrates a four-tRNA chain assembled using five oligos: one oligo at each end and three “bridging” oligos alternating between the tRNAs. The oligos are engineered to have strong, specific pairing with their intended partner sequences (high annealing stability) and minimal unintended pairing (“off-targef ’ annealing) with other oligos in the system.

[0068] This specificity is demonstrated using computational analyses of predicted secondary structure, hairpins, melting temperatures, and thermodynamic stability (e.g., delta G). Once the components are annealed, a ligation step joins the RNA pieces, creating a continuous, multi-tRNA chain. The overall construct length can reach several hundred nucleotides, sufficient for robust capture by direct RNA nanopore sequencing workflows. “Direct RNA sequencing” means the sequencer reads native RNA without making DNA copies, preserving modification signals.

[0069] The design also includes adapter-compatible sequences so that the final construct integrates smoothly with standard library preparation protocols, particularly for Oxford Nanopore Technologies’ direct RNA sequencing kits. Although the example shows four tRNAs, the approach is modular and can chain two, three, or more tRNAs, limited mainly by oligo design quality and ligation efficiency.

[0070] The exemplified strategy uses a set of five oligos with defined roles and lengths, interleaving between four tRNA units from 5' to 3'. The oligos are crafted so that:

[0071] • Each captures the 3' NCCA / ACC A overhang of an adjacent tRNA, ensuring selective inclusion of desired tRNAs in the chain.

[0072] • Paired neighbors exhibit high-affinity annealing, while non-neighboring oligos show little to no annealing, reducing spurious assemblies. • The 5 '-most oligo provides a buffer to mitigate typical loss of signal at the 5' end in nanopore reads, improving data capture from the first tRNA.

[0073] Because the oligo sequences can be customized, the system can enrich for specific tRNA species (e.g., by matching only certain anticodon families or organism-specific tRNA variants), thereby reducing purification burdens and controlling chain composition. The disclosure provides predicted structural models for the oligos and their interactions and shows that the chained construct likely adopts a defined geometry (e.g., ~90-degree spreads between tRNA units), though the precise 3D conformation is not required for function.

[0074] The strategy yields several practical benefits:

[0075] • Improved sequencing performance for tRNAs: Single tRNAs are short and structurally complex, which reduces read quality and complicates modification calling. By chaining multiple tRNAs, the construct becomes longer and informationrich, enabling long-read platforms like nanopore to produce continuous reads that capture multiple tRNAs and their modification signatures in one pass.

[0076] • Enhanced modification analysis and controls: Including in vitro transcribed (IVT) tRNAs, synthetic tRNAs lacking natural modifications, alongside native tRNAs in the same chain enables internal “negative controls.” Differences in signal between native and IVT regions on the same read aid precise detection of modifications and minor signal deviations. “IVT” refers to RNA synthesized enzymatically from a DNA template, typically modification-free unless intentionally engineered.

[0077] • Modular enrichment and selective assembly: By designing oligos with overhang complements specific to certain tRNA classes, researchers can enrich chains for desired subsets of tRNAs and avoid unintended pairings, streamlining experimental workflows.

[0078] • Nanostructure construction (“nucleic acid origami”): tRNAs have stiff, well-defined secondary and tertiary structures, making them useful scaffolds for building RNA polyhedra and other nanostructures. Controlled chaining provides a programmable framework for assembling geometric constructs with potential in drug delivery, immunomodulation, or molecular computation applications.

[0079] • Scalability: While the example chains four tRNAs, the approach is extensible to longer chains, depending on oligo design and ligation efficiency, enabling larger, custom architectures for sequencing or nanotechnology. The sequencing can be performed by any direct sequencing method that comprises a nanopore, for instance Oxford Nanopore technologies. The nanopore direct sequencing and the materials and protocols to perform it are known in the art. For instance, in US Patent Number 6,015,714. In some embodiments, the oligonucleotide adapter configured to perform nanopore direct sequencing is a double-stranded sequencing adapter DNA oligonucleotide with a helicase protein bound to one of the strands and having the complementary strand, a first DNA adapter oligonucleotide hybridization region. In some embodiments, the nanopore direct sequencing comprises a membrane, said membrane can be either solid-state or biological membranes.

[0080] Any known nanopore direct sequencing method or product can be used, for instance the one disclosed in US Patent Number 6,015,714 or US6,362,002.

[0081] The analysis or performing algorithm used can be any commercial one known by a skilled of many performing algorithms known in the art suitable for nanopore direct RNA sequencing. The first step is extracting the reads. This step can be done by commercial software, for instance MinKNOW or any software configured to analyze the sequencing results of the nanopore direct sequencing. Next step of the analysis is the base calling, which can be done by a skilled person using any of several known performing algorithms in the field, such as Guppy or Bonito. Last step of the analysis is mapping, which can be done by several known performing algorithms. For example, Minimap2 or BWA which is a versatile sequence alignment program that aligns nucleic acid sequences against a large reference database. In some embodiments, the performing algorithm is configured to capture (and sequence) more tRNA in a quantitative way.

[0082] The assembly proceeds by mixing the tRNAs with the set of targeting oligos under annealing conditions favoring formation of the intended alternating pattern of oligo-tRNA-oligo-tRNA. Because the capture sequences bind specifically to the conserved 3' termini, and the annealing domains exhibit strong preferential pairing to their designated counterparts with negligible cross-pairing, the reagents self-organize into the desired linear complex.

[0083] Subsequent treatment with an RNA ligase yields covalent linkages between the RNA components, generating a single concatenated RNA strand of substantially increased length. The number of tRNAs incorporated can be scaled by extending the series of alternating targeting oligos and tRNAs; practical limits are governed by oligo design, hybridization fidelity, and ligase performance.

[0084] For direct RNA sequencing, the total length of the chained construct, including the bookend oligos, is adjusted to exceed platform-specific minimums and to optimize read accuracy and throughput. In an exemplary four-tRNA chain assembled with five targeting oligos, the total length is on the order of several hundred nucleotides, which materially improves read statistics and information density over single-tRNA sequencing. The 5' bookend oligo protects the first tRNA from signal loss typically observed at the 5' ends of directly sequenced molecules, while the 3' adapter-compatible oligo streamlines library preparation.

[0085] The Frogligo approach further enables the incorporation of both native and IVT tRNAs within a single chain. Such mixed constructs provide internal negative controls that facilitate identification and calibration of chemical modifications during analysis, as individual tRNAs on the same molecule can be compared directly in a shared sequencing context. The capture sequences can be tailored to enrich for particular tRNA subgroups or isoacceptors by exploiting unique sequence features adjacent to or within the termini, thereby improving selectivity and reducing purification burdens. The same chaining strategy is also applicable to non-sequencing applications, including the construction of 3D RNA nanostructures, where the predictable geometries of tRNAs and designed oligo domains can be leveraged to define angles and connectivity.

[0086] Disclosed is a method of preparing a sequencing library. The method may comprise: providing at least two transfer RNAs (tRNAs), each independently having a 3' NCCA overhang or a functional variant; contacting the tRNAs with a plurality of RNA targeting oligonucleotides, wherein each targeting oligonucleotide independently comprises in 5' to 3' order: (i) a capture sequence complementary to at least a portion of the 3' NCCA overhang or the functional variant of a corresponding tRNA, and (ii) an annealing domain that hybridizes to a complementary annealing domain of an adjacent targeting oligonucleotide; annealing the tRNAs and targeting oligonucleotides to form an alternating complex of targeting oligonucleotides and tRNAs; and ligating the annealed components of the alternating complex with an RNA ligase to form a single concatenated RNA molecule comprising the at least two or more tRNAs covalently linked via the targeting oligonucleotides.

[0087] In some embodiments, the capture sequence comprises UGGU, CGGU, AGGU, or GGGU. In some embodiments, the at least two tRNAs are the same tRNA species. In some embodiments, each of the at least two tRNAs is a different tRNA species. In some embodiments, the at least two tRNAs are identical in sequence. In some embodiments, each of the at least two tRNAs differs in sequence from the others. In some embodiments, the concatenated RNA molecule comprises at least three tRNAs, at least four tRNAs, at least five tRNAs, at least six tRNAs, at least seven tRNAs, at least eight tRNAs, at least nine tRNAs, or at least ten tRNAs. In some embodiments, the concatenated RNA molecule comprises 2-4 tRNAs, 4-6 tRNAs, 6-8 tRNAs, 8-10 tRNAs, 10-12 tRNAs, 12-14 tRNAs, 14-16 tRNAs, 16-18 tRNAs, or 18-20 tRNAs. In some embodiments, the concatenated RNA molecule comprises n tRNAs and n+1 targeting oligonucleotides, wherein n is at least 2. In some embodiments, n is 2-100. In some embodiments, nis 2-4, 4-6, 6-8, 8-10, 10-12, 12-14, 14-16, 16-18, 18-20.

[0088] In some embodiments, the concatenated RNA molecule comprises a 5' bookend oligonucleotide and a 3' adapter-compatible oligonucleotide. In some embodiments, the concatenated RNA molecule comprises at least four tRNAs and five targeting oligonucleotides. In some embodiments, the annealing domains selectively hybridize to the complementary annealing domain of the adjacent targeting oligonucleotide compared to annealing domains of non-adjacent targeting oligonucleotides. In some embodiments, the tRNAs include at least one native tRNA and at least one in vitro transcribed (IVT) tRNA on the same concatenated RNA molecule. In some embodiments, the method further comprises sequencing the concatenated RNA molecule using a sequencing platform.

[0089] In some embodiments, the sequencing platform is a nanopore sequencing platform. In some embodiments, the sequencing platform uses a motor associated sequencing adapter for direct RNA sequencing. In some embodiments, the 3' adapter-compatible oligonucleotide comprises a terminal region for direct RNA sequencing library preparation. In some embodiments, the RNA targeting oligonucleotide is 10 to 200 nucleotides in length. In some embodiments, the RNA targeting oligonucleotide is 10 to 20 nucleotides in length, 20 to 30 nucleotides in length, 30 to 40 nucleotides in length, 40 to 50 nucleotides in length, 50 to 100 nucleotides in length, 100 to 150 nucleotides in length, or 150 to 200 nucleotides in length.

[0090] In some embodiments, ligating comprises using T4 RNA Ligase 2, T4 DNA ligase, or a combination thereof. In some embodiments, the concatenated RNA molecule has a total length of at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, or at least 500 nucleotides. In some embodiments, the concatenated RNA molecule has a total length of 100-200 nucleotides, 200-300 nucleotides, 300-400 nucleotides, 400-500 nucleotides, or 500-1000 nucleotides. In some embodiments, one or more of the targeting oligonucleotides comprises GC-rich annealing domains. In some embodiments, the method further comprises enriching for a subgroup of tRNAs by selecting capture sequences that selectively hybridize to the functional variant unique to the subgroup of tRNAs. In some embodiments, the method further comprising selecting the synthetic RNA oligonucleotides to minimize off-target hybridization by designing the oligonucleotides to have high melting temperatures with intended partners and low predicted self-annealing and cross-annealing with non-partner oligonucleotides. In some embodiments, the annealing adjacent synthetic RNA oligonucleotides is configured to impart a defined angular spacing between successive tRNA molecules to promote three-dimensional structuring of the chained tRNA construct. In some embodiments, the method further comprising attaching sequencing adapters to the chained tRNA construct to enable direct RNA sequencing on a nanopore sequencing platform. In some embodiments, the synthetic RNA oligonucleotides comprise a 5' buffer oligonucleotide at the 5' terminus of the chained construct to mitigate loss of information at the 5' end during direct RNA sequencing. In some embodiments, the synthetic RNA oligonucleotides include a 3' terminal oligonucleotide configured to accept a platformspecific sequencing adapter.

[0091] Disclosed herein is a chained tRNA construct comprising: a plurality of tRNA molecules; and a plurality of synthetic RNA oligonucleotides interposed between and ligating the plurality of tRNA molecules into a single continuous RNA strand, wherein each synthetic RNA oligonucleotide comprises a capture sequence complementary to a 3' terminal NCCA overhang of a corresponding tRNA molecule and a region configured to anneal to an adjacent synthetic RNA oligonucleotide. In some embodiments, the construct comprises at least two and up to ten tRNA molecules. In some embodiments, the synthetic RNA oligonucleotides comprise overhang-capture motifs selected from UGGU, CGGU, AGGU, and GGGU. In some embodiments, at least one tRNA molecule is an in vitro transcribed tRNA and at least one other tRNA molecule is a native, post-transcriptionally modified tRNA on the same continuous RNA strand. In some embodiments, the synthetic RNA oligonucleotides are designed to exhibit high annealing specificity with intended partner oligonucleotides and low cross-annealing with non-partner oligonucleotides. In some embodiments the construct further comprising sequencing adapters compatible with a direct RNA nanopore sequencing protocol. In some embodiments, the synthetic RNA oligonucleotides are arranged to provide a defined angular orientation between successive tRNA molecules suitable for nucleic acid origami and polyhedral assembly. In some embodiments, the total length of the synthetic RNA oligonucleotides is at least 150 nucleotides. In some embodiments, the single continuous RNA strand is configured to produce an information-rich signal for identifying nucleotide modifications in the tRNA molecules during direct RNA sequencing. Kits

[0092] Disclosed herein is a kit comprising a plurality of RNA targeting oligonucleotides, wherein each targeting oligonucleotide independently comprises in 5' to 3' order: (i) a capture sequence complementary to at least a portion of a 3' NCCA overhang or a functional variant of a corresponding tRNA, and (ii) an annealing domain that hybridizes to a complementary annealing domain of an adjacent targeting oligonucleotide. In some embodiments, the kit further comprises an RNA ligase.

[0093] In some embodiments, the kit further comprises instructions for annealing and ligating the tRNAs and targeting oligonucleotides to produce a single concatenated RNA molecule. In some embodiments, the set of RNA targeting oligonucleotides comprises a 5' bookend oligonucleotide and a 3' adapter-compatible oligonucleotide. In some embodiments, at least one capture sequence comprises UGGU. In some embodiments, at least one pair of annealing domains is GC-rich. In some embodiments, the annealing domains selectively hybridizes to the complementary annealing domain of the adjacent targeting oligonucleotide compared to annealing domains of non-adjacent targeting oligonucleotides. In some embodiments, the 3' adapter-compatible oligonucleotide comprises a terminal region for direct RNA sequencing library preparation.

[0094] In some embodiments, the RNA targeting oligonucleotide is 10 to 200 nucleotides in length. In some embodiments, the RNA targeting oligonucleotide is 10 to 20 nucleotides in length, 20 to 30 nucleotides in length, 30 to 40 nucleotides in length, 40 to 50 nucleotides in length, 50 to 100 nucleotides in length, 100 to 150 nucleotides in length, or 150 to 200 nucleotides in length.

[0095] EXAMPLES

[0096] The invention now being generally described, it will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.

[0097] Example 1: Frogligo Strategy

[0098] The frogligo strategy aims to link tRNAs through enzymatic ligation. This can feed into sequencing library preparation protocols, or can be used to design 3d RNA structures. We have detailed the implementation for linking 4 tRNAs together. This requires 5 synthetic oligos, alternating between each of the 4 tRNAs and at the bookends of the molecule. Each tRNA is attached to the targeting oligo through the use of a complementary sequence to each tRNA’s highly conserved NCCA overhang. The predicted secondary structure of the molecule shows an approximately 90 degree spread between each of the 4 tRNAs (Fig. 1).

[0099] However the true secondary and tertiary structure have not been determined. The sequences consist of several parts, heavily featuring long sections of complementary oligos to their target partner as well as sequences designed to capture the NCCA overhang. The oligo structure, using UGGU overhangs, without attached tRNAs can be seen in Fig. 2. The combined length of the oligos is 172 nucleotides (22 + 40 + 40 + 40 + 30). With the inclusion of tRNA fMet for example (length 77 nucleotides), the total structure of 5 oligos and 4 tRNAs is 480 nucleotides. A key component of the oligos is that they exhibit exceptionally high levels of annealing with their paired neighbor molecules, and little to no annealing to other oligos in the system. This ensures that the molecules will bind together as intended, minimizing off target effects, and allowing the full construct to hold up to the ligation procedure. Together the oligos have sufficient length for direct RNA sequencing and the 5’ most oligo buffers the first tRNA from the loss of sequencing information on the 5’ end of molecules in direct RNA sequencing.

[0100] Figs. 3-7 detail predicted behaviors of each of the component oligos both as standalone entities as well as their interactions with target oligos as well as off target oligos.

[0101] Oligo 1:

[0102] Sequence: GACUUAUGUAUGUCUGUCUGGU (SEQ ID NO: 1)

[0103] Oligo 2:

[0104] Sequence: GACAGACAUACAUAAGGAGAUAGUUACUUAGUUACUUGGU (SEQ ID NO: 2)

[0105] Oligo 3:

[0106] Sequence: AGUAACUAAGUAACUAGAGAUCAGUCAGUCAGUCAUUGGU (SEQ ID NO: 3)

[0107] Oligo 4:

[0108] Sequence: AUGACUGACUGACUGAGAGAUGUGUGUGUAUGUGUGUGGU (SEQ ID NO: 4)

[0109] Oligo 5:

[0110] Sequence: CACACAUACACACACAGAGATAGTAGGTTC (SEQ ID NO: 5) This strategy can be effective for creating increased length and pairing successive tRNAs in a single molecule. While this is a feasible strategy for any sequencing platform, the strength of increasing the length is better observed in long read platforms. Additionally because the oligos selected can feature any of the 4 combinations of NCCA overhang complementing sequence our strategy can be used to enrich for specific subgroups of tRNA. This could reduce the burden of purification by preventing erroneous conjoining of tRNAs that are not desired in the experimental procedure.

[0111] Additionally the limitation on the number of tRNAs that can be joined together is only dependent on the design of the oligos and efficacy of the ligation enzyme. For instance while this strategy gives four as an example, we have successfully run experiments with 2 or 3 tRNAs chained together. This strategy could be extended to chain together larger and larger tRNA populations.

[0112] Our initial experiments have shown this strategy is achievable with evidence of at least 2 tRNAs being sequenced. In Figs. 8A-8C, we show results from preliminary experiments using oligos 3-5 and synthetic yeast fMet tRNAs. The gel shows successful ligation of a product of approximately 260 nucleotides in length. The sequencing run produced a peak of read lengths slightly below and including the expected maximal length of successfully ligated molecules, and proper alignment to the expected sequence.

[0113] INCORPORATION BY REFERENCE

[0114] Each of the patents, published patent applications, and non-patent references cited herein are hereby incorporated by reference in their entirety.

[0115] EQUIVALENTS

[0116] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. We claim:

1. A method of preparing a sequencing library, comprising:3.providing at least two transfer RNAs (tRNAs), each independently having a 3' NCCA overhang or a functional variant;4.contacting the tRNAs with a plurality of RNA targeting oligonucleotides, wherein each targeting oligonucleotide independently comprises in 5' to 3' order:5.(i) a capture sequence complementary to at least a portion of the 3' NCCA overhang or the functional variant of a corresponding tRNA, and (ii) an annealing domain that hybridizes to a complementary annealing domain of an adjacent targeting oligonucleotide;6.annealing the tRNAs and targeting oligonucleotides to form an alternating complex of targeting oligonucleotides and tRNAs; and7.ligating the annealed components of the alternating complex with an RNA ligase to form a single concatenated RNA molecule comprising the at least two or more tRNAs covalently linked via the targeting oligonucleotides.

2. The method of claim 1, wherein the capture sequence comprises UGGU, CGGU, AGGU, or GGGU.

3. The method of claim 1 or 2, wherein the at least two tRNAs are the same tRNA species.

4. The method of claim 1 or 2, wherein each of the at least two tRNAs is a different tRNA species.

5. The method of claim 1 or 2, wherein the at least two tRNAs are identical in sequence.

6. The method of claim 1 or 2, wherein each of the at least two tRNAs differs in sequence from the others.

7. The method of any one of claims 1-6, wherein the concatenated RNA molecule comprises at least three tRNAs, at least four tRNAs, at least five tRNAs, at least six tRNAs, at least seven tRNAs, at least eight tRNAs, at least nine tRNAs, or at least ten tRNAs.

8. The method of any one of claims 1-7, wherein the concatenated RNA molecule comprises 2-4 tRNAs, 4-6 tRNAs, 6-8 tRNAs, 8-10 tRNAs, 10-12 tRNAs, 12-14 tRNAs, 14-16 tRNAs, 16-18 tRNAs, or 18-20 tRNAs.

9. The method of any one of claims 1-8, wherein the concatenated RNA molecule comprises n tRNAs and n+1 targeting oligonucleotides, wherein n is at least 2.

10. The method of claim 9, wherein n is 2-100.

11. The method of claim 9 or 10, wherein n is 2-4, 4-6, 6-8, 8-10, 10-12, 12-14, 14-16, 16-18, 18-20.

12. The method of any one of claims 1-11, wherein the concatenated RNA molecule comprises a 5' bookend oligonucleotide and a 3' adapter-compatible oligonucleotide.

13. The method of any one of claims 1-12, wherein the concatenated RNA molecule comprises at least four tRNAs and five targeting oligonucleotides.

14. The method of any one of claims 1-13, wherein the annealing domains selectively hybridize to the complementary annealing domain of the adjacent targeting oligonucleotide compared to annealing domains of non-adjacent targeting oligonucleotides.

15. The method of any one of claims 1-14, wherein the tRNAs include at least one native tRNA and at least one in vitro transcribed (IVT) tRNA on the same concatenated RNA molecule.

16. The method of any one of claims 1-15, further comprising sequencing the concatenated RNA molecule using a sequencing platform.

17. The method of claim 16, wherein the sequencing platform is a nanopore sequencing platform.

18. The method of claim 16 or 17, wherein the sequencing platform uses a motor associated sequencing adapter for direct RNA sequencing.

19. The method of any one of claims 12-18, wherein the 3' adapter-compatible oligonucleotide comprises a terminal region for direct RNA sequencing library preparation.

20. The method of any one of claims 1-19, wherein the RNA targeting oligonucleotide is 10 to 200 nucleotides in length.

21. The method of any one of claims 1-20, wherein the RNA targeting oligonucleotide is 10 to 20 nucleotides in length, 20 to 30 nucleotides in length, 30 to 40 nucleotides in length, 40 to 50 nucleotides in length, 50 to 100 nucleotides in length, 100 to 150 nucleotides in length, or 150 to 200 nucleotides in length.

22. The method of any one of claims 1-21, wherein ligating comprises using T4 RNA Ligase 2, T4 DNA ligase, or a combination thereof.

23. The method of any one of claims 1-22, wherein the concatenated RNA molecule has a total length of at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, or at least 500 nucleotides.

24. The method of any one of claims 1-23, wherein the concatenated RNA molecule has a total length of 100-200 nucleotides, 200-300 nucleotides, 300-400 nucleotides, 400-500 nucleotides, or 500-1000 nucleotides.

25. The method of any one of claims 1-24, wherein one or more of the targeting oligonucleotides comprises GC-rich annealing domains.

26. The method of any one of claims 1-25, further comprising enriching for a subgroup of tRNAs by selecting capture sequences that selectively hybridize to the functional variant unique to the subgroup of tRNAs.

27. A kit comprising a plurality of RNA targeting oligonucleotides, wherein each targeting oligonucleotide independently comprises in 5' to 3' order:32.(i) a capture sequence complementary to at least a portion of a 3' NCCA overhang or a functional variant of a corresponding tRNA, and (ii) an annealing domain that hybridizes to a complementary annealing domain of an adjacent targeting oligonucleotide.

28. The kit of claim 27, further comprising an RNA ligase.

29. The kit of claim 27 or 28, further comprising instructions for annealing and ligating the tRNAs and targeting oligonucleotides to produce a single concatenated RNA molecule.

30. The kit of any one of claims 27-29, wherein the set of RNA targeting oligonucleotides comprises a 5' bookend oligonucleotide and a 3' adapter-compatible oligonucleotide.

31. The kit of any one of claims 27-30, wherein at least one capture sequence comprises UGGU.

32. The kit of any one of claims 27-31, wherein at least one pair of annealing domains is GC-rich.

33. The kit of any one of claims 27-32, wherein the annealing domains selectively hybridizes to the complementary annealing domain of the adjacent targeting oligonucleotide compared to annealing domains of non-adjacent targeting oligonucleotides.

34. The kit of any one of claims 30-33, wherein the 3' adapter-compatible oligonucleotide comprises a terminal region for direct RNA sequencing library preparation.

35. The kit of any one of claims 27-34, wherein the RNA targeting oligonucleotide is 10 to 200 nucleotides in length.

36. The kit of any one of claims 27-35, wherein the RNA targeting oligonucleotide is 10 to 20 nucleotides in length, 20 to 30 nucleotides in length, 30 to 40 nucleotides in length, 40 to 50 nucleotides in length, 50 to 100 nucleotides in length, 100 to 150 nucleotides in length, or 150 to 200 nucleotides in length.

Images